ADAMTS1, CRABP1, and NR3C1 Identified As

Cellular Oncology 28 (2006) 259–272 259 IOS Press ADAMTS1, CRABP1,andNR3C1 identiﬁed as epigenetically deregulated genes in colorectal tumorigenesis

Guro E. Lind a, Kristine Kleivi b,∗, Gunn I. Meling c, Manuel R. Teixeira d, Espen Thiis-Evensen e, Torleiv O. Rognum f and Ragnhild A. Lothe a,g,∗∗ a Department of Cancer Prevention, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway b Department of Genetics, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway c Surgical Department, Faculty Division Akershus University Hospital, University of Oslo, Oslo, Norway d Department of Genetics, Portuguese Oncology Institute, Porto, Portugal e Medical Department, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway f Institute of Forensic Medicine, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway g Department of Molecular Biosciences, University of Oslo, Oslo, Norway

Abstract. Background: Gene silencing through CpG island hypermethylation is a major mechanism in cancer development. In the present study, we aimed to identify and validate novel target genes inactivated through promoter hypermethylation in colorectal tumor development. Methods: With the use of microarrays, the gene expression profiles of colon cancer cell lines before and after treatment with the demethylating agent 5-aza-2 -deoxycytidine were identified and compared. The expression of the responding genes was compared with microarray expression data of primary colorectal carcinomas. Four of these down- regulated genes were subjected to methylation-specific PCR, bisulphite sequencing, and quantitative gene expression analysis using tumors (n = 198), normal tissues (n = 44), and cell lines (n = 30). Results: Twenty-one genes with a CpG island in their promoter responded to treatment in cell lines, and were simultaneously down-regulated in primary colorectal carcinomas. Among 20 colon cancer cell lines, hypermethylation was subsequently identified for three of four analyzed genes, ADAMTS1 (85%), CRABP1 (90%), and NR3C1 (35%). For the latter two genes, hypermethylation was significantly associated with absence or reduced gene expression. The methylation status of ADAMTS1, CRABP1,andNR3C1 was further investigated in 116 colorectal carcinomas and adenomas. Twenty-three of 63 (37%), 7/60 (12%), and 2/63 (3%) adenomas, as well as 37/52 (71%), 25/51 (49%), and 13/51 (25%) carcinomas were hypermethylated for the respective genes. These genes were unmethylated in tumors (n = 82) from three other organs, prostate, testis, and kidney. Finally, analysis of normal colorectal mucosa demonstrated that the observed promoter hypermethylation was cancer-specific. Conclusion: By using a refined microarray screening approach we present three genes with cancer-specific hypermethylation in colorectal tumors, ADAMTS1, CRABP1, and NR3C1. Keywords: ADAMTS1, adenomas, bisulphite sequencing, colorectal carcinomas, CRABP1, gene expression, methylation, microarrays, NR3C1, 5-aza-2 deoxycytidine

1. Introduction *Current address: Medical Biotechnology, VTT Technical Re- search Centre of Finland, Turku, Finland. Impaired epigenetic regulation is as common as ** Corresponding author: Ragnhild A. Lothe, Department of gene mutations in human cancer [22]. These mech- Cancer Prevention, Institute for Cancer Research, Rikshospitalet- Radiumhospitalet Medical Centre, Montebello, 0310 Oslo, Nor- anisms lead to quantitative and qualitative gene ex- way. Tel.: +47 22934415; Fax: +47 22934440; E-mail: Ragnhild. pression changes causing a selective growth advantage, [email protected]. which may result in cancerous transformation. Aber-

1570-5870/06/$17.00  2006 – IOS Press and the authors. All rights reserved 260 G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis rantly hypermethylated CpG islands in the gene pro- were cultured in DMEF-12 medium (GIBCO, Invit- moter associated with transcriptional inactivation are rogen Carlsbad, CA) with 10% fetal bovine serum among the most frequent epigenetic changes in cancer. (GIBCO), 2 mM L-glutamine (GIBCO), 100 U/ml In the large bowel, the adenoma-carcinoma se- penicillin G, and 100 µg/ml streptomycin (GIBCO) quence is paralleled by several genetic and epigenetic and harvested before confluency. Two MSI cell lines changes. One of these is hypermethylation of MLH1, (HCT15, SW48) and two MSS cell lines (HT29, SW480) were cultured in parallel with and without which leads to inactivation of the DNA mismatch repair system and subsequent microsatellite instability 10 µM 5-aza-2 -deoxycytidine (Sigma-Aldrich Com- (MSI) [20]. Approximately 15% of all sporadic col- pany Ltd., Dorset, UK) in the medium for 72 hours. DNA was extracted from the cell lines and their 5- orectal carcinomas display MSI seen as insertions and deletions of short nucleotide repeats in their near- aza-2 -deoxycytidine treated counterparts by a standard phenol-chloroform procedure, and total RNA was diploid genome [1]. The microsatellite stable (MSS) isolated using Trizol (Invitrogen, Carlsbad, CA). The tumors have a functional mismatch repair system but RNA quality was measured by a 2100 bioanalyzer (Ag- usually display chromosomal aberrations, including ilent Technologies, Palo Alto, CA) and the RNA con- several common regions of loss or gain [42]. Sub- centration was determined using ND-1000 Nanodrop groups of both types of colorectal carcinomas reveal (NanoDrop Technologies, Wilmington, DE). aberrant methylation of tumor suppressor genes asso- DNA from 53 colorectal carcinomas (25 MSS and ciated with lack of expression, although the methyla- 28 MSI) from 52 patients, including one patient with tion frequencies are generally higher in the MSI tumor hereditary non-polyposis colorectal cancer (HNPCC), group [29]. 63 adenomas (61 MSS and 2 MSI) from 52 patients, Furthermore, Toyota and co-workers suggested the normal mucosa samples from 22 colorectal cancer pa- CpG island methylator phenotype (CIMP) as the third tients (taken from distant sites from the primary car- pathway of colorectal tumorigenesis [56]. In 1999, cinoma), and another 22 normal colorectal mucosa they identified two epigenetically distinct tumor groups, samples from cancer-free individuals was subjected to one in which methylation was extremely rare (CIMP methylation analysis. The carcinomas (mean age 68 negative) and a second, in which the tumors were years) and the first group of normal mucosa samples methylated at multiple loci (CIMP positive). This ini- (mean age 64 years) were taken from colorectal cancer tial concept has been supported by some reports [45, patients admitted between 1987–1989 to one of seven 47,59,60], but not by others [3,26,61]. hospitals located in the south-east region of Norway Aberrant DNA methylation changes have also been [34]. For nine of these 22 normal mucosa samples the reported to occur early in the development of colorectal corresponding primary tumor was also included in the tumors [26,44] and are therefore promising as early di- present study. The adenomas were obtained from vol- agnostic markers of existing disease. The potential re- unteers (mean age 67 years) participating in a polyp versibility of DNA methylation patterns by epigenetic screening program [55]. The normal mucosa samples therapy further suggests that these are viable targets for from cancer-free individuals were obtained from de- treatment of cancer. ceased persons (mean age 54 years, including 8 individuals 60 years). The majority of the total set In the present study we have used a genome-wide of normal samples (27/44) consisted of mucosa only, approach to identify novel epigenetically regulated tar- whereas the remaining samples were taken from the get genes in colorectal tumorigenesis, followed by bowel wall. The research bio-bank is registered at the technical, biological, and clinical validation analyses. Norwegian Institute of Public Health according to the Norwegian biobank legislation and the project was ap- proved for filing and processing personal health data 2. Material and methods by the national Data Inspectorate. Ten cell lines from various tissues were also in- 2.1. Cell cultures and tissue samples cluded in the present study (prostate, n = 3; testicular germ cell tumor, n = 3; and ovary, n = 4). Addi- Twenty colon cancer cell lines were included in the tionally, clinical series of prostate (n = 20) and kid- present study, nine MSI: Co115, HCT15, HCT116, ney (n = 20) carcinomas from the University Hospi- LoVo, LS174T, RKO, SW48, TC7, and TC71, and tal of Porto, and a series of testicular germ cell tumors 11 MSS: ALA, Colo320, EB, FRI, HT29, IS1, IS2, (n = 42) from patients admitted to the Norwegian Ra- IS3, LS1034, SW480, and V9P [23]. All cell lines dium Hospital, Oslo, were screened for methylation. G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis 261

2.2. Gene expression microarrays 2.3. Bisulphite treatment and methylation-specific PCR Eighteen cell lines and four 5-aza-2-deoxycytidine Bisulphite treatment of DNA leads to sequence vari- treated counterparts were analyzed by cDNA microar- ations as unmethylated but not methylated cytosines rays. Labeled cDNA was synthesized from 30 µgto- are converted to uracil [8]. DNA from cell lines and tal RNA in an oligo dT-primed polymerization with TM colorectal carcinomas was bisulphite treated as previ- SuperScript II RNase H reverse transcriptase (Invit- ously described [11,16], whereas DNA from the ade- rogen) in the presence of either Cy3 (reference) or nomas was bisulphite treated according to the proto- Cy5 (test) labeled dUTP (Amersham Pharmacia, Pis- col of the CpGenomeTMDNA modification kit (Inter- cataway, NJ). Test and reference cDNA was mixed gen Boston, MA) [51]. The promoter methylation sta- and hybridized onto cDNA microarrays (The microar- tus of ADAMTS1, CRABP1, NDRG1, and NR3C1 was ray core facilities, The Norwegian Radium Hospital, subsequently analyzed by methylation-specific PCR Oslo, Norway), containing 15486 spots representing (MSP), a method allowing for distinction between un- 12688 unique cDNA clones from 8461 genes. The hu- methylated and methylated alleles [19,10]. All primers man universal reference RNA (containing a mixture were designed with MethPrimer [27] (with the excep- of RNA from ten different cell lines; Stratagene, CA, tion of NR3C1 bisulphite sequencing primers, see ac- USA) was mixed 4:1 with total RNA from four com- knowledgements). Their sequences are listed in Ta- bined colon cancer cell lines (two MSI; HCT116 and ble 1, along with the product fragment length, primer LoVo, and two MSS; HT29 and SW480) and used as location, and annealing temperature for each PCR. The a common reference for all samples. The fluorescence fragments were amplified using the HotStarTaq DNA intensities of the spots were detected by a laser confo- Polymerase (QIAGEN Inc., Valencia, CA), and all re- cal scanner (Agilent Technologies). For each array el- sults were confirmed with a second independent round ement, a ratio between the background subtracted rel- of MSP. ative fluorescence intensities of the test and reference was calculated (GenePix Pro 6.0; Axon Instruments, 2.4. Bisulphite sequencing Union City, Ca, USA). The ratios in all samples were post-processed and normalized by the locally weighted Bisulphite sequencing allows a positive display of scatterplot smoothing (LOWESS) algorithm [62] us- 5-methyl cytosines in the gene promoter after bisul- ing BASE [46]. Array elements up-regulated more than phite modification as unmethylated cytosines appear two-folds after 5-aza-2-deoxycytidine treatment in at as thymines, whereas 5-methyl cytosines appear as cytosines in the final sequence [8]. For genes ADAMTS1, least three of four cell lines, were considered to be po- CRABP1, and NR3C1, we subjected a subset of the tential targets for DNA methylation. cell lines to bisulphite sequencing (n = 13, n = 9, Microarray analysis of colorectal carcinomas and n = 10, respectively), based on the MSP results. (n = 18) and normal mucosa samples (n = 3; taken Most analyzed cell lines were methylated as assessed from sites in distance from the tumors) was performed by the MSP analyses, but a minimum of one unmethy- in a parallel study (unpublished). The resulting data lated and one monoallelic methylated cell line were set was used to identify the in vivo expression level of also included in the panel sequenced for each gene. the genes that responded to 5-aza-2 -deoxycytidine in Primer sequences and PCR conditions are listed in Ta- the cell lines. Briefly, labeled cDNA was synthesized ble 1. All fragments were amplified with the HotStar- from 20 µg total RNA using the Agilent direct-label Taq DNA Polymerase and eluted from a 2% agarose cDNA synthesis kit (Agilent Technologies) in the pres- gel by the MinEluteTMGel Extraction kit (QIAGEN). ence of either Cy3 (human universal reference RNA) The samples were subsequently sequenced using the or Cy5 (test) labeled dCTP (Perkin Elmer Life Sci- dGTP BigDye Terminator Cycle Sequencing Ready ence, Boston, MA). The purified cDNA was hybridized Reaction kit (Applied Biosystems, Foster City, CA) in to Agilent Human 1A v2 22K oligo microarrays (Ag- an ABI Prism 377 Sequencer (Applied Biosystems). ilent Technologies) according to the manufacturers’ The approximate amount of methyl cytosine of each protocol. The scanned images were processed by the CpG site in the various fragments was calculated by Agilent Feature Extraction 7.5 software (Agilent Tech- comparing the peak height of the cytosine signal with nologies), prior to local background subtraction and the sum of the cytosine and thymine peak height sig- LOWESS normalization. nals, as previously described [35]. 262 G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis

2.5. Quantitative gene expression analyses

∗ We used TaqMan real-time ﬂuorescence detection (Applied Biosystems, Foster city, CA) to quantify 25 27 20 18 12 10 25 156 158 140 139 − − + + + + − + + − − mRNA levels in the colon cancer cell lines, as previously described [14,18]. cDNA was generated from 128 to 128 to 192 to 193 to 256 to 256 to 477 to 151 to 201 to 336 to 336 to TM − − − − − − − two µg total RNA using the SuperScript II re- − − − − verse transcriptase enzyme (Invitrogen) and oligo dT primers (Medprobe) according to the manufacturers’ protocol. cDNA from the genes of interest (ADAMTS1, . Size, fragment size; An. Temp, an- Hs01095534_g1; CRABP1 Hs00171635_m1; and NR3C1, Hs00230818_m1) and the endogenous con- trols (ACTB, Hs99999903_m1 and PGK1, Hs00943173_gH) were ampliﬁed separately by the ABI Prism 7000 Sequence Detection System follow- ing the protocol recommended by Applied Biosystems. All samples were analyzed in duplicates. The quantitative expression levels were measured against a standard curve generated from dilutions of cDNA from the human universal reference RNA (containing a mixture of RNA from ten different cell lines; Stratagene). In order to adjust for the possibly variable amounts of cDNA input in each PCR, we normalized the expression quantity of the target genes with the quantity of the housekeeping gene PGK1, which was found to be the most suitable (see Results). Table 1 2.6. Statistics

All 2 × 2 contingency tables were analyzed using Fisher’s exact test. For the statistical analyses of the quantitative gene expression, a 2 × 3 table and Chi- square test were used. The gene expression was divided in two categories: low expression included samples with gene expression < median value for the PCR primers used for methylation-speciﬁc PCR and bisulphite sequencing gene in question across all cell lines, high expression includes samples with gene expression > median. Methylation status was divided in three categories: un-

Fragment location lists the start and end point (in base pairs) of each fragmentmethylated, relative to the transcription start point provided by NCBI partial methylation, and methylated. All P ∗ values were derived from two tailed statistical tests using the SPSS 11.5 software (SPSS, Chicago, IL, USA).

3. Results

3.1. Identiﬁcation of novel candidate genes potentially epigenetically deregulated in colorectal carcinomas

Ninety-three array elements were up-regulated two http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi Primer setADAMTS1 MSP-M GTGAGTAATATCGTAGTTAAGGCGG CTAAAACAAAAAACGCTCTAAAACG Sense primer 103 59 Abbreviations: MSP, Antisense primer methylation-specific PCR; BS, bisulphite sequencing; M, methylated-specific primers; U, unmethhylated-specific primers; Frg Frg. Size, bp An. Temp Fragment location nealing temperature (in degrees celcius). ADAMTS1 MSP-U GTGAGTAATATTGTAGTTAAGGTGG AAAACAAAAAACACTCTAAAACACC 101 59 ADAMTS1 BS GAGAGGGGAGAGTTTTGAGTAGAGT ACTCTAAATTATTAAAATTAACAATTTCTA 307 50 CRABP1 MSP-M GGAGGTTTTTTAGTTGGAGAGC CTCGCAAAACGAAAACTAACG 211 57 CRABP1 MSP-U GAGGTTTTTTAGTTGGAGAGTGG AACTCACAAAACAAAAACTAACACT 212 57 CRABP1 BS AGGGAGGTGGAGGTTTTTTAGT CACCAACTTACCCAATACCTTAAAC 359 53 NDRG1 MSP-M GAGTCGATTTATAATTCGGGTTTC GAAATTTATTTACGTCCGAACGA 266 53 NDRG1 MSP-U GAGTTGATTTATAATTTGGGTTTTG ACAAAATTTATTTACATCCAAACAA 268 53 NR3C1 MSP-M TCGGTTTCGTTCGTTCGTTTAGGTC CGTCCCGATCCCAACTACTTCGAC 196 69 NR3C1 MSP-UNR3C1 BS TTGGTTTTGTTTGTTTGTTTAGGTT CCATCCCAATCCCAACTACTTCAAC GTTGTTAAGYGTTATTAATAGGTTG CTCCATAAATAAAAAAAAAACCfold 197 or more 452 61 after 52 5-aza-2 -deoxycytidine treatment G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis 263 ), and primary colorectal B ization. The gene expression ) and was simultaneously down-regulated in primary B -deoxycytidine treated cell lines ( ), 5-aza-2 A -deoxycytidine treatment in colon cancer cell lines ( ). Genes submitted to methylation analyses are highlighted in red. C ). The panels illustrate the gene expression in alphabetically order as assessed by microarray analyses. Each ratio is presented by a color for visual C carcinomas ( colorectal carcinomas relative to normal colon mucosa ( Fig. 1. Gene expression of potential candidates for inactivation by DNA hypermethylation in colon cancer cell lines ( of 21 genes containing a CpG island in their promoter was induced by 5-aza-2 264 G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis in at least three out of the four cell lines analyzed NR3C1 was also significantly higher in MSI carcino- (HCT15, HT29, SW48, and SW480). Among the 93 mas (12/28; 43%) than in MSS carcinomas (1/23; 4%; elements, 88 were present on Agilent oligo arrays used P = 0.003). Two of 63 (3%) adenomas and none of to analyze a panel of 18 primary colorectal carcinomas the normal mucosa samples were hypermethylated for and three normal colon tissues (unpublished). The me- NR3C1. dian of 60 of these genes was down-regulated across Both ADAMTS1 and CRABP1 were hypermethy- the panel of tumor samples relative to normal colon lated in a subset of cancer cell lines from various tissue and 21 of them contained a CpG island in their other tissues (3/13 and 9/13, respectively), but were un- 5’region (based on the definition and search algorithm methylated in 82 tumors from prostate, testis, and kid- presented by Takai and Jones [53]), thus represent- ney. NR3C1 was unmethylated in the same cell lines ing potential epigenetically deregulated target genes. and was therefore not subjected to methylation analy- Included in this list was APC, which is one of the sis in these primary tumors. known gene targets for inactivation by hypermethyla- MSP analyses of the four 5-aza-2-deoxycytidine tion in colorectal cancer. Among the 21, we selected treated colon cancer cell lines verified that ADAMTS1, ADAMTS1, CRABP1, NDRG1, and NR3C1 (Fig. 1), CRABP1, and NR3C1 were demethylated in 80% encoding proteins with potential roles in tumor devel- (8/10) of the originally methylated cases. ADAMTS1 opment [12,15,17,21,24,32,33,38,40,41,49,58], as the was still methylated in 5-aza-2-deoxycytidine treated first candidates to be analyzed. The genes were sub- SW480 cells and no change in gene expression was jected to promoter methylation analysis in colon cancer detected by the microarray analyses. However, in cell lines. Prior to the analyses, the microarray cDNA drug treated SW48 cells, NR3C1 expression was up- clones responding to 5-aza-2-deoxycytidine treatment regulated compared with untreated cells even in the ab- were sequenced, and their identity confirmed. sence of visible demethylation.

3.2. Methylation status of novel candidate genes in 3.3. Bisulphite sequencing vitro and in vivo Bisulphite genomic sequencing of ADAMTS1, The promoters of ADAMTS1, CRABP1, and NR3C1 CRABP1, and NR3C1 in selected colon cancer cell were hypermethylated in 17/20 (85%), 18/20 (90%), lines showed that all cytosines at non-CpG sites were and 7/20 (35%) colon cancer cell lines, respectively, converted to thymine. This is seen in Fig. 3 along whereas NDRG1 was unmethylated in all samples as with the detailed sequencing results and the initial pro- assessed by the MSP analysis (Table 2 and Fig. 2). moter methylation status as assessed by MSP. In gen- Thirty-seven of 52 (71%) colorectal carcinomas were eral, there seemed to be a good association between hypermethylated for ADAMTS1, with equal frequen- the MSP scoring and the bisulphite sequences. Five cies in MSI and MSS tumors (Table 2). Moreover, out of nine cell lines methylated in ADAMTS1,asas- 23/63 (37%) of the colorectal adenomas, 2/22 (9%) sessed by MSP, displayed only fully methylated CpG of the normal mucosa samples taken from distant sites, whereas the remaining four cell lines displayed sites from tumors, and none (0/21) of the normal mu- partial methylation (the presence of both methylated cosa samples from cancer-free individuals, were hy- and unmethylated cytosine) in one to six CpG sites. permethylated. The primary carcinomas represented Among these, the TC71 cell line had five partially in the nine pairs of matched normal and cancer tis- methylated CpG sites including sites 17 to 19, which sue were methylated in 6/8 (75%), 4/7 (57%), and 4/7 were fully methylated in all other methylated cell lines. (57%), for ADAMTS1, CRABP1, and NR3C1, respec- In the CRABP1 gene promoter, the majority of CpG tively, whereas the corresponding normal mucosa sam- sites in the methylated cell lines were also fully methy- ples were unmethylated. CRABP1 was significantly lated in the bisulphite sequencing electropherograms. more frequently methylated among the MSI carcino- Some partial methylation was seen around CpG sites mas (22/28; 79%) than the MSS group (3/23; 13%; 6 to 11 as five out of the six methylated cell lines, P<0.001), and 7/60 (12%) of the adenomas, 1/22 as assessed by MSP, displayed both methylated and (5%) of the normal mucosa samples taken from dis- unmethylated cytosines of two to five of these CpG tant sites from tumors, and none (0/21) of the nor- sites. RKO was the only methylated cell line, as as- mal mucosa samples from cancer-free individuals, sessed by MSP analysis, harboring partial methyla- were hypermethylated. The methylation frequency of tion for NR3C1 and only at two of the 58 successfully G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis 265

Table 2 Promoter hypermethylation of candidate genes in colon cancer cell lines, colorectal carcinomas, adenomas, and normal mucosa Sample MSI status ADAMTS1 CRABP1 NDRG1 NR3C1 Co115 MSI M M U M HCT15 MSI M M U U/M HCT116 MSI M M U U LoVo MSI U/M U/M U U LS174T MSI U U U U RKO MSI M M U M SW48 MSI M M U M TC7 MSI U/M U/M U U TC71 MSI M U/M U U ALA MSS M U/M U U Colo320 MSS U M U U EB MSS M M U M FRI MSS U U/M U U HT29 MSS M M U M IS1 MSS M M U U IS2 MSS M M U U IS3 MSS M M U U LS1034 MSS M M U U/M SW480 MSS M U U U V9P MSS U/M M U U Carcinomas MSI and MSS* 37/52 (71%) 25/51 (49%) Nd 13/51 (25%) MSI 20/28 (71%) 22/28 (79%) Nd 12/28 (43%) MSS 17/24 (71%) 3/23 (13%) Nd 1/23 (4%) ∗∗ Adenomas MSI and MSS 23/63 (37%) 7/60 (12%) Nd 2/63 (3%) Normala) 2/22 (9%) 1/22 (5%) Nd 0/22 (0%) Normalb) 0/21 (0%) 0/21 (0%) Nd 0/20 (0%) Abbreviations: U, unmethylated; M, methylated; MSI, microsatellite stable; MSS, microsatellite unstable; Nd, not done. ∗ MSI and MSS carcinomas grouped together. ∗∗ Only two adenomas were MSI. The remaining 61 were MSS. Here they are presented together. a)Normal mucosa samples from individual colorectal cancer patients (taken from distant sites from the primary carcinoma). b)Normal colorectal mucosa samples from healthy individuals.

Fig. 2. Representative methylation-specific PCR results from the analysis of ADAMTS1, CRABP1, NDRG1,andNR3C1 in sixteen colon cancer cell lines. A visible PCR product in lanes U indicates the presence of unmethylated alleles whereas a PCR product in lanes M indicates the presence of methylated alleles. NB, normal blood (positive control for unmethylated samples); IVD, in vitro methylated DNA (positive control for methylated samples); neg, negative control (containing water as template); U, lane for unmethylated MSP product; M, lane for methylated MSP product. Each gel panel is a merge of two to three gel panels mainly run on the same agarose gel. 266 G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis 267

ampliﬁed CpG sites. The three remaining cell lines, Co115, HT29, and SW48, displayed full methylation at all sites.

3.4. Quantitative gene expression of ADAMTS1, CRABP1, and NR3C1 in colon cancer cell lines

Figure 4 shows the relative expression levels of CRABP1 and NR3C1 in the colon cancer cell lines (n = 20). The expression levels are displayed as ratios between the individual genes and the endogenous control PGK1 and multiplied by a factor of 1000. The housekeeping genes PGK1 and ACTB had comparable expression levels overall, but since the median standard deviation in PGK1 was less than in ACTB (0.12 and 1.69, respectively), the gene expression of PGK1 was chosen for normalization of the target genes. For ADAMTS1, there was a trend toward lower gene expression in methylated cell lines compared with the unmethylated cell line Colo320, but the difference was not statistically significant. Colo320 demonstrated a high level of gene expression, whereas in the remaining two unmethylated cell lines, ADAMTS1 was not expressed at all. The majority of the methylated cell lines demonstrated little or no expression of ADAMTS1 with the exception of TC71 and LS1034, which had elevated gene expression levels, although still 3–4 fold lower than seen in Colo320. Among the three cell lines displaying both methylated and unmethylated DNA molecules for ADAMTS1, only V9P ex- Fig. 4. CRABP1 (A), and NR3C1 (B) expression in colon cancer pressed the gene and again at a low level (data not cell lines. The quantitative expression levels are displayed as ratios between the specified gene and the endogenous control PGK1 mul- Fig. 3. Methylation status of individual CpG sites by bisulphite se- tiplied by a factor of 1000. The CpG island hypermethylation sta- quencing in ADAMTS1 (A), CRABP1 (B), and NR3C1 (C). The up- tus assessed by methylation-specific PCR (MSP) is shown below per part of each panel is a schematic presentation of the CpG is- each chart. Filled circles represent methylated CpGs, open circles land in the area of transcription start amplified by the bisulphite se- represent unmethylated CpGs, and open circles with a slash repre- quencing primers. The transcription start site is represented by +1 sent presence of both methylated and unmethylated alleles. For both and the vertical bars indicate the location of individual CpG sites. genes, promoter hypermethylation was associated with reduced or The two arrows indicate the location of the methylation-specific lost gene expression (P value listed in the right corner of each panel). PCR primers. For the middle part of each panel, filled circles represent methylated CpGs; open circles represent unmethylated CpGs; and open circles with a slash represent partially methylated sites shown). For CRABP1, there was a strong associa- (the presence of approximately 20–80% cytosine, in addition to tion between gene expression and methylation status thymine). The column of U, M and U/M at the right side of this (P = 0.005). Cell lines containing both methylated middle part lists the methylation status of the cell line from MSP and unmethylated DNA molecules revealed the high- analyses of the respective genes. The lower part of each panel (highlighted in grey) is a section of the bisulphite sequence electrophero- est CRABP1 expression. Promoter hypermethylation gram, where cytosines in CpG sites are underlined in black and cy- of NR3C1 was also associated with reduced gene ex- tosines that have been converted to thymines are underlined in red. pression (P = 0.031). NR3C1 was not expressed at all The sequencing electropherograms illustrated here, are from SW48, in four of the five fully methylated cell lines, and also Co115, and Co115, respectively. Abbreviations: MSP, methylation- specific PCR; s, sense; as, antisense; U, unmethylated; M, methy- the gene expression in the methylated Co115 was close lated; U/M, presence of both unmethylated and methylated band. to zero. 268 G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis

3.5. Promoter methylation and association to clinical three known control genes) in the RKO cell line. The variables processed microarray expression data from the four drug-treated colon cancer cell lines in the present study For the colorectal carcinomas there was a strong include eight of the twelve methylated genes identi- association between methylation and right-sided tu- fied by Suzuki et al. [52]. Five of these genes also mor location as 15/19 (79%) tumors methylated in responded to 5-aza-2deoxycytidine treatment in our CRABP1 and 10/13 (77%) tumors methylated in study of colon cancer cell lines, whereas FOLH1, NR3C1 were located in the right side of the colon PCDH8, and TIMP2 did not. FOLH1 and PCDH8 had (P = 0.001 and P = 0.002, respectively). Further, a comparable methylation pattern in primary colorec- more methylation was found among the lowly differen- tal carcinomas and their normal counterparts [52], and tiated tumors than among medium to highly differenti- thereby these markers are not tumor specific. TIMP2 ated tumors. For CRABP1 this was statistically signif- turned out to be methylated only in the RKO cell line icant (P = 0.029). We saw more methylation among and not in a panel of eight additional colon cancer cell tumors from females (11/27; 41%) than in those from lines or in primary colorectal cancers [52]. In sum- males (2/24; 8%) for NR3C1 (P = 0.01). There was mary, by using the screening and selection approach no statistically significant association between methy- outlined in the present study, the probability of iden- lation and age nor methylation and Duke’s stage. tifying epigenetic targets with biologic significance in colorectal tumorigenesis is increased. 4. Discussion Three of our four candidates were hypermethylated in several colon cancer cell lines as identified by We have used microarray gene expression profiling MSP analysis. As this method tends to overestimate in combination with 5-aza-2 -deoxycytidine treatment DNA methylation in certain cases [43], we additionally of colon cancer cell lines to identify novel gene tar- bisulphite sequenced approximately half of the cell gets epigenetically inactivated at early stages of col- lines. For all genes, there seemed to be a good associ- orectal tumorigenesis. When cell lines are cultured ation between the results obtained with the two meth- with the DNA methyltransferase inhibitor 5-aza-2- ods. Rand et al. [43] have pointed out that incompletely deoxycytidine, epigenetic gene silencing by aberrant converted sequences during bisulphite treatment can be DNA methylation can be reversed. This could be co-amplified with the methylated alleles during MSP. seen in the present study by the reappearance of un- In the present study, all cytosines at non-CpG sites in methylated MSP bands of originally methylated con- the bisulphite sequences were converted to thymine. trol genes. Genes up-regulated in cell lines after 5-aza- Additionally, none of our MSP primer sets amplified 2 -deoxycytidine treatment might be potential candi- untreated DNA (data not shown), which means that if dates for inactivation by hypermethylation in colorectal cancer. unconverted sequences had been present, this would In order to limit the probability of selecting false not have influenced the results. To establish whether positives, strict criteria were used. Only array elements the promoter hypermethylation of the present target up-regulated more than two-fold in at least three of genes led to transcriptional inactivation, we analyzed the four cell lines analyzed, were further investigated. the quantitative gene expression in the cell lines. There The expression level of these genes was subsequently was a good association between hypermethylated sta- examined in primary colorectal carcinomas, and the tus and reduced gene expression, which was significant down-regulated ones were identified. This step-wise for CRABP1 and NR3C1. The relatively small sam- approach most likely explains the high success rate in ple set might partly explain the lack of statistical sig- validation of novel and tumor specific epigenetically nificance for ADAMTS1. Other mechanisms may also regulated target genes in colorectal cancer. Genome cause lack of expression of this gene since two of three wide DNA microarray approaches have previously cell lines unmethylated for ADAMTS1 showed no ex- been used to identify new target genes for epigenetic pression (data not shown). inactivation in colorectal cancer [36,37,52] as well as DNA from cell lines is often more frequently hy- in other cancer types [28,30]. Suzuki and co-workers permethylated than is DNA from primary tumors [50]. [52] cultured the colon cancer cell line RKO with tri- CpG island hypermethylation has also previously been chostatin A and low-dose-5-aza-2deoxycytidine, in- demonstrated to be an early and frequent event dur- ducing the expression of several genes. Complete ing colorectal carcinogenesis, but only a limited num- methylation was shown for twelve genes (including ber of epigenetic changes have been identified in be- G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis 269 nign lesions [26,44]. To investigate the potential role ADAMTS1 is a metalloproteinase of the ADAM of ADAMTS1, CRABP1, and NR3C1 in colorectal tu- (A disintegrin-like and metalloprotease) family con- morigenesis in vivo, we analyzed a series of colorec- taining a thrombospondin type 1 motif and was first tal carcinomas, adenomas, and normal mucosa sam- described in 1997 as an inflammation and cancer ples. The three genes displayed methylation in carci- cachexia-related gene [25]. Today, a total of 19 similar nomas as well as in some adenomas, and thus, they genes have been characterized in the human genome appear at least occasionally to be early events in col- [4], and several of them have been implicated in var- orectal cancer development. Interestingly, methylation ious diseases, including cancer [40]. The carboxyl- of ADAMTS1 and CRABP1 was also found in a minor- terminal half region of ADAMTS1 has been shown ity of the normal mucosa samples taken from cancer to suppress both tumorigenicity and experimental tu- patients. However, the normal samples from cancer- mor metastatic potential [24] and by binding and se- free individuals were unmethylated. Taken together, questrating VEGF165, ADAMTS1 inhibits angiogene- the mucosa cells with methylation might be prone sis and endothelial proliferation [32]. Down-regulated for transformation, however, “contamination” from the gene expression of ADAMTS1 is found in breast car- primary carcinoma during removal of the sample can- cinomas and pancreatic cancer [41,33] but the mech- not be excluded. The MSP is a highly sensitive DNA anistic cause(s) is not known. This study did not methylation technique, and can detect as little as one find a significant association between hypermethyla- methylated allele in a pool of 1000 unmethylated al- tion and reduced gene expression, and thus the im- leles [19]. Still, the latter possibility seems unlikely, portance of methylation for regulation of gene expres- since among the nine normal and tumor pairs investi- sion of ADAMTS1 remains unclear. Investigation of gated all mucosa samples were unmethylated, whereas ADAMTS1 methylation in breast – and/or pancreatic most of the corresponding carcinomas were methy- cancer might clarify this. lated. In summary, these results suggest that the methy- The cellular retinoic acid binding proteins (CRABP) lation of the three genes in question is cancer-specific have a high affinity for retinoic acid and belong to a rather than age-specific [57]. However, it should be family of small cytosolic lipid binding proteins. Two noted that the mean age of the non-cancerous individu- highly homologous forms of CRABP have been char- als from whom the normal tissue samples were taken is acterized, CRABP1 and CRABP2, with about 75% lower than the mean age at onset for colorectal cancer. amino acid identity [5]. Although their exact functions Finally, no methylation of ADAMTS1 and CRABP1 are not completely understood, regulation of the avail- was detected in series of testis, prostate, or kidney cancer and NR3C1 was unmethylated in a panel of can- ability of retinoic acid to its nuclear receptors and sub- cer cell lines from the same tissues. However, it still sequent enhancement of the retinoic acid effect on reg- remains to be seen whether methylation of ADAMTS1, ulating target gene expression are both plausible [38]. CRABP1, and NR3C1 is specific to colorectal cancer Retinoic acid, a metabolite of vitamin A, plays a role in or is found also in other tumor types of the hereditary cell cycle arrest, cell differentiation, and to a certain ex- nonpolyposis colon cancer (HNPCC) spectrum. tent apoptosis by altering gene transcription, and there Some somatically hypermethylated genes, like APC is increasing evidence that retinoic acid metabolism and MLH1, have been shown to predispose to colorec- may be altered during carcinogenesis [38]. Moreover, tal cancer syndromes by an inactivating germ line mu- several reports have documented alterations in the ex- tation. The epigenetically deregulated genes presented pression of retinol and retinoic acid binding proteins in here, might therefore also represent interesting candi- various tumor types [38]. CRABP1 was initially shown dates for novel genetic predisposition loci, in partic- to be inactivated by promoter hypermethylation in pap- ular NR3C1 (5q31.1), which maps to a chromosome illary thyroid carcinomas and in two colon cancer cell arm with positive association with familial colorectal lines [21] and lately in colorectal carcinomas [39]. In cancer [9]. the present study, we demonstrate that methylation of Expected associations between promoter methyla- CRABP1 is present both in benign and malignant tu- tion status and other known variables (such as MSI sta- mors of the large bowel, in contrast to normal mu- tus, site, and differentiation) were confirmed; variables cosa, showing that this change is an early tumorigenic that previously have been shown to be associated with event. Furthermore, all cell lines with CRABP1 hyper- each other [31]. However, multivariate analysis of clin- methylation had reduced or no gene expression, which ically representative tumor series is necessary to draw indicates that the promoter hypermethylation leads to final conclusions. transcriptional inactivation. The mouse Crabp1 gene, 270 G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis which reveals 99.3% amino acid identity to human was found in tumors with methylated CDKN2A and CRABP1 [5], demonstrates developmentally regulated wild type TP53. Although the functional and clini- gene expression through methylation changes in its 5- cal importance of NR3C1 inactivation in colorectal tu- flanking region [58]. Taken together, these lines of ev- morigenesis is not known, the inactivation of this re- idence support that CRABP1 expression is epigeneti- ceptor might be of clinical importance in the treat- cally deregulated early in the establishment of colorec- ment of cancer patients receiving glucocorticoids as tal tumors. part of the standard treatment protocol, such as lym- The nuclear receptor subfamily 3, group C, mem- phoma and acute lymphatic leukemia patients. Inter- ber 1 (NR3C1) gene encodes the glucocorticoid re- estingly, frequent down-regulation of NR3C1 is found ceptor, which resides in the cytoplasm in a multipro- in such tumors in public available microarray datasets tein complex. Upon binding to glucocorticoid, the pro- [2] (see SOURCE for the expression of NR3C1 in tein translocates into the nucleus where it functions lymphomas: http://source.stanford.edu/cgi-bin/source/ as a transcription factor and participates in the regula- sourceSearch; see GDS363 report deposited in NCBIs tion of several molecular processes such as inflamma- Gene Expression Omnibus; GEO, http://www.ncbi. tion, cell growth, differentiation, and glucocorticoid- nlm.nih.gov/geo/). Methylation of NR3C1 should there- induced apoptosis [12]. The ligand-activated gluco- fore be studied in these malignancies. corticoid receptor is especially efficient in killing cer- In summary, by using a refined microarray screening tain cells of the lymphoid lineage, and glucocorticoids approach we present three genes with cancer-specific are therefore included in essentially all chemotherapy hypermethylation in colorectal tumors, ADAMTS1, protocols for lymphoid malignancies [13]. Glucocorti- CRABP1, and NR3C1. coids can also repress cell cycle progression in a num- ber of other cell types, including neoplastic thymic Acknowledgements epithelial cells [12] and non-small cell lung cancer cells [15]. In general, people have a variable sensitiv- The authors gratefully acknowledge Professor ity to glucocorticoids, which in part can be explained Sverre Heim for critically reading the manuscript, and by genetic changes reported in the NR3C1 gene, in- Dr. Mario Fraga’s expert help with the primer design cluding several polymorphisms and some mutations of the NR3C1 bisulphite sequencing primers. The Nor- [7]. The level of NR3C1 expression is a critical de- wegian Cancer Society supported the present study terminant for glucocorticoid sensitivity [48], and thus employing GEL and KK as Research Fellows (Grant: transcriptional inactivating promoter hypermethylation A95068, RAL). in tumors will render them glucocorticoid resistant. This study is, to our knowledge, the first reporting promoter hypermethylation of NR3C1 and subsequent References loss of expression. In primary colon cancers, the immunohistochemical expression of NR3C1 has previ- [1] L.A. Aaltonen, P. Peltomäki, F.S. Leach, P. Sistonen, L. Pylkkänen, J.P. Mecklin, H. Järvinen, S.M. Powell, J. Jen, ously been correlated with the expression of the cell S.R. Hamilton, G.M. Petersen, K.W. Kinzler, B. Vogelstein and cycle-related molecules pRb and p16 [54]. This was A. de la Chapelle, Clues to the pathogenesis of familial col- corroborated in the present study as NR3C1 hyperme- orectal cancer, Science 260 (1993), 812–816. thylation was associated with tumors also harboring [2] A.A. Alizadeh, M.B. Eisen, R.E. Davis, C. Ma, I.S. Lossos, hypermethylation of CDKN2A (encoding the p16 pro- A. Rosenwald, J.C. Boldrick, H. Sabet, T. Tran, X. Yu, J.I. Pow- tein; data not shown). Simultaneously, NR3C1 hyper- ell, L. Yang, G.E. Marti, T. Moore, J. Hudson, Jr., et al., Dis- tinct types of diffuse large B-cell lymphoma identified by gene methylation seemed to be mutually exclusive with the expression profiling, Nature 403 (2000), 503–511. presence of mutations in the central tumor suppressor [3] C. Anacleto, A.M. Leopoldino, B. Rossi, F.A. Soares, TP53 (data not shown), in accordance with a previous A. Lopes, J.C. Rocha, O. Caballero, A.A. Camargo, A.J. Simp- study reporting crosstalk between these two proteins son and S.D. Pena, Colorectal cancer “methylator phenotype”: [49]. On the other hand, these associations might sim- fact or artifact?, Neoplasia 7 (2005), 331–335. ply reflect the MSI phenotype of the primary tumors. [4] S.S. Apte, A disintegrin-like and metalloprotease (reprolysin NR3C1 type) with thrombospondin type 1 motifs: the ADAMTS fam- Hypermethylation of was associated with MSI ily, Int. J. Biochem. Cell Biol. 36 (2004), 981–985. positive tumors, whereas mutations in TP53 were as- [5] A. Åstrøm, A. Tavakkol, U. Pettersson, M. Cromie, J.T. El- sociated with MSS tumors [6]. Similar observations der and J.J. Voorhees, Molecular cloning of two human cel- were done for the CRABP1 gene. Methylated CRABP1 lular retinoic acid-binding proteins (CRABP). Retinoic acid- G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis 271

induced expression of CRABP-II but not CRABP-I in adult hu- [22] P.A. Jones and S.B. Baylin, The fundamental role of epigenetic man skin in vivo and in skin fibroblasts in vitro, J. Biol. Chem. events in cancer, Nat. Rev. Genet. 3 (2002), 415–428. 266 (1991), 17662–17666. [23] K. Kleivi, M.R. Teixeira, M. Eknaes, C.B. Diep, K.S. Jakobsen, [6] A.L. Børresen-Dale, R.A. Lothe, G.I. Meling, P. Hainaut, R. Hamelin and R.A. Lothe, Genome signatures of colon carci- T.O. Rognum and E. Skovlund, TP53 and long-term prognosis noma cell lines, Cancer Genet. Cytogenet. 155 (2004), 119– in colorectal cancer: mutations in the L3 zinc-binding domain 131. predict poor survival, Clin. Cancer Res. 4 (1998), 203–210. [24] K. Kuno, K. Bannai, M. Hakozaki, K. Matsushima and K. Hi- [7] P.J. Bray and R.G. Cotton, Variations of the human gluco- rose, The carboxyl-terminal half region of ADAMTS-1 sup- corticoid receptor gene (NR3C1): pathological and in vitro presses both tumorigenicity and experimental tumor metastatic mutations and polymorphisms, Hum. Mutat. 21 (2003), 557– potential, Biochem. Biophys. Res. Commun. 319 (2004), 1327– 568. 1333. [8] S.J. Clark, J. Harrison, C.L. Paul and M. Frommer, High sen- [25] K. Kuno, N. Kanada, E. Nakashima, F. Fujiki, F. Ichimura sitivity mapping of methylated cytosines, Nucleic. Acids. Res. and K. Matsushima, Molecular cloning of a gene encoding a 22 (1994), 2990–2997. new type of metalloproteinase-disintegrin family protein with [9] A. de la Chapelle, Genetic predisposition to colorectal cancer, thrombospondin motifs as an inflammation associated gene, J. Nat. Rev. Cancer 4 (2004), 769–780. Biol. Chem. 272 (1997), 556–562. [10] S. Derks, M.H. Lentjes, D.M. Hellebrekers, A.P. de Bruine, J.G. Herman and M. van Engeland, Methylation-specific PCR [26] S. Lee, K.S. Hwang, H.J. Lee, J.S. Kim and G.H. Kang, Aber- unraveled, Cell Oncol. 26 (2004), 291–299. rant CpG island hypermethylation of multiple genes in colorectal neoplasia, Lab. Invest. 84 (2004), 884–893. [11] M.F. Fraga and M. Esteller, DNA methylation: a profile of methods and applications, Biotechniques 33 (2002), 632–649. [27] L.C. Li and R. Dahiya, MethPrimer: designing primers for [12] Y. Funakoshi, H. Shiono, M. Inoue, Y. Kadota, M. Ohta, methylation PCRs, Bioinformatics 18 (2002), 1427–1431. H. Matsuda, M. Okumura and T. Eimoto, Glucocorticoids in- [28] G. Liang, F.A. Gonzales, P.A. Jones, T.F. Orntoft and T. Thyk- duce G1 cell cycle arrest in human neoplastic thymic epithelial jaer, Analysis of gene induction in human fibroblasts and blad- cells, J. Cancer Res. Clin. Oncol. 131 (2005), 314–322. der cancer cells exposed to the methylation inhibitor 5-aza-2 - [13] P.S. Gaynon and A.L. Carrel, Glucocorticosteroid therapy in deoxycytidine, Cancer Res. 62 (2002), 961–966. childhood acute lymphoblastic leukemia, Adv. Exp. Med. Biol. [29] G.E. Lind, L. Thorstensen, T. Løvig, G.I. Meling, R. Hamelin, 457 (1999), 593–605. T.O. Rognum, M. Esteller and R.A. Lothe, A CpG island [14] U.E. Gibson, C.A. Heid and P.M. Williams, A novel method hypermethylation profile of primary colorectal carcinomas and for real time quantitative RT-PCR, Genome Res. 6 (1996), 995– colon cancer cell lines, Mol. Cancer 3 (2004), 28. 1001. [30] D. Lodygin, A. Epanchintsev, A. Menssen, J. Diebold and [15] A.K. Greenberg, J. Hu, S. Basu, J. Hay, J. Reibman, T.A. Yie, H. Hermeking, Functional epigenomics identifies genes fre- K.M. Tchou-Wong, W.N. Rom and T.C. Lee, Glucocorticoids quently silenced in prostate cancer, Cancer Res. 65 (2005), inhibit lung cancer cell growth through both the extracellular 4218–4227. signal-related kinase pathway and cell cycle regulators, Am. J. [31] R.A. Lothe, P. Peltomäki, G.I. Meling, L.A. Aaltonen, Respir. Cell Mol. Biol. 27 (2002), 320–328. M. Nyström-Lahti, L. Pylkkänen, K. Heimdal, T.I. Andersen, [16] C. Grunau, S.J. Clark and A. Rosenthal, Bisulfite genomic se- P. Møller, T.O. Rognum, S.D. Fosså, T. Haldorsen, F. Lang- quencing: systematic investigation of critical experimental pa- mark, A. Brøgger, A. de la Chapelle and A.L. Børresen, Ge- Nucleic Acids Res. 29 rameters, (2001), E65. nomic instability in colorectal cancer: relationship to clini- [17] R.J. Guan, H.L. Ford, Y. Fu, Y. Li, L.M. Shaw and A.B. Pardee, copathological variables and family history, Cancer Res. 53 Drg-1 as a differentiation-related, putative metastatic suppres- (1993), 5849–5852. sor gene in human colon cancer, Cancer Res. 60 (2000), 749– [32] A. Luque, D.R. Carpizo and M.L. Iruela-Arispe, ADAMTS1/ 755. METH1 inhibits endothelial cell proliferation by direct bind- [18] C.A. Heid, J. Stevens, K.J. Livak and P.M. Williams, Real time ing and sequestration of VEGF165, J. Biol. Chem. 278 (2003), quantitative PCR, Genome Res. 6 (1996), 986–994. 23656–23665. [19] J.G. Herman, J.R. Graff, S. Myöhänen, B.D. Nelkin and S.B. Baylin, Methylation-specific PCR: a novel PCR assay for [33] T. Masui, R. Hosotani, S. Tsuji, Y. Miyamoto, S. Yasuda, J. Ida, methylation status of CpG islands, Proc. Natl. Acad. Sci. U.S.A. S. Nakajima, M. Kawaguchi, H. Kobayashi, M. Koizumi, 93 (1996), 9821–9826. E. Toyoda, S. Tulachan, S. Arii, R. Doi and M. Imamura, Ex- pression of METH-1 and METH-2 in pancreatic cancer, Clin. [20] J.G. Herman, A. Umar, K. Polyak, J.R. Graff, N. Ahuja, Cancer Res. 7 (2001), 3437–3443. J.P. Issa, S. Markowitz, J.K. Willson, S.R. Hamilton, K.W. Kin- zler, M.F. Kane, R.D. Kolodner, B. Vogelstein, T.A. Kunkel [34] G.I. Meling, R.A. Lothe, A.L. Børresen, S. Hauge, C. Graue, and S.B. Baylin, Incidence and functional consequences of O.P. Clausen and T.O. Rognum, Genetic alterations within hMLH1 promoter hypermethylation in colorectal carcinoma, the retinoblastoma locus in colorectal carcinomas. Relation to Proc. Natl. Acad. Sci. U.S.A. 95 (1998), 6870–6875. DNA ploidy pattern studied by flow cytometric analysis, Br. J. [21] Y. Huang, C.A. de la Chapelle and N.S. Pellegata, Hyperme- Cancer 64 (1991), 475–480. thylation, but not LOH, is associated with the low expression [35] J.R. Melki, P.C. Vincent and S.J. Clark, Concurrent DNA hy- of MT1G and CRABP1 in papillary thyroid carcinoma, Int. J. permethylation of multiple genes in acute myeloid leukemia, Cancer 104 (2003), 735–744. Cancer Res. 59 (1999), 3730–3740. 272 G.E. Lind et al. / ADAMTS1, CRABP1, and NR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis

[36] Y. Mori, K. Cai, Y. Cheng, S. Wang, B. Paun, J.P. Hamilton, M.A. Caligiuri and C. Plass, Excessive CpG island hyper- Z.Jin,F.Sato,A.T.Berki,T.Kan,T.Ito,C.Mantzur,J.M. methylation in cancer cell lines versus primary human malig- Abraham and S.J. Meltzer, A genome-wide search identifies nancies, Hum. Mol. Genet. 10 (2001), 1413–1419. epigenetic silencing of somatostatin, tachykinin-1, and 5 other [51] B. Smith-Sørensen, G.E. Lind, R.I. Skotheim, S.D. Fosså, genes in colon cancer, Gastroenterology 131 (2006), 797–808. Ø. Fodstad, A.E. Stenwig, K.S. Jakobsen and R.A. Lothe, Fre- [37] Y. Mori, J. Yin, F. Sato, A. Sterian, L.A. Simms, F.M. Selaru, quent promoter hypermethylation of the O6-Methylguanine- K. Schulmann, Y. Xu, A. Olaru, S. Wang, E. Deacu, J.M. Abra- DNA Methyltransferase (MGMT) gene in testicular cancer, ham, J. Young, B.A. Leggett and S.J. Meltzer, Identification Oncogene 21 (2002), 8878–8884. of genes uniquely involved in frequent microsatellite instabil- [52] H. Suzuki, E. Gabrielson, W. Chen, R. Anbazhagan, M. van ity colon carcinogenesis by expression profiling combined with Engeland, M.P. Weijenberg, J.G. Herman and S.B. Baylin, A epigenetic scanning, Cancer Res. 64 (2004), 2434–2438. genomic screen for genes upregulated by demethylation and [38] R.M. Niles, Signaling pathways in retinoid chemoprevention histone deacetylase inhibition in human colorectal cancer, Nat. and treatment of cancer, Mutat. Res. 555 (2004), 81–96. Genet. 31 (2002), 141–149. [39] S. Ogino, M. Cantor, T. Kawasaki, M. Brahmandam, [53] D. Takai and P.A. Jones, Comprehensive analysis of CpG is- G. Kirkner, D.J. Weisenberger, M. Campan, P.W. Laird, lands in human chromosomes 21 and 22, Proc. Natl. Acad. Sci. M. Loda and C.S. Fuchs, CpG island methylator phenotype U.S.A. 99 (2002), 3740–3745. (CIMP) of colorectal cancer is best characterized by quantitative DNA methylation analysis and prospective cohort studies, [54] S. Theocharis, G. Kouraklis, A. Margeli, E. Agapitos, S. Ni- Gut 55 (2006), 1000–1006. nos, G. Karatzas and A. Koutselinis, Glucocorticoid receptor [40] S. Porter, I.M. Clark, L. Kevorkian and D.R. Edwards, The (GR) immunohistochemical expression is correlated with cell ADAMTS metalloproteinases, Biochem. J. 386 (2005), 15–27. cycle-related molecules in human colon cancer, Dig. Dis. Sci. 48 (2003), 1745–1750. [41] S. Porter, S.D. Scott, E.M. Sassoon, M.R. Williams, J.L. Jones, A.C. Girling, R.Y. Ball and D.R. Edwards, Dysregulated ex- [55] E. Thiis-Evensen, G.S. Hoff, J. Sauar, F. Langmark, B.M. Majak pression of adamalysin-thrombospondin genes in human breast and M.H. Vatn, Population-based surveillance by colonoscopy: carcinoma, Clin. Cancer Res. 10 (2004), 2429–2440. effect on the incidence of colorectal cancer. Telemark Polyp Study I, Scand. J. Gastroenterol. 34 (1999), 414–420. [42] H. Rajagopalan, M.A. Nowak, B. Vogelstein and C. Lengauer, The significance of unstable chromosomes in colorectal cancer, [56] M. Toyota, N. Ahuja, M. Ohe-Toyota, J.G. Herman, Nat. Rev. Cancer 3 (2003), 695–701. S.B. Baylin and J.P. Issa, CpG island methylator phenotype [43] K. Rand, W. Qu, T. Ho, S.J. Clark and P. Molloy, Conversion- in colorectal cancer, Proc. Natl. Acad. Sci. U.S.A. 96 (1999), specific detection of DNA methylation using real-time poly- 8681–8686. merase chain reaction (ConLight-MSP) to avoid false positives, [57] M. Toyota and J.P. Issa, CpG island methylator phenotypes in Methods 27 (2002), 114–120. aging and cancer, Semin. Cancer Biol. 9 (1999), 349–357. [44] A. Rashid, L. Shen, J.S. Morris, J.P. Issa and S.R. Hamilton, [58] L.N. Wei and C.H. Lee, Demethylation in the 5 -flanking re- CpG island methylation in colorectal adenomas, Am. J. Pathol. gion of mouse cellular retinoic acid binding protein-I gene is 159 (2001), 1129–1135. associated with its high level of expression in mouse embryos [45] M. van Rijnsoever, F. Grieu, H. Elsaleh, D. Joseph and B. Iaco- and facilitates its induction by retinoic acid in P19 embryonal petta, Characterisation of colorectal cancers showing hyperme- carcinoma cells, Dev. Dyn. 201 (1994), 1–10. thylation at multiple CpG islands, Gut 51 (2002), 797–802. [59] D.J. Weisenberger, K.D. Siegmund, M. Campan, J. Young, [46] L.H. Saal, C. Troein, J. Vallon-Christersson, S. Gruvberger, T.I. Long, M.A. Faasse, G.H. Kang, M. Widschwendter, A. Borg and C. Peterson, BioArray Software Environment D. Weener, D. Buchanan, H. Koh, L. Simms, M. Barker, (BASE): a platform for comprehensive management and B. Leggett, J. Levine, M. Kim, A.J. French, S.N. Thibodeau, analysis of microarray data, Genome Biol. 3 (2002), SOFT- J. Jass, R. Haile and P.W. Laird, CpG island methylator pheno- WARE0003. type underlies sporadic microsatellite instability and is tightly [47] W.S. Samowitz, H. Albertsen, J. Herrick, T.R. Levin, associated with BRAF mutation in colorectal cancer, Nat. C. Sweeney, M.A. Murtaugh, R.K. Wolff and M.L. Slattery, Genet. 38 (2006), 787–793. Evaluation of a large, population-based sample supports a CpG [60] V.L. Whitehall, C.V. Wynter, M.D. Walsh, L.A. Simms, D. Pur- island methylator phenotype in colon cancer, Gastroenterology die, N. Pandeya, J. Young, S.J. Meltzer, B.A. Leggett and 129 (2005), 837–845. J.R. Jass, Morphological and molecular heterogeneity within [48] S. Schmidt, J. Rainer, C. Ploner, E. Presul, S. Riml and nonmicrosatellite instability-high colorectal cancer, Cancer R. Kofler, Glucocorticoid-induced apoptosis and glucocorti- Res. 62 (2002), 6011–6014. coid resistance: molecular mechanisms and clinical relevance, [61] K. Yamashita, T. Dai, Y. Dai, F. Yamamoto and M. Perucho, Cell Death. Differ. 11 Suppl 1 (2004), S45-S55. Genetics supersedes epigenetics in colon cancer phenotype, [49] S. Sengupta and B. Wasylyk, Physiological and pathological Cancer Cell 4 (2003), 121–131. consequences of the interactions of the p53 tumor suppressor with the glucocorticoid, androgen, and estrogen receptors, Ann. [62] Y.H. Yang, S. Dudoit, P. Luu, D.M. Lin, V. Peng, J. Ngai and N. Y. Acad. Sci. 1024 (2004), 54–71. T.P. Speed, Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide system- [50] D.J. Smiraglia, L.J. Rush, M.C. Fruhwald, Z. Dai, W.A. Held, atic variation, Nucleic Acids Res. 30 (2002), e15. J.F. Costello, J.C. Lang, C. Eng, B. Li, F.A. Wright, M EDIATORSof INFLAMMATION

The Scientific Gastroenterology Journal of Research and Practice Diabetes Research Disease Markers World Journal Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal of International Journal of Immunology Research Endocrinology Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Submit your manuscripts at http://www.hindawi.com

BioMed PPAR Research Research International Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal of Obesity

Evidence-Based Journal of Stem Cells Complementary and Journal of Ophthalmology International Alternative Medicine Oncology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Parkinson’s Disease

Computational and Mathematical Methods Behavioural AIDS Oxidative Medicine and in Medicine Neurology Research and Treatment Cellular Longevity Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014