DOCSLIB.ORG

CRABP1 Protects the Heart from Isoproterenol-Induced Acute and Chronic Remodeling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
CRABP1 Protects the Heart from Isoproterenol-Induced Acute and Chronic Remodeling 236 3 Journal of S W Park et al. CRABP1 protects the heart 236:3 151–165 Endocrinology RESEARCH CRABP1 protects the heart from isoproterenol-induced acute and chronic remodeling Sung Wook Park1, Shawna D Persaud1, Stanislas Ogokeh1, Tatyana A Meyers2, DeWayne Townsend2 and Li-Na Wei1 1Department of Pharmacology, University of Minnesota Medical School, Minneapolis, Minnesota, USA 2Department of Integrative Biology and Physiology, University of Minnesota Medical School, Minneapolis, Minnesota, USA Correspondence should be addressed to L-N Wei: [email protected] Abstract Excessive and/or persistent activation of calcium-calmodulin protein kinase II (CaMKII) is Key Words detrimental in acute and chronic cardiac injury. However, intrinsic regulators of CaMKII f CaMKII activity are poorly understood. We find that cellular retinoic acid-binding protein 1 f CRABP1 (CRABP1) directly interacts with CaMKII and uncover a functional role for CRABP1 in f heart failure regulating CaMKII activation. We generated Crabp1-null mice (CKO) in C57BL/6J background f cardiac remodeling for pathophysiological studies. CKO mice develop hypertrophy as adults, exhibiting significant left ventricular dilation with reduced ejection fraction at the baseline cardiac function. Interestingly, CKO mice have elevated basal CaMKII phosphorylation at T287, and phosphorylation on its substrate phospholamban (PLN) at T17. Acute isoproterenol (ISO) challenge (80 mg/kg two doses in 1 day) causes more severe apoptosis and necrosis in CKO hearts, and treatment with a CaMKII inhibitor KN-93 protects CKO mice from this injury. Chronic (30 mg/kg/day) ISO challenge also significantly increases hypertrophy and fibrosis in CKO mice as compared to WT. In wild-type mice, CRABP1 expression is increased in early stages of ISO challenge and eventually reduces to the basal level. Mechanistically, CRABP1 directly inhibits CaMKII by competing with calmodulin (CaM) for CaMKII interaction. This study demonstrates increased susceptibility of CKO mice to ISO-induced acute and chronic cardiac injury due to, at least in part, elevated CaMKII activity. Deleting Crabp1 results in reduced baseline cardiac function and aggravated damage challenged with acute and persistent β-adrenergic stimulation. This is the first report of a physiological role of CRABP1 Journal of Endocrinology as an endogenous regulator of CaMKII, which protects the heart from ISO-induced damage. (2018) 236, 151–165 Introduction Neuroendocrine stimulation of β-adrenergic receptors ventricular remodeling marked by cell death, inflammation, (β-AR) in the heart augments muscle contractility and heart fibrosis, hypertrophy and cardiac dilation, leading to rate, thereby increasing cardiac output during fight-or-flight arrhythmias and heart failure (Nichtova et al. 2012, response (Mann & Bristow 2005). Excess and/or persistent Garg & Khanna 2014). β-Adrenergic stimulation activates stimulation by catecholamines, e.g. isoproterenol (ISO) – a cAMP-protein kinase A (PKA) signaling and CaMKII synthetic agonist of β-ARs, causes decompensation and left (Grimm & Brown 2010) through multiple mechanisms. http://joe.endocrinology-journals.org © 2018 Society for Endocrinology https://doi.org/10.1530/JOE-17-0613 Published by Bioscientifica Ltd. Printed in Great Britain Downloaded from Bioscientifica.com at 10/07/2021 08:04:00AM via free access 10.1530/JOE-17-0613 Journal of S W Park et al. CRABP1 protects the heart 236:3 152 Endocrinology Initial activation of CaMKII by Ca2+/calmodulin physiological assessment. Interestingly, the basal cardiac (CaM) induces autophosphorylation at T287 that function of CKO mice is significantly reduced and their provides molecular memory to sustain its activity. hearts display evidence of adverse remodeling. We CaMKII substrates include ryanodine receptor 2a conclude that CKO mice are more susceptible to both (RyR2a) at S2814 and phospholamban (PLN) at T17 on acute and chronic ISO challenges due to significantly the sarcoplasmic reticulum (SR) membrane to augment elevated CaMKII activity in cardiomyocyte, and that a excitation–contraction coupling (Mattiazzi et al. 2015). physiological function of CRABP1 is to modulate CaMKII Ca2+ surge caused by excessive and/or persistent CaMKII activity through direct interaction with CaMKII and activity leads to diastolic SR Ca2+ leak and arrhythmias competing with CaM for CaMKII activation. This study (Ferrero et al. 2007, Chelu et al. 2009). Indeed, CaMKII reports a physiological role for apo-CRABP1 in modulating inhibition by specific inhibitors and genetic ‘loss of heart health. function’ in animal models have demonstrated that excessive CaMKII activation underlines β-AR stimulated cardiac damage (Zhang et al. 2005, Kreusser et al. Materials and methods 2016), ischemia/reperfusion injury (Said et al. 2011, Ling et al. 2013), workload and pressure overload injury Plasmid constructs and cell culture (Grimm et al. 2015), hypertrophy (Sucharov et al. 2006) and cell apoptosis and necrosis (Vila-Petroff et al. 2007). Mouse CaMKII alpha Venus was a gift from Steven Consistently, CaMKII expression and its autonomous Vogel (Addgene plasmid # 29427) (Thaler et al. 2009). activity are significantly elevated in hypertrophy and Mouse cDNA for Camk2D (MMM1013-202805730, GE heart failure (Zhang et al. 2003, Mollova et al. 2015). Dharmacon, Lafayette, CO, USA) was amplified with Therefore, a consensus has emerged that CaMKII PCR and subcloned into a modified pCMX-PL1 vector activation underlines various heart diseases and can containing Flag tag. Mouse Crabp1 cDNA was PCR be a therapeutic target for heart failure. To this end, amplified with primers for cDNA and cloned into a several small-molecule and peptide inhibitors have modified pCMX-PL1 vector containing Flag tag and into been tested experimentally, but not for clinical use due pET-15b vector containing His tag for Flag-CRABP1 and to concerns over the inhibition of other kinases and His-CRABP1, respectively. Calmodulin was cloned through channels (Pellicena & Schulman 2014). Understanding PCR of mouse cDNA into pGEX-2T containing GST tag. physiological regulation of CaMKII is important for HEK293T cells were maintained in DMEM supplanted with managing the cardiovascular system. This study attempts 10% fetal bovine serum and 1% penicillin–streptomycin. to address a newly discovered negative physiological Expression vectors for GFP-CaMKIIα and Flag-CRABP1 control of CaMKII activity in the heart. were transfected by calcium phosphate method. Cellular retinoic acid (RA)-binding protein 1 (CRABP1) is a highly conserved cytosolic protein that can bind RA Experimental mice, ISO injection and with a high affinity Fiorella( 1993). Its biological et al. tissue preparation activity is classically measured by specific RA binding in vitro and implicated in modulating the biological availability of Experimental procedures were conducted according RA (Donovan et al. 1995, Venepally et al. 1996). However, to NIH guidelines and approved by the University of its physiological function has remained elusive due to Minnesota Institutional Animal Care and Use Committee. the lack of apparent phenotype of Crabp1-null mice We used a Crabp1-targeted DE3 (ES) clone 22 to generate (de Bruijn et al. 1994, Gorry et al. 1994). Nevertheless, CKO mice. CKO Crabp1 allele contains 5 bp insertion transgenic mice ectopically expressing CRABP1 exhibited generating a Not1 restriction site (Gorry et al. 1994). Male abnormal cell growth and differentiation in the eye and WT and CKO mice (16–20 weeks of age) were divided into the liver (Wei & Chen 1991, Perez-Castro et al. 1993), two groups each: control and ISO groups. We applied two indicating certain physiological function of CRABP1 that ISO treatment strategies: acute and chronic injection. For remains to be uncovered. acute treatment, ISO groups of WT and CKO mice were In a proteomic screening, we found CRABP1 directly intraperitoneally injected with 80 mg/kg of ISO (I6504, interacts with CaMKII and confirmed its interaction with Sigma-Aldrich) twice with 8-h interval and were killed endogenous CaMKII in cardiomyocytes. We thus generated at 24 h after first injection. For chronic treatment, ISO Crabp1-null mice (CKO) in C57BL/6J background for groups of WT and CKO mice were treated with daily http://joe.endocrinology-journals.org © 2018 Society for Endocrinology https://doi.org/10.1530/JOE-17-0613 Published by Bioscientifica Ltd. Printed in Great Britain Downloaded from Bioscientifica.com at 10/07/2021 08:04:00AM via free access Research Journal of S W Park et al. CRABP1 protects the heart 236:3 153 Endocrinology intraperitoneal injections of ISO (30 mg/kg/day) for (50 mM Tris–HCl, pH 8.0, 150 mM NaCl, 0.2% NP40, 15 days or 5 weeks. Control groups were treated with daily 10% glycerol, and 1 mM EDTA) at cold room overnight. injections of 0.9% saline. KN-92 and KN-93 (5 µmol/kg, Or proteins from HEK293T ectopically expressing 2 doses, MedChem Express, Monmouth Junction, NJ, GFP-CaMKIIα with or without Flag-CRABP1 were USA) (Zhang et al. 2005) were injected 30 min before extracted in RIPA buffer (25 mM Tris–HCl, pH 7.4, ISO injection (80 mg/kg, 2 doses) into CKO mice. At the 150 mM NaCl, 0.1% SDS, 1% NP-40 and 0.5% sodium end of ISO injection period, hearts were quickly excised, deoxycholate). GFP-CaMKIIα was precipitated with anti- cross-cut in the middle of ventricles and ventricles were GFP antibody and protein G beads. After washing with weighed after blood, aorta and atria were removed. Base the binding
Load more

Recommended publications
  • Sonic Hedgehog-Gli1 Signaling and Cellular Retinoic Acid Binding Protein 1 Gene Regulation in Motor Neuron Differentiation and Diseases
    International Journal of Molecular Sciences Article Sonic Hedgehog-Gli1 Signaling and Cellular Retinoic Acid Binding Protein 1 Gene Regulation in Motor Neuron Differentiation and Diseases Yu-Lung Lin y, Yi-Wei Lin y, Jennifer Nhieu y, Xiaoyin Zhang and Li-Na Wei * Department of Pharmacology, University of Minnesota, Minneapolis, MN 55455, USA; [email protected] (Y.-L.L.); [email protected] (Y.-W.L.); [email protected] (J.N.); [email protected] (X.Z.) * Correspondence: [email protected]; Tel.: +1-612-6259402 Contributed equally. y Received: 29 April 2020; Accepted: 7 June 2020; Published: 9 June 2020 Abstract: Cellular retinoic acid-binding protein 1 (CRABP1) is highly expressed in motor neurons. Degenerated motor neuron-like MN1 cells are engineered by introducing SODG93A or AR-65Q to model degenerated amyotrophic lateral sclerosis (ALS) or spinal bulbar muscular atrophy neurons. Retinoic acid (RA)/sonic hedgehog (Shh)-induced embryonic stem cells differentiation into motor neurons are employed to study up-regulation of Crabp1 by Shh. In SODG93A or AR-65Q MN1 neurons, CRABP1 level is reduced, revealing a correlation of motor neuron degeneration with Crabp1 down-regulation. Up-regulation of Crabp1 by Shh is mediated by glioma-associated oncogene homolog 1 (Gli1) that binds the Gli target sequence in Crabp10s neuron-specific regulatory region upstream of minimal promoter. Gli1 binding triggers chromatin juxtaposition with minimal promoter, activating transcription. Motor neuron differentiation and Crabp1 up-regulation are both inhibited by blunting Shh with Gli inhibitor GANT61. Expression data mining of ALS and spinal muscular atrophy (SMA) motor neurons shows reduced CRABP1, coincided with reduction in Shh-Gli1 signaling components.
    [Show full text]
  • Cell Line-Dependent Variability of Coordinate Expression of P75ntr and CRABP1 and Modulation of Effects of Fenretinide on Neuroblastoma Cells
    Hindawi Publishing Corporation Oxidative Medicine and Cellular Longevity Volume 2016, Article ID 7568287, 8 pages http://dx.doi.org/10.1155/2016/7568287 Research Article Cell Line-Dependent Variability of Coordinate Expression of p75NTR and CRABP1 and Modulation of Effects of Fenretinide on Neuroblastoma Cells Yaoli Pu Yang, Simeng Wang, Xingguo Li, and Nina F. Schor Department of Pediatrics, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642, USA Correspondence should be addressed to Nina F. Schor; nina [email protected] Received 10 September 2015; Revised 18 October 2015; Accepted 22 October 2015 Academic Editor: Giuseppe Filomeni Copyright © 2016 Yaoli Pu Yang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Neuroblastoma is a childhood neural crest tumor. Fenretinide, a retinoic acid analogue, induces accumulation of mitochondrial reactive oxygen species and consequent apoptosis in neuroblastoma cells. The p75 neurotrophin receptor (p75NTR) enhances the antineuroblastoma cell efficacy of fenretinide in vitro. We examined the role of the retinoid binding protein, CRABP1, in p75NTR- mediated potentiation of the efficacy of fenretinide. Knockdown and overexpression, respectively, of either p75NTR or CRABP1 were effected in neuroblastoma cell lines using standard techniques. Expression was determined by qRT-PCR and confirmed atthe protein level by Western blot. Metabolic viability was determined by Alamar blue assay. While protein content of CRABP1 correlated roughly with that of p75NTR in the three neuroblastoid or epithelioid human neuroblastoma cell lines studied, manipulation of p75NTR expression resulted in cell line-dependent, variable change in CRABP1 expression.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Role of Cellular Retinoic Acid Binding Protein 2
    Airway biology Dysregulation of elastin expression by fibroblasts in Thorax: first published as 10.1136/thx.2007.093302 on 11 July 2008. Downloaded from pulmonary emphysema: role of cellular retinoic acid binding protein 2 L Plantier,1,2,3 C Rochette-Egly,4 D Goven,1 A Boutten,1,5 M Bonay,1,6 G Lese`che,3,7 M Fournier,2,3 B Crestani,1,2,3 J Boczkowski1,8 1 INSERM U700, Hoˆpital Bichat, ABSTRACT in the lung is a stimulus for the alveologenesis 2 Paris, France; Services de Background: All-trans retinoic acid (ATRA) stimulates phase of lung development3; secondly, all-trans Pneumologie, Hoˆpital Bichat, elastin synthesis by lung fibroblasts and induces alveolar retinoic acid (ATRA) induces the expression of Assistance Publique-Hoˆpitaux de 4 Paris, Paris, France; 3 Universite´ regeneration in animal models of pulmonary emphysema. elastin in lung fibroblasts ; thirdly, vitamin A Paris 7, UFR me´dicale Denis However, ATRA treatment has had disappointing results deficiency leads to an emphysema-like phenotype Diderot, Faculte´Bichat, Paris, in human emphysema. It was hypothesised that a defect in the lung of adult rats5; finally, the systemic 4 France; Institut de Ge´ne´tique in the ATRA signalling pathway contributes to the defect administration of ATRA has been reported to et de Biologie Mole´culaire et Cellulaire, Strasbourg, France; of alveolar repair in the human emphysematous lung. abrogate elastase induced emphysema in adult rats 5 Service de Biochimie A, Hoˆpital Methods: Fibroblasts were cultured from the lung of 10 and mice.67 Retinoic acid exerts its effects by Bichat, Assistance Publique- control subjects and eight patients with emphysema.
    [Show full text]
  • ADAMTS1, CRABP1, and NR3C1 Identified As
    Cellular Oncology 28 (2006) 259–272 259 IOS Press ADAMTS1, CRABP1,andNR3C1 identified as epigenetically deregulated genes in colorectal tumorigenesis Guro E. Lind a, Kristine Kleivi b,∗, Gunn I. Meling c, Manuel R. Teixeira d, Espen Thiis-Evensen e, Torleiv O. Rognum f and Ragnhild A. Lothe a,g,∗∗ a Department of Cancer Prevention, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway b Department of Genetics, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway c Surgical Department, Faculty Division Akershus University Hospital, University of Oslo, Oslo, Norway d Department of Genetics, Portuguese Oncology Institute, Porto, Portugal e Medical Department, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway f Institute of Forensic Medicine, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Centre, Oslo, Norway g Department of Molecular Biosciences, University of Oslo, Oslo, Norway Abstract. Background: Gene silencing through CpG island hypermethylation is a major mechanism in cancer development. In the present study, we aimed to identify and validate novel target genes inactivated through promoter hypermethylation in colorectal tumor development. Methods: With the use of microarrays, the gene expression profiles of colon cancer cell lines before and after treatment with the demethylating agent 5-aza-2 -deoxycytidine were identified and compared. The expression of the responding genes was compared with microarray expression data of primary colorectal carcinomas. Four of these down- regulated genes were subjected to methylation-specific PCR, bisulphite sequencing, and quantitative gene expression analysis using tumors (n = 198), normal tissues (n = 44), and cell lines (n = 30). Results: Twenty-one genes with a CpG island in their promoter responded to treatment in cell lines, and were simultaneously down-regulated in primary colorectal carcinomas.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name cellular retinoic acid binding protein I Gene Symbol Crabp1 Organism Mouse Gene Summary Description Not Available Gene Aliases AI326249, Crabp-1, CrabpI, Rbp-5 RefSeq Accession No. NC_000075.6, NT_039474.8 UniGene ID Mm.34797 Ensembl Gene ID ENSMUSG00000032291 Entrez Gene ID 12903 Assay Information Unique Assay ID qMmuCID0018468 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000034830 Amplicon Context Sequence CTGTGCGCACCACGGAGATCAACTTCAAGGTCGGAGAGGGCTTCGAGGAGGAG ACAGTGGACGGACGCAAATGCAGGAGTTTACCCACGTGGGAGAATGAGAACAA GATTCACTGCACACAGACACTTCTTGAGGGGGATGGCCCTAAAA Amplicon Length (bp) 120 Chromosome Location 9:54765585-54768456 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 96 R2 0.999 cDNA Cq 19.04 cDNA Tm (Celsius) 84.5 gDNA Cq 43.1 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Crabp1, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • (DARPP-32) and Survival in Breast Cancer: a Retrospective Analysis of Protein and Mrna Expression Shreeya Kotecha1, Marie N
    www.nature.com/scientificreports OPEN Dopamine and cAMP-regulated phosphoprotein 32 kDa (DARPP-32) and survival in breast cancer: a retrospective analysis of protein and mRNA expression Shreeya Kotecha1, Marie N. Lebot1, Bhudsaban Sukkarn1, Graham Ball 2, Paul M. Moseley1, Stephen Y. Chan1, Andrew R. Green1, Emad Rakha1, Ian O. Ellis1, Stewart G. Martin1 & Sarah J. Storr 1* Dopamine and cAMP regulated phosphoprotein 32 kDa (DARPP-32) also known as phosphoprotein phosphatase-1 regulatory subunit 1B and encoded by the PPP1R1B gene is an inhibitor of protein phosphatase-1 and protein kinase A. DARPP-32 is expressed in a wide range of epithelial cells and some solid tumours; however, its role in breast cancer is only partially defned. DARPP-32 expression was determined using immunohistochemistry in two independent cohorts of early stage invasive breast cancer patients (discovery n = 1352; validation n = 1655), and 112 HER2 positive breast cancer patients treated with trastuzumab and adjuvant chemotherapy. PPP1R1B mRNA expression was assessed in the METABRIC cohort (n = 1980), using artifcial neural network analysis to identify associated genes. In the discovery cohort, low nuclear expression of DARPP-32 was signifcantly associated with shorter survival (P = 0.041), which was independent of other prognostic variables (P = 0.019). In the validation cohort, low cytoplasmic and nuclear expression was signifcantly associated with shorter survival (both P = 0.002), with cytoplasmic expression independent of other prognostic variables (P = 0.023). Stronger associations with survival in oestrogen receptor (ER) positive disease were observed. In patients treated with trastuzumab, low nuclear expression was signifcantly associated with adverse progression-free survival (P = 0.031).
    [Show full text]
  • V12a58-Dash Pgmkr
    Molecular Vision 2006; 12:499-505 <http://www.molvis.org/molvis/v12/a58/> ©2006 Molecular Vision Received 30 September 2005 | Accepted 26 April 2006 | Published 12 May 2006 Fine mapping of the keratoconus with cataract locus on chromosome 15q and candidate gene analysis Durga Prasad Dash,1 Giuliana Silvestri,2 Anne E. Hughes1 Departments of 1Medical Genetics and 2Ophthalmology, Queen’s University of Belfast, Belfast, United Kingdom Purpose: To report the fine mapping of the keratoconus with cataract locus on chromosome 15q and the mutational analysis of positional candidate genes. Methods: Genotyping of two novel microsatellite markers and a single nucleotide polymorphism (SNP) in the critical region of linkage for keratoconus with cataract on 15q was performed. Positional candidate genes (MORF4L1, KIAA1055, ETFA, AWP1, REC14, KIAA1199, RCN2, FA H , IDH3A, MTHFS, ADAMTS7, MAN2C1, PTPN9, KIAA1024, ARNT2, BCL2A1, ISL2, C15ORF22 (P24B), DNAJA4, FLJ14594, CIB2 (KIP2), C15ORF5, and PSMA4) prioritized on the basis of ocular expression and probable function were screened by PCR-based DNA sequencing methods. Results: We report the refinement of the linkage region for keratoconus with cataract to an interval of approximately 5.5 Mb flanked by the MAN2C1 gene and the D15S211 marker on chromosome 15q. Mutational analysis of positional candi- date genes detected many sequence variations and single nucleotide polymorphisms. None of the sequence variants were considered pathogenic as they were also found in unaffected family members and normal control DNA samples. Conclusions: Fine mapping of the keratoconus with cataract locus on 15q has reduced the linked region to 5.5 Mb, thereby excluding 28 candidate genes.
    [Show full text]
  • A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression
    Supplementary Materials A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression Table S1. Statistically significant DEGs (Adj. p-value < 0.01) derived from meta-analysis for samples irradiated with high doses of HZE particles, collected 6-24 h post-IR not common with any other meta- analysis group. This meta-analysis group consists of 3 DEG lists obtained from DGEA, using a total of 11 control and 11 irradiated samples [Data Series: E-MTAB-5761 and E-MTAB-5754]. Ensembl ID Gene Symbol Gene Description Up-Regulated Genes ↑ (2425) ENSG00000000938 FGR FGR proto-oncogene, Src family tyrosine kinase ENSG00000001036 FUCA2 alpha-L-fucosidase 2 ENSG00000001084 GCLC glutamate-cysteine ligase catalytic subunit ENSG00000001631 KRIT1 KRIT1 ankyrin repeat containing ENSG00000002079 MYH16 myosin heavy chain 16 pseudogene ENSG00000002587 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 ENSG00000003056 M6PR mannose-6-phosphate receptor, cation dependent ENSG00000004059 ARF5 ADP ribosylation factor 5 ENSG00000004777 ARHGAP33 Rho GTPase activating protein 33 ENSG00000004799 PDK4 pyruvate dehydrogenase kinase 4 ENSG00000004848 ARX aristaless related homeobox ENSG00000005022 SLC25A5 solute carrier family 25 member 5 ENSG00000005108 THSD7A thrombospondin type 1 domain containing 7A ENSG00000005194 CIAPIN1 cytokine induced apoptosis inhibitor 1 ENSG00000005381 MPO myeloperoxidase ENSG00000005486 RHBDD2 rhomboid domain containing 2 ENSG00000005884 ITGA3 integrin subunit alpha 3 ENSG00000006016 CRLF1 cytokine receptor like
    [Show full text]
  • Powerful Gene-Based Testing by Integrating Long-Range Chromatin Interactions and Knockoff Genotypes
    medRxiv preprint doi: https://doi.org/10.1101/2021.07.14.21260405; this version posted July 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Powerful gene-based testing by integrating long-range chromatin interactions and knockoff genotypes Shiyang Ma1, James L. Dalgleish1, Justin Lee2, Chen Wang1, Linxi Liu3, Richard Gill4;5, Joseph D. Buxbaum6, Wendy Chung7, Hugues Aschard8, Edwin K. Silverman9, Michael H. Cho9, Zihuai He2;10, Iuliana Ionita-Laza1;# 1 Department of Biostatistics, Columbia University, New York, NY, 10032, USA 2 Quantitative Sciences Unit, Department of Medicine, Stanford University, Stanford, CA, 94305, USA 3 Department of Statistics, University of Pittsburgh, Pittsburgh, PA, 15260, USA 4 Department of Human Genetics, Genentech, South San Francisco, CA, 94080, USA 5 Department of Epidemiology, Columbia University, New York, NY, 10032, USA 6 Departments of Psychiatry, Neuroscience, and Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, NY, 10029, USA 7 Department of Pediatrics and Medicine, Herbert Irving Comprehensive Cancer Center, Columbia Uni- versity Irving Medical Center, New York, NY, 10032, USA 8 Department of Computational Biology, Institut Pasteur, Paris, France 9 Channing Division of Network Medicine and Division of Pulmonary and Critical Care Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA 10 Department of Neurology and Neurological Sciences, Stanford University, Stanford, CA 94305, USA # e-mail: [email protected] Abstract Gene-based tests are valuable techniques for identifying genetic factors in complex traits.
    [Show full text]
  • Physiological and Pathological Implications of Retinoid Action in the Endometrium
    236 3 Journal of Y Jiang et al. Retinoids and endometrium 236:3 R169–R188 Endocrinology REVIEW Physiological and pathological implications of retinoid action in the endometrium Yanwen Jiang1, Lu Chen1, Robert N Taylor2, Chunjin Li1,* and Xu Zhou1,* 1College of Animal Sciences, Jilin University, Changchun, Jilin, China 2Departments of Obstetrics and Gynecology and Molecular Medicine and Translational Sciences, Wake Forest School of Medicine, Winston-Salem, North Carolina, USA Correspondence should be addressed to X Zhou or C Li: [email protected] or [email protected] *(C Li and X Zhou contributed equally to this work) Abstract Retinol (vitamin A) and its derivatives, collectively known as retinoids, are required for Key Words maintaining vision, immunity, barrier function, reproduction, embryogenesis and cell f retinoids proliferation and differentiation. Despite the fact that most events in the endometrium f endometrial stroma are predominantly regulated by steroid hormones (estrogens and progesterone), f implantation accumulating evidence shows that retinoid signaling is also involved in the development f endometriosis and maintenance of the endometrium, stromal decidualization and blastocyst implantation. Moreover, aberrant retinoid metabolism seems to be a critical factor in the development of endometriosis, a common gynecological disease, which affects up to 10% of reproductive age women and is characterized by the ectopic localization of endometrial-like tissue in the pelvic cavity. This review summarizes recent advances in research on the mechanisms and molecular actions of retinoids in normal endometrial development and physiological function. The potential roles of abnormal retinoid signaling in endometriosis are also discussed. The objectives are to identify limitations in current knowledge regarding the molecular actions of retinoids in endometrial biology and to stimulate new investigations toward the development potential therapeutics to Journal of Endocrinology ameliorate or prevent endometriosis symptoms.
    [Show full text]
  • INVESTIGATING the ROLE of CRABP1 in ADIPOSE BIOLOGY By
    i INVESTIGATING THE ROLE OF CRABP1 IN ADIPOSE BIOLOGY by JOSHUA E. MILLER Submitted in partial fulfillment of the requirements For the degree of Master of Science Thesis Adviser: Dr. Noa Noy Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY May, 2017 ii CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis of Joshua E. Miller candidate for the degree of Master of Science*. Committee Chair: Ruth Keri, Ph.D. Committee Member: Hua Lou, Ph.D. Committee Member: Noa Noy, Ph.D. Committee Member: Monica Montano, Ph.D. Committee Member: David Danielpour Date of Defense: January 13th, 2017 *We also certify that written approval has been obtained for any proprietary material contained therein. iii Table of Contents TABLE OF CONTENTS___________________________________________________________iii LIST OF FIGURES____________________________________________________________iv-v ACKNOWLEDGEMENTS_____________________________________________vi-vii ABSTRACT____________________________________________________________1 CHAPTER 1: Background and Statement of Purpose______________________________________________________________2-8 CHAPTER 2: Materials and Methods_____________________________________________________________9-14 CHAPTER 3: Examination of the role of CRABP1 in Adipocytes__________________________________________________________15-30 CHAPTER 4: Conclusions, Discussion and Future Directions___________________________________________________________31-37 Bibliography________________________________________________________38-41
    [Show full text]