Kobe University Repository : Thesis
Mechanism of β-1,3-glucan mediated food uptake in the protozoon 学位論文題目 Raphidiophrys contractilis(原生生物Raphidiophrys contractilis におけ Title るβ-1, 3-グルカンが介在する捕食機構) 氏名 MOUSUMI BHADRA Author 専攻分野 博士（理学） Degree 学位授与の日付 2017-09-25 Date of Degree 公開日 2018-09-25 Date of Publication 資源タイプ Thesis or Dissertation / 学位論文 Resource Type 報告番号 甲第7000号 Report Number 権利 Rights JaLCDOI URL http://www.lib.kobe-u.ac.jp/handle_kernel/D1007000
※当コンテンツは神戸大学の学術成果です。無断複製・不正使用等を禁じます。著作権法で認められている範囲内で、適切にご利用ください。
PDF issue: 2021-10-07
Doctoral Dissertation
Mechanism of β-1, 3-glucan mediated food uptake in the protozoon Raphidiophrys contractilis
原生生物 Raphidiophrys contractilis における
β-1, 3-グルカンが介在する捕食機構
July 2017
Graduate School of Science
Kobe University
Mousumi Bhadra
Contents
Acknowledgements ...... 2
Summary ...... 3
Chapter 1: Introductory review...... 7
Chapter 2: Proteins required for food capturing in Raphidiophrys contractilis...... 11
2.1. Introduction ...... 11
2.2. Materials and methods ...... 15
2.3. Results ...... 24
2.4. Discussion...... 32
2.5. Tables and figures ...... 38
Chapter 3: Concluding remarks and future perspectives ...... 58
References ...... 60
1 | P a g e
Acknowledgements
Firstly, I would like to express my sincere gratitude to my supervisor Prof. Dr.
Toshinobu Suzaki for his continuous support in my PhD study and related research, and also for his patience, motivation, and immense knowledge. His guidance helped me in all the time of research and writing of this thesis. I could not have imagined having a better advisor and mentor for my PhD study.
I would like to thank the rest of my thesis committee for their insightful comments and encouragement, and also for the difficult questions which incented me to widen my research from various perspectives. I am also honored to be able to thank Professor Madoka
Kitagawa, Kobe University, and Professor Motonori Ando of Okayama University for their helpful support to my experiments.
I thank my fellow labmates of Suzaki laboratory: Chisato Yoshimura, Osamu Yagiu,
Jun Makimoto, Rina Matsumoto, Kyoko Nakata, Akane Chihara, Kento Nagao, and
Munehiro Karasawa for stimulating discussions, for the time we were working together before deadlines, and for all the fun we have had in the last three years. In particular, I am grateful to Dr. Chihong Song, Dr. Lin Chen, and Dr. Mayumi Kobayashi for enlightening me the first glance of research.
I'm actually at a loss for words to express my gratitude to my parents; my father, late
Sushil Ranjan Bhadra who dreamed of my higher studies and my mother; Rita Bhadra who always dedicates her happiness for my raising. I am also thankful to my father and mother in- laws.
Last but not the least, I would like to thank my beloved sisters, my brothers and all my family members, friends for supporting me spiritually throughout writing this thesis and my life in general. Special thanks to my husband Dr. Ranjan Kumar Mitra, for your caring love, understanding and all supports you have given me to complete this dissertation.
2 | P a g e
Summary
For heterotrophic protists, self and nonself discrimination is necessary for correct targeting of the predatory protozoa to prey organisms. The overall objective of this research was to find out proteins that take part in the food capturing system of the heliozoon
Raphidiophrys contractilis. In this research, β-1,3-glucan binding proteins were found to be involved in the food capturing system of R. contractilis.
In chapter 1, after briefly mentioned about prey/predator interactions in heterotrophic protozoon organisms, I summarized the importance of β-1,3-glucan in self/nonself discrimination in unicellular eukaryotes. β-1,3-glucan, in general, plays important roles in self/nonself discrimination in eukaryotes. In both innate and acquired immunity, β-1,3-glucan plays roles in activating components of the immune systems. For example, β-1,3-glucan works in the innate immune system by binding to the surface receptors on macrophages and activating their availability to identify and destroy foreign organisms. β-1,3-glucan-binding proteins are employed in the immune systems that recognize or attack other organisms that has β-1,3-glucan molecules on the surface. These proteins take part in discrimination between self and nonself, which is also indispensable in heterotrophic unicellular organisms for correct targeting of the predator to prey organisms. Heliozoons are unicellular protists which obtain nutrition by predatorial feeding, using special granulated organelles called extrusomes.
R. contractilis is an example of heliozoans that possess extrusomes in axopodia, or long and slender cytoplasmic projections radiating from the spherical cell body. Contents of the extrusomes are expelled outside when the heliozoons make contact with prey, by which prey organisms stop swimming and firmly entrapped by the predator.
In chapter 2, I demonstrated that two β-1,3-glucan binding proteins are involved in the food capturing system of R. contractilis for detecting and capturing prey cells. R. contractilis were cultured monoxenically with Chlorogonium capillatum as food. The ability of β-1,3-
3 | P a g e glucan recognition by R. contractilis was shown by microscopic observation. β-1,3-glucan molecules were found to be recognized by R. contractilis as food in both living conditions
(living yeast cells) and as naturally-derived substances (curdlan and zymosan). These materials were finally engulfed into phagosomes for intracellular digestion. Experiments were carried out to find out specific proteins that bind to β-1,3-glucan by pull-down purification with curdlan (insoluble β-1,3-glucan) gel. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed to detect glucan-binding proteins. A protein band of an apparent molecular mass of 100 kDa appeared as a sole band that showed β-1,3-glucan binding. Mass spectrometry was carried out with a reference nucleotide database (contig database) constructed by a transcriptome analysis. Several protein fragments were successfully detected from the 100 kDa protein band, and BLAST search suggested that all of the sequences were parts of the major vault protein (MVP). Then, these contigs were carefully aligned with one of the top-hit MVP protein sequence. Some contigs were found to be overlapped with others, strongly suggesting that multiple MVP proteins are included in the 100 kDa protein band. After alignment, the sequence gaps were filled by PCR amplification using primers targeting parts of the neighboring contigs. The full-length sequences of the transcripts were determined by 3'- and 5'-RACE methods. Finally, two protein sequences were determined (named as RAC (meaning R. contractilis) MVP-1 and
RAC MVP-2), both belonging to the MVP protein family with consensus multiple “MVP repeats” and a “MVP shoulder” domain. The full-length cDNA of RAC MVP-1 had 2,669 base pairs (bp) with an open reading frame of 2,493 bp. The full-length cDNA of RAC MVP-
2 had 2,629 bp, and 2,535 bp for the open reading frame. MVP is a main component of the vault, a ubiquitous and a very large cytoplasmic ribonucleoprotein particle with yet undetermined function. It was also suggested that the RAC MVP-1 and RAC MVP-2 are neither transmembrane nor secreted proteins. The MVPs in R. contractilis might form
4 | P a g e polymers, because “MVP shoulder” domains of both RAC MVP-1 and MVP-2 contain
“oligomer interface regions”, as in MVPs of other organisms. These proteins were further verified as MVP with antibodies against anti-human MVP. According to a neighbor joining phylogenetic tree, both RAC MVP-1 and RAC MVP-2 were positioned next to each other
(bootstrap value 100), and were included in the family of MVP, closely related to
Opisthokonta and Amoebozoa supergroups.
The specific association of RAC MVPs to β-1,3-glucan was demonstrated by competitive inhibition using laminarin (soluble β-1,3-glucan). This result can be explained if association of MVP and curdlan is competitively inhibited by the presence of another glucan species, and is considered as an additional evidence that RAC MVPs act as glucan-binding proteins. RAC MVPs were found to be secreted from R. contractilis cells during feeding. In this experiment, R. contractilis was mixed with prey flagellates, and the surrounding medium was collected and subjected to pull-down purification with curdlan gel. By SDS-PAGE analysis and mass spectrometry, not only RAC MVPs but also several other proteins
(including other minor components of the vault complex such as poly ADP-ribose polymerase and telomerase associated protein) were detected to be trapped by curdlan, suggesting that RAC MVPs and other proteins are released as a complex during food uptake.
The effect of Ca2+and Mg2+ on the glucan binding ability of RAC MVPs was examined, and no significant inhibitory effect was found against the glucan binding ability of RAC MVPs.
The cellular localization of MVP was finally examined by immunofluorescence and post- embedding immunogold electron microscopy. In immunofluorescence microscopy, MVP was detected at small particles located on the periphery of the cell body of R. contractilis, that coincided with the localization of extrusomes. The labeling of gold particles was also observed on extrusomes by immunoelectron microscopy.
5 | P a g e
Vault is a eukaryotic organelle found in most eukaryotic cells. The function of this organelle is not understood yet, and only implicated in a wide range of cellular functions including cell signaling and innate immunity. In this study, I presented evidence that RAC
MVPs have an ability to bind β-1,3-glucan, and are employed in food recognition and uptake.
The discovery of RAC MVPs in β-1,3-glucan-mediated food recognition may also shed light on the evolution of self- and nonself recognition and innate immunity systems of eukaryotes.
6 | P a g e
Chapter 1: Introductory review
Prey/predator response is the basic physiological reactions in living organisms.
Self/nonself discrimination is depending on cellular receptors, allowing the host organism to bind, engulf, and kill potential invaders and offenders in both unicellular and multicellular organisms (Cooper, 2010). Among the invertebrates, important groups such as sponges, cnidarians, worms, mollusks, crustaceans, chelicerates, insects, and echinoderms are all known to possess cell surface receptors which bind to foreign elements and allow differentiation of self and non-self (Dzik, 2010). Mechanical recognition of prey is also involved in the prey predator interaction. In the ciliate Homalozoon vermiculare, prey capture is initiated by explosive extrusion of toxicysts (rod-like elements) upon mechanical contact by a food organism, which eventually results in immobilization and killing of the prey. In addition, chemical recognition is also involved during prey capturing in ciliates (Hausmann
1978, 2002).
At the early stages of evolution of animals (both invertebrates and vertebrates), they developed unique recognizing systems for responding to microbial surface molecules like lipopolysaccharides, lipoteichoic acids, lipoproteins, peptidoglycans and β-1,3-glucans
(Begum et al., 2000; Medzhitov and Janeway, 2000; Aderem and Ulevitch, 2000). For instance, in invertebrates, recognition of unique carbohydrate structures by Toll-like receptors or peptidoglycan-recognition proteins as “non-self” markers is a key phenomenon in prominent immune responses (Liu et al., 2015; Chaosomboon et al., 2017; Takeda and Akira,
2005; Dziarski and Gupta, 2006). “Self” and “nonself”’ discrimination is necessary for basic nutrition and feeding process, in which predator select food items and exert phagocytosis. In addition, genetic exchange and sexual reproduction is dependent on this type of discrimination (Buchmann, 2014).
7 | P a g e
The paramount feature of immunity is the mechanism for monitoring the presence of nonself molecules. The nonself recognition system triggers defensive responses. The immune system comprises innate immunity and acquired or adaptive immunity. Vertebrate organisms have developed gradually a powerful adaptive memory that is helpful for their existence.
These organisms, while retaining the elaborate system of innate immunity, developed additional specific immunoglobulin system and specialized cells (Vargas-Albores and Yepiz-
Plascencia, 2000). Whereas, in invertebrate animals, as is surmised to be a lack of adaptive immunity, they developed a different mode of innate immune response that has not been established in vertebrates (Chaves and Sequeira, 2000). The innate immune system of invertebrate comprises defense systems such as hemolymph coagulation system, pro- phenoloxidase (pro-PO) activating system, lectin-complement system, agglutinin-lectin system, reactive oxygen-producing system, and phagocytic system (Iwanaga and Lee, 2005).
These immune responses are ready to be activated by the proteins involved in the recognition process of cell wall components of microorganisms, such as lipopolysaccharide (LPS) and β-
1,3-glucan. For instance, LPS and β-1,3-glucan mediate the coagulation cascade of horseshoe crab Tachpleus tridentatus (Iwanaga and Lee, 2005) and triggers the pro-Po activation system of arthropods (Vargas-Albores et al., 1993; Yoshida et al., 1996), crayfish (Cerenius et al.,
1994) by activation of the serine protease zymogen in pro-Po system (Lee et al., 2000), and earthworm Eisenia foetida (Beschin et al., 1998). Thus, β-1,3-glucan works to activate components of the immune system which has evolved to protect the host from a universe of pathogenic microbes. In the innate immune system, β-1,3-glucan also binds to macrophages, activates and increases their availability to identify and destroy foreign organisms. The immune system helps in discarding the toxic or allergenic substances that enter through mucosal surfaces (Chaplin, 2010). β-1,3-glucan-binding proteins are widely employed as molecules that either recognize or attack other organisms in primitive immune systems. The
8 | P a g e host uses both innate and adaptive mechanisms to detect and eliminate pathogenic microbes.
Both of these mechanisms include self-nonself discrimination, where β-1,3-glucan-binding proteins take part in discrimination between self and nonself, which is indispensable for the correct targeting of prey to predator.
The innate immune system of microorganisms comprises of membrane-bound and soluble molecules which are involved in recognition of ‘pathogen-associated molecular patterns’ and possess minimal cross-reactivity with self-cells (Medzhitov and Janeway,
1997). In heterotrophic protists, many involved in self and non-self discrimination; as well as cell-cell interactions, prey capture, predator avoidance response, etc. (Sakaguchi et al., 2001).
For example, amoebapores (polypeptide) secreted from Entamoeba histolytica are involved in antibacterial and cytosolic activities by forming pores on the membranes of different organisms (Bruhn et al., 2003). Induction of conjugation between sexual type ciliates is also triggered by gamones in Blepharisma and Euplotes (Luporini and Miceli, 1986; Miyake,
1981). Protozoan species also possess many membrane-bound secretory granules called extrusomes, which are involved in prey capture and defensive behavior by spreading out their contents (Harumoto and Miyake, 1991). Contents of these granules are important not only for correct recognition of the target prey, but also for the establishment and maintenance of the prey predator relationship. For example, food recognition, prey capture, and induction of phagocytosis in Actinophrys sol are initiated by the aid of a β-1,3-glucan binding protein (β-
GBP, gp40) that is usually stored in the extrusomes, and secreted in response to the prey signals, (Sakaguchi et al., 2001). Exception occurs in Trypanosoma cruzi (parasitic euglenoid flagellate); sometimes the presence of antigens (non-self) on the cell surface, yet induce no immune response at all (Buscaglia and Di Noia, 2003).
Predominantly, food acquisition of free-living protists is classified into two types: filter feeding and predation (Hausmann and Hülsmann, 1996). For instance, filter feeding is
9 | P a g e characteristic to ciliates such as Paramecium (Ishida et al., 2001) and various flagellates
(Boenigk et al., 2001). They use their cilia or flagella for gathering food particles into the cell body, by means of directing the current of water towards filter device which takes part in concentration of food particles before endocytosis occurs (Hausmann, 2002). Whereas, in predatorial feeding, protists obtain their food by means of special granulated structures, called extrusomes. For example, A. sol (Patterson and Hausmann, 1981) and Echinosphaerium nucleofilum (Suzaki et al., 1980) use extrusomes called “dense granules” to capture prey.
Centrohelid heliozoons are the members of Kingdom Chromista, with many ecologically and evolutionarily secondary heterotrophs, pseudofungi, ciliates etc. (Yabuki et al., 2012). Harosa (Heterokonta, Alveolata, Rhizaria) and Hacrobia (Haptophyta, Cryptista,
Heliozoa) are the two subkingdoms of Chromista. Haptista is the Phylum of Hacrobia, which is divided into two subphylums; Haptophytine and Heliozoa. (Cavalier-Smith et al., 2015).
Structurally, heliozoa is composed of radial stiff cellular projections (axopodia), which carry granules-like structures (extrusomes) that take part in secreting digestive enzymes (for food capture) and immobilizing enzymes (for entrapping prey). Whereas, axopodia are supported by the axoneme that is composed of interlinked microtubules in a geometrically regular array.
The goal of my study was initially set to find out proteins involved in food capturing by the centrohelid heliozoon Raphidiophrys contractilis (hereafter called RAC), and eventually, two major vault proteins (MVPs) were discovered. According to immunocytochemistry and immunogold labelling electron microscopy, the localization of
RAC MVP was suggested to be in kinetocysts. These results suggest a possible involvement of MVP in the food capturing system of RAC.
10 | P a g e
Chapter 2: Proteins required for food capturing in Raphidiophrys contractilis
2.1. Introduction
In centrohelid heliozoa (including RAC), extrusomes are called kinetocysts; complex polar organelles, including an electron dense bipartite central core enclosed by a jacket of less dense materials (Bardele, 1976), and located in close association with the plasma membrane of axopodia (Sakaguchi et al., 2002). Food capture of RAC is mediated by trapping of prey on the surface of axopodia, followed by contraction of axopodia resulting in the formation of food vacuoles and finally phagocytosis (Fig. 2-1). Involvement of kinetocysts in attachment to prey cells and capturing prey was already evidenced (Sakaguchi et al., 2001). According to
Hausmann’s report (Hausmann, 1978), centrohelidian’s kinetocysts may have an extrusive nature. But, there is no evidence yet found that the kinetocyst actually expels its content regarding food capture. According to description of Sakaguchi’s group research (Sakaguchi et al., 1998, 2002), food capture system of RAC is almost similar to that of Actinophrys sol.
That is, in heliozoa, glycoproteins on the cell surface are regarded to be essential for cell recognition, adhesion and signal transduction. In this research, I found a β-1,3-glucan binding protein in RAC, which showed a strong homology to major vault protein (MVP) of vertebrates, whose function is not yet clear.
The basic structure of β-glucan is a polymer of glucose, often constituting an insoluble gel. β-glucan is a major component of cell walls of bacteria, yeasts, algae, etc. It exists also in the cell wall of plants. In many cases, glucose is linked by β (1,3) linkage, but β
(1,6) linkage may be included in some cases (Rahar et al., 2011). In the yeast, Saccharomyces cerevisiae, the cell wall architecture composed of contains β (1→3)-d-glucan, β (1→6)-d- glucan, chitin, and mannoprotein(s) (Kollar et al., 1997). In protozoan species, detection of
11 | P a g e glucan was recorded in A. sol. (Sakaguchi et al., 2001). The euglenoid Euglena gracilis produces linear β-1,3 glucan or paramylon, and gather it as a storage polysaccharide that contain approximately 700 polymerized glucose units (Barras and Stone, 1968). Two enzymes, glucan synthase-like EgGSL1 and EgGSL2 were involved in paramylon synthesis.
But recently, involvement of EgGSL2 as a predominant enzyme for paramylon (β-1,3 glucan) biosynthesis from E. gracilis cells was reported (Tanaka et al., 2017). In this research, it was observed that curdlan gel, as well as other β-1,3-glucan structures, was phagocytized by
RAC, and β-1,3-glucan-binding proteins were detected as co-precipitated factors with curdlan gel. These proteins were also purified by affinity chromatography.
The major vault protein (MVP) is a main component of the vault, which is a ubiquitous and a very large cytoplasmic ribonucleoprotein particle, with yet undetermined function. Vaults are multimeric protein complexes and MVP accounts for more than 70% of the total vault complex (Herrmann et al., 1996). Vault is a barrel-shaped ribonucleoprotein particles and highly conserved across eukaryotic species; from slime molds to mammals
(Paspalas, 2009). First cDNA cloning and sequencing of MVP was performed in
Dictyostelium discoideum. D. discoideum vaults contained two major proteins, MVP alpha
(94.2 kDa) and MVP beta (approximately 92 kDa) (Vasu et al., 1993). 104 kDa MVP of
Rattus norvegicus was also cloned and sequenced by Kickhoefer and Rome (1994). The full length cDNA and deduced amino acid sequence of human MVP, named drug resistance- related protein LRP, was also recorded (Scheffer et al., 1995). But the glucan binding nature of MVP was not documented at all for any of the MVPs recorded so far. A glucan binding nature was discovered in this study for MVP isolated from RAC. As a continuation of this work, cDNA of this protein was cloned and sequenced, and it was found that this protein band included two protein species, both having a strong homology to MVP of other organisms, sharing characteristic features of MVP such as repeated vault units and a MVP
12 | P a g e shoulder domain. Subsequently, Western blotting confirmation was also conducted with an antibody against MVP.
In Drosophila, to observe the competitive glucan binding assay, the N-terminal domain of Gram-negative binding protein 3 (GNBP3) (called GNBP3-Nter) was tagged with yeast cells/ curdlan or pretreated with soluble laminaritetraose/ laminarin for Western blotting and ELISA test (Mishima et al., 2009). The competitive glucan binding assay also examined in A. sol, incubation with curdlan or other glucans (laminarin, zymosan, LPS and cellulose)
(Kakuta, 2008). I have done the experiment to confirm the glucan binding nature of MVP by means of competitive glucan binding action of curdlan and laminarin (β-1,3-glucan).
Subsequently, I have examined if MVP is released during food capture or not. In addition, I have checked if minor components of the vault complex (VPARP and TEP1) are also released from the cells or not. It was reported that VPARP and TEP1 are incorporated into the interior structure of vault shell, even after completion of the MVP vault exterior shell. The dynamic structure of the exterior vault shell allowed an embodiment of the minor vault proteins, as well as other vault associated proteins into the interior shell (Poderycki et al., 2006).
The role of Ca2+ in secretion of secretory granules is well documented in metazoan cells (Burgoyne and Morgan, 1998). In heliozoa, Ca2+ dependent axopodial contraction was reported (Matsuoka and Shigenaka, 1984). In A. sol, extracellular Ca2+ dependent prey capture was reported by Kakuta and Suzaki (2008). The exocytosis of trichocysts, extrusomes of Paramecium also showed Ca2+ dependency (Plattner and Kissmehl, 2003). Moreover, the agglutination activity of Fenneropenaeus merguiensis (FmLGBP) was reported as Ca2+ dependent (Chaosomboon et al., 2017). Here, I have also examined the effects of Ca2+ and
Mg2+ on the glucan binding of RAC MVP.
13 | P a g e
Localization of MVP can be determined by two techniques, subcellular fractionation and immunocytochemistry. By these techniques, it was found that the vaults are exclusively present in the cytoplasm in all cell types examined, and the presence of vault particles is regarded to be dependent on the vault-specific loci (Hamill and Suprenant, 1997).
The cellular localization of RAC MVP was observed by immunocytochemistry and post-embedding immunogold labeling electron microscopy.
In this Research, I tried to investigate the probable function of RAC-MVP in recognition of prey organisms, overall to find out the role of MVP in total food capture mechanism in RAC. The involvement of the heliozoan MVP homolog in prey recognition suggests a possible novel function of this protein in self-nonself discrimination, at least in unicellular organisms.
14 | P a g e
2.2. Materials and methods
2.2.1. Organisms and culture method
RAC was originally collected at Shukkein Garden, Hiroshima, Japan. Organisms were cultured monoxenically with C. capillatum as food (Sakaguchi and Suzaki, 1999). The culture medium was composed of 46.2 mM NaCl, 0.9 mM KCl, 0.8 mM CaCl2, 2.3 mM
MgCl2, 0.6 mM NaHCO3, 0.74 mM sodium acetate, 0.01% polypeptone, 0.02% tryptone,
0.02% yeast extract, 5 mM Tris-HCl at pH 7.8. Cells were co-cultures with food flagellates
Chlorogonium capillatum at 20±1°C.
2.2.2. Light microscopy
Food flagellates C. capillatum were washed in 10% artificial sea water (ASW) and left for at least 30 min for adaptation to the medium. RAC and food organisms were then mixed and observed under Nikon Eclipse Ni microscope with differential interference contrast optics.
The affinity of RAC to glucan was also examined by light microscopy with living yeast cells (Saccharomyces cerevisae). Before microscopic observation, yeast cells were washed with 10% ASW. Moreover, curdlan (Wako Pure Chemical Industries, Japan) and
Zymosan-A (Sigma Aldrich, Germany) were used as materials containing β-1,3-glucan. Both curdlan and zymosan are insoluble β-1,3-glucan.
2.2.3. Isolation of β-1,3-glucan-binding protein from R. contractilis
Experiments were carried out to find out specific proteins that bind to β-1,3-glucan. In this experiment, curdlan (an insoluble β-1,3 glucan) was used as an affinity matrix to assess
β-1,3-glucan binding. At first, curdlan was processed for gelation. Curdlan particles were suspended in the lysis buffer (0.5% Nonidet P-40, 200 mM NaCl, 50 mM Tris-HCl (PH 7.4),
15 | P a g e
1 µg/ml leupeptin, 1 mM EDTA, 1mM phenylmethylsulfonyl fluoride; PMSF) and heated at
90°C for 5 min. Then, after cooling down for gelation, the cooled gel was mechanically crushed and washed in the lysis buffer for 3 times.
RAC cells (approximately 4×106 cells) were lysed in the lysis buffer by pipetting, and incubated for 10 min on ice. Then, lysed cells were centrifuged (KUBOTA 3500, Japan) at 15,000 rpm at 4°C for 5 min the supernatant was collected as the cell lysate. The cell lysate
(10 ml) was mixed with 100 µl of curdlan gel (2 mg in dry weight), kept shaking on ice for 3 h and centrifuged at 4,400 rpm at 4°C for 5 min. The supernatant portion was used as the curdlan-unbound (glucan-unbound) sample, and the pellet was washed with the lysis buffer for five times by centrifugation (4,400 rpm at 4°C for 5 min each), and the final pellet was used as the curdlan-bound (glucan-bound) sample. The cell lysate, curdlan-unbound and curdlan-bound samples were subjected to SDS-PAGE. Only the curdlan gel was used as a negative control.
2.2.4. SDS-PAGE analysis
Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate proteins, following protocols by Laemmli (1970). Samples were mixed with the sample buffer containing 0.125 M Tris-HCl (PH 6.8), 4% SDS, 5% β-mercaptoethanol, 20% glycerol and 0.01% bromophenol blue with the same proportion (1:1). Then, samples were heated at 95°C for 10 min and centrifuged at 15,000 rpm for 10 min. Samples were then run on 12% polyacrylamide gels and stained by Silver Stain MS Kit (Wako Pure Chemical
Industries, Japan). The protein’s molecular weight was estimated by using PagrRuler
Unstained protein Ladder (Thermo Scientific, Lithuana).
16 | P a g e
2.2.5. De novo transcriptome analysis
Cells were collected, followed by mild centrifugation, and rinsed gently in cold 10%
ASW. Cells were then frozen immediately by liquid nitrogen, kept at -80ºC until transported to TAKARA BIO INC. Isolation of total RNA and RNA-seq was done by TAKARA BIO
INC. Poly A+ RNA was isolated after isolation of total RNA using by RNAiso Plus
(TAKARA BIO Inc.) from freeze-thaw cells. After construction of the mRNA library using
TruSeq Stranded mRNA LT sample Prep kit (Illumina), the template for RNA-seq were constructed using TruSeq Cluster kit v3-cBot- Hs (Illumina). RNA sequencing were performed by Hi-seq 2000 using TruSeq SBS kit v3-HS (Illumina). After gaining the read data (100 base, paired-end) without adapter sequences from TAKARA BIO Inc., reads were assembled by Minia software for de novo sequencing analysis (http://minia.genouest.org).
2.2.6. Mass spectrometry
The 100 kDa (approx.) protein band obtained from SDS-PAGE gel electrophoresis
(Fig. 2-4, lane 4) was cut out for Mass Spectrometry. Mass Spectrometry was done on the target protein by LC-MS/MS (Thermos Fischer). Analysis was done by Mascot software
(version_2.1.04, Matrix Science) based on the de novo transcriptome database as described above. The contigs which correspond to the target protein were identified and annotated by
BLAST (National Center for Biotechnology Information, NCBI).
2.2.7. Isolation of RNA and synthesis of cDNA
Total RNA was isolated from cells in the stationary phase using Trizol reagent
(Invitrogen) based on the AGPC (acid guanidinium-phenol-chloroform) method. The cDNA was synthesized from total RNA using SMARTer RACE 5'/3' Kit (Clonthech
Laboratories,Inc. A Takara Bio Company). Poly A + RNA was reverse transcribed to first
17 | P a g e strand cDNA with SMARTScribe Reverse Transcriptase and SMARTer II A
Oligonucleotide.
2.2.8. cDNA cloning and sequence determination
The contigs were mapped to MVP-like protein of Saccoglossus kawalevskii
(accession no. XM_006815194). For amplification of DNA fragment of MVP gene of RAC1
(a strain of RAC), 8 gene specific primers (four forward, Fw, and four reverse, Rv, primers) which are derived from contigs produced by de novo RNA-seq were prepared (Table. 2-1).
Four primer pairs 86138_Fw and 68024_Rv; 68025_Fw and 85282_Rv; 45973_Fw and
68025_Rv_1; 68025_Fw and 85658_Rv_1 amplified the DNA fragments respectively PCR amplification and 3’- and 5’- RACE PCR were done on DNA using Ampli Taq Gold 360
DNA Polymerase (Applied Biosystems) or Ampli Taq Gold (Applied Biosyatems). The master mix contains 360 GC enhancer. PCR amplification were conducted with 35 cycles of
30s denaturation at 95ºC, 30s primer annealing at 53ºC, 2 mins extension at 72ºC. PCR products were separated in sized 0.8% agarose gel electrophoresis and visualized by ethidium bromide staining. Purification of PCR products conducted by using Wizard SV Gel and PCR
Clean-up System (Promega). Later, cloning of PCR products was done using by TOPOTA
Cloning Kit with PCR 2.1-TOPO vector (Applied Biosystems). After isolation of plasmids by
GenElute plasmid Miniprep Kit (SIGMA-ALDRICH), PCR was performed on the plasmids using by Ampli Taq Gold 360 DNA Polymerase (Applied Biosystems) or Ampli Taq Gold
(Applied Biosystems) to prepare templates for DNA sequencing. Sanger sequencing reaction was performed by ABI PRISM BigDye Terminator ver 3.1 Cycle Sequencing Kits (Applied
Biosystems) on PCR products purified by ExoSAP-IT for PCR Product Clean-Up
(Affymetrix/USB). Finally, analyzed on ABI 3100, ABI 3130xl or ABI 3130 Genetic analyzer (Applied Biosystems, USA). Amino acid sequence were deduced by Nucleotide
18 | P a g e
Sequence Translation (The European Bioinformatics Institute, http://www.ebi.ac.uk/Tools/st/) and Expasy translate tool (http://web.expasy.org/translate/).
The fragments are amplified by 3'- and 5'- RACE PCR with pairs of gene specific primer and Universal Primer A Mix (UPM) supplied in SMARTer RACE 5'/3' Kit. Finally, full length cDNA of R. contractilis MVP-1 and MVP-2 were constructed.
2.2.9. Analysis of sequencing alignment and phylogenetic tree
The deduced amino acid sequences of RAC MVP-1 and MVP-2 were characterized by SignalP (4.1) (Petersen et al., 2.11), Expasy PI/MW (http://web.expasy.org/compute_pi/),
SOSUI (engine ver. 1.11) (Hirokawa et al., 1998), Motif scan (Chaosomboon et al., 2017),
ScanProsite (http://prosite.expasy.org/scanprosite/), NCBI Protein BLAST
(https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins), InterPro
(http://www.ebi.ac.uk/interpro/), DAS-TMfilter (http://mendel.imp.ac.at/sat/DAS/DAS.html).
The amino acid sequences of RAC MVP-1, RAC MVP-2 and Rattus norvegicus MVP
(Swiss-Prot protein sequence database, accession no. Q62667) were multiple-aligned using by using Clustal W (version 2.1, http://clustalw.ddbj.nig.ac.jp/). The full length multiple alignment of the Raphidiophrys βGBP was compared with other supergroup organisms MVP
(Perina et al., 2014; Berger et al., 2009). Amino acid sequences from various species were retrieved from the NCBI Genbank.
Multiple sequence alignment was generated with ClustalW (version 2.1, http://clustalw.ddbj.nig.ac.jp/). Neighbor joining (NJ) phylogenetic tree was constructed by
MEGA, version 6.6 (Tamura et al., 2013). The reliability of the branching was tested using bootstrap re-sampling (with 1000 pseudo replicates) (Felsenstein, 1985). The p-distance method was used for computing the evolutionary distances (Nei and Kumar, 2000).
19 | P a g e
2.2.10. Immunoblotting
SDS-PAGE analysis was carried out prior to Western Blotting, following the methods described above in the section. 2.2.4. Two samples were subjected to SDS-PADE; one is a cell homogenate (cells were homogenized without the lysis buffer) and a curdlan-bound sample (as described in section 2.2.3.).
For immunoblotting, the gels were blotted onto polyvinylidene difluoride membranes
(PVDF, GE Healthcare, Amersham Hybond-P, UK) and transferred proteins on PVDF membrane was washed with 0.1% Tween-20 in 1X Duibecco’s phosphate-buffered saline
(DPBS) solution for 15 minutes; 5 minutes each. Membranes were blocked with a blocking solution (5% milk powder, 1X DPBS, 0.1% Tween-20) for 1 h to block nonspecific banding to the proteins. Then the PVDF membrane was incubated for 2 h at room temperature in the primary antibody (Rabbit anti-human major vault protein polyclonal antibody, Flarebio
Biotech LLC. USA) at 1:2000 concentration. Incubation was carried out in the secondary antibody (Per oxidase labelled anti-rabbit antibody, GE Healthcare, USA). Unbound proteins were removed by 1X DPBS with 0.1% Tween-20 solution. Finally, PVDF membrane was treated by Amersham ECL Western blotting detection reagent (GE Healthcare, UK) and visualized with Amersham Hyperfilm MP (GE Healthcare, UK).
2.2.11. Competitive glucan binding assays
In order to confirm the glucan binding ability of RAC MVP and competitive inhibition of glucan binding by laminarin (soluble β-1,3-glucan, Nacalai tesque, Japan), the following experiment was performed. Competitive glucan binding of RAC MVP between curdlan and laminarin was carried out by incubating cell lysate (supernatant) of R. contractilis pretreated with and without laminarin (100 mg/ml), prior to the addition of curdlan gel. After 3 h incubation in the mixing condition on ice, curdlan gel was precipitated
20 | P a g e by centrifugation and then washed intensively with the lysis buffer (recipe previously mentioned). The curdlan gel was mixed with SDS sample buffer, followed by heat treatment and centrifugation. Two samples were prepared for the competitive glucan binding assay; the cell lysate was separated into two portions, and treated with or without laminarin prior to the addition of curdlan gel. Proteins were subjected to SDS-PAGE and visualized by silver staining.
2.2.12. Food induced protein released during food capture
To observe if MVP is released from RAC cells during food capture or not, an experiment was conducted as follows. First, the cell culture was separated into two parts; and the RAC cell suspensions were mixed with or without addition of the food flagellates C. capillatum cells (after washed intensively with 10% ASW), and incubated for 10 minutes at room temperature. Both cell suspensions were centrifuged at 4,400 rpm at 4C for 5 minutes for 2 times to remove all the cells. The supernatant was added with curdlan gel (100 µl)
(curdlan gel preparation method described in 2.2.3. section) and incubation for 3 hours on ice in mixing condition. The mixture was centrifuged to collect the pellet, washed with the lysis buffer (recipe previously mentioned), and finally the pellet was subjected to SDS-PAGE.
Besides this, I also searched for other released proteins during food uptake, and found that many proteins were co-precipitated with curdlan gel, together with MVP. These proteins were analyzed by mass spectrometry, and proteins were identified by BLAST search.
2.2.13. Effect of Ca2+ and Mg2+ on the glucan binding of R. contractilis MVP
In this section, an experiment was performed to observe the effect of divalent cations on the glucan binding ability of MVP. The cell lysate was separated into four portions, and mixed with curdlan gel with and without Ca2+and Mg2+ in the lysis buffer (i.e., four different
21 | P a g e combinations with Ca2+and Mg2+as indicated in the figure legend to Fig, 2-16). The experiment basically followed the procedure described in section 2.2.3.
2.2.14. Immunocytochemistry
To detect the cellular localization of RAC MVP, unfed R. contractilis were treated with
100 mM EDTA (ratio 1: 90) and left for 2 min at room temperature. After washed by hand centrifugation and again rinsed with DDW, the cells were placed on a slide and extra fluid was discarded by using a fine tip pipette and dried. Later, 2% paraformaldehyde (PFA) was added on the dried cells, and kept for 2 min. Cells were then rinsed with 1X PBS for two times (1 min each). The cells were treated with the blocking solution (1% bovine serum albumin in 1X PBS) for 5 min, and after rinsed again with PBS, primary antibody (rabbit anti-human major vault protein polyclonal antibody, Flarebio Biotech LLC. USA) was applied to the cells in PBS (1:500) for 30 min at room temperature. After PBS rinse, the cells were treated with the secondary antibody (Alexa Flour 488 goat anti-rabbit SFX Kit,
Abacum, Japan) at 1: 100 dilution for 30 min at room temperature, PBS rinsed, and mounted by Fluoro–Keeper antifade reagent without DAPI staining (Nacalai Tesque, INC, Japan).
Observation and photography were carried out by a confocal laser scanning microscope
FV300-IX71 (Olympus, Japan).
2.2.15. Immunogold labelling and electron microscopy
Post embedding immunogold staining of LR-White embedded specimen was performed for transmission electron microscopy. RAC cells feeding on Cholorogonium cells (washed with 10% ASW) were fixed for 30 min at room temperature with a fixative containing 50 mM phosphate buffer (pH 7.0), 4% paraformaldehyde, 4% glutaraldehyde, 1 mM MgCl2, and
1mM EGTA (Nacalai Tesque, Japan). Cells were dehydrated with a graded series of ethanol
22 | P a g e followed by infiltration with 100% LR White resin (20g LR White Resin, 2g 2-ethoxy-
2bphenylacetophenone) at -20°C overnight and polymerized by UV at -20°C for 27 hours.
Obtained ultrathin sections (70 nm) were treated with a blocking solution (1% BSA in PBS) for 1 h, followed by incubation in anti MVP primary antibody (Rabbit anti-human major vault protein polyclonal antibody, Flarebio Biotech LLC. USA) in PBS (1:1000) and later on secondary antibody for Anti rabbit IgG (whole molecule Gold 10 nm, Sigma Aldrick, UK), kept each antibody for 1 hour prior to antibody treatment. After being rinsed with PBS, labeled the cells with Protein A colloidal gold 10 nm (EY Laboratories, USA) in blocking solution (1:20). Finally ultrathin sections were stained with EM stainer (Nisshin EM) and
Reynolds’ lead citrate stain (Reynolds, 1963) for 10 minutes. Then observed with transmission electron microscope H-7100 (HITACHI) provisioned with a CDD camera system (AMT advantage HR, HITACHI).
23 | P a g e
2.3. Results
2.3.1. Recognition of β-1,3-glucan by R. contractilis as food
As shown in Fig. 2-1, Chlorogonium capillatum cells were captured and enclosed in food vacuoles. Saccharomyces cerevisiae (Fig. 2-3A) and its cell wall derivative zymosan-A
(Fig. 2-3B) were also ingested into food vacuoles. As the main component of the cell wall of
Saccharomyces cerevisiae is β-1,3-glucan, curdlan (insoluble polymer of β-1,3-glucan) was applied to RAC. As shown in Fig. 2-3C, fragments of curdlan were recognized as prey and ingested into food vacuoles just in the same manner as seen in normal food uptake by RAC.
2.3.2. Glucan binding assay
To identify β-1,3-glucan binding proteins of RAC, pull-down assay was carried out by mixing the cell extract with curdlan gel. Proteins were co-precipitated with curdlan gel and curdlan-binding proteins were examined by SDS-PAGE as shown in Fig. 2-4. A major protein band of 100 kDa (indicated by solid triangle in lane 4) was detected. Two non- specific bands were also observed in lane 4, which were derived from the curdlan gel.
2.3.3. Mass analysis revealed that 100-kDa glucan-binding protein is a major vault protein
Mass spectrometry result revealed that the obtained contig sequences from the 100 kDa protein have strong homology to MVP. Nucleotide sequences of those contigs were retrieved from the transcriptome data of RAC. NCBI BLAST search resulted that acquired contigs with significant Mascot scores more than the threshold value (65.6) (Table 2-2) all correspond to MVP with significant E-values. Then these contigs were aligned with one of the top-hit protein sequence to the most significant contig (68025__len__351). It was major vault protein-like Saccoglossus kowalevskii (NCBI Blast, accession no. XP_006815257.1),
24 | P a g e and the result of alignment was shown in Fig. 2-5. Some contigs are overlapped with others, strongly suggesting that multiple MVP proteins are included in the 100 kDa protein band.
After alignment, the gaps among contigs were filled up by PCR amplification. The degenerated primers pairs were used to amplify the gap sequences. Finally, it was concluded that two cDNA sequences are present there, and named as RAC MVP-1 and RAC MVP-2, as schematically shown in Fig. 2-6. For RAC MVP-1, the DNA fragment was amplified by PCR with the primer pairs (86138_Fw / 68024_Rv); (68024_Fw / 85282_Rv) and for RAC MVP-
2, (45973_Fw / 68025_Rv_1); (68025_Fw / 85658_Rv_1) primers pairs were used to fill in the gaps between detected contigs. The nucleotide sequence of the full length transcript of
RAC MVP-1 was determined by using 3'- and 5'-RACE reactions using 85282_Fw primer at
3'-end and 68024_Rv primer at the 5' end. In case of RAC MVP-2, 68025_Fw primer at the 3' end and 68025_Rv_1 primer at the 5' end were used in 3'- and 5'-RACE reactions (Fig 2-6).
Thus, the full length cDNA of RAC MVP-1 and RAC MVP-2 were constructed. The deduced amino acid sequences of RAC MVP-1 and RAC MVP-2 were obtained by Expasy translate tool.
2.3.4. Sequence characterization of R. contractilis MVP-like protein-1 (RAC MVP-1)
The full length cDNA of RAC MVP-1 (2,669 bp) had an open reading frame (ORF) of 2,493 bp, encoding 831 amino acids (aa). The deduced polypeptide sequence was found to be composed of 831 aa predicted by Expasy translate tool. Amino acids were numbered beginning from the first methionine (start codon) and ended by stop codon (Fig. 2-7). The
SignalP (4.1) result revealed no signal peptide in RAC MVP-like protein-1 sequence. The
Expasy PI/MW server estimated pI of 5.70 and 92.50 kDa molecular mass (average), which is smaller than the estimated size by SDS-PAGE, suggesting possible protein modification.
SOSUI (engine ver. 1.11) resulted that it’s a soluble protein. The Motif Scan and ScanProsite
25 | P a g e analysis strongly stated that the RAC MVP-1 protein had two N-linked glycosylation sites at
Asn22 to Arg25 and Asn601 to Phe604, but no O-linked glycosylation site. Analysis result also revealed RAC MVP-1 contains two N- Myristoylation sites (Gly430 to Arg435, Gly696 to
Glu701); a cAMP- and cGMP-dependent protein kinase phosphorylation site (Arg366 to
Ser369); one alanine rich region (Ala673 to Ala726); one IQ motif (Ala649 to Ser678); 14 Protein kinase C phosphorylation site (Thr150 to Arg152, Thr187 to Arg189, Thr220 to Lys222, Ser229 to
Arg231, Thr232 to Lys234, Thr250 to Lys252, Thr275 to Arg277,Thr291 to Lys293, Thr385 to Lys387,
Thr446 to Arg448, Gln581 to Arg583, Thr641 to Lys643, Ser768 to Lys770, Thr782 to Lys784);
Phosphatase tensin-type domain (PTEN) Trp194 to Ala454 ; one NLS_BP (bipartite nuclear localization signal profile) Arg655 to Lys670. No EF hand (elongation factor) motif was found.
In addition the characteristic strong motif of eight major vault protein repeat site residing at amino acid positions Met1 to Pro52; Arg54 to Pro114; Pro115 to Lys167; Pro168 to Thr220; Glu221 to
Thr275; Arg277 to Gly325; Glu326 to Asp373; Glu374 to Ala425 was also found in RAC MVP-1 sequence. The amino acid region from Val474 to Ala660 belongs to the SPFH domain / Band 7 family; which comprises of a diverse set of membrane-bound proteins. NCBI BLAST search showed the open reading frame composed of four repeated vault unit and MVP shoulder domain. The shoulder domain includes oligomer interface (polypeptide binding site) according to InterPro, protein sequence analysis and software program.
2.3.5. Sequence characterization of R. contractilis MVP-like protein-2 (RAC MVP-2)
The cDNA of RAC MVP-2 was composed of 2,629 bp in length, and 2,535 bp encoded 845 aa to complete an ORF. The deduced polypeptide sequence was found to be composed of 845 aa predicted by Expasy. Amino acids were numbered beginning from the first methionine (start codon) and ended by stop codon. Except A, T, G, C code; Y, R, M nucleotide codes also found in RAC MVP-2 sequence, which corresponds more than one
26 | P a g e amino acid (Fig. 2-8). That’s why it is still ambiguous to translate. But the NCBI BLAST result of deduced translated sequence by Expasy, showed the open reading frame composed of four repeated vault unit and MVP shoulder domain. The shoulder domain includes oligomer interface (polypeptide binding site) according to InterPro. Alike RAC MVP-1, the
SignalP (4.1) result revealed absence of signal peptide in RAC MVP-like protein-2 sequence and solubility of this protein was estimated by SOSUI (engine ver. 1.11). The isoelectric point (pI) and molecular mass (average) was 5.69 and 93.89 kDa respectively, estimated by the Expasy PI/MW server. The Motif Scan and ScanProsite analysis strongly stated that the
RAC MVP-2 protein had two N-linked glycosylation sites (Asn11 to Thr14, Asn36 to Arg39) and no O-linked glycosylation site present. Analysis result also revealed RAC MVP-2 contains three N-Myristoylation sites (Gly2 to Ser7, Gly445 to Ala445, Gly710 to Glu715); one alanine rich region (Ala687 to Ala740); one IQ motif (Ala663 to Ser692); 13 Protein kinase C phosphorylation site (Thr3 to Lys5, Ser201 to Arg203, Thr234 to Lys236, Thr246 to Lys248, Thr264 to
Lys266, Thr289 to Arg291, Thr354 to Arg356, Ser399 to Lys401, Thr446 to Arg448, Thr460 to Arg462,
Thr655 to Lys657, Ser782 to Lys784, Thr796 to Lys798); one tyrosine kinase phosphorylation site
(Lys84 to Tyr90). One phosphatase tensin-type domain was found (Pro218 to Ala468), but no EF hand motif and transmembrane domain (DAS-TMfilter server) were found. In addition the characteristic strong motif of eight major vault protein repeat site residing at amino acid positions Pro24 to Pro66; Arg68 to Pro128; Glu129 to Lys181; Pro182 to Thr234; Asp235 to Thr289;
Arg291 to Gly339; Glu340 to Asp387; Glu388 to Asp440 was also found in RAC MVP-2 sequence, related to RAC MVP-1.
It is suggested that the RAC MVP-like protein-1 and RAC MVP-like protein-2 is neither a transmembrane (according to DAS-TMfilter server) nor a secreted protein. The
MVP-like protein might form polymer as well as MVP of other organisms, because Shoulder domain of MVP contains Oligomer interface.
27 | P a g e
Primary structures of MVP-like protein-1 and MVP-like protein-2 of RAC show similarities to MVP of other organisms, such as Saccoglossus kowalevskii (accession no.
XM_006815194), Larimichthys crocea (KKF21095.1), Dictyostelium purpureum
(XP_003292154.1), Polysphondylium pallidum (EFA80481.1), according to NCBI Blastp results (Fig. 2-9). Repeated vault units, MVP Shoulder domain with oligomer interfaces are common characteristics in all MVP structures.
2.3.6. Multiple aligning and phylogenetic analysis of RAC MVP-1 and RAC MVP-2
The full length alignment of the RAC MVP-1 and RAC MVP-2 sequences were compared with Rattus norvegicus MVP (Swiss-Prot entry Q62667). Alignment of amino acid sequences of homologous proteins was carried out by Clustal W program (Fig. 2-10). In the picture it is observed that both MVP shared four repeated vault units. The MVP shoulder domain contains oligomer interface, including polypeptide binding site. R. norvegicus MVP has 57% identity with RAC MVP-1 and 56% identity with RAC MVP-2 (according to Clustal
W result). The identity between RAC MVP-1 and MVP-2 is 86%.
A phylogenetic tree was constructed by using the deduced amino acid sequences of
MVP of the species from the following supergroup members, including Opisthokonta
(Mollusca; Annelida; Chordata; Fungi, Cnidaria; Echinodermata; Arthropoda; Porifera),
Amoebozoa, Excavata, Cliophora (covering protozoa), and Centrohelid heliozoa (illustrated in Fig. 2-11). Both RAC MVP-1 and RAC MVP-2 positioned next to each other. From the phylogenetic tree, it is predicted that the phylogenetic position of RAC MVP is incoherent.
Nevertheless, the constructed phylogenetic tree at least indicated that RAC MVP-1 and RAC
MVP-2 are included in the family of MVP, closely related to Opisthokonta and Amoebozoa supergroups (bootstrap value 100). Whereas, Opisthokonta supergroup comprises mainly of animals, fungi, clanoflagellates, and Amoebozoa members are free living slime molds and
28 | P a g e
Entamoeba. RAC is a centrohelid heliozoa, whose evolutionary position is still unclear, and the evolutionary position of MVP of RAC is also unrecognizable here.
2.3.7. Confirmation of RAC MVP by Western blotting
For Western Blotting confirmation of RAC MVP, whole cell extract (without lysis buffer treatment) of RAC and curdlan (glucan) bound samples were subjected to SDS-PAGE
(Fig. 2-12A, lane 1 & 2), transferred onto a PVDF membrane and treated with the primary antibody (rabbit anti-human major vault protein polyclonal antibody). On the Western blot film, protein bands appeared in both whole cell extract and curdlan bound lane (Fig. 2-12B, lane 1 & 2) at the 100 kDa position. Thus, RAC MVP isolated by affinity purification was reacted with anti MVP antibody, ant it is another proof that the 100 kDa protein band contains
MVP and it is present in RAC cells. There detected some minor cytoplasmic protein bands in the whole cell homogenate lane (Fig. 12B, lane 1). The nature of these proteins were not clarified.
2.3.8. Competitive inhibition of glucan binding by laminarin confirmed that RAC MVP is a glucan binding protein
Competitive inhibition experiment of the curdlan binding of RAC MVP by laminarin
(insoluble β-1,3-glucan) was performed and the result is shown in Fig. 2-13. The curdlan bound MVP band became reduced when the cell lysate was pre-treated with laminarin. This result can be explained if association of MVP and curdlan is competitively inhibited by the presence of another glucan species, and is considered as another evidence that RAC MVP acts as a glucan-binding protein.
29 | P a g e
2.3.9. MVP is released to the surrounding medium during food uptake
To observe the released proteins during food capture of R. contractilis, food flagellates were added to R. contractilis cell culture, just prior to the collection of the extracellular fluid. By SDS-PAGE and subsequent Western blotting (Fig. 2-14, lane 1 and 2),
MVP was detected at the 100 kDa position. It means that RAC release MVP only during food capture, since without Chlorogonium, no proteins were detected at all from the extracellular fluid. This result clearly indicates the involvement of glucan binding MVP during food capturing system of RAC.
2.3.10. Possible incorporation of minor vault proteins with major vault protein
In addition to the release of MVP, some other proteins were also found to be released and trapped by curdlan gel (Fig. 2-15, lane 2). Protein bands were analyzed by mass spectrometry, and the acquired contigs were examined by Blast search for annotation. From the protein band at high molecular weight (<200), vault poly ADP-Ribose polymerase
(VPARP) and telomerase-associated protein 1 (TEP1) were detected as the top hit proteins.
Similarly, protein bands were examined from the top (high molecular weight) to the bottom
(low molecular weight) as indicated with rectangles in Fig. 2-15. As mentioned above, the 1st box contained minor vault proteins, 2nd box represents hydroxyproline rich glycoprotein, 3rd box- a disintegrin and metalloproteinase with thrombospondin motifs 9, 4th box- major vault protein, 5th box- a disintegrin and metalloproteinase with thrombospondin motifs 9, 6th box- tubulin_FtsZ_CetZ-like superfamily, 7th box- NBD_sugar-kinase_HSP70-actin superfamily of protein. Since all of these proteins were co-precipitated with MVP, this result may suggest that these proteins are the constituents of a large protein complex that include MVP.
According to NCBI BLAST, VPARP contained PARP (poly ADP Ribose polymerase) domain and TEP1 contained characteristic THROVE domain, WD40 superfamily. Whereas,
30 | P a g e
TEP1 also comprised of transcription factor ImmunoGlobin (TIG or IPT) domains, located in cell surface receptors (such as plexins and scatter factor receptors). These minor vault proteins may locate in the vault-associated location, so it predicts that they may additionally incorporate with the function of MVP, as cell signaling. According to these results, minor vault proteins are suggested to be incorporated into major vault protein functionally.
2.3.11. Effect of Ca2+ and Mg2+ on glucan-binding of MVP
Inspired from the Ca2+ dependency of Fenneropenaeus merguiensis LGBP agglutination assay with Vibrio harveyi, the experiment was conducted to test the Ca2+ dependency of RAC MVP in the glucan binding assay (Fig. 2-16). Moreover, Mg2+ and both
Ca2+, Mg2+ effects also checked. As the result, no significant inhibitory effect was found against the glucan binding of MVP.
2.3.11. Immunofluorescence microscopy
The results of immunofluorescence microscopy are shown in Fig. 2-17. The fluorescence showed an enormous signal at the periphery and outside of the cell body (Fig. 2-
17B). This result indicates that RAC MVP is localized at the edge of cell body, as kinetocysts located beneath the plasma membrane of RAC cells (Fig. 2-17A).
2.3.12. Immunoelectron microscopy
The localization of RAC MVP was further examined by immunoelectron microscopy.
Detection was carried out by using specific antibodies and protein A gold (10 nm) particles.
Protein A gold particles labeled MVP on kinetocysts (approximately 400 nm in height and
300 nm in width) seen as globular structured (Fig. 2-18 A and B).
31 | P a g e
2.4. Discussion
The objective of this study was to investigate the molecular mechanism of food recognition by the protozoon R. contractilis (RAC).
Present study is the first attempt to examine the feeding behavior of RAC in the molecular level. The extrusive organelles, kinetocysts, expel their contents upon attachment by the prey. The involvement of kinetocysts in prey capture was previously reported
(Sakaguchi et al., 2002), but the nature of materials expelled from kinetocysts were not yet determined. In case of A. sol., a 40-kDa glycoprotein (gp40), which has an adhesive substance with Con A-binding ability, is involved in the food capturing by the heliozoan
(Sakaguchi et al., 2001). At first, the present research followed the experiment made for A. sol by Sakaguchi et al., (2001) attempting to isolate proteins from RAC that may have a function similar to gp40.
As shown in the results section, RAC was found to show the feeding behavior and preference to the food materials just like A. sol, namely RAC captured and ingested living organisms and materials containing β-1,3-glucan (Fig. 2-3A-C). These results were in accordance with the previous report made for A. sol, and clearly indicated that RAC recognizes β-1,3-glucan as food. As it was mentioned previously, the yeast cell wall (S. cerevisae) is mainly composed of β-1,3-glucan molecules as the main component (Kollar et al., 1997). Next, a pull-down affinity purification was carried out using curdlan gel to isolate proteins that have specific affinity to β-1,3-glucan. As shown in Fig. 2-4, a protein band appeared at 100 kDa position. As for A. sol, the molecular weight of the β-1,3-glucan binding protein is reported as 40 kDa (Sakaguchi et al., 2001), less than half in the molecular size of the protein found in RAC. In other organisms, lipopolysaccharide and β-1,3-glucan-binding proteins (LGBPs) were isolated and characterized in freshwater crayfish Pacifastacus leniusculus (Lee et al., 1999), silkworm Bombyx mori (Ochiai and Ashida, 2000), pyralid
32 | P a g e moth (Fabrick et al., 2004) etc. All of these proteins are around 40 kDa in molecular mass, but no proteins of this size were detected in RAC samples, indicating that the β-1,3-glucan- binding protein of RAC may be quite different from those already reported for other organisms.
The cDNA cloning, sequencing and RACE reactions were conducted to construct the full length sequence of the 100 kDa glucan-binding protein. The result showed a strong homology to MVPs of other organisms. To the best of my knowledge, this is the first demonstration that shows MVP having a glucan binding nature. The biological functions of
MVP are incompletely understood, while in higher organisms, it may represent a versatile platform for intracellular regulation of multiple signaling pathways and innate immunity
(Begum et al., 2009, Berger et al., 2009). In the case of RAC, as a member of protozoa, however, the functional mode may be different, because it has a glucan-binding nature. MVP occupies 70% of the total mass of the vault particle, with some minor components such as
290 kDa telomerase-associated protein 1 (TEP 1) (Kickhoefer et al., 1999b), 193 kDa vault poly (ADP- Ribose) polymerase (VPARP) (Kickhoefer et al., 1999a) and small untranslated vault RNA components (VR) (Kickhoefer et al., 1993, Kedersha et al., 1986, Tanaka et al.,
2009, Poderycki et al., 2006). Structurally, the following characteristic domains of MVP are also shared by both RAC MVP-1 and RAC MVP-2, such as N-linked glycosylation sites, N- myristoylation sites, alanine rich region, IQ motif, protein kinase C phosphorylation site, phosphatase tensin-type domain (PTEN), major vault protein repeat site, SPFH domain/ Band
7 family. Whereas, cAMP- and cGMP-dependent protein kinase phosphorylation sites and one NLS_BP (bipartite nuclear localization signal profile) are found only in RAC MVP-1, and are absent in RAC MVP-2. The N-linked glycosylation sites and EF hand motifs were observed in feline lung resistance-related protein (LRP) or MVP. The function of EF hand motif (calcium-binding domain) suggested that it is involved in the transport of various drugs
33 | P a g e and substrates between the nucleus and the cytoplasm (Fukushima et al., 2006). In RAC
MVP-1 and RAC MVP-2 no EF hand motif was detected, suggesting that RAC MVPs may not be Ca2+-independent or Ca2+ ions can’t make ligands with this glucan binding MVP. IQ motif is a common structure of MVP of Danio rerio (InterPro, accession no. A3KQH2). The function IQ motif binding site of RAC MVP might be different. Because IQ motif is also known as the EF hand binding site, but as mentioned the EF hand motif is absent in RAC
MVPs. MVP100 has conserved myristoylation sites and numerous consensus motifs for phosphorylation by several protein kinases (Herrmann et al., 1996). In bacteria, the function of mature protein sequences containing alanine-rich repeat sequences may play role in the export of the SpaA protein across a bacterial membrane (Holt and Latha, 2000). It was also stated that alanine rich region of Streptococcus mutans also showed strong adhesion to tooth surfaces (Matsumoto-Nakano et al., 2000). It is therefore speculated that the alanine rich region of RAC MVPs may take part in MVP transport outside the cell. The association between PTEN (a tumor suppressor gene) and MVP was reported (Yu et al., 2002) and regulatory function of PTEN in many cellular events as growth, adhesion, migration, invasion, apoptosis was also revealed (Stambolic et al., 1998). Bipartite nuclear localization in MVP was stated by Vollmar et al., 2008. That is the N-linked glycosylation site of RAC
MVP. However, localization of RAC MVP indicates that it is not detected in the nucleus
(will be shown in Fig. 2-17). The presence of characteristic vault repeating unit in the N- terminal half of protein and SPFH domain (coiled coil) in the C-terminal region like RAC
MVPs are also present in sea urchin and other organisms (Stewart et al., 2005; Tanaka and
Tsukihara, 2012; Daly et al., 2013).
The multiple aligning between MVP of RAC and Rattus showed repeated vault unit and shoulder domain according to the NCBI BLAST result (Fig. 2-10). But the exact function of these domains was not clearly reviewed. Since many of these domains are evolutionarily
34 | P a g e conserved in eukaryotes, including slime mold to human, it is postulated that due to these domains MVP can recognize different invading microorganisms.
Moreover, a phylogenetic tree of MVP of different organisms was generated in order to verify the evolutionary relationship of RAC MVP-1 and RAC MVP-2 (Fig. 2-11). From the modified phylogenetic analysis of Cavalier-Smith (2015), centrohelids are far distant from
Amoebozoa, Rhizarian group. But in the phylogenetic tree, glucan binding RAC MVP (both
MVP-1 and MVP-2) are positioned near to Amoebozoa (Dictyostelium discoideum) and other
Opisthokonta group members (Arthropoda, Porifera and Cnidaria). So, the phylogeny of
RAC MVP is contradictory and difficult to be described.
Immunoblotting has been done to confirm that obtained protein was MVP, used by the rabbit anti-human major vault protein polyclonal antibody as the primary antibody. The result revealed that the blotted band contains MVP (Fig. 2-12).
The competitive glucan binding assay experiment revealed the competitive inhibition of curdlan by laminarin. Both curdlan and laminarin evidently compete for a common binding site on β-1,3-glucan binding MVP, because laminarin, in a surplus amount, may have been strongly occupied the glucan-binding site of MVP, hindering further association with curdlan any longer. In A. sol competitive glucan binding assay, protein binding by curdlan was inhibited by the presence of laminarin and LPS, not by zymosan and cellulose. The fact that specific association of RAC MVP to curdlan (insoluble β-1,3-glucan) was inhibited by laminarin (soluble β-1,3-glucan) is in good accordance with the experiment made on A. sol
(Kakuta, 2008).
RAC MVP was found to be emitted from RAC cells after addition of food, during feeding (Fig. 2-14). While extrusomes of A. sol releases its contents (gp40) only during food capture (Sakaguchi et al., 2001), RAC was also examined to see if MVP is also released from the cell during food uptake. RAC cells were mixed with or without prey, and extracellular
35 | P a g e fluid was collected, followed by affinity purification with curdlan gel. By SDS-PAGE analysis, not only MVP but also some other proteins (including minor vault proteins) were secreted after induction of prey capturing. This result strongly suggests that many proteins form a complex with MVP and co-precipitated with curdlan gel.
The effect of Ca2+ and/or Mg2+ on the glucan binding ability of RAC MVP was examined. The result showed no significant effect on the glucan binding ability of RAC MVP
(Fig. 2-16), indicating that the glucan binding ability of RAC MVP is not dependent on Ca2+ and Mg2+. This result may be related to the fact that EF hand motif was not detected in both
RAC MVP-1 and RAC MVP-2. In many other organisms, the functions of MVP are regarded as Ca2+-dependent. The agglutinating activity of the purified Fenneropenaeus merguiensis
(FmLGBP) was observed against nine microorganisms (five Gram-negative bacteria, three
Gram-positive bacteria and yeast) in the presence or absence of Ca2+. Agglutinating activity was found Ca2+-dependent; no agglutination activity was detected in the absence of Ca2+ of all microorganisms. Furthermore, binding of purified rLGBP to Vibrio harveyi (bacterium, causes a violent disease in F. merguiensis) was also detected as Ca2+ dependent. In addition, in the absence of Ca2+, binding of rLGBP was incomplete. These Ca2+ specificity might be helpful in strengthening of LGBP binding (Chaosomboon et al., 2017). According to Ca2+ independency of RAC MVP expression, RAC MVP seems to have broad specificity with non-self recognition and is capable to agglutinate with glucan particles in presence of Ca2+ and Mg2+, or even in both.
From the results of immunocytochemistry and immunogold labeling electron microscopy, it was observed that MVP was located at the kinetocysts, which is located beneath the plasma membrane and axopodia of RAC cells. As in immunocytochemistry (Fig.
2-17), the MVP was stained at the periphery of RAC cells, where kinetocysts exist. By
36 | P a g e electron microscopy, it was further observed that localization of RAC MVP inside the kinetocysts (Fig. 2-18).
The function of MVP depends on its location in the cell. The vault is reported to play roles in multidrug resistance and cell signaling in innate immunity (Scheffer et al., 1995;
Scheffer et al., 2000; Yu et al., 2002; Kolli et al., 2004; Gopinath et al., 2005; Steiner et al.,
2006; Kowalski et al., 2007). Daly et al. (2013) suggested that MVP is an ancient eukaryotic protein that was probably already present in the common ancestry of eukaryotes, and the original function of MVP might have been lost or completely different functions were assigned to MVP, as eukaryotic organisms experienced evolution of multicellularity.
37 | P a g e
2.5. Tables and figures
Table 2-1. Nucleotide sequences of primers used in this study
Primer Oligonucleotide 45973_Fw 5'-TCCCAGGGGAGAAGTTGGCCTC-3' 86138_Fw 5'-ACCCCGGCGAGAAGCTCGGAAG-3' 86138_Fw_1 5'-CCACCAAACAAGGCCTTGCGTC-3' 68024_Fw 5'-TGAGGTGGAGATCATCGACCGC-3' 68024_Rv 5’- AGCGCGGGGGAGATCCTTTTG -3’ 68025_Fw 5'-GGAGGTTGAGATCATTGACAAG-3' 68025_Rv 5’- TGCGCGAGGAAGGTCCTTGGA-3’ 68025_Rv_1 5’- GGAAGGGTCCAGATCCGCAGCC -3’ 85282_Fw 5'-AGGCCGAGAAGTCCAGGGCTGATT-3' 85282_Rv 5’- CTTGAGCTGGGCTTGTGTGAC T -3’ 85658_Rv 5'-TGTGACGCAGGCACAACTCAAG-3' 85658_Rv_1 5’- GGCCGAGAAGTCCAGAGCCGAGC -3’ Here, Fw and Rw denotes forward and reverse primers respectively
38 | P a g e
Table 2-2. Identified contigs encoding 100-kDa glucan-binding protein
Corresponding Mascot Predicted E- Organisms Accession no. contigs Score* Protein value 85282__len__259 305 MVP Aplysia californica XP_005108623.1 3e-24
85658__len__261 296 MVP Strongylocentrotus NP_001116989.1 7e-25 purpuratus 45973__len__493 234 MVP Polysphondylium EFA80481.1 3e-60 pallidum 68024__len__724 217 MVP Saccoglossus XP_006815257.1 1e-91 kowalevskii Polysphondylium 86138__len__338 103 MVP EFA80481.1 3e-38 pallidum 68025__len__351 93 MVP Saccoglossus XP_006815257.1 1e-91 kowalevskii 114830__len__222 90 MVP Oscillatoria sp. WP_017716983.1 5e-29
92821__len__66 90 MVP Lottia giganttea XP_009051879.1 3e-05
MVP, Major vault protein *Identity threshold is 65.6. Blast was used to identify the corresponding contigs
39 | P a g e
Table 2-3. MVPs of different organisms with their NCBI GenBank accession numbers
GenBank accession Eukaryotic group Organism number Aplysia californica XM_005108566.2 Mollusca Biomphalaria glabrata XM_013206721.1 (opisthokonta) Crassostrea gigas JH816734.1 Capitella teleta ELU07764.1 Annelida Helobdella robusta ESN94932.1 (Opisthokonta) Biomphalaria glabrata LOC106051537 Branchiostoma floridae GG666503.1 Danio rerio NM_201325.1 Xenopus tropicalis NM_001078825.1 Chordata Xenopus laevis NM_001086470.1 (Opisthokonta) Gallus gallus NC_006115.4 Homo sapiens BC015623.2 Mus musculus NM001006336.1 Echinodermata Strongylocentrotus purpuratus NM_001123517.1 (Opisthokonta) Cnidaria Hydra vulgaris HAD01003807.1 (Opisthokonta) Exaiptasia pallida KXJ17149.1 Stegodyphus mimosarum KK121419.1 Arthropoda Parasteatoda tepidariorum X2 XP_015912406.1 (Opisthokonta) Parasteatoda tepidariorum X1 XP_015912405.1 Parasteatoda tepidariorum X3 XP_015912407.1 Raphidiophrys contractilis MVP-1 Centrohelid heliozoa Raphidiophrys contractilis MVP-2 Amoebozoa Dictyostelium discoideum XP_635368.1 Trypanosoma grayi XM_009309022.1 Excavata Trypanosoma brucei XP_822454.1 Fungi Phytophthora infestans-1 EEY53394.1 (Opisthokonta) Phytophthora infestans-2 XP_002905012.1 Porifera (Opisthokonta) Amphimedon queenslandica XP_01141052.1 Alveolata Paramecium tetraurelia CAK87534.1
40 | P a g e
A Chr
K
A
Fig. 2-1. A light micrograph showing food capturing by Raphidiophrys contractilis. R. contractilis has numerous needle-like axopodia (A) radiating from the spherical cell body, by which food flagellates (Chlorogonium capillatum) are trapped and engulfed into food vacuoles (Chr). Arrows indicate kinetocysts (K) on the axopodia (A). Bar, 10 µm.
Fig. 2-2. Chemical structure of curdlan (β-1,3-glucan) (Cheeseman and Brown Jr, 1995)
41 | P a g e
A B C
Fig. 2-3. Recognition of β-1,3-glucan structures by R. contractilis. Light micrographs showing uptaking of both living and static structures made of β-1,3-glucan. A: an arrow indicates living yeast cell (Saccharomyces cerevisiae) B: zymosan-A (insoluble β-1,3-glucan prepared from the cell wall of S. cerevisiae). C: curdlan (high molecular-weight insoluble polymer of β-1,3-glucan). Bars, 10 µm.
42 | P a g e
1 2 3 4
Fig. 2-4. Isolation of curdlan-binding protein as analyzed by 12% SDS-PAGE. Lane 1:
Negative control (curdlan only). Lane 2: cell lysate of R. contractilis. Lane 3: curdlan- unbound fraction of the cell lysate. Lane 4: curdlan-bound fraction of the cell lysate. A prominent curdlan-binding protein band appeared at around 100 kDa (solid triangle), while open triangles show non-specific bands derived from curdlan gel.
43 | P a g e
Fig. 2-5. Obtained contigs RAC MVP mapping to MVP-like of Saccoglossus kowalevskii.
Box shaded gray and white boxes indicate MVP-like amino-acid sequence of S. kowalevskii and deduced contigs of MVP of RAC1, respectively. Arrowhead and open arrowhead indicate Forward ( ) and Reverse ( ) gene specific primers, respectively, which amplify
MVP gene fragments of RAC1. 1, 45973_Fw; 2, 86138_Fw 3, 86138_Fw_1; 4, 68024_Fw;
5, 68025_Fw; 6, 85282_Fw; 7, 85658_Fw; 8, 68024_Rv; 9, 68025_Rv_1; 10, 68025_Rv; 11,
85282_Rv; 12, 85658_Rv; 13, 85658_Rv_1.
44 | P a g e
A. R. contractilis Major Vault Protein like-1 (RAC MVP-1)
B. R. contractilis Major Vault Protein like-2 (RAC MVP-2)
Fig. 2-6. Full-length transcript sequencing of genes encoding MVP. MVP of R. contractilis showing corresponding contigs constructing MVP-1 (A) and MVP-2 (B) with involved primer sets used for PCR amplification and the 5' and 3' missing ends produced by RACE.
45 | P a g e
Fig. 2-7. RAC MVP-1 cDNA and deduced amino acid sequence. Start codon (ATG) is represented as M and bold letters, whereas stop codon (TAG) is in bold and marked with asterisk.
46 | P a g e
Fig. 2-8. RAC MVP-2 cDNA and deduced amino acid sequence. Start codon (ATG) is represented as M and bold letters, whereas stop codon (TAG) is in bold and marked with asterisk.
47 | P a g e
1 125 250 375 500 625 831
H2N COOH
Major vault protein repeat MVP_shoulder A. Raphidiophrys contractilis MVP-1
1 125 250 375 500 625 750 845
H2N COOH
Major vault protein repeat MVP_shoulder B. Raphidiophrys contractilis MVP-2
1 125 250 375 500 625 750 861 H2N COOH
Major vault protein repeat MVP_shoulder
C. Saccoglossus kowalevskii
1 125 250 375 500 625 750 861 H2N COOH
Major vault protein repeat MVP_shoulder D. Larimichthys crocea 1 125 250 375 500 625 750 833 H2N COOH
Major vault protein repeat MVP_shoulder E. Dictyostelium purpureum 1 125 250 375 500 625 750 825 H2N COOH
Major vault protein repeat MVP_shoulder
F. Polysphondylium pallidum
Fig. 2-9. Structures of major vault proteins in different organisms. A and B: primary structures of MVP-like protein-1 and MVP-like protein-2 of R. contractilis, respectively, with repeated vault units and a shoulder domain. C-F: structure of major vault proteins of Saccoglossus kowalevskii (accession no. XM_006815194), Larimichthys crocea (KKF21095.1), Dictyostelium purpureum (XP_003292154.1), and Polysphondylium pallidum (EFA80481.1), respectively, from NCBI database and Blastp search.
48 | P a g e
Fig. 2-10. Comparison of amino acid sequence of Rattus norvegicus MVP (accession no.
Q62667) and Raphidiophrys contractilis MVP-1 and MVP-2. Here, characters in blue indicate repeated vault units, violet characters indicate MVP shoulder domain where red bold letters showed the oligomer interfaces (polypeptide binding site). Identity score of R. norvegicus MVP with RAC MVP-1 is 57% and with RAC MVP-2 is 56%. Identity between
RAC MVP-1 and MVP-2 is 86%.
49 | P a g e
Fig. 2-11. Neighbor-joining phylogenetic tree of the amino acid sequences of MVPs from different species. The GenBank accession numbers used to construct the phylogenetic tree of these species proteins are given in table 2-3. The R. contractilis MVP-1 and MVP-2 are indicated as bold, italic form. Bar (0.05) indicates the genetic distance.
50 | P a g e
A B
1 2 1 2
MVP
Fig. 2-12. SDS-PAGE and Western blot confirmation of R. contractilis Major Vault Protein
(MVP). Picture B is the corresponding Western blot film of the SDS-PAGE gel as shown in
A. Here, lane 1 indicates the whole cell extract of R. contractilis and lane 2 denotes curdlan bound preparation. The 100 kDa MVP is observed distinctly in the film (B; lane 1, 2) and lane 2 in the gel plate. In Western Blot film some other faint protein bands are observed in the whole cell homogenate (lane 1) part. These proteins were cytoplasmic proteins and reacted with anti-MVP antibody against human MVP.
51 | P a g e
Curdlan + Curdlan laminarin kDa
200 150 120 100 85 70 60 50 40
30 25 20
Fig. 2-13. A silver-stained SDS-PAGE gel, showing competitive inhibition of glucan binding of RAC MVP by laminarin. The left lane shows a curdlan-binding MVP band, while it became reduced in the right lane where the cell lysate was pretreated with laminarin (soluble
β-1,3 glucan) prior to the addition of curdlan gel.
52 | P a g e
Fig. 2-14. Protein profile of the food-induced and curdlan-binding fraction and detection of
MVP by Western blotting. Extracellular fluid was collected immediately after a cell suspension of Raphidiophrys contractilis was mixed with prey flagellate Chlorogonium capillatum, and curdlan-binding fraction was subjected to SDS-PAGE (lane 1) and Western blotting using anti-human MVP antibody (lane 2). A triangle shows the position of MVP. In addition to MVP, many other proteins were found to be secreted from the heliozoan, suggesting many proteins form a complex with MVP and co-precipitated by the curdlan gel.
53 | P a g e
Fig. 2-15. Protein profile of the food-induced proteins released from R. contractilis. Lane 1 showing the extracellular fluid obtained without addition of Chlorogonium cells after pull- down purification with curdlan gel (negative control). No distinct band was observed. Lane 2 indicates extracellular fluid collected after food-induction, followed by co-precipitated with curdlan gel. In lane 2, boxed protein bands were subjected to mass spectrometry analysis and arrow indicated top-hit proteins obtained through NCBI Blast search.
54 | P a g e
2+ kDa Cell Ca 2+ 2+ 2+ lysate Curdlan Ca Mg & Mg 200
100
60 50 40
30 25 20
15
Fig. 2-16. Effect of Ca2+ and Mg2+ on the glucan binding of RAC MVP. Lane 1, cell lysate; lane 2 indicates MVP co precipitated with curdlan (glucan) as a control; lane 3, 4, 5 denotes co precipitation of MVP with curdlan in presence of Ca2+ (11 mM) , Mg2+ (11 mM) and both
(Ca2+ + Mg2+) together concentration of 10.5 mM each. No inhibitory effect of Ca2+ and Mg2+ observed on the glucan binding of MVP.
55 | P a g e
A B
Fig. 2-17. Immunofluorescence micrographs of a R. contractilis cells A: Bright field micrograph showing small granules surrounding the cell body, as indicated by arrow. B:
Fluorescence image of the same cell, showing localization of MVP as bright fluorescence at the granules at the periphery of the cell body of R. contractilis.
56 | P a g e
A B
Fig. 2-18. Transmission electron micrographs of localization of MVP in R. contractilis cells.
A and B. Globular kinetocysts (arrow) are labelled with protein A gold (arrowheads) Bars,
100 nm and 500 nm, respectively.
57 | P a g e
Chapter 3: Concluding remarks and future perspectives
From the present research, it was established that major vault proteins (MVPs) of the centrohelid heliozoon Raphidiophrys contractilis (RAC) are β-1,3-glucan-binding proteins.
Further characterization of the glucan binding nature of MVP and identification of receptor proteins for MVP on the surface of RAC cells are required in the future at the molecular level. Experimental results revealed that RAC MVP is released outside the cells as a complex with other proteins. The molecular architecture of the complex and its relationship between the vault complex is also to be examined. Determination of the glucan-binding site of MVP may be achieved by partial digestion and/or producing recombinant proteins.
Receptor protein to RAC-MVPs are presumed to be present on the surface of RAC for inducing phagocytosis of the prey cells. Isolation and determination of receptor proteins from the cell surface of RAC may be achieved by using chemical cross-linking and mass spectrometry procedures.
Here, I presented evidence that MVP of RAC is secreted outside the cell from kinetocysts. The exact localization of vault in the kinetocyst structure is to be determined in the future. The ultrastructure of the kinetocyst of RAC is composed of a bipartite central element (core) enclosed by a jacket of stacked disks. Both are covered with a mushroom- shaped cap structure that is associated with the surrounding membrane at its tapered edges. It was observed that during prey capture kinetocysts expel some material towards prey organisms. After discharge, the core part was strongly adhered to the RAC cell surface, whereas jacket and other parts spread out. The distal end of the core was often observed to be connected to or fused with the cell surface of the prey (Sakaguchi et al., 2002). Therefore, it is predicted that MVP may be located at either the core part or the jacket part.
Numerous predatory protozoans feed on other protozoans for their survival.
Sometimes they also feed their own clones due to starvation. So, it is necessary for protozoan
58 | P a g e species to differentiate between self and non-self for avoiding cannibalism. For instance, in
Amoeba proteus, self/nonself recognition is mediated by a small protein named A-factor
(Kusch, 1999). In some other protozoan species, on the contrary, it is sometimes necessary to capture and ingest their own clones for survival, for example in Blepharisma (Giese, 1938), indicating that these ciliates have an elaborate ability to switch objects to capture according to various environmental conditions. Still it is necessary for most of the protozoan species, including RAC, to discriminate between self and non-self for correct targeting of prey. In this study, it was found that RAC reacts to glucan molecules to cause predation behavior, but
RAC may also be reactive to biomolecules other than glucan. In future it is necessary to broadly search the repertoire of substances that RAC can recognize as bait and to clarify all details of the predation mechanism of RAC.
The most unexpected outcome of my research was the fact that MVP, which was believed to be present in the cytoplasm, has been secreted extracellularly at least in RAC and is used to capture food. As already mentioned in the Discussion section, the function of MVP like this may have been the basic function of MVP that a primitive eukaryotic ancestor had.
In the process of multicellularization of organisms, such functions become unnecessary, and
MVP may have acquired other functions. Therefore, elucidating the molecular evolution of
MVP may provide hints to clarify the mechanism of early evolution of eukaryotes. For that purpose, it will be necessary to comprehensively examine the glucan cognitive ability of
MVP of predatory protists other than RAC.
59 | P a g e
References
Aderem, A., Ulevitch, R., 2000. Toll-like receptors in the induction of the innate immune
response. Nature. 406, 782-787.
Bardele, C.F., 1976. Particle movement in heliozoan axopods associated with lateral
displacement of highly ordered membrane domains. Z. Naturforsch. 31, 190–194.
Barras, D.R., Stone, B.A., 1968. Carbohydrate composition and metabolism in Euglena. In
The Biology of Euglena (Buetow DE, ed.),. Academic Press, New York, NY. pp.
149–191.
Berger, W., Steiner, E., Grusch, M., Elbling, L., Micksche, M., 2009.Vaults and the major
vault protein: novel roles in signal pathway regulation and immunity. Cell Mol Life
Sci. 66,43–61.
Begum, N., Matsumoto, M., Tsuji, S., Toyoshima, K., Seya, T., 2000. The primary host
defense system across humans, flies and plants. Current Trends in Immunology. 3,
59-74.
Begum, W., Steiner, E., Grusch, M., Elbling, L., Micksche, M., 2009. Vaults and the major
vault protein: Novel roles in signal pathway regulation and immunity. Cell. Mol.
Life Sci. 66, 43 – 61.
Beschin, A., Bilej, M., Hanssens, F., Raymakers, J., Van Dyck, E., Revets, H., Brys, L.,
Gomez, J., De Baetselier, P., Timmermans, M., 1998. Identification and cloning of a
glucan- and lipopolysaccharide-binding protein from Eisenia foetida earthworm
involved in the activation of prophenoloxidase cascade. J. Biol. Chem. 273, 24948-
24954.
Boenigk, J., Arndt, H., Cleven, E.J., 2001. The problematic nature of fluorescently labelled
bacteria (FLB) in Spumella feeding experiments- an explanation by using video
microsopy. Arch. Hydrobiol. 152, 329-338.
60 | P a g e
Bruhn, H., Beate R.B., Berninghausen, O., Leippe, M., 2003. Amoebapores and NK-lysin,
members of a class of structurally distinct antimicrobial and cytolytic peptides
from protozoa and mammals: a comparative functional analysis. Biochem J.
375(3), 737–744.
Buchmann, K., 2014. Evolution of innate immunity: Clues from invertebrates via fish to
mammals. Front. Immunol. 5, 459.
Burgoyne, R.D., Morgan, A., 1998. Calcium sensors in regulated exocytosis. Cell Calcium.
24, 367-376.
Buscaglia, C.A., Di Noia, J.M., 2003. Trypanosoma cruzi clonal diversity and the
epidemiology of Chagas’ disease. Microbes Infec. 5, 419–427.
Cavalier-Smith, T., Chao, E.E., Lewis, R., 2015. Multiple origins of Heliozoa from flagellate
ancestors: New cryptist subphylum Corbihelia, superclass Corbistoma, and
monophyly of Haptista, Cryptista, Hacrobia and Chromista. Molecular
Phylogenetics and Evolution 93, 331–362.
Cerenius, L., Liang, Z., Duvic, B., Keyser, P., Hellman, U., Palva, T., Iwanaga, S., Söderhӓll,
K., 1994. Structure and biological activity of a 1,3-β-D-glucan –binding protein in
crustacean blood. J. Biol. Chem. 269, 29462-29467.
Chaosomboon, A., Phupet, B., Rattanaporn, O., Runsaeng, P., Utarabhand, P., 2017.
Lipopolysaccharide- and β-1,3-glucan-binding protein from Fenneropenaeus
merguiensis functions as a pattern recognition receptor with a broad specificity for
diverse pathogens in the defense against microorganisms. Developmental and
Comparative Immunology. 67, 434-444.
Chaplin, D.D. 2010. Overview of the immune response. J Allergy Clin Immunol. 125(2), S3-
23. doi: 10.1016/j.jaci.2009.12.980.
61 | P a g e
Chaves, M.A., Sequeira, T., 2000. Is there any kind of adaptive immunity in invertebrates?
Aquaculture 191, 247–258.
Cheeseman, I.M., Brown Jr, R.M., 1995. Microscopy of curdlan structure. Howard Hughes
Molecular Biology Summer Research Program Poster, Austin, TX.
Cooper, E.L., 2010. Evolution of immune systems from self/not self to danger to artificial
immune systems (AIS). Phys. Life. Rev. 7, 55-78. Doi:
10.1016/j.plrev.2009.12.001.
Daly, T.K., Andrew, J., Smith, S., Penny, D., 2013. In silico resurrection of the major vault
protein suggests it is ancestral in modern eukaryotes. Genome Biol. Evol. 5(8),
1567-1583.
Dziarski, R., Gupta, D., 2006. The peptidoglycan recognition proteins (PGRPs). Genome
Biology. 7, 232.
Dzik, J.M., 2010. The ancestry and cumulative evolution of immune reactions. Acta.
Biochim. Pol. 57, 443-66.
Fabrick, J.A., Baker, J.E., Kanost, M.R., 2004. Innate immunity in a pyralid moth. Functional
evaluation of domains from a β-1,3- glucan recognition protein. J. Biol. Chem. 279,
26605-26611.
Felsenstein, J., 1985. Phylogenies and the comparative method. Am. Naturalist. 125, 1-15.
Fukushima, K., Okai, Y., Matsuura, S., Tsujimoto, H., Endo. Y., 2006. Molecular cloning of
feline lung resistance-related protein (LRP) cDNA and its expression in a feline
lymphoma cell line and adriamycin-resistant subline. J. Vet. Med. Sci. 68(8), 885–
890.
Giese, A., 1938. "Cannibalism and Gigantism in Blepharisma". Transactions of the American
Microscopical Society. 57 (3), 245–255.
62 | P a g e
Gopinath, S.C., Matsugami, A., Katahira, M., Kumar, P.K., 2005. Human vault-associated
non-coding RNAs bind to mitoxantrone, a chemotherapeutic compound. Nucleic
Acids Res. 33, 4874-4881.
Hamill, D.R., Suprenant, K.A., 1997 Characterization of the sea urchin major vault protein - a
possible role for vault ribonucleoprotein particles in nucleocytoplasmic transport.
Developmental Biology. 190, 117-128.
Harumoto, T., Miyake A., 1991. Defensive function of trichocysts in Paramecium. J. Exp.
Zool. 260, 84-92.
Hausmann, K., 1978. Extrusive organelles in protists. Intl. Rev. Cytol. 52, 197-276.
Hausmann, K., 2002. Food acquisition, food ingestion and food digestion by protists. Jpn. J.
Protozool. 35(2), 85-95.
Hausmann, K., Hülsmann, N., 1996. Protozoology, 2nd ed. Georg Thieme Verlag, Stuttgart.
Herrmann, C., Volknandt, W., Wittich, B., Kellner, R., Zimmermann. H., 1996. The Major
vault protein (MVP100) is contained in cholinergic nerve terminals of electric ray
electric organ. J. Biol. Chem. 271(23), 13908–13915.
Hirokawa, T., Boon-Chieng, S., Mitaku, S., 1998. SOSUI: classification and secondary
structure prediction system for membrane proteins. Bioinformatics. 14 (4), 378-9.
Holt, R.G., Latha R., 2000. Signal sequence and alanine-rich region of streptococcal protein
antigen A of Streptococcus sobrinus can direct localization of alkaline phosphatase
to the periplasm of Escherichia coli. FEMS Microbiology Letters 184, 17-21.
Ishida, M., Allen, R.D., Fok, A.K., 2001. Phagosome formation in Paramecium: Roles of
somatic and oral cilia and of solid particles as revealed by video microscopy. J. Euk.
Microbiol. 48(6), 640-646.
Iwanaga, S., Lee, B.L., 2005. Recent advances in the innate immunity of invertebrate
animals. J. Biochem. Mol. Biol. 38(2), 128-150.
63 | P a g e
Kakuta, S., 2008. Analysis of the feeding behavior and related proteins in the heliozoon
Actinophrys sol. http://www.lib.kobe-u.ac.jp/repository/thesis/d1/D1004184.pdf.
Kakuta, S. and Suzaki, T., 2008. Ca2+- and glycoconjugates-dependent prey capture in the
heliozoon Actinophrys sol. Eur. J. Protistol., 44: 163-167.
Kedersha, N.L., Rome, L.H., 1986. Isolation and characterization of a novel
ribonucleoprotein particle: large structures contain a single species of small RNA. J
Cell Biol. 103, 699-709.
Kickhoefer, V.A., Rome, L.H., 1994. The sequence of a cDNA encoding the major vault
protein from Rattus norvegicus. Gene. 151, 257- 260.
Kickhoefer, V.A, Searles, R.P., Kedersha, N.L., Garber, M.E, Johnson, D. L., Rome, L.H.,
1993. Vault ribonucleoprotein particles from rat and bullfrog contain a related small
RNA that is transcribed by RNA polymerase III. J Biol Chem. 268, 7868-7873.
Kickhoefer, V.A, Siva, A.C, Kedersha, N.L, Inman, E.M, Ruland, C., Streuli, M., Rome, L.
H., 1999a. The 193-kD vault protein, VPARP, is a novel poly (ADP-ribose)
polymerase. J Cell Biol. 146, 917-928.
Kickhoefer, V.A, Stephen, A.G, Harrington, L., Robinson, M.O, Rome, L.H., 1999b. Vaults
and telomerase share a common subunit, TEP1. J Biol Chem. 274, 32712-32717.
Kollar, R., Reinhold, B.B., kova, E.P., Yeh, H.J.C., Ashwell, J., Drgonova, J., Kapteyn, J.C.,
Klis, F.M. and Cabib, E., 1997. Architecture of the yeast cell wall. β (1,6)-glucan
interactions mannoprotein, β(1,3)-glucan, and chitin. The J. of Biol. Chem. 272
(28), 17762–17775.
Kolli. S, Zito, C.I, Mossink, M.H, Wiemer, E.A, Bennett, A.M. 2004. The major vault protein
is a novel substrate for the tyrosine phosphatase SHP-2 and scaffold protein in
epidermal growth factor signaling. J. Biol. Chem. 279 (28), 29374-85.
64 | P a g e
Kowalski, M.P, Dubouix-Bourandy, A., Bajmoczi, M., Golan, D.E., Zaidi, T., Coutinho-
Sledge, Y.S., Gygi, M.P., Gygi, S.P., Wiemer, E.A., Pier, G.B., 2007. Host
resistance to lung infection mediated by major vault protein in epithelial cells.
Science. 317, 130317(5834), 130-2.
Kusch, J., 1999. Self-recognition as the original function of an amoeban defense including
kairomone. Ecology. 80, 715-720.
Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature. 227(5259), 680-685.
Lee, S.Y., Wang, R., Söderhӓll, K., 2000. A lipopolysaccharide and β-1, 3-glucan binding
protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus.
Purification, characterization and cDNA cloning. J. Biol. Chem. 275 (2), 1337-
1343.
Liu, Y., Liu, J., Pang, X., Liu, T., Ning, Z., Cheng, Z., 2015. The roles of direct recognition
by animal lectins in antiviral immunity and viral pathogenesis. Molecules. 20, 2272-
2295.
Luporini, P., Miceli, C., 1986. in The molecular biology of ciliated protozoa (Gall, J.C., ed.),
263-299, Academic Press.
Matsumoto-Nakano, M., Tsuji, M., Amano, A., Ooshima, T., 2008. Molecular interactions of
alanine-rich and proline-rich regions of cell surface protein antigen c in
Streptococcus mutans. Oral Microbiol Immunol. 23, 265–270.
Matsuoka, T., Shigenaka, Y. 1984. Localization of calcium during axopodial contraction in
heliozoan, Echinosphaerium akamae. Biomed. Res. 5, 425-432.
Medzhitov, R., Janeway, C. A., 1997. Innate Immunity: Impact on the adaptive immune
response. Current opinion in Immunology. 9, 4-9.
65 | P a g e
Medzhitov, R., Janeway, C. Jr., 2000. Innate immune recognition: mechanisms and pathways.
Immunol. 173, 89-97.
Mishima, Y., Quintin, J., Aimanianda, V., Kellenberger, C., Coste, F., Clavaud, C., Hetru, C.,
Hoffmann, J. A., Latge, J. P., Ferrandon, D., Roussel, A., 2009.The N-terminal
domain of Drosophila gram-negative binding protein 3 (GNBP3) defines a novel
family of fungal pattern recognition receptors. J. Biol. Chem. 284 (42), 28687–
28697.
Miyake, A., 1981. In Biochemistry and physiology of protozoa (Levandowsky, M. and
Hutner, S.H., eds), 125-198, Academic Press.
Nei, M., Kumar, S., 2000. Molecular evolution and phylogenetics. Oxford University Press,
New York.
Ochiai, M., Ashida, M., 2000. A pattern-recognition protein for β-1,3-glucan. The binding
domain and the cDNA cloning of β-1,3glucan recognition protein from the
silkworm, Bombax mori. The Journal of Biol. Chem. 275(7), 4995-5002.
Paspalas, C.D., Perley, C.C., Venkitaramani, D. V., Goebel-Goody, S.M., Zhang, Y., Kurup,
P., Mattis, J.H., Lombroso, P.J., 2009. Major vault protein is expressed along the
nucleus-neurite axis and associates with mRNAs in cortical neurons. Cereb Cortex.
19(7), 1666-77.
Patterson, D.J., Hausmann, K., 1981. Feeding by Actinophrys sol. (Protista, Heliozoa): 1 light
microscopy. Microbios. 31, 39-55.
Perina, D., Mikoc, A., Ahel, J., Cetkovic, H., Zaja, R., Ahel, I., 2014. Distribution of protein
poly (ADP-ribosylation systems across all domains of life. DNA repair. 23, 4-16.
Plattner, H., Kissmehl, R. 2003. Dense-core secretory vesicle docking and exocytotic
membrane fusion in Paramecium cells. Biochim. Biophys. Acta. 1641, 183-193.
66 | P a g e
Poderycki, M.J., Kickhefer, V.A., Kaddis, C.S., Fernandes, S.R., Johansson, E., Zink, J.I.,
Loo, J.A., Rome, L.H., 2006. The vault exterior shell is a Dynamic structure that
allows incorporation of vault associated proteins into its interior. Biochemistry.
45(39), 12184-12193.
Rahar, S., Swami, G., Nagpal, N., Nagpal, M.A., and Singh, G.S. 2011. Preparation,
characterization, and biological properties of β-glucans. J Adv Pharm Technol Res.
2(2), 94–103.
Reynolds, E.S., 1963. The use of lead citrate at high pH as an electron-opaque stain in
electronmicroscopy. J Cell Biol. 17(1), 208–212.
Sakaguchi, M., Suzaki, T., 1999. Monoxenic culture of the heliozoon Actinophrys sol. Europ.
J. Protistol. 35, 411-415.
Sakaguchi, M., Hausmann, K., Suzaki, T., 1998. Food capture and adhesion by the heliozoon
Actinophrys sol. Protoplasma. 203, 130-137.
Sakaguchi, M., Suzaki, T., Khan, S. M. M. K. and Hausmann, K., 2002. Food capture by
kinetocysts in the heliozoon Raphidiophrys contractilis. Europ. J. Protistol. 37, 453-
458.
Sakaguchi, M., Murakami, H., Suzaki, T., 2001. Involvement of a 40-kDa glycoprotein in
food recognition, prey capture, and induction of phagocytosis in the protozoon
Actinophrys sol. Protist. 152, 33-41.
Scheffer, G. L., Wijngaard, P.L.J., Flens, M.J., Izquierdo, M.A., Slovak, M.L., Pinedo, H.
M., Meijer, C.J.L.M., Clevers, H.C., Scheper, R.J. 1995. The drug resistance-related
protein LRP is the human major vault protein. Nature Medicide. 1(6), 578- 582.
Scheffer, G.L., Schroeijers, A.B., Izquierdo, M.A., Wiemer, E.A., Scheper, R.J., 2000. Lung
resistance-related protein/major vault protein and vaults in multidrug-resistant
cancer. Curr Opin Oncol. 12, 550-556.
67 | P a g e
Stambolic, V., Suzuki, A., de la Pompa, J.L., Brothers, G.M., Mirtsos, C., Sasaki, T., Ruland,
J., Penninger, J.M., Siderovski, D.P., Mak, T.W., 1998. Negative regulation of PKB
⁄Akt-dependent cell survival by the tumor suppressor PTEN. Cell. 95, 29–39.
Steiner, E., Holzmann, K., Pirker, C., Elbling, E., Micksche, E., Sutterlüty, H., Berger, W.,
2006. The major vault protein is responsive to and interferes with interferon-γ-
mediated STAT1 signals. J. Cell. Sci. 119, 459-469.
Stewart, P.L., Makabi, M., Lang, J., Dickey-Sims, C., Robertson, A.J., Coffman, J.A.,
Suprenan, K.A., 2005. Sea urchin vault structure, composition, and differential
localization during development. BMC Developmental Biology. 5(3), 1-12.
Suzaki, T., Shigenaka, Y., Watanabe, S., Toyohara, A. 1980. Food capture and ingestion in
the large heliozoan, Echinosphaerium nucleofilum. J. Cell. Sci. 42, 61-79.
Takeda, K., Akira, S., 2005. Toll-like receptors in innate immunity. International
Immunology. 17(1), 1–14.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular
evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30(12), 2725–2729.
Tanaka, H., Kato, K., Yamashita, E., Sumizawa, T., Zhou, Y., Yao, M., Iwasaki, K.,
Yoshimura, M., Tsukihara, T., 2009. The structure of rat liver vault at 3.5 angstorm
resolution. Science. 323, 384-387.
Tanaka, H., Tsukihara, T., 2012. Structural studies of large nucleoprotein particles, vaults.
Proc. Jpn. Acad., Ser. B. 88, 416-45.
Tanaka, Y., Ogawa, Y., Maruta, T, Yoshida, Y., Arakawa, K., Ishikawa, T., 2017. Glucan
synthase-like 2 is indispensable for paramylon synthesis in Euglena gracilis. 2017.
FEBS Press. 591, 1360-1370.
Vargas-Albores, F., Yepiz-Plascencia, G., 2000. Beta glucan binding protein and its role in
shrimp immune response. Aquaculture. 191, 13-21.
68 | P a g e
Vargas-Albores, F., Guzman-Murillo, M.A., Ochoa, J.L., 1993. An anticoagulant solution for
haemolymph collection and prophenoloxidase studies of Penaeid shrimp (Penaeus
californiensis). Comp.Biiochem. Physiol. 106A, 299-303.
Vasu, S.K., Kedersha, N.L., Rome, L.H., 1993. cDNA cloning and disruption of the major
vault protein alpha gene (mvpA) in Dictyostelium discoideum. The J. of Biol. Chem.
268, 15356-15360.
Vollmar, F., Hacker, C., Zahedi, R.P., Sickmann, A., Ewald, A., Scheer, U., Dabauvalle,
M.C., 2008. Assembly of nuclear pore complexes mediated by major vault protein.
Journal of Cell Science. 122, 780-786.
Yabuki, A., Chao, E.E., Ishida, K., Cavalier-Smith, T., 2012. Microheliella maris
(Microhelida ord. n.), an ultrastructurally highly distinctive new axopodial protist
species and genus, and the unity of phylum Heliozoa. Protist 163, 356–388.
Yoshida, H., Kinoshita, K., Ashida, M., 1996. Purification of a peptidoglycan recognition
protein from hemolymph of the silkworm, Bombyx mori. J. Biol. Chem. 271, 13854-
13860.
Yu, Z., Fatouhi-Ardakani. N., Wu, L., Maoui, M., Wang, S., Banville, D., Shen, S.H., 2002.
PTEN associates with the vault particles in HeLa cells. J Biol Chem. 277, 40247-
40252.
69 | P a g e