1 Supplemental Methods for Supplemental Figure 1: RNA

Supplemental Methods for Supplemental Figure 1: RNA extraction and cDNA synthesis Total RNA was extracted from FDC-P1 cells using an RNeasy Mini kit, as per manufacturer’s instructions (QIAGEN Pty Ltd.). Briefly, 1 x 106 cells were washed in PBS and lysed in 600 μl Buffer RLT. The lysate was homogenised by centrifugation at 16,000 x g for 2 min in a QIAshredder spin column and 600 μl of 70% EtOH was added to the lysate. The mixture was then transferred to an RNeasy spin column which was centrifuged for 15 seconds at 16,000 x g. The column was washed in 350 μl Buffer RW1 and the membrane incubated for 15 minutes in DNAse I to remove contaminating DNA. The column was washed again in 350 μl Buffer RW1, then 2x with 500 μl Buffer RPE. The RNA was eluted in 50 μl RNase free water and quantified on a spectrophotometer. To make cDNA, 10 μg of RNA in 20 μl DEPC- water was incubated with 0.5 μg/ml oligo dT (Sigma Genosys) at 65oC for 10 minutes to allow for primer annealing. For reverse transcription the RNA was divided into two tubes and incubated at 42oC for 1.5 hours with 10 μl master mix including 10 U RNase inhibitor, 0.5 mM dNTPs and either 1 U M-MLV reverse transcriptase (Promega) or 1 μl water for the negative control. The enzyme was inactivated at 70oC for 10 minutes, after which time the samples were diluted with 180 μl DEPC-water and stored at - 20oC. Quantitative real-time PCR (qRT-PCR) Oligonucleotide primers that detect individual PP2A subunit isoforms (Sigma Genosys) are presented in Table 1. Each 12.5 μl qRT-PCR reaction was prepared using the Power SYBR® Green PCR Master Mix (Applied Biosystems) and contained 1μl cDNA with 4 pM primer. All qRT-PCR experiments were performed using the 7500 1 Real Time PCR System (Applied Biosystems). Triplicate reactions were performed for each run on four repeats from two RNA isolations. Thermal cycling conditions consisted of 50oC for 2 minutes, initial heating at 95 oC for 10 minutes, followed by 40 cycles of 95 oC for 15 seconds and 60 oC for 1 minute. Ribosomal protein S18 (RPS18) was chosen as the reference gene based on preliminary experiments which confirmed its expression remained constant between the FDC-P1 cell lines. In addition, a standard curve of 10-fold serial cDNA dilutions was routinely included to monitor the reaction efficiency between plates. For analysis of fold changes in PP2A gene expression compared to FDC-P1 empty vector cells, the following comparative quantification algorithms were used: 1. CtGene of interest - CtRPS18 = Avg ΔCT 2. Avg ΔCTtest cell line – Avg ΔCTEV cell line = ΔΔCT 3. Fold difference (relative to FDC-P1 EV)= 2-ΔΔCT 2 Table 1. Quantitative real-time PCR primers Primer Gene Accession Primer Sequence 5’ 3’ F - TAGCCTTTGCCATCACTGCC RPS18 NM 022331 R - CATGAGCATATCTTCGGCCC NM 002715 F - CTTGTAGCTCTTAAGGTTCG PPP2CA R - TCTGCTCTCATGATTCCCTC PPP2CB NM 004156 F - TTCTTGTAGCATTAAAGGTGCG R - TCCCATACTTTCGCAGACAT NM 014225 F - GCTCTTCTGCATCAATGTGCT PPP2R1A R - ATGCGCAGAACCGTGGGTA NM 002716 F - ACTTTATTCTGCATTAATGCACT PPP2R1B R - TGGGCAGCATTTGCTTAGTA NM 002717 F - CTGTGGAAACATACCAGGTG PPP2R2A R - AACACTGTCAGATCCATTCC NM 018461 F - AACGGTTCGGATAGCGCCA PPP2R2D R - GCGTGTCTCTATCAAACATC NM 006243 F - TTGTTTCATGCTCAGCTAGC PPP2R5A R - GGCTCTGTTAGTGTTGTATC NM 006244 F - ACTCTGACAGAGCACGTGAT PPP2R5B R - GAAACATCACCTCCTTCTGG NM 002719 F - TGGCCTCATCTACAGCTTGT PPP2R5C R - GGTTGGAAATCTGGAGACTCT NM 006245 F - ACTGAGGCTGTTCAGATGCT PPP2R5D R - CGCAGCAGCACTTTCTCCT NM 006246 F - TCAGATCGTCAGCGTGAGA PPP2R5E R - CTCTTTAACTCCAGATCCTC NM 002718 F - TTGCGGTCCAGAAGGATGT PPP2R3A R - ACAAGCGTCTCATACTCCTC NM 178001 F - ATGTATAAGGCCGAGTGCCT PPP2R4 R - TCCCGAACTTGAAGTGCTG 3 .

Load more