IMPACT OF THE POLY(A) LIMITING ELEMENT ON MRNA 3’ PROCESSING EFFICIENCY AND

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of

Philosophy in Graduate School of The Ohio State University

By Jing Peng, M.A.

∗∗∗∗∗

The Ohio State University 2004

Dissertation Committee: Approved by

Professor Daniel R. Schoenberg, Advisor

Professor Kathleen A. Boris-Lawrie

Professor Lee F. Johnson

Professor Michael C. Ostrowski Advisor Graduate Program in the Ohio State Biochemistry Program

1

ABSTRACT

The poly(A)-limiting element (PLE) is a cis-acting sequence whose

presence in the terminal results in the addition of a short, discrete <20 nt poly(A) tail on reporter mRNA. This study has examined the 3’ processing and translation efficiencies of PLE-containing mRNAs with short poly(A) tails. In cells transfected with the human β-globin reporter with or without a PLE, the

PLE increases the accumulation of β-globin mRNA in both nuclear and

cytoplasmic RNA fractions. Quantitative RT-PCR and RNase protection assays

showed that the PLE increases pre-mRNA 3’ cleavage in vivo to the same

degree that it increases the amount of β-globin mRNA. Moreover, in vitro

cleavage assays also indicated that the PLE enhances 3’ processing efficiency.

Thus, in addition to restricting the length of the poly(A) tail to <20 nt, the PLE also acts as an enhancer of pre-mRNA 3’ processing.

A firefly luciferase reporter was used to examine the translation efficiency of PLE-containing mRNAs with short poly(A) tails. In transfected cells,

PLE-containing mRNA with a <20 nt poly(A) tail associated with polysomes and was translated as well as the matching control mRNA with a long poly(A) tail.

The impact of the PLE and poly(A) tail length on translation in vitro was examined using a cap- and poly(A)-dependent in vitro translation system

ii prepared from HeLa cells. In vitro the presence of a PLE did not overcome the

negative effect of a short poly(A) tail on translation. A similar result was

observed for capped and polyadenylated mRNAs directly transfected into cells,

suggesting that a nuclear processing event facilitates PLE-stimulated translation

of short poly(A) mRNA. The addition of the PLE-binding did not selectively enhance the translation of PLE-containing mRNAs with short poly(A) tails in vitro. However, selective PLE-enhanced translation of short poly(A) mRNA was observed in vitro when PABP activity was inhibited. Although the translation of PLE-containing mRNAs was still less efficient than that observed in vivo, these data indicate that the PLE functionally substitutes for bound PABP to stimulate translation of short poly(A) mRNA.

iii

Dedicated to all of the people who supported me through this work.

iv ACKNOWLEDGMENTS

I wish to express my appreciation to my advisor and mentor, Dr. Daniel R.

Schoenberg, whose advice and encourage have been essential to my

development as a scientist. He has taught me how to think critically and has

given me motivation and support throughout my training.

I would like to thank the members of my dissertation committee, Dr.

Kathleen Boris-Lawrie, Dr. Lee Johnson, and Dr. Michael Ostrowski for their

support, encouragement and stimulating discussions.

I want to thank Dr. Nahum Sonenberg and Dr. Reinhard Lϋhrmann for

providing reagents.

I would like to thank my colleague Dr. Beth Murray for sacrificing her

leisure time to edit this dissertation. I also want to thank all the Schoenberg Lab

members who have educated and inspired me, including Joy, Rob, Venk,

Changhong, Feng, Emily, Yan, Ravi, Yong, Jennifer, Noah, Yuichi, Merlin, and

especially Kris, Mark, Haidong and Kirsten who have taught me so much.

I would like to thank my husband Dong Xie, my mother Li Tang and father

Xiaotang Peng for their unconditional love and support.

I want to thank the Ohio State Biochemistry Program for its support and

the NIH for funding.

v

VITA

July 23, 1975 …………………………Born – Guiyang, P. R. China

1992 – 1996 ………………………… B.S. Microbiology, Nankai University

1996 – 1998 ………………………… M.A. Biochemistry, Temple University

1998 – present ……………………… Graduate Research Associate, The Ohio State University.

FIELDS OF STUDY

Major Field: Ohio State Biochemistry Program

vi TABLE OF CONTENTS

Page

ABSTRACT……………………………………………………………………………...ii

DEDICATION……………………………………………………………………….…..iv

ACKNOWLEDGMENTS…………………………………………………………….….v

VITA……………………………………………………………………………………...vi

TABLE OF CONTENTS………………………………………………………………vii

LIST OF TABLES………………………………………………………………..……xiii

LIST OF FIGURES……………………………………………………………………xiv

ABBREVIATIONS……………………………………………………………………xvi

CHAPTERS:

1. INTRODUCTION………………………………………………..1

1.1 Formation of the poly(A) tail: 3’ end processing………....….2 1.1.1 Mammalian cleavage/…………………....…..3 1.1.1.1 Mammalian cleavage/polyadenylation signal…………..…….3 1.1.1.2 Mammalian cleavage/polyadenylation machinery…..…..…..6 1.1.1.2.1 Cleavage/polyadenylation specific factor (CPSF)……..….....6 1.1.1.2.2 Cleavage stimulation factor (CstF)………………………….…7 1.1.1.2.3 Cleavage factors Im and IIm (CF Im and CF IIm)……….…..….8 1.1.1.2.4 Poly(A) polymerase (PAP)…………………………………...... 8 1.1.1.2.5 Poly(A) binding N1 (PABPN 1)…………………….....9 1.1.1.2.6 The C-terminal domain of RNA polymerase II (CTD of RNAP II)………………………………………………………....9 1.1.1.3 The process of 3’ end formation in mammalian cells……...10 1.1.2 Yeast cleavage/polyadenylation………………………….….11 1.1.2.1 Yeast polyadenylation signal …………………………….…..11 1.1.2.2 Yeast cleavage/polyadenylation machinery………………...11 1.1.2.3 The process of 3’ end formation in yeast cells……………..15

vii 1.2 Poly(A) tail and translation initiation: circular translation model……………………………………………………….…..16 1.2.1 General pathway of translation initiation……………………17 1.2.2 Three key protein factors in the circular translation Model………………………………………………...……….…18 1.2.2.1 The cap binding protein: eIF4E……………………...……….18 1.2.2.2 The scaffold protein: eIF4G……………………………..……19 1.2.2.3 The Poly(A) binding protein: PABP.………..……….….……20 1.2.3 Circularization of translating mRNAs………………..………22 1.2.4 Translation of poly(A)-deficient histone mRNA………..……24 1.2.5 Translational control at the cap-eIF4E-eIF4G-PABP- poly(A) interface.…………………………………………….…26 1.2.5.1 eIF4E binding proteins (4E-BPs)…………………………….26 1.2.5.2 PABP interacting proteins (Paip)………………………….…26 1.2.5.3 Cytoplasmic polyadenylation mediated translational control…………………………………………………………..27 1.2.5.4 Viral infection…………………………………………………..28 1.2.5.4.1 Picornaviruses…………………………………………………29 1.2.5.4.2 Rotavirus………………………………………………………..30 1.2.5.4.3 Influenza virus………………………………………………….31 1.2.6 Length dependent translation stimulation by the poly(A) tail……………………………………………………………….32 1.3 Poly(A) limiting element (PLE)……………………………….32 1.3.1 Sequence of PLE…………………………..………………….34 1.3.2 PLE binding proteins: PLE-BPs………………………….…..34 1.4 Specific aims of this study…………………………………….36 1.4.1 Determine whether the PLE also functions to modulate the efficiency of pre-mRNA 3’ processing…………………..37 1.4.2 Examine impact of the PLE on the translation of mRNAs with short poly(A) tails….……………………………38 1.4.3 Analyze the effect of PLE-BPs and modulators of PABP on the translation of PLE-containing mRNAs with short poly(A) tails…………………………………………39

2. MATERIALS AND METHODS……………………………….46

2.1 Plasmid construction………………………………………….46 2.1.1 Plasmids used for transfection………………………………46 2.1.1.1 CMV-luc-SPA and CMV-luc-PLEB-SPA…………………….46

viii 2.1.1.2 CMV-glo-SPA-X200, CMV-glo-PLEB-SPA-X200 and CMV- glo-MutG-SPA-X200…………………………………………..47 2.1.1.3 pcDNARluc……………………………………………………..47 2.1.2 Plasmids used as templates to generate antisense probes……………………………………………………….….47 2.1.2.1 pTopo-gloA2……………………………………………….…...47 2.1.2.2 pBS-X200……………………………………………………….48 2.1.2.3 pGEMPL156……………………………………………………48 2.1.2.4 pGEMRL289…………………………………………………...48 2.1.2.5 pBSPL156 and pBSRL289…………………………….….….49 2.1.2.6 pTopII-Alb……………………………………………….….…..49 2.1.3 Plasmids used as templates to generate transcripts for in vitro cleavage assays……………………………………....49 2.1.3.1 pGgloEx3SPA and pGgloEx3PLEBSPA…………………….49 2.1.3.2 pGEM(PLEB)4 and pGEM(MutG)4………………………...…50 2.1.3.3 pGEx3(PLEB)4SPA and pGEx3(MutG)4SPA…………….....50 2.1.4 Plasmids used as templates to generate luciferase transcripts with poly(A) tails of different lengths……………50 2.1.4.1 Cloning of part of β-globin exon3 with A14, A54 or A78 into the pGEM3Z vector………………………………….…...50 2.1.4.2 Insertion of the entire β-globin exon3 into the pGEM A14, A54 or A78 vectors…………………………..….51 2.1.4.3 pGglo-A14, A54, A78……………………………………….…51 2.1.4.4 pGluc-A14, A54, A78 and pGluc-PLEB-A14, A54, A78.…..51 2.1.4.5 pGluc-PLEB-A98 and pGluc-A98……………………….……52 2.1.4.6 pGluc-A20 and pGluc-PLEB-A20……………………….……52 2.1.4.7 pGRluc-A78……………………………………………….……52 2.1.4.8 pGluc-EPPLE-A20, A98………………………………………53 2.2 Cell culture……………………………………………….……..53 2.3 Transfection of Cos7 cells……………………………….……53 2.4 Transfection of LM(tk-) cells………………………………….54 2.5 Total RNA extraction…………………………………….…….55 2.6 Extraction of cytoplasmic and nuclear RNA…………….…..56 2.7 Labeling of the 5’ end of DNA oligo-nucleotides with [γ-32P]-ATP……………………………………………….….….57 2.8 Quantitative RT-PCR to detect pre-mRNA………………….57 2.9 The poly(A) tail length assay…………………………………58 2.10 In vitro ……………………………………………59 2.10.1 Internally [32P] labeled antisense transcripts…………….….59

ix 2.10.2 Internally [32P] labeled transcripts bearing an m7GpppG cap………………………………………………………………60 2.10.3 Transcripts for in vitro translation experiments……………..61 2.11 Synthesis of random primed DNA probe……………………62 2.12 Synthesis of 32[P]-labeled U6 probe…………………………63 2.13 Northern blot……………………………………………………63 2.14 RNase Protection Assay (RPA)……………………………...64 2.15 Nuclear transcription run-on assay…………………….…….65 2.16 In vitro cleavage assay…………………………………….….66 2.17 Sucrose density gradient analysis……………………….…..67 2.18 Preparation of Hela cytoplasmic extract…………………….69 2.19 Purification of GST-Paip2………………………………….….69 2.20 Purification of GST-La(226-348)………………………….….71 2.21 Purification of recombinant hPABP-(His)6………………...... 71 2.22 In vitro translation………………………………………….…..72 2.23 Western blot……………………………………………………73

3. THE PLE ENHANCES PRE-mRNA 3’ PROCESSING……77

3.1 The presence of a PLE increases the accumulation of nuclear and cytoplasmic β-globin mRNA…………………...78 3.2 The PLE does not alter the rate of gene transcription….…79 3.3 The PLE enhances the efficiency of 3’ processing in vivo………………………………………………………..….80 3.4 The PLE enhances 3’ cleavage in vitro………………..……83

4. IMPACT OF THE PLE ON THE TRANSLATION OF WITH SHORT POLY(A) TAILS…………………….…98

4.1 The PLE restricts the poly(A) tail of intronless luciferase reporter mRNA to <20 nt in transiently transfected cells………………………………………………..98 4.2 PLE-containing luciferase mRNA with a short poly(A) tail is translated efficiently in transiently transfected cells………………………………………………………….…..99 4.3 PLE-containing mRNA is efficiently recruited to polysomes…………………………………………………….100 4.4 Impact of the PLE on the translation of mRNAs with a short poly(A) tail in vitro……………………………………102

x 4.4.1 The in vitro transcripts used for the in vitro translation..…102 4.4.2 The development of a poly(A)-responsive in vitro translation system……………………………………………103 4.4.3 The in vitro translation of non-PLE-containing and PLE-containing transcripts with poly(A) tails of different lengths……………………………………………....105 4.5 A nuclear event is required to activate translation of PLE-containing mRNA………………………………….……108

5. IMPACT OF THE PLE-BINDING PROTEINS AND PABP INHIBITORS ON THE TRANSLATION OF PLE-CONTAINING mRNA…………………………………..133

5.1 Impact of the nuclear PLE-binding proteins on the translation of PLE-containing mRNA………………………134 5.1.1 Impact of U2AF on the translation of PLE-containing mRNA…………………………………………………………134 5.1.2 Effect of SF3b on the translation of PLE-containing mRNA…………………………………………………………135 5.1.3 Impact of La protein on the translation of PLE- containing mRNA………………………………………….…137 5.1.4 Impact of U2AF, SF3b and La on translation is not specific to firefly luciferase reporter mRNA……………….138 5.2 Inhibiting the activity of PABP had a different impact on the translation of PLE-containing mRNA with a short poly(A) tail…………………………………………....139 5.2.1 Translation in PABP-depleted Krebs cell extract…………141 5.2.2 Impact of poly(rA) competition for poly(A)-binding proteins on the translation of PLE-containing mRNAs…..142 5.2.3 Effect of Paip2………………………………………………..146

6. DISCUSSION…………………………………………………171

6.1 The PLE enhances pre-mRNA 3’ processing efficiency…171 6.2 The PLE in combination with a short poly(A) tail functionally substitute for a long poly(A) tail in stimulating translation in vivo……………………………….175 6.3 Translational stimulation of short poly(A) mRNA by the PLE requires the nuclear experience………………….177

xi 6.4 Summary - The PLE and a short poly(A) tail: a novel mechanism to regulate ?……….181

LIST OF REFERENCES…………………………………………………….………187

xii LIST OF TABLES

Table Page

Table 1.1 Yeast cleavage/polyadenylation machinery...……………………..12

Table 2.1 Primer sequences …………………..……………………………….75

xiii LIST OF FIGURES Figure Page

Figure 1.1 Circular translation model …………………………..……………….43

Figure 1.2 Multiple types of circular mRNA …………………………..……..….45

Figure 3.1 Impact of the PLE on steady-state levels of nuclear and cytoplasmic β-globin mRNA………………………..………………...87

Figure 3.2 The PLE does not affect transcription efficiency …...……………..89

Figure 3.3 Impact of the PLE on the efficiency of pre-mRNA 3’ processing – RT-PCR assay ……………………………………..91

Figure 3.4 Impact of the PLE on the efficiency of pre-mRNA 3’ processing – RNase protection assay………………………………93

Figure 3.5 Impact of the PLE on 3’ cleavage in vitro ………………………….95

Figure 3.6 In vitro cleavage assay of (PLE)4 and (MutG)4 pre-mRNA ……….97

Figure 4.1 The PLE imparts a short poly(A) tail on luciferase mRNA ………112

Figure 4.2 Impact of a PLE on mRNA and protein expression in vivo………114

Figure 4.3 Polysome profile analysis of PLE-containing mRNA ...……….....116

Figure 4.4 Plasmid map of pGluc-A20………………………………………….118

Figure 4.5 Luciferase transcripts used for in vitro translation and RNA transfection …………………………………………………………...120

Figure 4.6 Titration of the input mRNA concentration …………………….….122

Figure 4.7 Titration of the MgCl2 concentration to optimize translation of +PLE A14 luciferase mRNA in vitro…………………………………124

Figure 4.8 Titration of the KCl concentration to optimize translation of +PLE A14 luciferase mRNA in vitro ………………………………...126 xiv

Figure 4.9 Impact of the PLE on translation in vitro ……………………….128

Figure 4.10 Translation of mRNAs containing the HIV-EP2 PLE ………….130

Figure 4.11 Impact of the PLE on translation of mRNA transfected into cultured cells ………………………………………………………132

Figure 5.1 Impact of U2AF on the translation of PLE-containing mRNAs……………………………………………………………..150

Figure 5.2 Impact of SF3b on the translation of PLE-containing mRNAs ……………………………………………………….……152

Figure 5.3 Impact of La protein on the translation of PLE-containing mRNAs …………………………………………………………….154

Figure 5.4 Impact of a dominant negative La mutant on translation …….156

Figure 5.5 The impact of PLE-binding proteins on translation is not specific to firefly luciferase reporter mRNA ……………………158

Figure 5.6 Translation in PABP-depleted Krebs cell extract………………160

Figure 5.7 Impact of poly(rA) competition for poly(A)-binding proteins on the translation of PLE-containing mRNAs ………………….162

Figure 5.8 Purification of hPABP-(His)6…………………………………..…..164

Figure 5.9 The Impact of poly(rA) on translation is reversed by addition of hPABP-(His)6…………………………………………..166

Figure 5.10 Impact of Paip2 inhibition of PABP on the translation of PLE-containing mRNAs ………………………..………………….168

Figure 5.11 Inhibition of Paip2 on translation is reversed by addition of hPABP-(His)6……………………………………………………..170

Figure 6.1 The PLE-mediated regulation of gene expression…………..…..186

xv ABBREVIATIONS

5’ UTR – 5’ untranslated region 3’ UTR – 3’ untranslated region 4E-BPs – eIF4E binding proteins ATP – adenosine triphosphate AMP – adenosine monophosphate bp - cDNA – complementary DNA CF IA – cleavage factor IA (yeast) CF IB – cleavage factor IB (yeast) CF II – cleavage factor II (yeast) CF Im – cleavage factor I (mammalian) CF IIm – cleavage factor II (mammalian) CF IIAm – cleavage factor II, component A (mammalian) CF IIBm – cleavage factor II, component B (mammalian) CGRP – calcitonin gene-related peptide CP – creatine phosphate CPE– cytoplasmic polyadenylation element CPEB – CPE binding protein CPSF – cleavage and polyadenylation specificity factor CstF – cleavage stimulation factor CTD – carboxyl-terminal domain CTP – cytosine triphosphate DEPC – diethyl pyrocarbonate dATP – deoxyadenosine triphosphate dCTP – deoxycytosine triphosphate dGTP – deoxyguanosine triphosphate dTTP – deoxythymidine triphosphate DNA – deoxyribonucleic acid DNase - deoxyribonuclease DSE – downstream element DMEM – Dulbecoo’s minimal essential medium DTT – dithiothreitol eIF2 – eukaryotic initiation factor 2 eIF3 – eukaryotic initiation factor 3 eIF4A – eukaryotic initiation factor 4A eIF4B – eukaryotic initiation factor 4B eIF4E – eukaryotic initiation factor 4E

xvi eIF4F – eukaryotic initiation factor 4F eIF4G – eukaryotic initiation factor 4G eIF5 – eukaryotic initiation factor 5 eIF5B – eukaryotic initiation factor 5B E. coli – Escherichia coli EDTA – ethylenediaminetetraacetic acid EGTA – ethylene glycol-bis(β-aminoethyl ether) N,N,N’,N’-tetraacetic acid EST – expressed sequence tag EMCV – encephalomyocarditis virus EMSA – electrophoretic mobility shift assay FBS – fetal bovine serum FMDV – foot-and-mouth disease virus GAIT – IFN-gamma activated inhibitor of translation GC-rich – guanosine-cytosine rich GRSF-1 – guanine-rich sequence factor 1 GTP – guanosine triphosphate HAV – hepatitis A virus HCV – hepatitis C virus HECT domain – Homologous to the E6-AP Carboxyl Terminus domain HIV-1 – human immunodeficiency virus type 1 hnRNP – heterogeneous nuclear ribonucleoprotein hsp70 – heat shock protein 70 IFN – interferon IRES – internal ribosomal entry site Kd – dissociation constant mRNA – messenger RNA MALDI-MS – matrix assisted laser desorption ionization mass spectrometry NLS – nuclear localization signal NMR – nuclear magnetic resonance NP-40 – Nonidet P-40 (detergent) NS1 – non-structural protein 1 (influenza virus) NSP3 – non-structural protein 3 (rotavirus) nt – nucleotide Pab1p – poly(A)-binding protein 1 (yeast) PABP – poly(A)-binding protein (mammalian cytoplasmic protein) PABPN1 – poly(A)-binding protein N1 (mammalian nuclear protein) Paip1 – PABP-interacting protein 1 Paip2 – PABP-interacting protein 2 PAP – poly(A) polymerase Pap1p – poly(A) polymerase I (yeast) xvii P bodies – processing bodies PBS cphosphate buffered saline PCI – phenol : chloroform : isoamyl alcohol (25:24:1) PCR – polymerase chain reaction PF I – polyadenylation factor I (yeast) PIE – polyadenylation-inhibitory element PLE – poly(A)-limiting element PMR1 – polysomal ribonuclease 1 PMSF – phenylmethylsulfonyl fluoride pre-mRNA – precursor messenger RNA PTB – polypyrimidine tract-binding protein PV – poliovirus PVDF – polyvinylidene fluoride RNA – ribonucleic acid RNase - ribonuclease RNAP II – RNA polymerase II RRM – RNA recognition motif RT-PCR – reverse transcriptase PCR SELEX – systematic evolution of ligands by exponential enrichment SDS – sodium dodecylsulfate SDS-PAGE – sodium dodecylsulfate polyacrylamide gel electrophoresis SLBP – stem-loop-binding protein snRNP – small nuclear ribonucleoprotein SPA – synthetic polyadenylation signal SR domain – serine/arginine rich domain SSC – sodium chloride/sodium citrate SV40 – simian virus 40 TAR – transactivation response element TBST – Tris-buffered-saline Tween-20 TFIID – RNAP II transcription factor D TFIIH – RNAP II transcription factor H TOP – terminal oligo-pyrimidine TPR – tetratricopeptide repeat tRNA − transfer RNA U1 snRNP – U1 small nuclear ribonucleoprotein U1A – U1 small nuclear ribonucleoprotein A U1 70K – 70 kDa U1 small nuclear ribonucleoprotein U2 snRNP – U2 small nuclear ribonucleoprotein U2AF – U2 small nuclear ribonucleoprotein auxiliary factor U2AF65 – the 65-kDa subunit of U2AF

xviii USE – upstream element UTP – uracil triphosphate UV – ultraviolet w/v – weight per unit volume xSLBP1– Xenopus stem-loop-binding protein 1 xSLBP2– Xenopus stem-loop-binding protein 2

Units µg/ml – microgram per milliliter µg – microgram µM – micromolar µl – microliter fmol – femtomole fmol/µl – femtomole per microliter g – gram g/L – gram per liter g/ml – gram per milliliter hr(s) – hour(s) kb – kilobase kDa – kilodalton L – liter mA – milliampere min – minute(s) ml - milliliter ml/g – milliliters per gram mg - milligram M – molar mM – milimolar mmol – milimole ng – nanogram ng/µl – nanogram per microliter nM – nanomolar pmol – picomole V - volt

xix

CHAPTER 1

INTRODUCTION

In eukaryotes, transcription of protein-encoding genes by RNA

polymerase II produces mRNA precursors (pre-mRNA) that undergo several

modification processes before they are exported to the cytoplasm to be

translated into proteins. With the exception of histone transcripts, most mRNAs

receive a poly(A) tail at the 3’-terminus during nuclear modification. Addition of

the poly(A) tract to a nascent pre-mRNA requires tens of proteins, and is a two-

step reaction including site-specific cleavage and subsequent polyadenylation of

the upstream cleavage product. Poly(A) tails are involved in almost every aspect

of mRNA metabolism: splicing, export, translation and decay.

For most mRNAs, the newly synthesized poly(A) tails are 200-250 residues in length in mammals, and 70-90 residues in yeast. These tails undergo

progressive shortening in the cytoplasm. When the poly(A) tails are reduced to

10-15 residues, the mRNAs are degraded in discrete foci named GW bodies in

mammalian cells (1), or processing bodies (P bodies) in yeast (2). mRNAs with

long poly(A) tails are generally more stable and are translated more efficiently

1 than those with short tails. This is probably because more copies of the poly(A)

binding protein (PABP) are bound to the poly(A) stretch. However, Xenopus

laevis albumin mRNA, which encodes one of the most abundant serum proteins

made in frog liver (3), has a short poly(A) tail. Previous work has shown that

albumin mRNA contains two cis elements located in the last exon, termed

poly(A) limiting elements (PLEs), that restrict the length of the poly(A) tail to as

few as 17 nt. The interesting question is how those PLE-containing mRNAs with

short poly(A) tails are processed and translated efficiently. The current study

focused on defining the roles of the PLE in the 3’-end processing and translation of mRNAs with short poly(A) tails <20 nt.

1.1 Formation of the poly(A) tail: 3’ end processing

Transcription by RNA polymerase II produces an elongated pre-mRNA.

To add a poly(A) tail at the 3’ end, the pre-mRNA is first cleaved by an

endonuclease at a specific site to generate two products. The upstream

cleavage product terminates with a 3’ hydroxyl group where AMPs from ATP are

sequentially added by poly(A) polymerase. The downstream fragment bearing a

5’ phosphate group is rapidly degraded (4). This 3’ end processing requires

special sequences on the mRNA as well as large protein complexes to ensure

that the poly(A) tail is added at the correct position.

2 1.1.1 Mammalian cleavage/polyadenylation

1.1.1.1 Mammalian cleavage/polyadenylation signal

In mammalian cells, three elements are essential for mRNA 3’ end

formation: a highly conserved hexanucleotide sequence AAUAAA located 10-30

nt upstream of the cleavage site, a less conserved U- or GU-rich sequence

downstream of the cleavage site, and the cleavage site itself.

The hexanucleotide AAUAAA is widely regarded as nearly ubiquitous in

the 3’ ends of all eukaryotic mRNAs (5-8). The most common variant is

AUUAAA that has activity comparable to AAUAAA. Other mutations in this

sequence inhibit polyadenylation (9;10), although these mutated forms are

present in certain genes and are often associated with alternative or tissue

specific polyadenylation (8). Early studies of cloned cDNAs from the mouse and

human genomes showed a 80-90% incidence of AAUAAA and approximately a

10% incidence of AUUAAA present in 3’ UTRs (11). However, recent bioinformatics analysis of expressed sequence tag (EST) datasets showed fewer

AAUAAA incidences, with estimates varying from 48 to 59% (11). The following reasons could explain this discrepancy: 1. A bias in the EST data. The EST data were obtained and compiled extremely rapidly, and possible errors and ambiguities may have been introduced with regard to identification of the authentic 3’ ends of mRNAs. For example, the EST data may contain false positives contributed by internal priming by oligo(dT) primes. 2. The different ways by which EST data and cDNA data are collected and reported. The cDNA

3 GeneBank represents the most common variant of the 3’ end sequences, as a single instance of cloning and sequencing of an mRNA is submitted. The EST

database gives equal weight to both the rare forms and the common forms of 3’

end sequences, since each instance of 3’ end sequence is recorded individually.

3. Possible mechanisms for AAUAAA-independent polyadenylation. For

example, a large number of specific alternatively processed mRNAs are present

in male germ cells, and interestingly, there are fewer AAUAAA incidences in

these cells. In addition, these cells have a cell-type specific polyadenylation

factor τCstF-64, which could influence the use of upstream AAUAAA signal.

However, further experimental data is needed to prove the existence of the

AAUAAA-independent polyadenylation mechanism (11).

The second element required for proper 3’ end formation is within the poorly conserved 30-nt region downstream of the cleavage site. There are two major types of this element: U- rich or GU-rich. A poly(A) signal may contain either element or both elements functioning synergistically. The facts that some

polyadenylation signals have neither a U-rich element nor a GU-rich element,

and that a point mutation or a small deletion in the downstream element has little

effect on 3’ processing, suggest that the downstream sequence is poorly defined

and may be redundant. However, the distance between the downstream

sequence and the cleavage site seems to be important in determining cleavage

site selection and polyadenylation efficiency (8).

4 Finally, the sequence around the cleavage site itself is not conserved and

therefore the position of cleavage is primarily determined by the distance

between AAUAAA and the downstream element. However, the 3’ cleavage

frequently occurs immediately after a CA dinucleotide. About 70% of vertebrate

mRNAs have an “A” to which the poly(A) tract is added (9). In addition, a

mutagenesis study of SV40 polyadenylation signals showed that the nucleotide

preference right upstream of the site of cleavage is A>U>C>>G (12).

Auxiliary sequences that regulate 3’ processing positively or negatively are

also found in many viral and cellular mRNAs. They are divided into two classes

according to their locations relative to the core polyadenylation signal: upstream

elements (USEs) and downstream elements (DSEs). Only a few DSEs have

been identified so far. One DSE is a G-rich sequence in the SV40 late

polyadenylation signal that enhances 3’ processing efficiency (13). Another DSE

is a pseudoexon sequence in calcitonin/CGRP (calcitonin gene-regulated

peptide) transcripts that stimulates processing at an upstream poly(A) site (14).

More USEs have been described. USEs that enhance 3’ processing efficiency

are common in viral mRNAs and have also been identified in cellular mRNAs,

including the human complement factor C2, lamin B2 (8) and collagen (15). One example of a USE that negatively modulates 3’ processing is the polyadenylation-inhibitory element (PIE) in U1A mRNA. The human U1A snRNP protein autoregulates its own production by binding to this 50-nt PIE and inhibiting poly(A) polymerase (PAP) activity (16;17). Another example is the

5 poly(A) limiting element (PLE), identified in Xenopus albumin mRNA, that restricts the length of the poly(A) tail to <20 nt (3). The PLE will be discussed in more detail in section 1.3. Whether or not the PLE also regulates the efficiency of 3’ end processing was not examined until this study.

1.1.1.2 Mammalian cleavage/polyadenylation machinery

The mammalian cleavage/polyadenylation machinery consists of cleavage/polyadenylation specific factor (CPSF), cleavage stimulation factor

(CstF), cleavage factors Im and IIm (CF Im and CF IIm), poly(A) polymerase and

the nuclear poly(A) binding protein N1 (PABPN1 or PABP II). In addition, RNA

polymerase II (RNAP II) is also required for the cleavage reaction.

1.1.1.2.1 Cleavage/polyadenylation specific factor (CPSF)

CPSF recognizes the AAUAAA sequence and is required for both

cleavage and polyadenylation steps. The binding of purified CPSF to AAUAAA is

weak but is dramatically increased by the addition of CstF, which binds to the

downstream signal sequence. CPSF consists of four protein subunits of 160,

100, 70 and 30 kDa. CPSF-160 is crucial for AAUAAA recognition, but other

CPSF subunits facilitate this interaction. CPSF-160 also interacts with PAP and

the 77-kDa subunit of CstF (18). The functions of CPSF-100 and CPSF-70 are

not yet very clear, although one report has suggested CPSF-70 could be the

catalytic endonuclease in the cleavage reaction (19). CPSF-30 probably

6 facilitates CPSF-160 in AAUAAA recognition through interaction with the nuclear poly(A) binding protein N1 (PABPN1) and stabilizing the polyadenylation complex

(20). CPSF-30 is also hypothesized to be the nuclease to cleave pre-mRNA since it is homologous to the Drosophila clip protein that has endoribonucleolytic

activity. However, this has not been proven experimentally (21).

In a recent study, hFip1 was identified as another integral component of

CPSF. hFip1 is homologous to the yeast processing protein Fip1p, and it has an arginine-rich RNA binding motif that preferentially binds to the U-rich element on

pre-mRNA. hFip1 interacts with CPSF-160 and PAP, and stimulates cleavage

and polyadenylation of U-rich element-containing pre-mRNA in vitro (22).

1.1.1.2.2 Cleavage stimulation factor (CstF)

CstF is involved in the cleavage step and consists of three subunits of 77,

64 and 50 kDa (23). CstF-77 interacts with the 160-kDa subunit of CPSF, and

this interaction stimulates the AAUAAA binding activity of CPSF and stabilizes

the polyadenylation complex (18). CstF-64 contains a RNA recognition motif that

binds to the U- or GU-rich region downstream of the cleavage site in an

AAUAAA-dependent manner (24). CstF-50 has seven repeats of the WD

domain, which is a protein-protein interaction motif (25).

7 1.1.1.2.3 Cleavage factors Im and IIm (CF Im and CF IIm)

CF Im consists of three subunits of 25, 59 and 68 kDa, and each subunit can be specifically UV-crosslinked to a cleavage/polyadenylation pre-mRNA

substrate (26). CF Im increases the stability of the CPSF-RNA complex and

could function in the early assembly of the 3’-end-processing complex and

recruitment of other processing factors (27). CF IIm contains two components:

the essential component CF IIAm and the stimulatory component CF IIBm. There are >15 proteins in purified CF IIAm, including splicing factors and transcription

factors, as well as proteins homologous to the yeast 3’ processing factors Pcf11p

and Clp1p. The 47-kDa subunit hClp1 interacts with CF Im and CPSF, implying it

is a bridge between the two processing complexes (28).

1.1.1.2.4 Poly(A) polymerase (PAP)

Poly(A) polymerase was first purified in early 1960’s from calf thymus but

its biological significance was not known until the discovery of poly(A) tails on

most mRNAs a decade later (29). The N-terminal two-thirds of PAP is the

catalytic domain and is conserved from yeast to man. The C-terminus contains a

primer-binding domain, a CPSF-160 interaction region, a nuclear localization

signal (NLS), and a serine/threonine rich region for the regulation of PAP activity

via phosphorylation (8). Purified PAP alone has specificity for ATP utilization, but

does not have specificity for its pre-mRNA substrate. CPSF confers substrate

specificity for pre-mRNA on PAP (30). PAP itself catalyzes poly(A) chain

8 elongation in a distributive manner, it dissociates from its substrate after the synthesis of a few nucleotides (30).

1.1.1.2.5 Poly(A) binding protein N1 (PABPN1)

PABPN1, also termed PABP II for poly(A) binding protein II, is required for rapid poly(A) elongation and regulation of poly(A) length. It binds to newly synthesized short poly(A) tails and converts PAP polymerase activity from distributive to processive. After the poly(A) tail has been elongated to 250 nt,

PAP returns to a distributive manner of polyadenylation (31;32). PABPN1 is a

33-kDa protein with an acidic domain at the N-terminus, a basic domain at the C- terminus, and a RNA recognition motif (RRM) in the middle (33). PABPN1 and cytoplasmic PABP (also termed PABP I for poly(A) binding protein I), which functions in translation and mRNA stability, differ in size and sequence.

However, they share some poly(A) binding characteristics since both have a minimum of 12 nt, and both form oligomers on a long poly(A) stretch with each protein monomer bound to 23-25 residues (34).

1.1.1.2.6 The C-terminal domain of RNA polymerase II (CTD of RNAP II)

Mammalian RNA polymerase II (RNAP II) has a long C-terminal domain

(CTD) composed of 52 repeats of the heptad amino acid sequence YSPTSPS.

The CTD is phosphorylated, and after transcription initiation, the phospho-CTD plays an important role in recruiting capping, splicing and 3’ processing factors to

9 the pre-mRNA as RNAP II is transcribing (35;36). RNAP II is required for the

cleavage step, in which the interaction of its CTD with CPSF and CstF probably

stabilizes the cleavage complex (37).

1.1.1.3 The process of 3’ end formation in mammalian cells

The 3’ end formation process initiates with the recognition of the poly(A)

signal on the pre-mRNA by CPSF and CstF, with the assistance of CF Im. CPSF-

160 binds to the AAUAAA consensus sequence; this binding is facilitated by

CPSF-30 and CPSF-100. CstF-64 binds to the downstream U- or GU-rich

sequence. The individual interactions of CPSF with AAUAAA and CstF with

downstream U- or GU-rich sequence are weak, but both binding interactions are

enhanced by the interaction between CPSF-160 and CstF-77. The precise

function of CF IIm in this process is not quite understood. The binding of CPSF

and CstF defines the cleavage site of the pre-mRNA, and subsequently, CPSF recruits PAP to the complex to add the poly(A) tail to the 3’-OH end of the 5’ cleavage product. Poly(A) addition is slow and distributive at first, but after

PABPN1 binds to the first 11- to 14-nt poly(A) tract, the reaction becomes fast

and processive. When the tail reaches a length of approximately 250 adenylate

residues, PAP activity becomes slow and distributive again. Although PABPN1 is

required for the second change in PAP activity, the mechanism is presently

unknown. The termination of polyadenylation is probably coupled with the

release of CPSF and PAP from the finished product (8).

10 1.1.2 Yeast cleavage/polyadenylation

1.1.2.1 Yeast polyadenylation signal

Unlike higher eukaryotes, yeast cells use a degenerate and complicated polyadenylation signal that includes at least three elements: an efficiency element, a positioning element and a poly(A) site. The efficiency element is UA- or U-rich and is located at a variable distance upstream of the cleavage site. The positioning element is located 20-nt upstream of the cleavage site and determines the cleavage position and contributes to processing efficiency. The poly(A) site is where the pre-mRNA is cleaved and the poly(A) tail is added, which often occurs at a pyrimidine-(A)n sequence (8;38).

1.1.2.2 Yeast cleavage/polyadenylation machinery

Despite the great differences between poly(A) signals from yeast and mammals, the protein components of the yeast cleavage/polyadenylation machinery are surprisingly conserved (8). In yeast, the following protein factors are required to reconstitute the pre-mRNA 3’ end formation in vitro: cleavage factors CF IA, CF IB and CF II are sufficient for site-specific cleavage, while CF

IA, CF IB, poly(A) polymerase Pap1p, poly(A) binding protein Pab1p and polyadenylation factor PF I are required for specific poly(A) addition (39).

Recently, a complex designated as cleavage and polyadenylation factor (CPF) that harbored CF II and PF I activities was purified from yeast extract with affinity purification (40). The subunits of each factor are summarized in Table 1.1.

11

Factor Subunit Molecular Characteristics Mammalian References Weight homologue (kDa)

CF IA Rna14p 76 Associates tightly CstF-77 (41) with Rna15p Pcf11p 72 Interacts with hPcf11p in (42) Rna14p and CFIIAm Rna15p Ef1a/ 50 GTP-binding hClp1 in (28) Clp1p protein CFIIAm Rna15p 38 Binds U-rich CstF-64 (41) sequences CF IB Nab4p/ 73 Interacts with hnRNP (43;44) Hrp1p Rna14p and A/B/D Rna15p; binds to UA repeats CF II Yhh1p/ 150 Recognizes CPSF-160 (39;45) Cft1p poly(A) site and interacts with RNAP II CTD Cft2p/ 105 RNA binding CPSF-100 (39) Ydh1p dependent on ATP, UA repeat and sequence around cleavage site Brr5p/ 100 ⎯ CPSF-73 (39) Ysh1p (46) Pta1p 90 ⎯ ⎯ (8)

Continued

Table 1.1. Yeast cleavage/polyadenylation machinery (adapted from (8;8))

12 Table 1.1 continued

Factor Subunit Molecular Characteristics Mammalian References Weight homologue (kDa)

PFI Pfs1p 58 ⎯ ⎯ (8) Fip1p 55 Represses hFip1 in CPSF (47) Pap1p activity; interacts with Yth1p, Rna14p and CF II Pfs2p 53 Interacts with ⎯ (40) CFII and CFIA Yth1p 24 Tether Fip1p and CPSF-30 (48) Pap1p; binds to pre-mRNA Pap1p Pap1p 64 Catalyzes poly(A) PAP (8) synthesis Pab1p Pab1p 70 Interacts with PABP (50) Rna15p; controls (PABP I) (49) the poly(A) tail length

13 CF IA consists of four subunits: Rna14p, Rna15p, Pcf11p and Clp1p.

Rna14p and Rna15p are related to mammalian CstF-77 and CstF-64

respectively (41). Rna15p may have a high affinity for the U-rich efficiency

element (24). Pcf11p interacts with the C-terminal domain of RNA polymerase II

and also involves in transcription termination (42).

CF IB consists of a single polypeptide called Nab4p/Hrp1p. It probably

binds to the UA-rich efficiency element and functions in cleavage site selection

(43;44).

CF II consists of four polypeptides: 150-kDa Yhh1p/Cft1p, 105-kDa

Cft2p/Ydh1p, 100-kDa Brr5p/Ysh1p and 90-kDa Pta1p (51). The largest three

subunits are homologous to the three larger subunits of mammalian CPSF

(CPSF-160, CPSD-100 and CPSF-73, respectively) (39). Yhh1p/Cft1p participates in poly(A) signal recognition and binds specifically to the phosphorylated CTD of poly(A) polymerase; its function may be to link poly(A) site recognition and RNA polymerase II transcription termination (45).

PF I supports poly(A) addition but not cleavage in vitro. The purified PF I complex contains nine polypeptides: Fip1p (factor interacting with Pap1p),

Pap1p, Yth1p, Pfs1p, Pfs2p and all four subunits of CF II (52). Fip1p interacts with Yth1p and Pap1p, and is thought to tether Pap1p to its substrate during polyadenylation (47). Yth1p is homologous to CPSF-30 and preferentially binds

RNA near the poly(A) site (48). Pfs2p interacts with subunits of CF II and CF IA,

14 and probably promotes the assembly of the processing complex by bridging

different processing factors (40).

Another important factor in yeast 3’ end formation is poly(A) binding

protein Pab1p. Although the majority of Pab1p is present in the cytoplasm where it functions in translation or mRNA stabilization, it is also imported into the

nucleus. There, it limits poly(A) tail length by preventing Pap1p from interacting

with RNA, and by recruiting poly(A)-specific nuclease (PAN) to reduce the

poly(A) tail length to 60-80 nt (50). In addition to Pab1p, nuclear export factor

Nab2p also functions in limiting poly(A) tail length. Loss of Nab2p causes hyperadenylation that cannot be restored by overexpression of Pab1p, but the

mechanism is still not known (53).

1.1.2.3 The process of 3’ end formation in yeast cells

The process of yeast 3’ end formation is still poorly understood, and the

model for it is based on homologies to the mammalian system. A proposed

model is that CF IA and CF IB bind at the efficiency element, CF II binds to A-rich

positioning element, and these three factors are responsible for specific cleavage

of the pre-mRNA (8). PF I is a complex of CF II plus PF I-specific subunits and

probably bridges cleavage and polyadenylation (52). PF I protein subunit Fip1p

recruits Pap1p to catalyze polyadenylation (47), and Pab1p and Nab2p are

responsible for regulating poly(A) tail length (53-55).

15 1.2 Poly(A) tail and translation initiation: circular translation model

Prior to the 1990s, there was an accumulation of experimental evidence that indicated that the poly(A) tail was involved in translation. This evidence included the following observations: First, polyadenylated transcripts were translated more efficiently in vitro using mammalian cell extracts. This stimulation was due to the enhanced binding of the 60S ribosome subunit in rabbit reticulate lysates (56). Second, adding exogenous poly(A) to the in vitro translation system increased the translation of capped, poly(A)-deficient mRNA while it inhibited the translation of polyadenylated poly(A) (56). Third, cytoplasmic polyadenylation of maternal mRNAs highly correlated with their recruitment to polysomes in vertebrate oocytes and developing embryos (57).

Fourth, mutations of the yeast poly(A) binding protein (Pab1p) gene lead to the inhibition of translation and cell growth (58). Significant advances have been made in the last decade in the elucidation of the synergistic actions of the poly(A) tail and the cap structure in stimulating translation. In recent years, this has resulted in the development of the circular translation model which proposes that the two termini of a translating mRNA are brought together by protein factors and the mRNA forms a closed loop. This model will be discussed in more detail below.

16

1.2.1 General pathway of translation initiation

The primary control of translation is exerted at the initiation step (59) and the two major protein factors required for mRNA circularization are in fact initiation factors. The general pathway of translation initiation includes the following steps: First, the cap structure m7GpppN, located on the 5’ end of the mRNA, interacts with the cap-binding complex eIF4F. eIF4F consists of three protein subunits: eIF4E, eIF4G and eIF4A. eIF4E actually binds to the cap structure. eIF4A hydrolyzes ATP and unwinds secondary structure in the 5’ untranslated region (UTR) of the mRNA. This process requires the help of another initiation factor eIF4B. Second, during the cap-binding process, a 40S preinitiation complex forms by the association of the 40S ribosomal subunit with eIF3 and eIF2, while eIF2 forms a ternary complex with GTP and methionine- charged initiation transfer RNA (Met-tRNAi, tRNAi is the specific tRNA derivative used to initiate protein synthesis in eukaryotes (60)). Third, the 40S preinitiation complex then joins with eIF4F to form the 43S initiation complex through an interaction between eIF3 and eIF4G. Then, the 43S initiation complex scans downstream along the mRNA until the anticodon of the Met-tRNAi recognizes the initiation codon. Fourth, as the 43S initiation complex stalls at the initiation codon, the GTP bound to eIF2 is hydrolyzed with the help of eIF5, and the initiation factors are released, followed by the joining of the 60S ribosomal subunit to form the 80S monosome. The joining of 60S ribosome subunit step

17 requires eIF5B to hydrolyze GTP. Formation of the 80S complex represents the

end of initiation and the beginning of elongation (60) (Figure 1.1).

1.2.2 Three key protein factors in the circular translation model

1.2.2.1 The cap binding protein: eIF4E

Eukaryotic initiation factor 4E is a 24-kDa protein with a high affinity to the

m7GpppN cap on mRNA. It also binds to m7G cap analogs with moderate

affinity, so eIF4E can be conveniently purified from cell extracts by affinity

chromatography using m7GDP-agarose. eIF4E associates with eIF4G and eIF4A

to form the heterotrimeric cap-binding complex eIF4F, which promotes binding of

the 43S preinitiation complex to mRNA. In addition, interaction with eIF4G

increases the cap-binding activity of eIF4E about 10 fold. Evolutionally, eIF4E is

conserved from yeast to human, and the murine eIF4E can functionally replace

the yeast counterpart in genetics study (reviewed in (61;62)).

The 3D structure of eIF4E has been solved by both X-ray crystallography and NMR. eIF4E structure resembles a baseball glove, with the hydrophobic cap-binding pocket formed by two tryptophan residues located on the concave β-

sheet face. The portion of eIF4E that interacts with eIF4G is located on the

convex side and contains three α-helices (62).

The binding of eIF4E to the cap is thought to be the limiting factor in translation initiation. Therefore, the activity of eIF4E is tightly controlled in the cell; disruption of eIF4E regulation affects cell growth and may lead to oncogenic

18 transformation (63). eIF4E is controlled in two ways. First, eIF4E is

phosphorylated at Ser-209 (numbering refers to the murine protein) by Mnk1.

Phosphorylation is not strictly required for eIF4E function but enhances eIF4E’s

affinity for mRNA (62;64). Second, a family of proteins that binds to eIF4E,

named 4E binding proteins (4E-BPs), inhibit translation by binding to eIF4E to

prevent it from interacting with eIF4G (this will be discussed in more detail in

section 1.2.5.1).

1.2.2.2 The scaffold protein: eIF4G

Like eIF4E, eIF4G is also a component of the eIF4F complex. It is a 220-

kDa protein that serves as a docking site for many translation factors. There are

two isoforms of eIF4G in yeast, plants and mammals: eIF4GI and eIF4GII

(eIF4GII is also termed eIFiso4G). Until recently, it was thought that eIF4GI was the prototype of the family and that eIF4GII functioned complementarily (65).

However, two lines of current data indicate that eIF4GI and eIF4GII have selective roles in mammalian cells. First, eIF4GII is recruited selectively to capped mRNA in differentiating cells; second, the cytokine thrombopoietin regulates eIF4GI and eIF4GII differentially (66).

eIF4GI can be divided into three distinct domains of similar size based on protease cleavage analysis. The N-terminal third, as defined by its cleavage by picornaviral proteases, directly interacts with eIF4E and the cytoplsmic poly(A) binding protein (PABP or PABP I), and is required for cap-dependent translation.

19 The middle part is the core domain for the assembly of translation machinery, as

it possesses RNA-binding activity (67) and also contains interaction sites for eIF3

(which brings in the 40S ribosome) and eIF4A (which unwinds RNA as it

hydrolyzes ATP) (68;69). The C-terminal domain appears to modulate

translation. It has a second independent binding site for eIF4A and interacts with

Mnk1, the eIF4E kinase. Notably, eIF4G can bind cap-binding protein eIF4E and

poly(A) binding protein PABP simultaneously, thus it bridges the association of

the two ends of an mRNA.

1.2.2.3 The Poly(A) binding protein: PABP

PABPs are characterized by a high affinity for poly(A). Human cytoplasmic PABP binds to oligo(rA)25 with an apparent Kd of 7 nM while its

affinity for other unrelated RNA sequences is about 100-fold lower (70). The

association of PABP with poly(A) requires a minimum of 12 residues, on a longer

poly(A) tract, PABP forms multimers and binds about every 25 residues (71).

PABP is very abundant; there are about eight million molecules of cytoplasmic

PABP per cell in growing HeLa cells, which corresponds to an intracellular

concentration of 4 µM (70).

PABPs are highly conserved proteins that are only found in eukaryotes.

There is only one PABP present in yeast (Pab1p) but metazoans and plants

contain multiple PABPs. For example, there are five PABPs in humans, and

Arabidopis has eight (72). Nuclear and cytoplasmic PABPs share no homology

20 and play distinct roles in mRNA metabolism: nuclear PABPs are involved in 3’ processing of mRNA (section 1.1.2.5) while cytoplasmic PABPs are involved in translation and mRNA stability. Cytoplasmic PABP contains four tandem RNA recognition motifs (RRMs) at the N-terminus and a helical domain at the C- terminus. These are connected by an unstructured linker that is rich in proline and methionine residues (72). Although each RRM is capable of RNA interaction, RRM1 and RRM2 are sufficient for specific poly(A) binding. They are also required for interacting with eIF4G (73;74). The C-terminal domain is homologous to the HECT domain in the hyperplastic discs family of ubiquitin- protein , although there is no evidence indicating that PABP is involved in ubiquitin mediated protein degradation (75). This domain does not bind RNA, but it enables PABP to multimerize on poly(A) (76) and it is also responsible for binding to release factor eRF3 and PABP-interacting proteins Paip1 and Paip2

(77).

In a recent report, cytoplasmic PABP was shown to interact directly and specifically with the 5’ cap structure of mRNA in vitro. This interaction protected the mRNA from decapping by hDcp2, even though PABP has a lower affinity for the cap than eIF4E (78).

21 1.2.3 Circularization of translating mRNAs

Since eIF4E and PABP can bind to eIF4G simultaneously, it has been proposed that the two ends of an mRNA are connected by the 5’-cap-eIF4E- eIF4G-PABP-poly(A)-3’ interaction, and thus the mRNA forms a “closed loop”.

Circular polysomes have been demonstrated by electron micrographs (79). In one recent report, Madin and colleagues observed ribosomes assembled into circular-type polysomes when they used electron microscopy to analyze the translation of luciferase mRNA in vitro with wheat embryo extract (80). However, the most alluring evidence for this model is the visualization by atomic force microscopy of filamentous mRNA loops closed by bulky but relatively uniform complexes containing the purified yeast recombinant proteins eIF4E, eIF4G and

Pab1p (81). Some cellular and viral mRNAs don’t have cap and/or poly(A) tail structure, but they also form a closed circle (Figure 1.2, sections 1.2.4 and 1.2.5).

Why does a translating mRNA form a circle? An intriguing possibility is that circularized mRNA enables efficient recycling of the ribosome on the same

RNA for re-initiation. On the other hand, the “closed loop” protects mRNA integrity and ensures the preferential translation of intact mRNAs containing both

5’ caps and 3’-poly(A) tails. In addition, the combined cooperative protein interactions enhance the cap-binding activity of eIF4F (82;83), increase the poly(A)-binding activity of PABP (84), and stimulate the RNA helicase and

ATPase activities of eIF4A, eIF4B and eIF(iso)4F (85). This could be due to conformational changes of the factors upon mutual interaction (86).

22 Another intriguing possibility is that mRNA circularization provides an opportunity for translation regulatory proteins that bind at the 3’ UTR of the mRNA to regulate translation initiation (87). One example is the translation silencing of induced by interferon-γ (IFN-γ). Upon IFN-γ treatment, ribosomal protein L13a is phophorylated and released from the 60S ribosomal subunit. It subsequently binds to the GAIT (IFN-gamma activated inhibitor of translation) element on the ceruloplasmin mRNA 3’-UTR and silences translation

(88). Interestingly, unlike many translational control mechanisms that prevent mRNA end-to-end interaction (section 1.2.5), this translation inhibition requires all three essential proteins for mRNA circularization: eIF4E, eIF4G and PABP (89).

Circularization of translating mRNAs could be an efficient way for the 3’UTR binding protein to sense environmental change and accordingly regulate translation at early steps.

However, there are still arguments against this circularization model.

First, adding exogenous poly(rA) of physiological length to in vitro translation lysates dramatically enhances translation of capped, poly(A)-deficient mRNA.

This stimulation requires eIF4G and PABP interaction, which suggests that the poly(A) tail can act in trans to cause cap-poly(A) synergy (90). On the other hand, the observation that the yeast poly(A) binding protein Pab1p can stimulate capped mRNA translation in trans suggests that the translation stimulation by the poly(A) tail in the initiation process doesn’t require the two ends of the mRNA to be linked (91). In other words, such evidence suggests that the circles

23 themselves provide no functional advantage to mRNA. Second, other than

serving to protect a translating mRNA, the mechanism by which a circular mRNA

enhances translation has not been addressed. Experimental evidence is still

lacking to prove mRNA circularization is essential for the reinitiation process

since a translation extract is not available yet that exhibits both poly(A) dependency and reinitiation activity (92).

1.2.4 Translation of poly(A)-deficient histone mRNA

Metazoan replication-dependent histone mRNAs do not terminate in a poly(A) tail but contain a highly conserved stem-loop structure instead. In transfected animal cells, the stem-loop is necessary and sufficient for efficient translation of reporter mRNA as long as it is located at the 3’-terminus.

Moreover, this translation stimulation is dependent on the 5’-cap, suggesting that the histone 3’-stem-loop is functionally similar to a poly(A) tail in translation (93).

The 16-nt stem-loop structure present at the 3’-end of histone mRNA is bound by a 31-kDa protein termed the stem-loop-binding protein (SLBP) that is required for

3’-processing, stabilization and translation of poly(A)-deficient histone mRNAs.

Interestingly, when human SLBP is introduced into the yeast Saccharomyces cerevisiae, it activates translation of reporter mRNAs that end in the histone 3’ stem-loop, but this activation requires eIF4E, eIF4G and eIF3. Furthermore,

SLBP also interacts physically with eIF4G in mammalian cells as shown by coimmunoprecipitation experiments (94). These results suggest that SLBP

24 functions similarly to PABP and that poly(A)-deficient histone mRNAs could also become circularized during translation (Figure 1.2 B).

Another extraordinary phenomenon reported recently is that a short poly(A) tail attached to the stem-loop sequence negatively regulates the translation of amphibian histone mRNA translation during oogenesis (95). Unlike mammals, Drosophila or that only contain one single

SLBP, Xenopus oocytes express two SLBPs: xSLBP1 and xSLBP2 (96). xSLBP1 is homologous to mammalian SLBP and it is expressed throughout development and activates histone mRNA translation. In contrast, xSLBP2 is only expressed in oocytes and inhibits histone mRNA translation. During

Xenopus oogenesis, a short poly(A) tail is attached to the stem-loop sequence of histone mRNA, and as oocytes maturate, this oligo(A) is removed and xSLBP2 is degraded. Most interestingly, although reporter mRNAs ending in a stem-loop with or without an oligo(A) were translated equally well in rabbit reticulate lysate, the reporter mRNA with oligo(A) was translationally silenced in frog oocytes (95).

This indicates that a short poly(A) tail functions as a translation silencer of histone mRNA in Xenopus oocytes.

25 1.2.5 Translational control at the cap-eIF4E-eIF4G-PABP-poly(A) interface

1.2.5.1 eIF4E binding proteins (4E-BPs)

A family of proteins that interacts with eIF4E has been identified using Far-

Western hybridization. These proteins are named eIF4E binding proteins or 4E-

BPs. There are three 4E-BPs (4E-BP1, 4E-BP2 and 4E-BP3) in mammals.

These proteins share identical function, but are expressed at different levels in tissues. The 4E-BPs inhibit cap-dependent translation by competing with eIF4G to bind eIF4E. The conserved eIF4E-binding motif contains a core sequence

YXXXXLΦ in which X is any amino acid and Φ is most often L, but sometimes M or F. The 4E-BPs bind to the same region on eIF4E that eIF4G binds.

Therefore, binding of the 4E-BPs prevents the association between eIF4E and eIF4G thus preventing the assembly of the eIF4F complex. The 4E-BPs are regulated by phosphorylation. Various extracellular stimuli activate the hyperphosphorylation of 4E-BPs at specific serine and threonine residues, which decreases the affinity of 4E-BPs for eIF4E. As a result, eIF4E dissociates from

4E-BPs and interacts with eIF4G to activate translation (62).

1.2.5.2 PABP interacting proteins (Paip)

Two PABP interacting proteins, named Paip1 and Paip2, have opposite effects on the regulation of the translation of polyadenylated mRNA. Paip1 enhances translation, probably by enhancing interaction of the two termini of mRNA (97);(98). However, Paip2 inhibits translation by decreasing PABP

26 binding affinity to poly(A) and competing with Paip1 for PABP binding (99).

Paip1 is homologous to the central domain of eIF4G and also interacts with eIF4A. It binds to PABP with 1:1 stoichiometry and an apparent Kd of 9 nM (98).

Paip1 contains two PABP binding sites, one at the N-terminus and the other at the C-terminus, and it binds to two sites in PABP, one in RRM1 and 2, and the other in the C-terminal domain (98). Paip2 binds to PABP with 2:1 stoichiometry and the two independent K(d)s as determined by Biacore and Far-Western analysis are 0.66 and 74 nM (100). Paip2 has two PABP binding sites, located in the central region and the C-terminus. In addition, PABP also has two binding regions for Paip2, one is located at RRM 2 and 3, and the other is at the C terminus.

1.2.5.3 Cytoplasmic polyadenylation mediated translational control

Cytoplasmic polyadenylation is a mechanism regulating translation in early development and long-term memory (101). In this process, translationally dormant (masked) mRNAs containing a cytoplasmic polyadenylation element

(CPE) undergo regulated polyadenylation and mobilize to polysomes for translation. This CPE-mediated translational control pathway is well studied in

Xenopus oocyte maturation. In Xenopus, immature oocytes store a large population of dormant maternal mRNAs with relatively short poly(A) tails of about

20-40 nt. Translation of these mRNAs is activated when the tails are elongated to about 150-nt during oogenesis. CPE and the CPE binding protein CPEB are

27 both required for translation repression in immature oocytes and poly(A) tail elongation during oocyte maturation. Another protein factor named maskin is also necessary for translation repression (101). CPEB is a highly conserved

RNA-binding protein that contains a zinc finger motif and an RNA recognition motif (RRM). It interacts with maskin which in turn binds to the same region of eIF4E that eIF4G and 4E-BPs bind. As the result of these protein interactions, eIF4E separates from eIF4G and translation is inhibited. Upon stimulation by progesterone, oocyte maturation begins. CPEB is phosphorylated by the kinase

Eg2 and then recruits the cleavage and polyadenylation specificity factor (CPSF) and poly(A) polymerase (PAP) to elongate the poly(A) tail. Simultaneously, maskin dissociates from eIF4E. Translation is then activated (102). Dissociation of maskin from eIF4E might be due to the stable PABP-eIF4G-eIF4E interaction followed by polyadenylation, which out-competes maskin binding to eIF4E (101).

1.2.5.4 Viral infection

Viruses often suppress translation of mRNAs from host cells and use the cellular translation machinery to synthesize their own proteins. Some viral mRNAs differ from cellular mRNAs at the 5’ and/or 3’ end structures. Therefore, modification of the cap-eIF4E-eIF4G-PABP-poly(A) interactions in cells can be an efficient way for those viruses to shut down translation of cellular mRNAs.

28 1.2.5.4.1 Picornaviruses

Picornaviruses are a large family of viruses including six genera:

Enterovirus (including poliovirus PV), Rhinovirus, Aphthovirus (including foot- and-mouth disease virus FMDV), Cardiovirus (including encephalomyocarditis

virus EMCV), Hepatovirus (including hepatitis A virus HAV) and Parechovirus.

They all have a positive-strand RNA genome. The viral RNA lacks a 5’-

m7GpppN cap structure but contains a very long 5’-untranslated region (610- to

>1200-nt) that folds into a complex secondary structure termed the internal ribosomal entry site (IRES). The cap-independent translation of these viral RNAs is through the direct entry of the ribosome at an IRES.

One IRES-mediated translation initiation pathway requires the middle and

C-terminal domains of eIF4G to bind at an IRES and recruit the 40S preinitiation complex through eIF4G-eIF3 interaction. Enterovirus, rhinovirus and aphthovirus encode proteases – protease 2A from enterovirus and rhinovirus, and protease L from FMDV – that cleaves eIF4G to remove the N-terminal domain that interacts with eIF4E and PABP. This cleavage suppresses the host cell’s cap-dependent translation but leaves the C-terminal two thirds of eIF4G intact for viral cap- independent, IRES-mediated translation (103). In a similar yet distinct mechanism, poliovirus-encoded protease 3C cleaves the C-terminal domain from

PABP to suppress cellular translation. A recent study showed that cleavage of

PABP inhibited cellular mRNA translation as severely as cleavage of eIF4G by protease 2A in HeLa translation lysates, although cleavage of PABP by protease

29 3C does not affect PABP-eIF4G interaction. Protease 3C seems to suppress

cellular mRNA translation at the late steps after initiation and during ribosome

recycling (104).

Cardiovirus (such as EMCV) infection does not lead to cleavage of eIF4G

but activates dephosphorylation of 4E-BPs by some unknown mechanism.

Dephosphorylated 4E-BPs bind to eIF4E and prevent it from interacting with

eIF4G thus inhibiting the formation of the cap-binding complex eIF4F. This

suppresses cellular cap-dependent translation but leaves the viral IRES- mediated, cap-independent translation unaffected (103) (Figure 1.2 C).

1.2.5.4.2 Rotavirus

Rotavirus has a double stranded RNA genome. The viral RNA is capped but not polyadenylated. One non-structural protein encoded by the viral RNA,

NSP3, is responsible for promoting viral protein synthesis. NSP3 forms a homodimer and binds to a viral RNA 3’ consensus (105). In addition to binding

RNA, NSP3 interacts with eIF4G and is functionally equivalent to PABP for circularizing viral RNA for translation. Moreover, the NSP3 binding site on eIF4G overlaps with the PABP binding site, but NSP3 has higher affinity for eIF4G than

PABP, so viral RNA is more efficiently translated than cellular polyadenylated mRNA (106).

30 1.2.5.4.3 Influenza virus

Influenza virus has a small negative-segmented RNA genome and its

replication cycle includes both nuclear and cytoplasmic phases. It shuts down

host cell gene expression by altering many steps of cellular mRNA metabolism, including inhibition of mRNA splicing, 3’-end processing and export as well as

degradation of cellular mRNAs both in the nucleus and in the cytoplasm. The

viral mRNA is similar to cellular mRNA in that it is both capped and

polyadenylated, but the viral mRNA has a unique sequence in its 5’-UTR that is

capable of directing efficient and specific translation. One of the 5’UTR-

interacting factors is the cellular protein GRSF-1 (guanine-rich sequence factor 1) that selectively recruits viral mRNA to polysomes and stimulates its translation.

The viral-encoded non-structural protein NS1 is also critical for host shutoff and

efficient expression of viral genes. In the nucleus, NS1 interacts with the 30-kDa

subunit of CPSF and nuclear polyA binding protein PABPN1, which suppresses

cellular mRNA 3’ processing and causes nuclear retention of cellular

polyadenylated mRNA (107). Interestingly, in the cytoplasm, NS1 associates

with polysomes and interacts simultaneously with both eIF4G and PABP. This

might reinforce the connection between the two ends of the viral RNA and

enhance its translation (108). Moreover, influenza virus infection also leads to

the dephosphorylation of eIF4E, which decreases the cap-binding affinity of

eIF4E and suppresses host translation without any effect on viral mRNA

31 translation. This suggests that translation of viral mRNA is less susceptible to the limitation of eIF4F (107).

1.2.6 Length dependent translation stimulation by the poly(A) tail

As previously discussed, the poly(A) tail plays important roles in mRNA translation. For most eukaryotic mRNAs, the function of poly(A) tails as translation enhancers is length dependent, as evidenced by in vitro translation experiments using either cell extract (62;109-111) or electroporated cells (112).

For example, a 15-nt poly(A) tail barely stimulates the translation of a capped transcript in HeLa cell extract, but progressively increasing the tail length from 31 nt to 98 nt stimulates translation up to 10 fold (111). In addition, a PABP-MS2 fusion protein stimulates translation of reporter mRNAs with multiple MS2 binding sites in place of a poly(A) tail (113), which suggests that mRNAs with longer poly(A) tails are translated more actively because there are more copies of PABP bound at the 3’ end of the mRNA.

1.3 Poly(A) limiting element (PLE)

Although most mRNAs require a long poly(A) tail for efficient translation, an exception was observed by the Schoenberg lab. It was observed that although albumin mRNA from Xenopus laevis has a distinct short poly(A) tail of

17 nt (114), it is efficiently translated. Albumin mRNA sediments exclusively with polysomes, and albumin is the most abundant serum protein produced in frog

32 liver (115). Two related cis-elements located in the last exon (exon 15) of

albumin mRNA that restricted the poly(A) tail to a length of less than 20 nt were

identified. These elements were named poly(A) limiting element A and B, or

PLE-A and PLE-B. Each PLE is sufficient to restrict the length of the poly(A) tail

of a reporter globin mRNA to less than 20 nt when it is located in the terminal

exon (116). The short poly(A) tail on PLE-containing mRNA is not due to

cytoplasmic deadenylation. The short tail forms before the mRNA is spliced in

the nucleus, as shown by RT-PCR assay with a primer recognizing the

region (117). A PLE-like element was also identified in Xenopus transferrin

mRNA, which also has a <20-nt poly(A) tail (118). Later, a genebank search

identified at least 100 genes bearing a PLE-like element in organisms from

Caenorhabditis elegans to humans (119). One gene identified was HIV-

EP2/Schnurri 2, a T cell-specific human homolog of Drosophila Schnurri-2

transcription factor that stimulates HIV-1 provirus transcription. The HIV-EP2

mRNA was tested and found to have a poly(A) tail <20 nt (119). Moreover, the

PLE in HIV-EP2 mRNA shares similar properties with Xenopus albumin PLE: it limits the poly(A) tail of human β-globin reporter mRNA to <20 nt in transfected cells and it regulates the length of the poly(A) tail on nuclear pre-mRNA.

33 1.3.1 Sequence of PLE

The sequences of PLEs identified to date are listed as follows:

PLE-A 5’ AAACUCACUGAGGAACA 3’

PLE-B 5’ AAAGUUCCUUCAGCUGAAAAGAG 3’

transferrin 5’ AGUUUAUUCUCAGAUGUGGGAGG 3’

HIV-EP2 5’ AAAGAUCCUUCAUCAGAAAAGAG 3’

PLEs are characterized by two to three adenosine residues at the 5’ end, then a stretch of up to eight pyrimidines (interrupted by a single “A” in some cases), followed by a stretch of up to nine purines with a predominance of “A” residues. Mutagenesis analysis indicated that the 5’ pyrimidine-rich portion is essential, as deleting this region or changing every other pyrimidine to a purine completely inactivated the PLE, although changing the two central pyrimidines to purines had a more modest effect. The 3’ purine-rich portion seems to be dispensable, as disrupting the contiguous stretch of purines by changing

GAAAAGA to ACUGCA had no effect on PLE function (119).

1.3.2 PLE binding proteins: PLE-BPs

The mechanism by which the PLE regulates poly(A) tail length in the nucleus is not clear yet. RNA electrophoretic mobility shift assay (EMSA) using

HeLa nuclear extract and a probe containing PLE-A and PLE-B showed the formation of three RNA-protein complexes. Furthermore, the addition of

34 increasing amounts of nuclear extract to the binding reaction caused these

complexes to merge and form a bigger complex, which suggests that a multiple-

component complex assembles on the PLE AB transcript (120). Tremendous

effort has been put into identifying trans-factors that bind to the PLE and function

in processing PLE-containing pre-mRNAs. Using UV-crosslinking analysis, a 65-

kDa protein from HeLa nuclear extract was detected that specifically interacted

with PLE-B. This protein was purified by conventional chromatography and

identified as the U2 snRNP auxiliary factor U2AF65 by MALDI TOF MS (matrix

assisted laser desorption/ionization time of flight mass spectrometry) and direct

sequencing of tryptic peptides. U2AF is an essential splicing factor that defines

the 3’ splice site (121-124) and links 3’ processing to terminal intron splicing

through its interaction with poly(A) polymerase PAP (125;126). Overexpression of wild type U2AF65 in transfected cells caused a PLE-containing reporter mRNA to possess a long poly(A) tail, however, expression of a U2AF65 with a deletion of the C-terminal RRMs had no effect on PLE regulation of poly(A) tails. On the other hand, overexpression of wild type U2AF65 restored the function of an inactive PLE mutant. These results suggest that U2AF65 modulates the function of the PLE, probably through interaction with other PLE binding proteins (127).

Besides U2AF65, a 50-kDa protein that interacted with the PLE was detected in HeLa nuclear extract by Northwestern blotting. This 50-kDa protein was also purified by conventional chromatography and identified as La autoantigen by mass spectrometry (120). La autoantigen is an RNA binding

35 protein with many biological functions. Its involvement in small RNA biogenesis has been well studied: La binds to the 3’ ends of all nascent transcripts from

RNA polymerase III, and this interaction stabilizes the small RNAs and facilitates

pre-tRNA maturation. La also stimulates translation of specific RNAs, including

viral mRNAs from poliovirus, hepatitis C virus (HCV), encephalomyocarditis virus

(EMCV) and cellular mRNAs containing a 5’ terminal oligopyrimidine (TOP)

sequence (128).

Finally, using a biotin-labeled PLE RNA transcript, the splicing factor

multiprotein complex SF3b was pulled down with streptavidin beads

(communication with Yan Chen, unpublished data). SF3b is an integral component of the U2 snRNP and the U11/U12 di-snRNP that is involved in the recognition of the branch site on pre-mRNA (129).

However, it is still not clear what roles, if any, La and SF3b play in poly(A) tail formation on PLE-containing mRNAs.

1.4 Specific aims of this study

PLE-containing mRNAs have a distinct short poly(A) tail when they exit the nucleus. Unlike most other mRNAs for which carrying short poly(A) tails means translation suppression and rapid degradation, PLE-containing Xenopus

albumin mRNA with a 17-nt poly(A) tail is well translated and very stable in frog hepatocytes. When the cells are stimulated by estrogen to produce yolk proteins, albumin mRNA is quickly degraded by a polysome-bound endo-

36 ribonuclease PMR1 (114;130;131). This suggests PLE-containing mRNAs with a short poly(A) tail belong to a particular class of mRNAs whose metabolism is regulated by a distinct pathway. On the other hand, a number of sequence elements upstream of the 3’ processing signal (USEs) affects the 3’ processing efficiency (as discussed in section 1.1.1.1). The PLE was identified as a USE regulating poly(A) tail length, but whether or not it also affected the efficiency of pre-mRNA 3’ processing was unknown. The purpose of this study was to examine the impact of the PLE on mRNA 3’ processing efficiency and translation, and furthermore, to explore how this special group of mRNAs is regulated in these aspects. The specific aims were:

1.4.1 Determine whether the PLE also functions to modulate the efficiency of pre-mRNA 3’ processing

Earlier work in the Schoenberg lab showed that PLE-containing β-globin reporter constructs expressed in transfected cells were more abundant at the steady state level than a non-PLE-containing control. Nuclear run-on transcription assays showed that the PLE does not affect the rate of transcription.

Therefore, it seemed that the PLE increases the mRNA steady state level post- transcriptionally. One possibility was that the PLE enhanced pre-mRNA 3’ end processing. RNase protection assay (RPA) was used to compare the steady state levels of nuclear and cytoplasmic β-globin reporter mRNA with or without a

PLE, and the result confirmed that in both nuclear and cytoplasmic fractions

37 there is about 50% more β-globin mRNA with a PLE than the control without a

PLE. In addition, quantitative RT-PCR indicated that less PLE-containing pre-

mRNA remains in the nucleus. RNase protection assay also showed that the

ratio of mature mRNA versus uncleaved pre-mRNA from PLE-containing

construct was higher than the ratios of constructs without a PLE or with an inactive PLE mutant. These results indicated that the PLE enhances the 3’

cleavage process in vivo. Finally, an in vitro cleavage assay with HeLa cell

nuclear extract showed that PLE-containing pre-mRNA is cleaved more efficiently than control pre-mRNA lacking a PLE.

1.4.2 Examine impact of the PLE on the translation of mRNAs with short poly(A) tails

Since most eukaryotic mRNAs require long poly(A) tails for efficient translation, I sought to determine whether the PLE-containing mRNA with a short poly(A) tail could be translated efficiently in transfected mammalian cells. Firefly luciferase was used as a reporter to examine the impact of PLE on the translation of mRNAs with short poly(A) tails. RT-PCR assays showed that the

PLE can restrict the poly(A) tail of intronless luciferase mRNA to <20 nt, and luciferase activity assays showed this PLE-containing, short-tailed mRNA is translated as well as a control mRNA with a long poly(A) tail. Moreover, a sucrose gradient polysome profile analysis showed that PLE-containing luciferase reporter mRNA associates with polysomes as well as control mRNA

38 lacking a PLE. Next, an in vitro translation system using HeLa cell cytoplasmic

extract was developed that had showed synergy between the cap and poly(A)

tail. In addition, in this system, the efficiency of translation was controlled by the

length of the poly(A). In contrast to results obtained in vivo, the PLE didn’t

stimulate the translation of luciferase transcripts with short poly(A) tails (A14 and

A20) in vitro. This result raised the possibility that nuclear events are essential for the efficient translation of PLE-containing mRNAs with short poly(A) tails, since the in vitro transcripts used in the in vitro translation assays lacked a nuclear experience. This hypothesis was confirmed by directly transfecting mRNA into cells, in which case PLE-containing mRNAs with short poly(A) tails were not

translated as efficiently as control mRNAs with long poly(A) tails.

1.4.3 Analyze the effect of PLE-BPs and modulators of PABP on the translation of PLE-containing mRNAs with short poly(A) tails

Since several proteins had been found that bind to the PLE, the question was if they could stimulate translation of PLE-containing mRNAs. U2AF65 and

SF3b are nuclear splicing factors that are also present in the cytoplasm. Sucrose density gradients were used to determine the distribution of these two proteins in the cytoplasm. The results showed that a population of them associate with polysomes, suggesting that U2AF65 and SF3b can function in translation.

Therefore, U2AF65 and SF3b were added to in vitro translation reactions to examine if the translation of PLE-containing mRNAs could be enhanced.

39 However, U2AF65 and SF3b had only a moderate stimulatory effect on the translation of all transcripts, and this effect was not specific to PLE-containing mRNAs.

La protein had been shown to enhance the translation of IRES-mediated translation of HCV, poliovirus and EMCV mRNAs. La purified from HeLa nuclear extract was added to the in vitro translation reaction mixture, but it didn’t stimulate translation of PLE-containing mRNA with a short poly(A) tail. On the other hand, a La dominant negative mutant containing an N-terminal deletion of the RRMs was added to in vitro translation reactions to test if La was also involved in the translation of PLE-containing mRNAs. However, this La mutant had no effect on the translation of any of the transcripts tested.

For most mRNAs with long poly(A) tails, the binding of multiple copies of the PABP to the tail enhances translation. We hypothesized that the PLE, possibly in combination with PLE-BPs, functions as a substitute for a long poly(A) tail, and that limiting the availability of PABP would have a less negative effect on the translation of PLE-containing mRNAs versus non-PLE-containing mRNAs.

To test this, exogenous poly(rA) or PABP inhibitory protein Paip2 were added to in vitro translation reactions, and under both conditions, PLE-containing mRNA with a 20-nt poly(A) tail was translated 30-50% more efficiently than the control mRNA with matching poly(A) tails. These results support the hypothesis that the

PLE functionally substitutes for PABP-bound poly(A) to stimulate the translation of mRNAs with short poly(A) tails. The low efficiency of stimulation observed in

40 vitro and in mRNA transfected cells might be due to the fact that these mRNAs did not undergo nuclear processing.

41

Figure 1.1. Circular translation Model. During translation initiation, eIF4E binds to the cap structure m7GpppN, and PABP binds to poly(A) tail, so that the two ends of mRNA are connected through eIF4E-eIF4G-PABP interaction. eIF4A also binds to eIF4G and unwinds secondary structure in the 5’ UTR, and this activity is facilitated by eIF4B. On the other hand, eIF2 interacts with GTP and Met-tRNAi then binds to eIF3/eIF1/eIF5 and subsequently binds to the 40S ribosome, which is termed the 40S initiation complex and loaded to mRNA through eIF3-eIF4G interaction to form 43S initiation complex. The 43S initiation complex scans the 5’UTR of mRNA until it finds the initiation codon AUG and stalls. GTP on eIF2 is hydrolyzed and the initiation factors are released, followed by joining of the 60S ribosome to form the 80S ribosome and formation of the first peptide bond. Multiple ribosomes can be loaded on a single mRNA to form a circular polysome, which has been observed by microscopy.

42 eIF4G AUG eIF4E AUG AAA AAA AUG

AAA eIF4A eIF4B

eIF1 eIF3 Met- tRNAi 40S eIF5

GTP eIF2 40S initiation complex

scanning AUG AUG

60S joining AAA AAA 43S initiation complex GTP hydrolysis factors released

AUG AUG

AAA AAA 80S initiation complex Circular ribosome

Figure 1.1 Circular translation Model

43

Figure 1.2. Multiple types of circular mRNA. A. Most mammalian mRNA forms a circle through eIF4E-eIF4G-PABP interaction; B. Histone mRNA (except yeast histone) forms a circle through SLBP-eIF4G interaction; C. Picornavirus mRNA (e.g. EMCV) forms a circle through possible IRES binding protein(s); D. Rotavirus mRNA forms a circle through NSP3-eIF4G interaction.

44

eIF4G eIF4G eIF4E eIF4E eIF4A eIF4A AUG AUG SLBP PABP 3’ AAA A. Mammalian mRNA B. Histone mRNA

eIF4G eIF4G Binding protein eIF4E eIF4A eIF4A AUG 5’ AUG IRES NSP3 PABP AAA 3’

C. EMCV mRNA D. Rotavirus mRNA

Figure 1.2 Multiple types of circular mRNA

45

CHAPTER 2

MATERIALS AND METHODS

2.1 Plasmid construction

The following plasmids were constructed according to the standard

cloning procedures described in (132). All the primer sequences are listed in

Table 2.1.

2.1.1 Plasmids used for transfection

2.1.1.1 CMV-luc-SPA and CMV-luc-PLEB-SPA

The construction of the plasmids CMV-glo-SPA and CMV-glo-PLEB-SPA were described previously (116;133). To prepare CMV-luc-SPA, CMV-glo-SPA was digested with Asp718 and end-filled with Klenow fragment of DNA polymerase followed by digestion with NcoI to remove the globin cassette, leaving intact the CMV promoter and the SPA 3’ processing element. The firefly

(Photinus pyralis) luciferase gene was obtained from pGtetOβAcluc3, generously provided by Jose Garcia-Sanz. This plasmid was first digested with XbaI, followed by end-filling using the Klenow fragment of DNA polymerase, and

46 second digested with NcoI. The recovered luciferase gene was cloned into the

CMV promoter-containing constructs prepared above. The fragment containing the PLEB sequence was obtained by annealing primers YC1 and Joy30. It was inserted into CMV-luc-SPA at the XbaI site to generate CMV-luc-PLEB-SPA.

2.1.1.2 CMV-glo-SPA-X200, CMV-glo-PLEB-SPA-X200 and CMV-glo-MutG-

SPA-X200

The construction of plasmid CMV-glo-PLEA-SPA-X200 was described previously (133). This plasmid was digested with XbaI to generate a 158-bp fragment, which was originally from ΦX174/HinfIII marker. The 158-bp fragment

(X200) was subsequently inserted to plasmids CMV-glo-SPA, CMV-glo-PLEB-

SPA and CMV-glo-MutG-SPA at XbaI site.

2.1.1.3 pcDNARluc

The fragment containing Renilla (Renilla reniformis) luciferase cDNA was obtained by digesting pRL-TK (Promega) with HindIII and XbaI. It was ligated into vector pcDNA3 at HindIII and XbaI sites.

2.1.2 Plasmids used as templates to generate antisense probes

2.1.2.1 pTopo-gloA2

LM(tk-) cells were transfected with CMV-glo-SPA, and the fragments spanning the three of human β-globin (40 nt from the 3’ end of exon1, the entire exon2 and 42 nt from the 5’ end of exon3) was generated by RT-PCR with 47 primers Kgloex1 and Kgloex3. The fragment obtained above was cloned into

pCRII-TOPO vector (Invitrogen) following the manufacturer’s instruction.

2.1.2.2 pBS-X200

The plasmid CMV-glo-SPA-X200 was completely digested with HindIII and

partially digested with XbaI. The 225-bp fragment that contained X200 and SPA

was ligated into pBluescript SK(+) (pBSK) at XbaI and HindIII site.

2.1.2.3 pGEMPL156

The 156-bp fragment corresponding to the first 156-nt of the coding

sequence of firefly luciferase was amplified from pGtetOβAcluc3 by PCR using

primers JP15 and JP17. It was digested with EcoRI and HindIII, and ligated into the pGEM3Z vector digested with the same .

2.1.2.4 pGEMRL289

The 289-bp fragment corresponding to the first 289-nt of the coding

sequence of Renilla luciferase was amplified from pRL-TK (Promega) by PCR

using primers JP19 and JP20, digested with EcoRI and HindIII, and ligated into

the pGEM3Z vector digested with the same enzymes.

48 2.1.2.5 pBSPL156 and pBSRL289

The plasmids pGEM-PL156 and pGEM-RL289 were digested with HindIII, end-filled with the Klenow fragment of DNA polymerase and digested with EcoRI.

The DNA fragments containing the firefly and Renilla luciferase sequences were then each ligated into vector pBluescript SK(+) (pBSK) at EcoRI and SmaI sites.

2.1.2.6 pTopII-Alb

The cDNA fragment spanning the Xenopus 68-kDa albumin exons 14 and

15 was generated from Xenopus larvae total RNA by RT-PCR with primers XG10 and HG11. This cDNA fragment was cloned into pCRII-TOPO vector (Invitrogen) following the manufacturer’s instruction.

2.1.3 Plasmids used as templates to generate transcripts for in vitro cleavage assays:

2.1.3.1 pGgloEx3SPA and pGgloEx3PLEBSPA

CMV-glo-SPA and CMV-glo-PLEB-SPA were digested with HindIII, end- filled with the Klenow fragment of DNA polymerase and then digested with

EcoRI. The small fragments (91 bp from CMV-glo-SPA and 108 bp from CMV- glo-PLEB-SPA) were ligated into the pGEM3Z vector digested with EcoRI and

SmaI restriction enzymes.

49 2.1.3.2 pGEM(PLEB)4 and pGEM(MutG)4

To generate a fragment with multiple copies of PLEB, primers YC1 and

Joy30 were annealed, digested with XbaI then ligated. The ligated product was

treated with T4 DNA polymerase to remove the protruding ends, then cloned into

the vector pGEM3Z at the SmaI site. After screening many colonies by

sequencing, a plasmid containing four copies of PLEB was selected and named

pGEM(PLEB)4. The plasmid pGEM(MutG)4 was constructed similarly. The

primers used to generate multiple copies of MutG were YC2 and YC3.

2.1.3.3 pGEx3(PLEB)4SPA and pGEx3(MutG)4SPA

The (PLEB)4 and (MutG)4 fragments lifted from pGEM(PLEB)4 and pGEM(MutG)4 by EcoRI and HincII restriction digestion were ligated into the

pGgloEx3SPA vector digested by EcoRI and SmaI restriction enzymes.

2.1.4 Plasmids used as templates to generate luciferase transcripts with

poly(A) tails of different lengths

2.1.4.1 Cloning of part of β-globin exon3 with A14, A54 or A78 into the

pGEM3Z vector

LM(tk-) cells were transfected with CMV-glo-SPA, and fragments

containing part of globin exon3 with different poly(A) tail lengths were amplified

by RT-PCR with primers XG1 and XG4. The fragments obtained above were

digested by BamHI and then cloned into the vector pGEM3Z at the BamHI site.

50 DNA sequence analysis was used to identify clones with 14-, 54- and 78-nt

poly(A) tracts, and those plasmids were used as vectors for further cloning.

2.1.4.2 Insertion of the entire β-globin exon3 into the pGEM A14, A54 or A78 vectors

Next, the entire globin exon3 was amplified by PCR from plasmid CMV- glo-SPA with primers Joy18 and Joy26, then inserted into the A14, A54 and A78 constructs made above at the XbaI and HincII sites.

2.1.4.3 pGglo-A14, A54, A78

Full-length globin cDNA was generated by RT-PCR with primers SP6gloC and HG35 using total RNA from CMV-glo-SPA- transfected LM(tk-) cells as template. This fragment was digested with BstXI then inserted into the A14, A54, and A78 plasmids that were digested with PstI, treated with T4 DNA polymerase then digested with BstXI. The constructs obtained were named pGglo-A14, pGglo-A54 and pGglo-A78.

2.1.4.4 pGluc-A14, A54, A78 and pGluc-PLEB-A14, A54, A78

The fragments containing firefly luciferase without or with a PLE were obtained by digestion of CMV-luc-SPA or CMV-luc-PLEB-SPA by NcoI and BglII.

These fragments were used to replace the β-globin cDNA in the plasmids pGglo-

A14, A54, A78 that were digested by NcoI and BglII.

51 2.1.4.5 pGluc-PLEB-A98 and pGluc-A98

The plasmid T3LucA98, kindly provided by Dr. Nahum Sonenberg, was

digested with EcoRI, end-filled with the Klenow fragment of DNA polymerase,

then digested with BamHI. The fragment containing a 98-nt poly(A) stretch was used to replace the 14-nt poly(A) tract (A14) from pGLuc-PLEB-A14 to construct

pGluc-PLEB-A98. A14 was removed by digestion with BglII followed by end-filling

with the Klenow fragment of DNA polymerase and digestion with BamHI. The

plasmid pGLucA98 was generated by removing the PLEB from pGluc-PLEB-A98

by XbaI digestion followed by religation of the plasmid.

2.1.4.6 pGluc-A20 and pGluc-PLEB-A20

Primers JP23 and JP25 were annealed. The obtained double stranded

DNA fragment was end-filled with the Klenow fragment of DNA polymerase to

generate a fragment containing a 20-nt poly(A) stretch (A20). The A20 fragment

was then used to replace A14 from pGLuc-A14 and pGLuc-PLEB-A14 between

the BglII and SstII sites.

2.1.4.7 pGRluc-A78

The fragment containing Renilla luciferase was lifted from plasmid pRL-TK

(Promega) by NheI and XbaI digestion. To clone pGRLucA78, the fragment obtained above was used to replace the firefly luciferase sequence in plasmid pGlucA78 at the NheI and XbaI sites.

52 2.1.4.8 pGluc-EPPLE-A20, A98

To generate a fragment containing the HIV-EP2 PLE, primers EP10 and

EP11 were annealed, end-filled with the Klenow fragment of DNA polymerase,

and digested with XbaI and SalI restriction enzymes. The HIV-EP2 PLE insert

was ligated into pGluc-A20 and pGluc-A98 vectors digested with XbaI and SalI to

construct pGluc-EPPLE-A20 and pGluc-EPPLE-A98.

2.2 Cell culture

Cos-1, Cos-7, LM(tk-) and CHO cells were grown in Dulbecco’s Minimal

Essential Medium (DMEM, Gibco) with 10% fetal bovine serum (FBS) and 2 mM

L-glutamine. HeLa S3 cells were maintained in DMEM with 10% FBS and 4 mM

L-glutamine. To grow Hels S3 cells in suspension, attached cells were

trypsinized and seeded to a 250-ml spinner flask at 5-8 x 104 cells/ml, which was

subsequently used to inoculate a 1-L spinner flask. All cells were kept in a 37oC incubator supplemented with 5% CO2.

2.3 Transfection of Cos-1 cells

The day before transfection, 3.5 x 106 cells per 150 mm dish were plated in complete growth medium. For each 150 mm dish of cells to be transfected, 30

µl Fugene-6TM was added to 870 µl serum free DMEM (Gibco) and incubated for

5 min at room temperature. Next, 10 µg total plasmid DNA was added and the

53 DNA/Fugene-6TM mixture was incubated for 20 min at room temperature before

being added to the cells. The cells were harvested 24 hrs after transfection.

2.4 Transfection of LM(tk-) cells

For plasmid DNA transfection, 8 x 105 cells per 60 mm dish were plated in complete growth medium the day before transfection. For each plate, 5 µg

plasmid DNA was diluted in 150 µl DMEM without serum. Thirty µl of

SuperFectTM (Qiagen) was added and the mixture was incubated for 5-10

minutes at room temperature. At the end of the incubation, 1 ml complete growth

medium with serum was added to the DNA/SuperFectTM mixture. The mixture

was then transferred to the cells that had been washed once with 4 ml phosphate

buffered saline (PBS, Gibco). After a 3-hr incubation at 37oC, the cells were

washed twice with 4 ml PBS and grown in fresh complete medium for 24-48 hrs

until harvest. The amount of each reagent to transfect LM(tk-) cells plated in

different size dishes are summarized as follows:

Plate size Cell number DMEM SuperFectTM Plasmid DMEM (-FBS) (+FBS) 6-well 4 x 105 100 µl 10 µl 2 µg 600 µl 60 mm 8 x 105 150 µl 30 µl 5 µg 1 ml 100 mm 2.4 x 106 300 µl 50 µl 10 µg 3 ml 150mm 5 x 106 500 µl 100 µl 20 µg 7 ml

54 For RNA transfection, 1.6 x 104 LM(tk-) cells per well were seeded in a 96-

well plate the day before transfection. For each well, 0.4 µl LipofectamineTM

2000 reagent (Invitrogen) was mixed with 10 µl Opti-MEM® and incubated for 5-

10 min at room temperature. Meanwhile, 160 ng (240 pmol) of each firefly

luciferase transcript and 40 ng (120 pmol) of m7GpppG capped Renilla luciferase

transcript with a 78-nt poly(A) tail (RLA78) were diluted in 10 µl Opti-MEM® medium. The diluted RNA and the diluted LipofectamineTM 2000 reagent were

mixed and incubated for 20 min at room temperature, then added to the cells.

The cells were incubated at 37oC for 1 hr before harvest. When 24-well dishes

were used, 8 x 104 cells were seeded in each well and transfected with 800 ng of

each firefly luciferase transcript, 200 ng of capped RLA78 transcript and 2 µl of

LipofectamineTM 2000 reagent. The volume of Opti-MEM® used to dilute either

RNA or LipofectamineTM 2000 reagent was 50 µl.

2.5 Total RNA extraction

In most cases, the TRIzol® reagent (Invitrogen) was used to extract total cellular RNA. At the time of harvest, cells were washed twice with ice cold PBS.

For each 60 mm dish of cells, 1 ml TRIzol® was added to the plate to lyse the

cells. The homogenized sample was then transferred to a 1.5 ml centrifuge tube

to which 200 µl chloroform was added. The sample was shaken vigorously then

incubated for 3 min at room temperature, followed by centrifugation at 12,000 xg

for 15 min in a refrigerated microcentrifuge. The aqueous phase was collected

55 and 500 µl isopropanol was added to precipitate the RNA. The total RNA was

recovered by centrifugation at 12,000 xg for 15 min and washed once with 1 ml

75% ethanol. Finally, the RNA was dissolved in 30-50 µl diethyl pyrocarbonate

(DEPC) treated water.

When the RNA was to be used for quantitative RT-PCR analysis, the

Absolutely RNA® RT-PCR mini-prep kit (Stratagene) was used for RNA extraction, because it includes a step for DNase I digestion. The instructions from the manufacturer were followed in these cases.

2.6 Extraction of cytoplasmic and nuclear RNA

Each 100 mm dish of cells were washed twice with ice cold PBS, and the cells were scraped off into 1.5 ml cold PBS. The cell pellet was collected by

centrifugation at 100 xg for 2 min. The cell membranes were lysed by incubation with 400 µl cytoplasmic RNA extraction buffer (0.14 M NaCl, 1.5 mM MgCl2, 10 mM Tris/HCl pH 8.0, 1 mM dithiothreitol (DTT), 0.5% Nonidet P-40 (NP-40) for 5 min on ice. The sample was then centrifuged at 12,000 xg for 90 seconds at

4oC. Nuclear RNA was extracted from the pellet using the Absolutely RNA® RT-

PCR mini-prep kit by adding 600 µl lysis buffer. Cytoplasmic RNA was extracted from the supernatant by 2 ml TRIzol®.

56 2.7 Labeling of the 5’ end of DNA oligo-nucleotides with [γ-32P]-ATP

A typical 20 µl labeling reaction mixture included 1 µg DNA oligo, 2 µl 10x

T4 PNK buffer (provided with the ), 3 µl 3000 Ci/mmol, 10 mCi/ml [γ-32P]-

ATP and 1 µl T4 polynucleotide kinase (Roche). This was incubated at 37oC for

30-60 min and heated at 65oC for 10 min to inactivate the enzyme. The product

was stored at –80oC.

2.8 Quantitative RT-PCR to detect pre-mRNA

Two µg nuclear RNA was reverse transcribed in a 20 µl reaction with

primer JP29 and SuperScriptTM II reverse transcriptase (Invitrogen) according to

the instructions from the manufacturer. The PCR reaction mixture contained the

following components: 1 µl reverse transcription product, 1 µl 10 x Taq DNA

polymerase buffer (Invitrogen, packed with the enzyme), 0.4 µl 50 mM MgCl2, 0.2

µl 10 mM dNTP mixture diluted from 100mM dATP, dCTP, dGTP and dTTP solutions (Invitrogen), 0.4 µl 100 ng/µl primer JP29, 0.5 µl 80 ng/µl [32P]-labeled

primer Bvluc1 (for luciferase mRNA) or XG1 (for human β-globin mRNA), 0.1 µl

Tag DNA polymerase and 6.5 µl water. The PCR reaction was performed as follows: 1 cycle of 2 min at 94oC, 13 cycles of 50 sec at 94oC, 50 sec at 58oC and

30 sec at 72oC, and 1 cycle of 2 min at 72oC. The PCR products were separated

on a 6% polyacrylamide/urea gel (National Diagnostics). The gel was dried,

visualized and analyzed by phophorimager analysis.

57 2.9 The poly(A) tail length assay

A ligation-mediated poly(A) tail length (LM-PAT) assay was used to

analyze the lengths of the poly(A) tails from the reporter mRNAs extracted from

transfected cells. For the luciferase mRNA poly(A) tail length assay, 250 ng total

RNA in 5 µl was incubated with 2 µl 10 ng/µl 5’-phosphate-(dT)15 for 10 min at

65oC before the following reaction components were added: 4 µl 5x 1st strand buffer (Invitrogen), 1 µl RNase Inhibitor (Invitrogen), 0.1 M DTT, 10 mM dNTP

mixture diluted from 100mM dATP, dCTP, dGTP and dTTP solutions (Invitrogen),

10 mM ATP, 3 µl water and 1.5 µl T4 DNA . After incubation at 42oC for 30 min, 1 µl of 200 ng/µl XG2 primer (Table2.1) was added and the reaction mixture was transferred to 12oC immediately for a 2-hr ligation. One µl SuperScriptTM II

reverse transcriptase (Invitrogen) was added and the reaction mixture was

incubated for 1 hr at 42oC, followed by inactivation of the enzyme at 65oC for 20

min. Three µl of the cDNA obtained above was added to the following reaction

components combined in a hot-start PCR tube (Molecular Bioproducts): 2.5 µl 10

x Taq DNA polymerase buffer (Invitrogen, packed with the enzyme), 3 µl 1.25

o mM dNTP mixture, 1 µl 50 mM MgCl2 and 2 µl water. This was heated at 94 C just long enough to melt the wax in the hot-start tube, then the remaining components of the PCR reaction were added, including: 12 µl water, 1 µl of 50 ng/µl 5’-[32P]-labeled BVluc1 primer (Table2.1) and 0.2 µl Taq DNA polymerase

(Invitrogen). The PCR reaction was performed as follows: 1 cycle of 2 min at

94oC, 25 cycles of 1 min at 94oC, 30 sec at 65oC and 1 min at 72oC, and 1 cycle 58 of 2 min at 72oC. The PCR products were separated on a 6%

polyacrylamide/urea gel (National Diagnostics). The gel was dried, visualized

and analyzed by phophorimager analysis.

2.10 In vitro transcription

2.10.1 Internally [32P] labeled antisense transcripts

The MAXIscript® in vitro transcription kit (Ambion) was used to generate

[32P]-uniformly-labeled antisense probes for the RNase protection assays (RPA).

The 20-µl transcription reaction mixture contained the following components: 1

µg linearized DNA template, 2 µl 10x Transcription Buffer, 1 µl 10 mM ATP

Solution, 1 µl 10 mM CTP Solution, 1 µl 10 mM GTP Solution, 1 µl 0.1 mM UTP,

3 µl 3000 Ci/mmol, 10 mCi/ml [α-32P]-UTP, and 2 µl appropriate RNA

Polymerase Solution. The reaction mixture was incubated at 37oC for 1 hr and

then 1 µl DNase I was added to digest the DNA template. The transcription

products were separated on a 6% polyacrylamide/urea gel. The band

corresponding to the full-length probe was excised from the gel and incubated

with 400 µl probe elution buffer (0.3 M sodium acetate, 1 mM EDTA, 0.2% SDS)

at 37oC for 2 hrs. The labeled probe was recovered by precipitation with 1 ml

ethanol. The DNA templates for different probes are summarized as follows:

59

Target mRNA Template DNA Linearizing enzyme DNA polymerase

Human β-globin pTopo-gloA2 EcoRV SP6 Firefly luciferase pBS-PL156 EcoRI T3 Renilla luciferase pBS-RL289 EcoRI T3 Xenopus albumin pTopIIAlb Asp718I T7 X200-SPA PCR products from EcoRI T7 pBS-X200 using T7 and JP31 primers

2.10.2 Internally [32P] labeled transcripts bearing an m7GpppG cap

To generate m7GpppG capped, [32P]-labeled transcripts for in vitro

cleavage assays, transcription reactions were performed similarly to those

described in 2.10.1. The 20-µl reaction mixture included 1 µg linearized DNA

template, 2 µl 10x Transcription Buffer, 0.4 µl 20 mM 5’-m7GpppG, 1 µl 10 mM

ATP Solution, 1 µl 10 mM CTP Solution, 0.2 µl 10 mM GTP Solution, 0.5 µl 10 mM UTP Solution, 3 µl 3000 Ci/mmol, 10 mCi/ml [α-32P]-UTP, and 2 µl

appropriate RNA Polymerase Solution. The reaction product was digested with 1

µl DNase I at 37oC for 15 min and the transcript was recovered by phenol/chloroform/isoamyl alchohol (25:24:1) extraction followed by ethanol

precipitation.

60 2.10.3 Transcripts for in vitro translation experiments

The transcripts with an m7GpppG cap were produced using the

mMessage mMachineTM transcription kit (Ambion). The transcription reaction

mixture contained the following components: 1 µg linear DNA template, 10 µl 2x

NTP/CAP, 2 µl 10x Reaction Buffer, 2 µl SP6 Enzyme Mix, and water to a volume of 20 µl. The templates were generated by SstII digestion of the plasmids pGlucAn or pGlucPLEAn (here, the number “n” stands for the length of the poly(A) stretch), except for the A0 and A98 transcripts. The templates to

generate A0 transcripts were BglII-digested pGlucA14 or pGlucPLEA14; and the

templates to generate A98 transcripts were pGlucA98 or pGlucPLEA98 digested

by BamHI and treated by Mung bean nuclease (USB). The transcription reaction

was carried out at 37oC overnight followed by a 15-minute digestion with 1 µl

DNase I. The transcripts were then precipitated by incubation with 30 µl water

and 25 µl LiCl Precipitation Solution (provided by the kit) at –20oC for at least 30

min. The transcripts were recovered by centrifugation at 12,000 xg for 15 min,

washed twice with 500 µl 70% ethanol and dissolved in 30 µl DEPC-treated water. The concentrations of the transcripts were measured by OD260/280, and the integrities of the transcripts were examined by 1% agarose gel electrophoresis.

Uncapped transcripts were made using the MEGAscript® transcription kit

(Ambion). A 20-µl reaction contained 1 µg of linear DNA template, 2 µl 10x

Reaction Buffer, 2 µl each ATP, CTP, GTP and UTP Solution, and 2 µl SP6

61 Enzyme Mix. The reaction mixture was incubated at 37oC overnight followed by

DNase I digestion and LiCl precipitation as above for the purification of

m7GpppG-capped transcripts. Transcripts with a 5’ApppG cap were synthesized

similarly to the uncapped transcripts except that 4 µl 20 mM 5’ApppG (Ambion)

was included in the reaction mixture, and 0.4 µl instead of 2 µl GTP solution was

used in each reaction.

2.11 Synthesis of random primed DNA probe

The Random Primers DNA labeling system (Invitrogen) was used to

synthesize [32P]-labeled DNA probes for Northern blot. In a typical reaction, 50-

100 ng of gel purified template DNA fragment in 10 µl was denatured at 95oC for

5 min then immediately cooled on ice. Then, the following reagents were added:

2 µl each of dCTP, dGTP and dTTP Solution, 15 µl Random Primers Buffer

Mixture, 13 µl water, 5 µl 3000 Ci/mmol, 10mCi/ml [α-32P]-dATP and 1 µl Klenow

Fragment of DNA Polymerase I. The reaction mixture was incubated at room

temperature for 2-3 hrs and then heated at 95oC for 5 min to denature the

synthesized double stranded DNA probe before hybridization. The plasmids

used as templates are summarized as follows.

Target mRNA Plasmid Digestion enzymes Template size

Firefly luciferase CMV-luc-SPA PpuMI and XbaI 476 bp Renilla luciferase RL-TK NheI and XbaI 947 bp

62 2.12 Synthesis of 32[P]-labeled U6 probe.

The Strip-EZTM PCR kit (Ambion) was used to generate a 32[P]-labeled

DNA probe to detect U6 snRNA on a Northern blot. The template for the PCR reaction was made by annealing primers U6fwd and U6rvs (Table 2.1) followed by treatment with the Klenow fragment of DNA polymerase. The primers used in the PCR reaction were JP27 and JP28 (Table 2.1). The PCR reaction was performed according to the instructions provided by the manufacturer.

2.13 Northern blot

Ten µl RNA samples were incubated with 3 µl de-ionized glyoxal and 2 µl

0.1 M sodium phosphate buffer (pH 7.0) at 50oC for 55 min or at 65oC for 15 min.

Then, 4 µl 5x RNA loading buffer (50% glycerol v/v, 10 mM sodium phosphate, pH 7.0, 0.05% bromophenol blue and 0.05% xylene blue, DEPC treated and autoclaved) was added and the RNA was separated on a 1% agarose gel in 0.01

M sodium phosphate buffer (pH 7.0) with constant stirring. The gel was then blotted to a nylon membrane (Osmonics) through overnight transfer using a

TurboBlotterTM apparatus (Schleicher & Schuell) in 10x sodium chloride sodium citrate (SSC) buffer (diluted from the 20x SSC buffer (Fisher)). The membrane was cross-linked by ultraviolet (UV) and stained with methylene blue stain solution (0.4 M acetic acid, 0.4 M sodium acetate, 0.2% methylene blue) to visualize ribosomal RNA and size marker (Invitrogen). Pre-hybridization of the blot was performed at 42oC in formamide hybridization buffer (50% formamide,

63 5x SSPE, 5x Denhardt’s solution, 1% sodium dodecylsulfate (SDS), 100 µg/ml

salmon sperm DNA (Invitrogen)) for a minimum of 30 min. The 5x SSPE was

diluted from the 20x SSPE buffer (3 M sodium chloride, 200 mM sodium phosphate and 20 mM ethylenediaminetetraacetic acid (EDTA). The 5x

Denhardt’s buffer was diluted from the 50x Denhardt’s solution (10 g/l Ficoll, 10

g/l polyvinylpyrrolidone and 10 g/l BSA). The heat-denatured DNA probe was

then added and hybridized overnight. After hybridization, the blot was washed

twice in 2x SSC, 0.1% SDS, twice in 0.5x SSC, 0.1% SDS, and twce in 0.1x

SSC, 0.1% SDS. All the washes were performed at 42oC for 10-20 min each

time. Finally, the membrane was dried and visulized by phosphorimager.

When the probe was an antisense RNA, the Perfecthyb™ Hybridization

Buffer (Sigma-Aldrich) was used instead of formamide buffer and the

hybridization temperature was 68oC instead of 42oC. The same washing buffers as described above were used but the washes were performed at 68oC.

2.14 RNase Protection Assay (RPA)

The RPAIIITM kit (Ambion) was used for RNase protection assays. All the

reagents mentioned below were from the kit except RNA samples and probes.

Briefly, 2 fmol antisense RNA probe (described in 2.10.1) was mixed with each

RNA sample and 10 µl Hybridization III buffer if the total volume of the RNA

sample and the probe was ≤ 4 µl. Otherwise, the RNA sample and the probe

were ethanol precipitated then resuspended in 10 µl Hybridization III buffer. The

64 mixture was heated at 95oC for 5 min and incubated at 42oC overnight for

hybridization. To remove the un-hybridized probes, 150 µl RNase A/T1 diluted

1:100 in RNase Digestion III Buffer was added to each sample and incubated at

37oC for 30 min. After digestion, 225 µl RNase Inactivation/Precipitation III Buffer

was added to each tube and the protected product was precipitated by incubation for 15 min at −20oC, and recovered by centrifugation for 15 min at 12,000 xg in a

refrigerated microcentrifuge. The pellet was dissolved in 4 µl Gel Loading Buffer

II and separated on a 6% polyacrylamide/urea sequencing gel. In every

experiment, control assays were performed with either Yeast RNA (provided by the kit) or total RNA from mock-transfected cells with or without RNase digestion to control for the integrity and specificity of the probes.

2.15 Nuclear transcription run-on assay

5.0 x 106 LM(tk-) cells were seeded in a 150-mm dish and co-transfected

with 10 µg of CMV-glo-SPA or CMV-glo-PLE-SPA and 10 µg of CMV-luc-SPA

plasmid DNA. Twenty-four hrs after transfection, the cells were washed twice

with ice-cold PBS, scraped off into 10 ml cold PBS and collected by

centrifugation at 200 xg for 5 min at 4oC in a Sovall HS-4 rotor. The cell pellet

was resuspended in lysis buffer (10 mM Tris/HCl, pH 7.5, 10 mM NaCl, 3 mM

MgCl2 and 0.5% (v/v) NP-40), and incubated on ice for 5-10 min to break the

cytoplasmic membranes. The nuclei were collected by centrifugation at 500 xg

for 5 min at 4oC in a Sovall HS-4 rotor, and resuspended in 200 µl glycerol

65 storage buffer (50 mM Tris/HCl, pH 8.0, 40% glycerol, 5 mM MgCl2 and 0.1 mM

EDTA). The nuclei were stored at −80oC. For the transcription assay, 50 µl (1.2

x 106) resuspended nuclei obtained above was incubated with an equal volume of 2x run-on reaction buffer (10 mM Tris/HCl, pH 8.0, 5 mM MgCl2, 0.3 M KCl, 1 mM CTP, GTP, ATP, 1 µM unlabeled UTP and 60 µCi of [α-32P]-UTP (3000

Ci/mmol)) for 30 min at 30°C. The radiolabeled nuclear RNA was recovered with

1 ml TRIzol® and resuspended in 10 µl water, followed by treatment with 10 units of RQ1 DNase (Promega) for 30 min at 37oC. Five µg heat denatured plasmids

containing cDNA of β-globin or firefly luciferase were applied to MSI nylon

transfer membrane (Osmonics) using a dot blot apparatus followed by UV cross linking. The membranes were prehybridized for two hrs at 42oC in formamide

hybridization buffer (the same buffer used in Northern blot as described in 2.12)

followed by hybridization with the elongated, [32P]-labeled run-on transcripts at

42°C for 24 hrs. The membranes were washed twice with 2x SSC containing

0.1% SDS for 1 h at 55° C, treated with 10 mg/ml RNase A in 2x SSC at 37°C for

30 min, dried, and visualized by phosphorimager.

2.16 In vitro cleavage assay

HeLa nuclear extract was made as described (134). It was dialyzed

against buffer D (20 mM HEPES/KOH pH7.9, 20% glycerol, 100 mM KCl, 0.2

mM EDTA and 0.5 mM DTT) prior to use. The in vitro cleavage reaction mixture

was assembled on ice with the following components: 1 µl (100 fmol) m7GpppG

66 capped, [32P] uniformly labeled pre-mRNA, 1 µl 2.5 mg/ml bovine liver tRNA, 2 µl

10 mM cordycepin triphosphate (3’-dATP), 2.5 µl 0.2 M creatine phosphate, 0.75

TM µl 100 mM DTT, 0.25 µl 50 mM MgCl2, 0.1 µl 40 unit/µl RNaseOut , 5 µl 12.5%

(v/v) polyvinyl alcohol (PVA), and 12.5 µl dialyzed HeLa nuclear extract. The reaction mixture was incubated at 30oC for varying times. The product was extracted by phenol/chloroform/isoamyl alcohol at different times and separated on a 6% polyacrylamide/urea gel. The result was analyzed by phosphorimager.

2.17 Sucrose density gradient analysis

The sucrose density gradient analysis for Cos1 cells was performed according to a protocol described by E. K. Davydova et al. (135) with modifications. Briefly, 3.5 x 106 cells on a 150-mm plate were washed two times

with ice-cold PBS, and scraped off in 1 ml PBS. The cell pellet was collected by

centrifugation at 200 xg for 2 min, and 400 µl of lysis buffer (20 mM

HEPES/KOH, pH 7.5, 100 mM KCl, 10 mM MgCl2, 1 mM DTT, 0.25% (v/v) NP-

40, 1 mM PMSF, 100 µg/ml cycloheximide, 100 units/ml RNaseOut™

(Invitrogen), and 25 µl/ml protease inhibitor cocktail (Sigma)) was added. The cells were lysed with 5 strokes of a syringe with a 25 gauge needle. Cells debris and nuclei were removed by centrifugation at 15,000 xg for 5 min at 4oC in a

refrigerated microcentrifuge. This was applied to a linear 10-45% sucrose

gradient and centrifuged at 225,000 xg for 2 hrs at 4oC in a Sorvall TH641 rotor.

The linear gradients consisted of 12 ml 15-40% sucrose prepared in lysis buffer.

67 A quarter ml fractions were collected from the bottom of the gradient and RNA was extracted from each even-numbered fractions with 1 ml TRIzol® reagent

(Invitrogen).

For other linear gradient experiments, 4 x 106 cells were washed three

times with 20 ml ice cold PBS and resuspended in 1 ml hypotonic lysis buffer (10

mM Tris/HCl, pH 7.5, 10 mM KCl, 5 mM MgCl2, 2 mM dithiothreitol (DTT), 500

µg/ml cycloheximide, 1 mM phenylmethyl-sulfonylfluoride (PMSF) and 100

units/ml RNaseOut™ (Invitrogen)). Cells were lysed using a Dounce

homogenizer, and cell debris and nuclei were removed by centrifugation at

15,000 xg for 5 min at 4oC in a refrigerated microcentrifuge. This was applied to

a linear 15-40% sucrose gradient and centrifuged at 225,000 xg for 3.5 hrs at

4oC in a Sorvall TH641 rotor. The linear gradients consisted of 10 ml 15-40%

sucrose prepared in hypotonic lysis buffer layered on top of a 1 ml pad of 60%

sucrose containing 5 mM EDTA to prevent the polysomes from sedimenting to the bottom of the tube. One half ml fractions were collected from the bottom of

the gradient and RNA was extracted from each even-numbered fractions with 2 ml TRIzol® reagent (Invitrogen).

To precipitate protein for Western blot analysis, each odd-numbered

fraction was diluted with an equal volume of PBS, and trichloroacetic acid (TCA)

was added to a final concentration of 10% (w/v). After incubation on ice for 30

min, the protein was recovered by centrifugation at 15,000 xg for 30 min in a

refrigerated microcentrifuge. The protein was washed with acetone then 95%

68 ethanol and finally dissolved in 10 µl buffer containing 10 mM Tris/HCl, pH 6.8

and 1% SDS.

2.18 Preparation of Hela cytoplasmic extract

HeLa S3 cells were grown in 1 L spinner flasks until the cell density

reached 4-6 x 105 cells/ml, at which time the cells were harvested by

centrifugation at 200 xg for 10 min at 4oC in a Sorvall HS-4 rotor. The cell pellet

was washed three times with ice cold PBS at 10x volume of the pellet and re-

suspended in a volume of hypotonic MC buffer (10 mM HEPES/KOH, pH 7.4, 10

mM potassium acetate, 0.5 mM magnesium acetate, 5 mM DTT, 1 mM PMSF

and 25 µl/ml protease inhibitor cocktail (Sigma)) equal to the volume of the pellet.

Cells were swollen on ice for 5-10 min before they were lysed with 25-30 strokes

of a Dounce homogenizer (B pestle). The cell debris and nuclei were removed

by centrifugation at 15,000 xg for 20 min at 4oC in a refrigerated microcentrifuge.

The supernatant containing the HeLa cell cytoplasmic extract (referred to as S15)

was frozen in aliquots at –80oC.

2.19 Purification of GST-Paip2

Recombinant GST-Paip2 was expressed in E.coli BL21(DE3)pLysS

(Stratagene) and purified using the Amersham GSTrapTMFF column. To express

the protein, a single colony of the bacteria transformed with pGEX-6p-2-Paip2

plasmid (kindly provided by Nahum Sonenberg) was selected to inoculate 3 ml

69 LB medium (Invitrogen) to grow an overnight culture at 37oC. The following day,

2.5 ml of this culture was used to inoculate 50 ml LB. The bacteria were grown

o for approximately 2 hrs at 37 C with shaking until the OD600 of the culture

reached 0.5, at which time isopropyl-beta-D-thiogalactopyranoside (IPTG) was

added to a final concentration of 1 mM to induce the expression of GST-Paip2.

The bacteria were grown for another 3 hrs at 30oC, because growth of the

bacteria at lower temperature was reported to help the folding of recombinant

proteins. Then, they were harvested by centrifugation at 5,000 xg for 10 min in a

Soval HS-4 rotor and resuspended in 3 ml PBS supplemented with 0.2 mM

PMSF and 25 µl/ml protease inhibitor cocktail (Sigma). To break the cell

membrane, the resuspended bacteria were incubated with 1 µg/ml lysosome for

15 min on ice then subjected to sonication. To remove the cell debris, the

bacterial lysate was centrifuged at 15,000 xg for 10 min in a refrigerated

microcentrifuge, and the supernatant was filtered through a 0.45 µm filter. The

filtered supernatant was then applied to a 1-ml GSTrapTMFF column, which was

then washed with 10 ml PBS. The bound GST-Paip2 protein was eluted with 5

ml elution buffer containing 50 mM Tris/HCl, pH 7.5, 0.2 mM PMSF and 10 mM

reduced glutathione. One half ml fractions were collected, and 10 µl of each fraction was separated on a 10% SDS polyacrylamide gel. The proteins were visualized by staining with GelCodeTM blue stain reagent (Pierce). Fractions

containing purified GST-Paip2 were pooled and dialyzed against MC buffer

(described in section 2.17) for 3 hrs at 4oC.

70 2.20 Purification of GST-La(226-348)

The E.coli BL21(DE3)pLysS was transformed with plasmid pGEX2T-

La(226-348) (kindly provided by Nahum Sonenberg). The recombinant GST-

La(226-348) protein was expressed and purified with the same procedure as described in 2.18.

2.21 Purification of recombinant hPABP-(His)6

Recombinant human PABP-(His)6 was expressed similarly to GST-Paip2.

Briefly, the E.coli BL21(DE3)pLysS strain was transformed with plasmid pET3b-

hPABP-His (kindly provided by Nahum Sonenberg). A single colony was

selected and amplified overnight in 3 ml LB medium, 2 ml of which was subsequently used to inoculate 100 ml LB medium. When the OD600 reached

0.5, 1 mM IPTG was added to the culture to induce the expression of hPABP for

3 hrs. The bacteria were harvested and lysed as described in section 2.18,

except that the bacterial pellet was resuspended in 5 ml His-binding buffer. The

His-binding buffer contained 20 mM sodium phosphate pH 7.8, 500 mM NaCl

and 50 mM imidazole, 0.2 mM PMSF and 25 µl/ml protease inhibitor cocktail

(Sigma). The cell debris was removed by centrifugation at 15,000 xg for 10 min.

The supernatant was filtered through a 0.45 µm filter before it was applied to a 1-

TM ml Hitrap chelating column (Amersham) charged with 0.1 mM NiCl2. The purification process was carried out using an FPLC system. The column was washed with 10 ml His-binding buffer, and the bound protein was eluted with 5 ml

71 His-binding buffer containing a gradient of 50-500 mM imidazole. One half ml

fractions were collected and 10 µl of each fraction was analyzed by 10% SDS polyacrylamide gel electrophoresis (SDS-PAGE) followed by staining with

GelCodeTM blue stain reagent (Pierce). Fractions containing purified hPABP

were pooled and concentrated with a CentriconTM YM30 spin column (Millipore).

Finally, the concentrated hPABP was dialyzed against MC buffer (described in

section 2.17) for 3 hrs at 4oC and stored in aliquots at −80oC.

2.22 In vitro translation

A typical 10 µl in vitro translation reaction contained 4 µl HeLa S15 cytoplasmic extract, 2 µl in vitro transcript (15 fmol/µl), 2 µl water, and 2 µl 5x translation buffer (5x TLB: 30 mM HEPES-KOH, pH 7.4, 330 mM KCl, 5 mM

MgCl2, 5 mM ATP, 0.25 mM GTP, 125 µM bovine liver tRNA, 50 µM amino acid

mix (Promega), 21 mM β-mercaptoethanol, 50 mM creatine phosphate, 125 ng/µl

creatine phosphokinase, 1.2 mM spermidine and 4 units of RNaseOut™

(Invitrogen)). Each translation reaction was performed in triplicate. Reactions were incubated at 37oC for 1 hr, and then 2 µl was used to assay for luciferase

activity. The remaining reaction mixtures for each transcript were combined and

RNA was extracted from 20 µl of the combine reaction mixture using 200 µl

TRIzol® reagent. One-tenth of the recovered RNA was used for Northern blot to

analyze the integrity of the transcripts.

72 In the experiments to titrate the magnesium and potassium

concentrations, MgCl2 and KCl were not supplemented in the 5x TLB. They were

added to the reaction mixture from a 10x stocking buffer with different

concentrations.

In the U2AF, SF3b and La experiments, the purified protein was dialyzed

against MC buffer, and different amounts of those proteins were added in a 2-µl

volume to the reaction in place of water. U2AF and La were purified from Hela

cells as described previously (120;127). SF3b was kindly provided by Drs. Cindy

Will and Reinhard Lϋhrmann.

In the poly(rA) competition and Paip2 experiments, 2 µl poly(rA) and Paip2

were added to the reaction with different amounts. In the experiments that

hPABP-(His)6 was added to overcome the effect caused by poly(rA) or Paip2, the reaction volume was 12 µl, excluding water but including 2 µl polyadenylic acid potassium salt (Sigma) and 2 µl hPABP-(His)6 with the amount indicated in each

figure. The T-test was performed using the SAS program.

2.23 Western blot

The protein samples were separated by SDS-polyacrylamide gel electrophoresis according to the standard lab protocol (132). After electrophoresis, the proteins were transferred from the SDS-polyacrylamide gel to polyvinylidene fluoride (PVDF) membrane (Millipore) at 300 mA for 3 hrs or at

150 mA for overnight at 4oC in the transfer buffer (5.8 g/l Tris base, 2.1 g/l of

73 glycine and 200 ml/l methanol). The membrane was incubated sequentially in blocking buffer (5% non-fat dry milk in 1x TBST (20mM Tris/HCl, pH 7.5, 150 mM

NaCl and 0.2% Tween-20)), the primary antibody solution, and the secondary antibody solution. Both the primary and secondary antibodies were diluted in the blocking buffer, and the fold dilution of each antibody is listed at the end of this section. All the incubations were performed either at room temperature for 1 hr or at 4oC for overnight. After incubation with either antibody solution, the membrane was washed three times with 1x TBST for 10 min each time. The signal for the target protein was detected using the SuperSignalTM west chemiluminescent substrate (Pierce) following the manufacturer’s instructions.

The antibody against U2AF65 (Anti-U2AF65) was kindly provided by Dr. Brent

Gravely, and the antibody against SF3b155 (Anti-SF3b155) was generously provided by Drs. Cindy Will and Reinhard Lϋhrmann. The dilution of each antibody is listed as follows:

Primary Dilution Secondary Dilution

Anti-U2AF65 1: 3,000 HRP-anti rabbit IgG (Santa Cruz) 1: 30,000 Anti-SF3b155 1: 5,000 HRP-anti rabbit IgG (Santa Cruz) 1: 30,000

74

Primers Sequences Bvluc1 5’-TCGACGCAAGAAAAATCAGAGAGAT EP10 5’-GTTCTAGAAGAGGAAAGCAAAGATCCTTCATCAGAAAA EP11 5’-GGGTCGACTGTAGCTGACTCTTTTCTGATGAAGGATCT HG11 5’-ACGAAGCTTGCTCTAAGCAAATGCTCTTTTCAG HG35 5’-TCTTTGCCAAAGT-GATGGGC Joy18 5’-CCTGGGCAACGTGCTGGTCT Joy26 5’-CGGAAGCTTCTAATGAAAATAAAGATCT Joy30 5’-CCTCTAGAGCTCTTTTCAGCTGAAGGAACTTT JP15 5’-ACACGAATTCACCATGGAAGACGCCAA JP17 5’-GCCAAGCTTGATGTCCACCTCGATATGTG JP19 5’-GGCGAATTC-CATCCACTTTGCCTTTCTC JP20 5’-GGCAAGCTT-TGTCGCCATAAATAAGAAGAG

JP23 5’-GCGGT20AATAAAGATCTTTTAT

JP25 5’-CTTTATTA20CCGCGGATC JP27 5’-GTGCTCGCTTCGGCAGCAC JP28 5’-AAAATATGGAACGCTTCACGAATTTG JP29 5’-GTAAAACGACGGCCAGTGCCAAG JP31 5’-AATGAATTCGAAGTGGACTGCTGGCGGAA Kgloex1 5’-AGGTGAACGTGGATGAAGTTGG Kgloex3 5’-AAGTGATGGGCCAGCACACACAG SP6gloC 5’-GAATACAAGCTAGCTTGCTT U6fwd 5’-TGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGA TACAGAGAAGATTAGCATGGC U6rvs 5’-AAAATATGGAACGCTTCACGAATTTGCGTGTCATCCTTG CGCAGGGGCCATGCTAATCTT

Continued

Table 2.1 Primer sequences

75

Table 2.1 continued

Primers Sequences XG1 5’-GGCAACGTGCTGGTCTGTGT XG10 5’-CCTCTAGACTCTTTTCAGCTGTACGTAC

XG2 5’-GGGGATCCGCGGT10

XG4 5’-GGGGATCCGCGGT15 YC1 5’-TTTCTAGAAAGTTCCTTCAGCTGAA YC2 5’-TTTCTAGAAAGTACGTACAGCTGAA YC3 5’-CCTCTAGACTCTTTTCAGCTGTACGTAC

76

CHAPTER 3

THE PLE ENHANCES PRE-mRNA 3’ PROCESSING

A number of sequences located upstream of the poly(A) signal have been identified that modulate the efficiency of pre-mRNA 3’ processing and affect the accumulation of mature mRNA (Chapter 1). The primary function of the poly(A) limiting element (PLE) is to restrict the poly(A) tail length to <20 nt when it is located in the last exon upstream of the polyadenylation site (133). However, in previous work, members in our lab, Jaydip Das Gupta and Haidong Gu, consistently observed that more mRNA was produced from PLE-containing reporter genes than from the control genes lacking a PLE. Therefore, this study sought to examine if in addition to its function in regulating the poly(A) tail length, the PLE also increases the efficiency of pre-mRNA 3’ processing, thus increasing the accumulation of the mature mRNA.

77 3.1 The presence of a PLE increases the accumulation of nuclear and

cytoplasmic β-globin mRNA.

The previous studies on the PLE were focused on its regulatory effect on

poly(A) tail length. In those experiments, LM(tk-) cells were transfected with plasmids expressing human β-globin with a CMV promoter and a synthetic

polyadenylation signal (SPA) with or without a PLE (CMV-glo-PLEB-SPA or

CMV-Glo-SPA). The same number of cells were transfected in parallel with equal amounts of plasmids and transfection reagent, and equal amounts of RNA

were used for RT-PCR-based poly(A) tail length assay. However, more PCR

products had always been obtained from RNA samples of cells transfected with

the PLE-containing plasmid compared to cells transfected with the control

plasmid lacking a PLE. This suggested that more β-globin mRNA is produced

when a PLE is present.

To confirm the hypothesis that the PLE increases the steady state of the

reporter mRNA, RNase protection assay (RPA) was used to compare the steady

state levels of β-globin mRNAs with or without a PLE in the nucleus and

cytoplasm. LM(tk-) cells were co-transfected with either CMV-glo-PLEB-SPA or

CMV-Glo-SPA and an equal amount of plasmid CMV-Luc-SPA that expresses firefly (Photinus pyralis) luciferase with the same CMV promoter and SPA polyadenylation signal to serve as a control for transfection efficiency.

Cytoplasmic and nuclear RNA was prepared 24 hours after transfection and RPA was performed to determine the accumulation of β-globin and luciferase mRNAs

78 (Figure 3.1B). In addition, Northern blot was used to detect U6 snRNA to show there was no contamination by the nuclear RNA in the cytoplasmic RNA fractions

(Figure 3.1C). The locations of the antisense probes for β-globin and luciferase mRNAs are shown by the arrows in Figure 3.1A. The β-globin probe spanned two exon junctions, and produced a 304-nt protected product for fully-spliced mRNA and a doublet protected product with bands at 262-nt for intron II- containing RNA and 264-nt for intron I-containing RNA. The luciferase probe recognized the first 156-nt of the coding sequence of the luciferase mRNA and generated a 156-nt protected product.

As shown in Figure 3.1B, when normalized to the luciferase mRNA, there was about 50% more fully-spliced PLE-containing β-globin mRNA compared to the control β-globin mRNA lacking a PLE, in both the cytoplasmic and the nuclear fractions. However, the levels of unspliced globin mRNAs with or without a PLE were similar, indicating that the PLE does not affect splicing efficiency.

Moreover, the ratios between cytoplasmic versus nuclear mRNAs with or without a PLE were also similar, which implies that the PLE does not affect mRNA export efficiency either.

3.2 The PLE does not alter the rate of gene transcription

A nuclear transcription run-on assay was used to compare the relative transcription rates of β-globin genes with or without a PLE in transiently transfected cells. LM(tk-) cells were transfected with the same plasmids as in the

79 RPA experiment shown in Figure 3.1. Nuclei prepared 24 hrs after transfection

were incubated with [α-32P]-UTP plus unlabeled ATP, GTP and CTP for 30 min at

37oC. The nuclear RNA extracted with TRIzol® was then hybridized to excess

plasmid DNA containing β-globin or luciferase cDNA immobilized on a nylon

membrane. Phosphorimager analysis showed the same degree of transcriptional

activity for the control and PLE-containing β-globin genes (Figure 3.2), thus

indicating that the PLE stimulates a post-transcriptional increase in the amount of

β-globin mRNA.

3.3 The PLE enhances the efficiency of 3’ processing in vivo

Upstream elements can modulate the efficiency of pre-mRNA 3’

processing (8). Since the PLE has no impact on the rate of reporter gene

transcription or on the efficiency of splicing, whether the increase observed in

Figure 3.1 resulted from an increase in the efficiency of 3’ processing was next examined. First, an RT-PCR approach was employed similar to that used by

Juge et al. (136) to examine the role of poly(A) polymerase on cleavage efficiency in vivo. This assay quantifies the relative amount of pre-mRNA that has not undergone cleavage and polyadenylation by comparing the recovery of

RT-PCR products generated by priming reverse transcription with an antisense oligonucleotide complementary to sequences downstream of the cleavage site.

Thus, an increase in the 3’ processing (cleavage) efficiency will appear as a decrease in product generated from the uncleaved pre-mRNA. The locations of

80 the primers used for this analysis are shown in Figure 3.3A. Since both the β- globin and luciferase constructs used a synthetic polyadenylation element (SPA) for 3’ processing, a single primer complementary to the 3’ portion of SPA was used to synthesize cDNA for both β-globin and luciferase RNA. The cDNA was then amplified by PCR using the 5’-[32P]-labeled upstream primers recognizing β-

globin or luciferase mRNA coding sequences and the downstream SPA

antisense primer. Amplification was limited to 13 cycles, which was empirically

determined to lie within the linear range, and each set of reactions included a

standard curve of plasmid DNA. Finally, to rule out any contribution from

contaminating plasmid DNA, a control prepared without reverse transcriptase

was included for each sample.

The PCR-amplified products were separated on a denaturing 6%

polyacrylamide/urea gel as shown in Figure 3.3B, with the RT-PCR products

prepared without (-RT) and with (+RT) reverse transcriptase in the last four

lanes. No β-globin or luciferase products were detected when reverse

transcriptase was omitted from the reaction. RT-PCR of nuclear RNA generated

a single product for each gene, with that from the PLE-containing RNA running

more slowly than the control because the 23-bp PLE lay between the primer

binding site in exon 3 and the downstream primer binding site. The signals of the

β-globin mRNAs were normalized to those of the plasmid standards and the

luciferase control. The results showed that the amount of uncleaved control pre-

mRNA was ~50% more than the amount of uncleaved PLE-containing pre-

81 mRNA, which mirrors the PLE-stimulated increase in nuclear β-globin mRNA as shown in Figure 3.1. These data indicate that, in addition to regulating the length

of the poly(A) tail, the PLE enhances the cleavage of the .

The RT-PCR experiment indirectly showed that the PLE enhances the

efficiency of pre-mRNA 3’ cleavage. One method to directly measure the

uncleaved pre-mRNA versus cleaved mature mRNA is RNase protection assay.

However, the PLE is very close to the 3’ processing site in the constructs CMV-

glo-SPA and CMV-glo-PLEB-SPA, thus it was not possible to design a single probe for transcripts generated from these two plasmids. To overcome this problem, a 158-bp fragment from HinfIII-digested ΦX174 DNA, X200, was

inserted immediately upstream of the SPA to increase the space between the

PLE and the SPA poly(A) signal, generating a construct CMV-glo-PLEB-X200-

SPA. The extra sequence has been shown not to affect PLE-mediated poly(A) length control (133). Plasmids CMV-glo-X200-SPA and CMV-glo-MutG-X200-

SPA (MutG is an inactive mutant of PLE) were produced the same way, thus one antisense RNase protection probe can be used to detect pre-mRNAs and mature mRNAs generated from the three constructs CMV-glo-X200-SPA, CMV-glo-

PLEB-X200-SPA and CMV-glo-MutG-X200-SPA. LM(tk-) cells were transfected with these plasmids, and the nuclear RNAs were extracted 24 hours after transfection for RNase protection assays. The position of the antisense probe is shown by an arrow in Figure 3.4A. The protected products for the pre-mRNAs and mature mRNAs were 169-nt and 132-nt, respectively. These were

82 separated on a denaturing 6% polyacrylamide/urea gel as shown in Figure 3.4B.

Consistant with the result shown in Figure 3.3, there was about 20% less PLE-

containing pre-mRNA than non-PLE-containing pre-mRNA. In addition, the ratio

of cleaved mature mRNA versus uncleaved pre-mRNA from PLE-containing

construct was 60% higher than the ratios of the non-PLE-containing control and

the construct carrying an inactive PLE mutant (MutG). This result directly

showed that the PLE increases the efficiency of pre-mRNA 3’ processing in vivo.

3.4 The PLE enhances 3’ cleavage in vitro

To determine the impact of the PLE on the rate of 3’ processing

(cleavage), an in vitro cleavage assay was developed using HeLa nuclear extract. The in vitro transcripts used in this assay contained part of the β-globin exon 3 and the SPA processing signal; the PLE-containing pre-mRNA was 157- nt in length while the non-PLE-containing pre-mRNA was 140-nt. Both transcripts were m7GpppG-capped and uniformly labeled with [α-32P]-UTP. The

in vitro cleavage reaction was carried out in the presence of cordycepin

triphosphate (3’-dATP), thus only a single nucleotide could be incorporated at the

poly(A) site. Therefore, the 85-nt or 68-nt cleavage products that were generated

from the pre-mRNAs containing a PLE or lacking a PLE, respectively, could be

easily resolved without any obscurity caused by the heterogeneous poly(A)

tracts. The reaction products were recovered at different times by

phenol/chloroform/isoamyl alcohol extraction, separated on a denaturing 6%

83 polyacrylamide/urea gel, and visulized by phosphorimager analysis. Multiple

bands were detected as the cleavage products generated from both transcripts,

which could be due to partial degradation or residue ATPs present in the nuclear

extract. The signal of these multiple bands in combination was quantified by

phosphorimger analysis, which represented the amount of each cleavage

product. The appearance of each cleavage product was graphed versus reaction

time, and a trendline was determined by linear regression using Excel program.

The rate of 3’ cleavage was calculated as the slope of the trendline. As shown in

Figure 3.5, the 3’ cleavage rate of the PLE-containing transcript was about 20%

faster than that of the Non-PLE-containing control. This result indicates that the

PLE moderately enhances pre-mRNA 3’ cleavage in vitro.

The next experiment was to examine if the enhancement of the 3’

cleavage efficiency observed by insertion of one copy of the PLE would be

further amplified by adding more copies of the PLE upstream of the

polyadenylation site. In vitro cleavage assays were performed to compare the 3’

cleavage efficiency of transcripts carrying four copies of the PLE ((PLE)4) versus four copies of MutG ((MutG)4), which is an inactive form of the PLE with three

mutated nucleotides (133). Both transcripts contained part of the β-globin exon 3

and the SPA polyadenylation signal, and both of them were m7GpppG capped

32 and [ P] labeled. The (PLE)4-containing pre-mRNA was 252-nt, and generated

a 182-nt cleavage product; the (MutG)4-containing pre-mRNA was 247-nt, and

generated a 176-nt cleavage product. The in vitro cleavage assays were

84 performed similarly to those described in Figure 3.5, and the results are shown in

Figure 3.6. Four copies of the PLE significantly enhanced the efficiency of 3’ processing, producing a rate about 80% faster than the (MutG)4-containing

counterpart. This was higher than the 20% stimulation by one copy of the PLE,

indicating that the effect of the PLE on the efficiency of 3’ cleavage is also

additive. In other words, presence of the PLE enhances the efficiency of 3’

cleavage, and more copies of the PLE further amplify the enhancement.

85

Figure 3.1. Impact of the PLE on steady-state levels of nuclear and cytoplasmic β-globin mRNA. A. The positions of the antisense probes used for RNase protection assays are shown schematically. The β-globin probe spans from the 3’ end of exon 1 (40-nt) to the 5’ end of exon 3 (42-nt). B. Nuclear and cytoplasmic RNAs were isolated 24 hr after transfection. Four micrograms of each sample were analyzed by RNase protection assay, and the protected products were separated on a denaturing 6% polyacrylamide/urea gel. The radiolabeled probes mixed with yeast total RNA were loaded in the first lane (probes), and the same mixture following RNase digestion was electrophoresed in the third lane (+RNase). Cytoplasmic (C) and nuclear (N) RNA from each transfectant were loaded in the last four lanes. The unspliced mRNA was identified with an asterisk. The signals for β-globin mRNA and luciferase mRNA were quantified by phosphorimager analysis and the relative amount of PLE- containing β-globin mRNA to the control β-globin mRNA lacking a PLE is shown beneath the autoradiogram. A marker of [32P]-labeled, HinfI digested ΦX174 DNA was electrophoresed in lane 2. C. The same RNA as in the last four lanes of B was separated on a 1% agarose gel, transferred to a nylon membrane, and probed with a [32P] labeled antisense DNA probe against U6 snRNA. The loading sequence was the same as the last four lanes in B.

86

Figure 3.1. Impact of the PLE on steady-state levels of nuclear and cytoplasmic β-globin mRNA.

87

Figure 3.2. The PLE does not affect transcription efficiency. Nuclei were harvested from LM(tk-) cells 24 hr after co-transfection with a plasmid expressing β-globin mRNA with or without a PLE and a plasmid expressing firefly luciferase (luc) as a control for transfection efficiency. Radiolabeled RNA generated during the transcription run-on process with these nuclei was hybridized to nylon filters bearing 5 µg of plasmid carrying β-globin or luciferase cDNA. Bound RNA was visualized and quantified by phosphorimager analysis.

88

Figure 3.2. The PLE does not affect transcription efficiency.

89

Figure 3.3. Impact of the PLE on the efficiency of pre-mRNA 3’ processing – RT-PCR assay. A. The locations of primers used for reverse transcription and PCR amplification are indicated by the arrows on a diagram of the reporter β- globin and control luciferase genes. B. Nuclear RNA from the experiment in Figure 3.1 was annealed to a primer complementary to the 3’ portion of the synthetic polyadenylation element (SPA) and incubated with (+RT) or without (- RT) reverse transcriptase in the first reaction. The cDNA products were PCR amplified using the same 3’ primer and 5’ [32P]-labeled primers for the 3’ end of the luciferase gene (upper autoradiogram), or the β-globin exon 3 (lower autoradiogram). A parallel set of PCR reactions were performed with 20, 10, 5, 2.5 and 1.25 pg of each transfected plasmid to generate a standard curve for quantifying the products of the PCR reaction. These were applied to the left portion of each gel. The reaction products were applied to a 6% polyacrylamide/urea gel, then visualized and quantified by phosphorimager analysis. The relative amount of the PCR product from the uncleaved control β- globin pre-mRNA lacking a PLE to that from uncleaved pre-mRNA containing a PLE is indicated beneath the autoradiograms. Lane M on each gel contains a marker of [32P]-labeled, HinfI digested ΦX174 DNA.

90

Figure 3.3. Impact of the PLE on the efficiency of pre-mRNA 3’ processing – RT-PCR assay.

91

Figure 3.4. Impact of the PLE on the efficiency of pre-mRNA 3’ processing – RNase protection assay. A. The positions of the antisense probe used for RNase protection assays is shown schematically. B. LM(tk-) cells were transfected with plasmids CMV-glo-X200-SPA (-PLE), CMV-glo-PLEB-X200-SPA (+PLE) or CMV-glo-MutG-X200-SPA (MutG). Nuclear RNA was isolated 24 hr after transfection. Two µg of each sample was analyzed by RNase protection assay, and the protected products were separated on a denaturing 6% polyacrylamide/urea gel. The radiolabeled probes mixed with yeast total RNA were loaded in the first lane (probes), and the same mixture following RNase digestion was electrophoresed in the third lane (+RNase). The signals for the pre-mRNAs and the cleaved mature mRNAs were quantified by phosphorimager analysis shown beneath the autoradiogram. To facilitate comparison, the values for the −PLE control were arbitrarily set to be 1. A marker of [32P]-labeled, HinfI digested ΦX174 DNA was electrophoresed in lane 2.

92

Figure 3.4. Impact of the PLE on the efficiency of pre-mRNA 3’ processing – RNase protection assay.

93

Figure 3.5. Impact of the PLE on 3’ cleavage in vitro. A. The pre-mRNAs and the corresponding cleavage products are shown in the diagram. B. One hundred femtomoles of the input transcripts were incubated with HeLa nuclear extract in the presence of cordycepin triphosphate, and the reaction products were extracted at different times and separated by electrophoresis. The input transcripts (pre-mRNA) and the cleavage products (CLV) are indicated on the side of the autoradiogram, and lane “M” in the middle shows the marker of [32P]- labeled, HinfI digested ΦX174 DNA. C. The cleavage products shown in B were quantified by phophorimager analysis and plotted against the reaction time. The phosphorimager counts from time 0 were subtracted as background. A trendline was calculated using linear regression. The control mRNA without a PLE (−PLE) is represented by empty diamonds with a dashed line, and the PLE-containing mRNA (+PLE) is represented by filled diamonds with a solid line. The line describing the cleavage of non-PLE containing mRNA had a slope of 1.4 x 103 counts per min (cpm) and an R2 value of 0.92; while the line describing the cleavage of PLE containing mRNA had a slope of 1.7 x 103 cpm and an R2 value of 0.94. By comparing the slopes, which represent the rates of cleavage reactions, the cleavage of PLE-containing mRNA was found to be about 20% faster than the control mRNA lacking a PLE.

94

Figure 3.5. Impact of the PLE on 3’ cleavage in vitro.

95

Figure 3.6. In vitro cleavage assay of (PLE)4 and (MutG)4 pre-mRNA. A. The pre-mRNAs and corresponding 3’ cleavage products are indicated in the diagram. B. One hundred femtomoles of the input transcripts were incubated with HeLa nuclear extract in the presence of cordycepin triphosphate, and the reaction products were extracted at different times and separated by electrophoresis. The input transcripts (pre-mRNA) and the cleavage products (CLV) are indicated on the side of the autoradiogram, and lane “M” in the middle shows the marker of [32P]-labeled, HinfI digested ΦX174 DNA. C. The cleavage products shown in B were quantified by phophorimager analysis and plotted against reaction time. The phosphorimager counts from time 0 were subtracted as background. A trendline was calculated using linear regression. The mRNA containing four copies of the PLE ((PLE)4) is represented by filled diamonds with a solid line, and the mRNA containing four copies of MutG ((MutG)4) is represented by empty diamonds with a dashed line. The line describing the 2 cleavage of (PLE)4 mRNA had a slope of 27 cpm and an R value of 0.96; while the line describing the cleavage of (MutG)4 mRNA had a slope of 15 cpm and an R2 value of 0.93. By comparing the slopes, which represent the rates of cleavage reactions, the 3’ cleavage of (PLE)4 mRNA was found to be about 80% faster than the control (MutG)4 mRNA.

96

Figure 3.6. In vitro cleavage assay of (PLE)4 and (MutG)4 pre-mRNA.

97

CHAPTER 4

IMPACT OF THE PLE ON THE TRANSLATION OF mRNAs WITH SHORT

POLY(A) TAILS

For most eukaryotic mRNAs, efficient translation requires a long poly(A) tail (>50 nt). However, the PLE-containing Xenopus albumin mRNA with a short poly(A) tail (<20 nt) is translated efficiently in the frog liver. The purpose of this study was to examine whether a PLE-containing mRNA with a short poly(A) tail could be translated efficiently in mammalian cells in vivo and in vitro.

4.1 The PLE restricts the poly(A) tail of intronless luciferase reporter mRNA to <20 nt in transiently transfected cells

To study the translation of PLE-containing mRNAs with a short poly(A) tail, a firefly (Photinus pyralis) luciferase reporter was selected because protein production can be easily measured with the sensitive and fast luciferase activity assay. However, previous studies on the PLE were performed with a β-globin reporter gene that contains two , whereas the luciferase reporter gene used in our lab has no intron. To examine whether the PLE regulates

98 polyadenylation of the intronless luciferase reporter, a poly(A) length assay was performed with RNA samples extracted from cells transiently transfected with either plasmid CMV-Luc-PLEB-SPA or control plasmid CMV-Luc-SPA. Both plasmids express the firefly luciferase with a CMV promoter and a synthetic

polyadenylation element (SPA). As shown in Figure 4.1, the control luciferase

mRNA lacking a PLE has a long, heterogeneous poly(A) tail, but the PLE-

containing luciferase mRNA has a short, discrete poly(A) tail. Thus it appears

that the PLE does regulate the poly(A) tail length of an intronless gene.

4.2 PLE-containing luciferase mRNA with a short poly(A) tail is translated

efficiently in transiently transfected cells

To examine the impact of the PLE on luciferase protein expression, Cos-7

cells were co-transfected with plasmids expressing firefly luciferase without or

with a PLE (CMV-Luc-SPA and CMV-Luc-PLEB-SPA) and a plasmid expressing

Renilla (Renilla reniformis) luciferase (pcDNA3Rluc) as a control for transfection

efficiency. The steady state levels of firefly and Renilla luciferase mRNAs were

determined by Northern blot. The protein expression levels were examined by

measuring firefly and Renilla luciferase activities with the Dual-Luciferase

Reporter Assay System (Promega). As shown in Figure 4.2A, when normalized

to the Renilla luciferase mRNA, there was about 20% more PLE-containing firefly

luciferase mRNA than the control luciferase mRNA lacking a PLE. This is

consistent with the previous observation with a β-globin reporter gene that the

99 presence of a PLE increased the steady state level of the mRNA (Chapter 3,

section 3.1). The luciferase activity assay showed that protein production

coordinated with mRNA level. Approximately 20% more firefly luciferase activity was detected from cells transfected with plasmid CMV-Luc-PLEB-SPA than with the control plasmid CMV-Luc-SPA (Figure 4.2B). These results suggest that the

PLE-containing mRNA with a short poly(A) tail is translated as efficiently in vivo

as control mRNA with a long poly(A) tail.

4.3 PLE-containing mRNA is efficiently recruited to polysomes

The major regulatory step of protein synthesis is translation initiation (59),

and the degree of ribosome association with an mRNA indicates the efficiency of

translation initiation of that mRNA. Therefore, a polysome profile was used to

analyze the impact of a PLE on translation initiation. Cos-1 cells were co-

transfected with a plasmid that expresses firefly luciferase with or without a PLE

(CMV-Luc-SPA or CMV-Luc-PLEB-SPA) and a plasmid (CMV-Alb-minigene) that

expresses Xenopus albumin. CMV-Alb-minigene was used as a control because the albumin mRNA expressed from the minigene contains two PLEs and a <20 nt poly(A) tail (116), and previous work has shown that this mRNA associates with polysomes (115;137). The cells were harvested 24 hours after transfection and the cytoplasmic extract was separated on a 10-45% continuous sucrose density gradient. RNA was extracted from even-numbered fractions and analyzed by

RNase protection assay. The result is shown in Figure 4.3. The majority of both

100 non-PLE-containing and PLE-containing luciferase mRNAs sedimented with

polysomes and 80S monosomes (fractions 1-32). Only a small portion of these

mRNAs associated with mRNPs in the top fractions, which could be the result of

overexpression of these mRNAs in some cells during transient transfection. In

this experiment, a higher percentage of non-PLE-containing luciferase mRNA in

the mRNP fractions (fraction 36-40) than that of the PLE-containing mRNA was observed. However, this might be caused by experimental error because it was not repeated in other similar experiments. The overall sedimentation patterns of luciferase mRNAs with or without a PLE were similar, which indicates that the

PLE-containing mRNA with a short poly(A) tail binds to ribosomes as well as the control mRNA with a long poly(A) tail. The sedimentation pattern of the Xenopus albumin mRNA expressed in transfected Cos-1 cells was somewhat different from that of the firefly luciferase mRNA, but the majority of the albumin mRNA also sedimented with polysomes and 80S monosomes (fractions 12-32). This is in good agreement with previous studies. In conclusion, these data indicate that the <20 nt poly(A) tail on PLE-containing mRNA has no negative impact on the efficiency of translation initiation in vivo.

101 4.4 Impact of the PLE on the translation of mRNAs with a short poly(A) tail

in vitro

4.4.1 The in vitro transcripts used for the in vitro translation

In vitro translation experiments were used to evaluate the relationship

between the presence of a PLE and the length of the poly(A) tail on translation

efficiency. The first step was to prepare a series of plasmid vectors to serve as

templates for in vitro transcription of luciferase mRNA with (+PLE) or without

(−PLE) a PLE, each with a poly(A) tail of different length. One representative

example of these plasmids, pGLuc-A20, whose map is shown in Figure 4.4, was

used to generate the −PLE luciferase mRNA with a 20-nt poly(A) tail. The

mRNAs transcribed in vitro by SP6 RNA polymerase either had a 5’ m7GpppG cap, an inactive ApppG cap or no cap; and the lengths of their poly(A) tails varied from 0 residues up to 98 residues, as shown in the diagram in Figure 4.5. The control mRNAs lacking a PLE with no poly(A) or 14-nt, 20-nt, 54-nt, 78-nt, 98-nt poly(A) were referred as −PLE A0 or −PLE A14, A20, A54, A78, A98 mRNAs,

respectively. The mRNAs containing a PLE with no poly(A) or 14-nt, 20-nt, 54-nt,

78-nt, 98-nt poly(A) were termed +PLE A0 or +PLE A14, A20, A54, A78, A98 mRNAs,

respectively. The spatial relationship of the PLE with respect to the luciferase

coding sequence and the poly(A) tail was the same as that for mRNAs expressed

in vivo.

102 4.4.2 The development of a poly(A)-responsive in vitro translation system

The poly(A) tail-mediated stimulation of translation observed in vivo is not replicated in commercial ready-made cell-free translation systems prepared from rabbit reticulocytes or wheat germ (138). However, translational synergy between the mRNA 5’ cap and 3’ poly(A) has been demonstrated in three other cell-free translation systems: The first was HeLa cytoplasmic extract without micrococcal nuclease treatment. This extract contained competitive mRNA since it lacked nuclease treatment (139); The second was HeLa cell extract or commercially available rabbit reticulocyte extract treated to partially deplete the ribosomes and translation initiation factors (140); The third was Krebs cell extract treated with micrococcal nuclease (141). At first, the rabbit reticulocyte lysate

(RRL, Promega) with partial depletion of ribosomes and translation initiation factors was tested, because the rabbit reticulocyte lysate could be easily purchased. The ribosomes and initiation factors were partially depleted by centrifugation following the protocol described in (140), but the translation efficiency was too low in this extract after the partial depletion. Next, four liters of

HelaS3 cells were cultured to prepare cytoplasmic extract to generate a poly(A)- responsive translation system according to the procedure described by

Bergamini et al. (111). In this cell extract, translation efficiency was higher than that in RRL with partial depletion of ribosomes and initiation factors, and poly(A)- mediated translation stimulation was also observed. Translation experiments were first performed to optimize those conditions because translation efficiency is

103 very sensitive to both the amount of input mRNA as well as the potassium and

magnesium concentrations in the mammalian cell-free translation systems

(111;140).

It has been previously shown that high mRNA concentrations increase in

vitro translation efficiency but decrease poly(A)-mediated translation stimulation

(140;142). Both polyadenylated (A78) and non-polyadenylated (A0) firefly luciferase transcripts capped with an m7GpppG were used to titrate the optimum

amount of input mRNAs. Therefore, poly(A) stimulation of translation could be calculated by the difference of translation between A0 and A78 mRNAs, as

measured by luciferase activity. As shown in Figure 4.6A, when the

concentration of input mRNA was increased from 15 nM to 60 nM, the production

of luciferase increased approximately 9- and 5-fold for A0 and A78 mRNAs,

respectively. However, the nearly 7-fold higher translation of A78 mRNA versus

A0 at 15 nM of input mRNA decreased to approximately 4-fold at 60 nM (Figure

4.6B). In other words, the stimulatory effect of the poly(A) tail on translation

decreased at higher input mRNA concentrations. This is consistent with previous

studies in other labs. Based on these results, 30 nM input mRNA was used for

later translation reactions because both translation efficiency and poly(A)

stimulation were relatively high under this condition. Moreover, other labs also

have used similar amounts of mRNA in their in vitro translation systems.

104 Next, the magnesium and potassium concentrations were titrated to

maximize the translation of the PLE-containing mRNAs with a short poly(A) tail,

7 either A14 (+PLE A14) or A20 (+PLE A20). Thirty nM m GpppG capped firefly luciferase +PLE A20 mRNA was translated at different MgCl2 concentrations

(Figure 4.7). The highest translation efficiency was obtained when the MgCl2 concentration was 1.2 mM. The same result was obtained with the firefly luciferase +PLE A14 mRNA (data not shown). Therefore, translation reactions were performed at this concentration for later experiments. The optimal potassium concentration was determined by translating m7GpppG capped firefly

luciferase +PLE A14 mRNA at different KCl concentrations. As shown in Figure

4.8, 70 mM KCl was the optimal concentration for the translation of this mRNA.

Therefore, this KCl concentration was used for later translation experiments.

4.4.3 The in vitro translation of non-PLE-containing and PLE-containing

transcripts with poly(A) tails of different lengths

Next, the conditions determined in 4.4.2 were used in in vitro translation

assays to examine and compare the efficiencies of translation of the in vitro

generated firefly luciferase mRNAs containing poly(A) tails of varying lengths with

(+PLE) or without (−PLE) a PLE. To normalize for differences in translation of each mRNA, a 5’ m7GpppG capped Renilla luciferase with a 78-nt poly(A) tail

(RL-A78) was co-translated in this experiment. These transcripts are shown in the diagram of Figure 4.5; the results of the in vitro translation assays are shown

105 in Figure 4.9. Luciferase activity was barely detected for mRNA without a 5’

m7GpppG cap or with a defective ApppG cap, regardless of the presence or absence of a poly(A) tail (Figure 4.9, upper panel, the first two lanes (A0 and

A98)). In contrast, a low level of translation was observed for A0 mRNA bearing

a 5’ m7GpppG cap (the third lane, cap A0). In this and subsequent experiments

7 the normalized value for m GpppG-capped A0 mRNA was arbitrarily set to 1 to

facilitate comparison. The translation of capped transcripts with 14-nt or 20-nt

poly(A) tails (−PLE A14 or −PLE A20) was 2.5 and 5-fold greater than the translation of capped transcripts without a poly(A) tail (−PLE A0), respectively.

However, in other experiments, the translation efficiencies of capped −PLE A14 and −PLE A20 transcripts were similar (data not shown). Luciferase expression

increased with the increasing length of the poly(A) tail, with an overall 5-fold

increase between capped −PLE A20 and −PLE A98 transcripts, and a 25-fold

increase comparing capped −PLE A0 and −PLE A98 transcripts. These results

are in good agreement with results obtained by others using a similar translation

system (111), and confirm the applicability of this system for studying the impact

of the PLE on translation.

Based on in vivo results in Figures 4.1-4.3, it was anticipated that capped

PLE-containing mRNA with A14 or A20 (+PLE A14 or +PLE A20) would be

translated as efficiently in vitro as capped non-PLE-containing mRNA with A98

(−PLE A98). However, in the experiment shown in Figure 4.9, the translation of

+PLE A14, A20, A54 and A98 mRNAs was lower than that of the matching −PLE

106 controls. In other experiments, these +PLE mRNAs were sometimes translated

better than the matching −PLE controls, but the +PLE A14 and +PLE A20 mRNAs were never translated as efficiently as the −PLE A98 mRNA. These results

indicate that the synergy between the PLE and the short poly(A) tail observed in

vivo was not replicated in vitro. To determine whether the translation results

could be due to deadenylation or differential degradation of mRNAs during the

incubation period, RNA recovered from each translation reaction was analyzed

by Northern blot (Figure 4.9, lower panel). Decreased recovery was only seen

for A0 mRNA with 5’ ApppG. Furthermore, there was no evidence for significant

deadenylation during the reaction when the mobility of A0 was compared with

that of the other mRNAs. Thus, the inability of the PLE to enhance the in vitro

translation of short poly(A) mRNA is not due to enhanced degradation or deadenylation.

The mRNAs examined in this experiment carried a PLE from the Xenopus

albumin gene. Previous work had identified a mammalian PLE on the HIV-

EP2/Schnurri-2 gene that encodes a T cell-specific zinc finger transcription factor

(119). To determine whether a mammalian PLE with a slightly different

sequence than a Xenopus PLE might better enhance the translation of mRNAs with a short poly(A) tail in vitro, A20 and A98 mRNAs with (+EPPLE A20 and

+EPPLE A98) or without (−PLE A20 and −PLE A98) the HIV-EP2 PLE were

translated in the same HeLa cytoplasmic extract. As shown in Figure 4.10, the translation of +EPPLE A20 mRNA was essentially the same as that of the −PLE

107 A20 mRNA, which was approximately 4-fold less than the translation of −PLE A98

mRNA. Therefore, the mammalian PLE does not enhance the in vitro translation of short poly(A) mRNA either.

4.5 A nuclear event is required to activate translation of PLE-containing mRNA

The differences between in vitro versus in vivo translation efficiencies of

PLE-containing mRNA with a short poly(A) tail raised the possibility that protein factors that are deposited onto the mRNA during the nuclear processing event could be essential for the translation of PLE-containing mRNA. To test this hypothesis, the transcripts used for in vitro translation were used to transfect

LM(tk-) cells to compare the translation efficiencies between mRNAs containing poly(A) tails of different lengths with or without a PLE. By directly transfecting the cells with the in vitro generated transcripts, the mRNAs were translated in vivo but they did not experience the nuclear processing events. In all cases, cells were co-transfected with capped and polyadenylated Renilla luciferase mRNA (RL-A78) to normalize for differences in translation of each mRNA. The

total RNA recovered from each sample at the end of the reaction was analyzed

by Northern blot to examine the integrities of the transcripts (as shown in Figure

4.11, lower panel).

108

Similar to the observation in the in vitro translation experiment as shown in

Figure 4.9, little translation of uncapped mRNA was observed regardless of the

presence of a PLE or a poly(A) tail (Figure 4.11, upper panel). For the −PLE

mRNAs, A14 and A20 stimulated the translation of capped mRNA 6-fold compared

to capped A0 mRNA; this was greater than the 3- and 5-fold stimulation,

respectively, observed in vitro. Translation increased another 2-fold when

poly(A) was increased to A54, and was increased 17-fold overall between capped

A0 and A98 transcripts. While the fold-increase in translation observed in mRNA- transfected cells was somewhat lower than that observed in vitro, these data are in good agreement with those in Figure 4.9 and confirm previous work showing poly(A) stimulates translation of capped mRNAs in transfected cells (112).

Translation of capped +PLE A14 or A20 mRNA was 6-7 fold greater than

capped −PLE A0 mRNA, a result that was not significantly different than that of

−PLE mRNA with the same length poly(A). Thus, the PLE has no effect on the translation of short-poly(A) RNA transfected into cells. Similar to results in Figure

4.9, the translation of +PLE mRNA increased with poly(A) tail length, and as seen

in vitro, capped +PLE A98 mRNA has the same stimulation relative to capped

−PLE A0 mRNA as −PLE A98 mRNA. The Northern blot in Figure 4.11, lower

panel, showed that, for the most part, equivalent amounts of each mRNA were

recovered from transfected cells. Therefore, the differences observed in

Fig.4.11, upper panel, resulted from differences in translation efficiency, but not

109 differences in mRNA stability in transfected cells. These results indicate that the presence of a PLE on cytoplasmic mRNA by itself is not sufficient to overcome the negative effect of a short poly(A) tail on translation, and they suggest that there is something fundamentally different between +PLE mRNA that has undergone nuclear processing and +PLE mRNA prepared in vitro.

110

Figure 4.1. The PLE imparts a short poly(A) tail on luciferase mRNA. A PLE was inserted between the firefly luciferase gene and a minimal synthetic polyadenylation element (SPA, (116)) in a plasmid in which transcription is controlled by the CMV promoter. The poly(A) tail length of mRNA expressed in transiently transfected cells was determined by RT-PCR using an oligo(dT) primer-adapter to prime reverse transcription and a 5’ [32P]-labeled upstream primer for luciferase. The amplified products were separated on a denaturing 6% polyacrylamide/urea gel and visualized by phosphorimager analysis. The lane marked M contains size markers of 5’ [32P]-labeled HinfI digested ΦX174 DNA.

111

Figure 4.1. The PLE imparts a short poly(A) tail on luciferase mRNA.

112

Figure 4.2. Impact of a PLE on mRNA and protein expression in vivo. Cos- 7 cells were transfected with firefly luciferase constructs without (−PLE) and with (+PLE) a PLE together with a plasmid expressing Renilla luciferase (pcDNA3Rluc). A. RNA extracted 24 hr after transfection was analyzed by Northern blot. F-luc is firefly luciferase mRNA, R-luc is Renilla luciferase mRNA. The signals of both luciferase mRNAs were quantified by phosphorimager analysis and the ratios of firefly to Renilla were shown below the autoradiogram. To facilitate comparison, the value for the −PLE control was arbitrarily set to be 100%. B. Luciferase activity was measured in cytoplasmic extracts 24 hr after transfection. The data are presented as the ratios of firefly (Fluc) to Renilla (Rluc) luciferase activity and represent an average of three independent determinations with the standard deviation from the mean. To facilitate comparison, the value for the −PLE control was arbitrarily set to be 100%.

113

Figure 4.2. Impact of a PLE on mRNA and protein expression in vivo.

114

Figure 4.3. Polysome profile analysis of PLE-containing mRNA. Cos-1 cells were co-transfected with firefly luciferase expression plasmids without (−PLE) or with a PLE (+PLE), and an albumin minigene that expresses full-length Xenopus albumin mRNA (116). Post-nuclear extracts were applied to a linear 10-45% sucrose gradient and centrifuged at 225,000 xg for 2 hr. A quarter ml fractions were collected and RNA was extracted from every even-numbered fraction with 1 ml Trizol®. A. The absorbance profile at 254 nm is shown in the upper panel. The RNA from every two even-numbered fractions were combined and RNase protection assays were performed to detect luciferase (−PLE, +PLE) and albumin mRNA. The results are shown in the lower panels. The direction of sedimentation is indicated by an arrow. B. The percentage of each mRNA in the indicated fractions was quantified by phosphorimager analysis of the RPA results shown in A. The control luciferase mRNA lacking a PLE (−PLE) is shown as solid diamonds with a dashed line, and the +PLE luciferase mRNA is shown as empty diamonds with a dotted line. The Xenopus albumin mRNA is shown as solid diamonds with a solid line.

115

A.

B.

Figure 4.3. Polysome profile analysis of PLE-containing mRNA.

116

Figure 4.4. Plasmid map of pGluc-A20. This map represents a series of plasmids constructed served as templates to generate mRNAs for in vitro translation experiments. They differ in the lengths of the poly(A) tract located downstream of the luciferase coding sequence between a BglII site and a SstII site. The mRNAs were produced by in vitro transcription with SP6 DNA polymerase. The Xenopus albumin PLE sequence was inserted at the XbaI site indicated with an arrow, and the HIV-EP2 PLE was inserted between the XbaI and SalI site. To generate templates for A0 transcripts, the plasmid was linearized at the BglII site (shown in bold) located immediately upstream of the poly(A) tract. To generate templates for A14, A20, A54 and A78 transcripts, the plasmids were linearized at the SstII site (shown in bold with an underline) located immediately after the poly(A) tract. The A14, A20, A54 and A78 transcripts terminate with a dinucleotide sequence “CC” after the poly(A) tract. The pGluc- A98 has a BamHI site instead of SstII at the end of the poly(A) tract. To generate a template to make the A98 transcript, the plasmid was digested with BamHI then treated with Mung Bean nuclease. As a result, the A98 transcripts end with a “GGG” sequence after the 98-nt poly(A) tract.

117

Figure 4.4. Plasmid map of pGluc-A20.

118

Figure 4.5. Luciferase transcripts used for in vitro translation and RNA transfection. Firefly luciferase transcripts with or without a PLE contain different-length poly(A) tails (indicated by the numbers in subscript after letter A). They are either m7GpppG capped, or ApppG capped, or not capped. Renilla luciferase transcripts used as control have a m7GpppG cap and a 78-nt poly(A) tail.

119

120

Figure 4.6. Titration of the input mRNA concentration. Fifteen to sixty nM m7GpppG capped firefly luciferase mRNA without a poly(A) tail (solid diamond with dashed line) or with a 78-nt poly(A) tail (empty square with solid line) were translated in HeLa cell extract with 100 mM KCl and 0.9 mM MgCl2 for 1 hour at 37oC. A. The luciferase activity was plotted against the amount of input mRNA. The error bars denote the standard deviation from the mean calculated from triplicate determinations. B. Fold stimulation by poly(A) was plotted against the input mRNA concentration. The fold stimulation by poly(A) was calculated as the translation ratios of A78 to A0 mRNA.

121

Figure 4.6. Titration of the input mRNA concentration.

122

Figure 4.7. Titration of the MgCl2 concentration to optimize translation of 7 +PLE A20 luciferase mRNA in vitro. Thirty nM m GpppG-capped +PLE firefly luciferase mRNA with a 20-nt poly(A) tail was translated in HeLa cytoplasmic extract in the presence of 100 mM KCl and 0.8-1.5 mM MgCl2. The error bars represent the standard deviation from the mean calculated from triplicate determinations.

123

Figure 4.7. Titration of the MgCl2 concentration to optimize translation of +PLE A20 luciferase mRNA in vitro.

124

Figure 4.8. Titration of the KCl concentration to optimize translation of 7 +PLE A14 luciferase mRNA in vitro. The m GpppG-capped +PLE firefly luciferase mRNA with a 14-nt poly(A) tail was translated in HeLa cytoplasmic extract in the presence of 1.2 mM MgCl2 and 50-110 mM KCl. The error bars represent the standard deviation from the mean calculated from triplicate determinations.

125

Figure 4.8. Titration of the KCl concentration to optimize translation of +PLE A14 luciferase mRNA in vitro.

126

Figure 4.9. Impact of the PLE on translation in vitro. The firefly luciferase mRNAs shown in Figure 4.5 were translated in a HeLa cytoplasmic extract for 1 hr together with a control Renilla luciferase mRNA. A0 and A98 mRNA have 5’ ApppG, and mRNAs labeled ‘cap’ have 5’ m7GpppG. The fold translation shown in the upper panel represents firefly luciferase activity normalized to Renilla luciferase activity and the error bars represent the standard deviation from the mean calculated from triplicate determinations. (Some standard deviation values are too small to be seen in the graph.) To facilitate comparison between the individual mRNAs the value for capped A0 mRNA was arbitrarily set to 1. The lower panel is a Northern blot of RNA extracted from each pooled set of reactions that was probed for firefly luciferase (Fluc) and Renilla luciferase (Rluc).

127

Figure 4.9. Impact of the PLE on translation in vitro.

128

Figure 4.10. Translation of mRNAs containing the HIV-EP2 PLE. The m7GpppG capped firefly luciferase mRNA ±HIV EP2 PLE bearing either 20-nt or 98-nt poly(A) tail was translated simultaneously with a control Renilla luciferase mRNA. The fold translation shown in the upper panel represents firefly luciferase activity normalized to Renilla luciferase activity and the error bars represent the standard deviation from the mean calculated from triplicate determinations. To facilitate comparison, the value for the control −PLE A20 mRNA is set to be 1.

129

Figure 4.10. Translation of mRNAs containing the HIV-EP2 PLE.

130

Figure 4.11. Impact of the PLE on translation of mRNA transfected into cultured cells. The firefly luciferase mRNAs shown in Figure 4.5 were co- transfected with Renilla luciferase mRNA into LM(tk-) cells. Extracts were prepared 1 hr after transfection and analyzed for luciferase activity as in Figure 4.5. The error bars represent the standard deviation from the mean calculated from triplicate determinations. The lower panel is a Northern blot of RNA extracted from RNA-transfected cells analyzed for firefly (Fluc) and Renilla (Rluc) mRNA.

131

Figure 4.11. Impact of the PLE on translation of mRNA transfected into cultured cells.

132

CHAPTER 5

IMPACT OF THE PLE-BINDING PROTEINS AND PABP INHIBITORS ON THE

TRANSLATION OF PLE-CONTAINING mRNA

The results in Chapter 4 show that nuclear experience is required for the

PLE to overcome the negative effect of a short poly(A) tail on translation. This raised the possibility that nuclear experience is necessary for sufficient depositing of protein factors required for efficient translation of PLE-containing mRNAs. The first purpose of this study was to examine if the nuclear PLE- binding proteins can stimulate the translation of PLE-containing mRNAs with a short poly(A) tail in the in vitro translation systems. The second purpose of this study was to examine if inhibiting the activity of poly(A) binding protein (PABP) would have a different impact on the translation of PLE-containing mRNAs with a short poly(A) tail versus non-PLE-containing mRNAs with a long poly(A) tail.

This was important because excessive PABP present in the cytoplasmic extract

may have masked the subtle stimulating effect of the PLE on the translation of

mRNAs with a short poly(A) tail in vitro. Since the 5’ m7GpppG cap is essential

133 for efficient translation of both PLE-containing and non-PLE-containing mRNAs, all of the transcripts used in this study had a 5’ m7GpppG cap.

5.1 Impact of the nuclear PLE-binding proteins on the translation of PLE- containing mRNA

Three protein factors from HeLa nuclear extract have been identified that selectively interact with the PLE. They are U2AF, SF3b and La. In vitro translation assays were used to examine if these PLE-binding proteins function in stimulating translation of PLE-containing mRNAs.

5.1.1 Impact of U2AF on the translation of PLE-containing mRNA

U2AF has been identified as a PLE-binding protein that modulates the regulation of poly(A) tail length control by the PLE (127). U2AF is an essential splicing factor that consists of two subunits: 65-kDa U2AF65 and 35-kDa

U2AF35. The majority of U2AF is present in the nucleus but it also shuttles to the cytoplasm (143). A continuous sucrose density gradient was used to analyze the distribution of U2AF65, and it showed that U2AF65 sedimented with polysomes (Figure 5.1A). This suggested that the splicing factor U2AF could function in translation initiation. To test the possibility that U2AF stimulates the translation of PLE-containing mRNAs with short poly(A) tails, firefly luciferase mRNAs containing poly(A) tails of varying lengths with (+PLE) or without (−PLE) a PLE were translated in the HeLa cytoplasmic extract after incubation with or

134 without the purified U2AF for 30 min on ice. The U2AF used in this experiment

was purified from HeLa nuclear extract by Haidong Gu (127). As shown in

Figure 5.1B, in no case did U2AF increase the translation of +PLE A14 or A20 mRNA to that of −PLE A98 mRNA. U2AF did increase the translation of +PLE A54 mRNA, but it had no effect on the translation of +PLE A20 mRNA. Therefore,

these results suggest that U2AF is not responsible for enhancing the translation of +PLE mRNA with a short poly(A) tail.

5.1.2 Effect of SF3b on the translation of PLE-containing mRNA

In a study performed by Yan Chen to identify PLE-binding proteins using affinity chromatography, the SF3b complex was recovered from HeLa nuclear extract by a biotin-labeled transcript containing four copies of the PLE

(unpublished data). In addition, in the parallel experiment, SF3b was not recovered by the control transcript containing four copies of MutG, which is an inactive mutant of the PLE (133). These results suggested that the SF3b protein complex specifically interacts with the PLE. Previous studies on SF3b had been focused on its function in splicing. SF3b consists of seven protein subunits, and the molecular weights of the subunits range from 10-kDa to 155-kDa (144).

SF3b is an integral component of U2 snRNP and U11/U12 di-snRNP and it is involved in the recognition of the pre-mRNA branch site within the major and minor (129). Whether the cells contain snRNP-free SF3b and whether SF3b functions in other mRNA metabolism steps besides splicing has

135 not been examined. Polysome profile analysis was used to determine if SF3b is

present in the cytoplasm and associates with ribosomes. The cytoplasmic

extract of CHO cells was separated on a 15-40% sucrose density gradient and

proteins from odd-numbered fractions were precipitated with TCA and analyzed

by Western blot. As shown in Figure 5.2A, the majority of the 155-kDa subunit of

SF3b (SF3b-155) was present in the top mRNP fractions on the gradient, but a

population of the SF3b-155 sedimented with polysomes. Other SF3b subunits

were not detected in the polysome fractions, but this could be because the

antibodies against those subunits were less sensitive (data not shown,

communication with Cindy Will). The binding of SF3b-155 to polysomes raised

the possibility that SF3b could function in enhancing the translation of PLE-

containing mRNAs with short poly(A) tails. To examine this, transcripts containing 20- or 98-nt poly(A) tails with (+PLE A20, A98) or without (−PLE A20,

A98) a PLE were translated in vitro in the presence of the SF3b complex purified

from HeLa nuclear extract (generously provided by Cindy Will and Reinhard

Lϋhrmann). As shown in Figure 5.2B, for all transcripts, translation of luciferase

in the presence of 150 fmol SF3b complex was approximately 2-fold higher

compared to translation with buffer along. Notably, the stimulatory effect was the

same on the translation of both +PLE and −PLE mRNAs. The fact that the

translation of +PLE A20 mRNA was not specifically increased by the addition of

SF3b indicates that SF3b does not selectively enhance the translation of PLE-

containing mRNA with a short poly(A) tail.

136 5.1.3 Impact of La protein on the translation of PLE-containing mRNA

La protein was detected by Northwestern analysis as a PLE-binding protein (120). La plays an important role in the 3’ processing of small RNAs transcribed by RNA polymerase III. La also stimulates the translation of certain viral and cellular mRNAs, probably by facilitating translation initiation and start codon selection (128). To examine if La enhances the translation of PLE- containing mRNAs with a short poly(A) tail, the transcripts containing poly(A) tails of varying lengths with or without a PLE were incubated with La before the in vitro translation reaction. La was purified by Haidong Gu from HeLa nuclear extract (120). As shown in Figure 5.3, incubation with 30 fmol of La did not have a significant impact on the translation of either −PLE or +PLE mRNAs, regardless of the poly(A) tail length. When excess La protein up to 120 fmol was added, an overall approximately 2-fold increase of translation was observed for most mRNAs, regardless of the poly(A) tail length and the presence of a PLE. This is in agreement with previous observations using rabbit reticulocyte lysate that excess La increased translation efficiency (145). Given that the overall effect of extra La protein on translation is similar between the −PLE and +PLE mRNAs, these results indicate that La does not selectively enhance the translation of

PLE-containing mRNA.

In the experiment shown in Figure 5.4, the impact of a dominant negative deletion mutant of La on translation was tested. The plasmid expressing GST-

La(226-348) (kindly provided by Nahum Sonenberg) that is a dominant negative

137 deletion mutant of La (referred as GST-LaDN) was transformed into E.coli

BL21(DE3)pLysS. The recombinant protein GST-LaDN was purified from 50 ml

of the bacteria culture using a GSTrapTMFF column (Amersham) following the

standard protocol provided by the manufacturer (Figure 5.4A). Up to 4 pmol of

the purified GST-LaDN was added to the in vitro translation reaction mixture to

inhibit the activity of La, but no significant changes on luciferase production were

detected for any of the transcripts tested (Figure 5.4B). The lack of specific

inhibition of the translation of PLE-containing transcripts by the addition of the

dominant negative La to the in vitro translation reaction is further support of the

conclusion that La is not responsible for the efficient translation of the PLE-

containing mRNAs.

5.1.4 Impact of U2AF, SF3b and La on translation is not specific to firefly

luciferase reporter mRNA

The experiments in Figure 5.1-5.3 showed that all three purified PLE-

binding proteins enhanced the translation of firefly luciferase mRNA moderately

at excessive amounts. It is possible that these proteins have a general

stimulatory effect on translation. However, it is also possible that the increase of translation is reporter specific, since all the experiments were performed using a firefly luciferase reporter. If the latter is true, a rather mild stimulatory effect of the PLE-binding proteins on the translation of the PLE-containing mRNA, if any, could have been masked. To examine whether the changes in translation

138 observed in Figures 5.1-5.3 were specific to the firefly luciferase mRNA, the

impacts of these PLE-binding proteins (U2AF, SF3b and La) on the translation of

the firefly and Renilla luciferase mRNAs were compared. In the experiments

7 shown in Figure 5.4, m GpppG capped A78 Renilla and firefly luciferase mRNAs

were translated together in the presence of either buffer or one of the three PLE-

binding proteins (U2AF, SF3b or La). The impact of the protein (fold effect),

which was calculated as the ratio of translation in the presence of the tested

protein versus buffer, was compared between the firefly and Renilla luciferase

reporter mRNA. As shown in Figure 5.4, the effects of U2AF, SF3b and La on

the translation of both firefly and Renilla luciferase mRNAs were essentially the

same. Therefore, the failure to detect any enhancement of these PLE-binding

proteins on the translation of PLE-containing mRNA with a short poly(A) tail in

the presence of exogenous PLE-binding proteins is not due to the selective effect

on the firefly luciferase reporter.

5.2 Inhibiting the activity of PABP had a different impact on the translation of PLE-containing mRNA with a short poly(A) tail

For most eukaryotic mRNAs with a long poly(A) tail, translational stimulation by the long poly(A) tail is mediated by the poly(A) binding protein

(PABP) (Chapter 1). However, cells have an excess of PABP over poly(A) (70), and it is conceivable that the excessive PABP in the in vitro translation system might mask a subtle activity of the PLE in stimulating translation of mRNA with a

139 short poly(A) tail. If the PLE functionally substitutes for a long poly(A) tail to

stimulate the translation of mRNAs with a short poly(A) tail, inhibiting the activity

of PABP would have a less severe negative impact on the translation of PLE-

containing mRNA with a short poly(A) tail. This hypothesis was examined in the

following experiments.

5.2.1 Translation in PABP-depleted Krebs cell extract

The first experiment was to deplete PABP from the in vitro translation

system. When poly(A) sepharose (Amersham) was used, approximately 50% of the PABP was depleted from the HeLa cytoplasmic extract. The extract obtained above was then used to translate the transcripts containing poly(A) tails of varying lengths with or without a PLE. However, translation of each transcript was severely inhibited after PABP depletion, regardless of the poly(A) tail length and the presence of a PLE, because other RNA binding proteins essential for translation may also have been depleted during this process (data not shown).

Another method to deplete PABP from the HeLa cytoplasmic extract is to

use GST-Paip2 immobilized to Glutathione Agarose Beads (Sigma). In cells, the

PABP interacting protein Paip2 specifically binds to PABP and inhibits

translation; previously, GST-Paip2 has been used to deplete PABP from

micrococcal nuclease-treated HeLa and Krebs cell extracts by Yuri Svitkin and

Nahum Sonenberg (141). GST-Paip2 was purified from E.coli BL21(DE3)pLysS

transformed with a plasmid expressing Paip2 containing an N-terminal GST tag

140 (kindly provided by Nahum Sonenberg, with more description about purification

process in section 5.2.3). The purified GST-Paip2 bound to Glutathione Agarose

Beads (Sigma) was used to deplete PABP from the non-nuclease treated HeLa cytoplasmic extract. However, only a small portion of PABP was depleted using

this method. It turned out that nuclease treatment was necessary for effective

depletion of PABP by Paip2 (personal communication with Drs. Yuri Svitkin and

Nahum Sonenberg), nevertheless, poly(A) length-dependent translation was not

replicated in the HeLa cytoplasmic extract treated by micrococcal nuclease (data

not shown).

Next, PABP-depleted (PABP−) Krebs cell extract and a control extract

without depletion of PABP (PABP+) were obtained from Drs. Yuri Svitkin and

Nahum Sonenberg. Luciferase transcripts containing a 20- or 98-nt poly(A) tail

with (+PLE A20, A98) or without (−PLE A20, A98) a PLE were translated in these

Krebs cell extract and the results are shown in Figure 5.6. The translation

efficiency increased only approximately 1.5-fold in both PABP+ and PABP−

extracts when the poly(A) tail length increased from 20-nt to 98-nt, regardless of

the presence of a PLE. This was less than the 4-fold increase observed in HeLa

cytoplasmic extract without micrococcal nuclease treatment (Figures 4.9 and

4.10). A decrease in the translational stimulation of long poly(A) mRNA versus

short poly(A) mRNA was also observed in HeLa cytoplasmic extract treated with

micrococcal nuclease (data not shown). These results indicate that the

141 difference of translation between short poly(A) (A20) and long poly(A) (A98)

mRNAs is small in nuclease-treated cell extract.

The inhibitory effects of PABP depletion on the translation of each

transcript in the Krebs cell extract are compared in Figure 5.6B. Normalizing the

translation of each transcript in PABP− extract to the translation in control PABP+

extract showed that depletion of PABP from the Krebs extract reduced the

translation efficiency about 50% for each transcript. The inhibitory effect caused by PABP-depletion was not significantly different between A20 and A98 mRNAs or

between +PLE and −PLE mRNAs. Thus, PABP depletion inhibited in vitro

translation of A20 and A98 mRNAs to the same extent. Taken together, the lack of

significant difference in the translation of A20 and A98 mRNAs in both PABP+ and

PABP− Krebs cell extracts treated with micrococcal nuclease indicate that poly(A) length-dependent translation is not well replicated in the nuclease treated

Krebs cell extract. Therefore, the micrococcal nuclease treated Krebs extract is

not a suitable in vitro translation system to evaluate the relationship between the

PLE and the poly(A) tail length in translational stimulation.

5.2.2 Impact of poly(rA) competition for poly(A)-binding proteins on the

translation of PLE-containing mRNAs

Based on the results in 5.2.1, it seemed impossible to completely deplete

PABP from the non-nuclease-treated translation extract in which the poly(A) tail

length-dependent translation was well replicated. To circumvent this problem,

142 reagents that inhibit PABP activity were added to the in vitro translation reaction.

First, excess poly(A) was used to titrate PABP in the translation extract. In the experiment shown in Figure 5.7, mRNAs containing poly(A) tails of different lengths with or without a PLE were translated in HeLa cytoplasmic extract supplemented with 100 or 200 ng of poly(A) (polyadenylic acid potassium salt,

Sigma, refered as poly(rA) to distinguish from poly(A) tail). Results with −PLE mRNAs (5.7A, left panel) showed that, as expected, the addition of poly(rA) inhibited the translation of polyadenylated mRNAs in a concentration-dependent manner, with the highest degree of inhibition observed for A78 and A98 mRNAs.

Poly(rA) addition also inhibited the translation of polyadenylated +PLE mRNAs

(5.7A, right panel), and as for −PLE mRNAs, this effect was greater for A78 and

A98 mRNAs.

The effect of the poly(rA) addition is more clearly illustrated in Figure 5.7B

when the relative translation for each mRNA was normalized to translation in the

absence of added poly(rA). Both 100 and 200 ng of poly(rA) stimulated the

translation of capped −PLE A0 and +PLE A0 luciferase mRNA 2-3 fold (cap A0).

This trans stimulation of A0 mRNA translation by poly(rA) was observed

previously in ribosome-depleted rabbit reticulocyte lysate (90). In the experiment

shown in Figure 5.7, the addition of poly(rA) also stimulated the translation of

both −PLE and +PLE mRNAs with 14-nt and 20-nt poly(A) tails, but sometimes

poly(rA) moderately inhibited translation of those mRNAs in other experiments.

Most interestingly, when the effect of poly(rA) on translation of +PLE and −PLE

143 with short poly(A) tails (A14 and A20) were compared, +PLE mRNAs were

translated 30-50% more efficiently than −PLE mRNAs with the addition of poly(rA) in 3 independent experiments (p-value < 0.1 for A14 mRNAs and p-value

< 0.05 for A20 mRNAs with t-Test, combining results from both poly(rA)

concentrations).

To confirm that the poly(rA) effect on translation observed above was due

to titrating out PABP, recombinant PABP was added back to the cell extract to

examine if the effect caused by poly(rA) addition could be reversed. To prepare

the recombinant PABP, a plasmid expressing human PABP with a C-terminal

(His)6 tag (hPABP-(His)6, kindly provided by Nahum Sonenberg) was

transformed to E.coli BL21(DE3)pLysS, and hPABP-(His)6 was purified from 100

ml bacterial culture using a HiTrapTM chelating column (Amersham) charged with

NiCl2, as shown in Figure 5.8. The bound protein was eluted in imidazole buffer,

and the purified hPABP-(His)6 were dialyzed against MC buffer (the buffer used

for the preparation of in vitro translation cell extract) before being added to the in

vitro translation reactions.

In the experiment shown in Figure 5.9, mRNAs containing a 20-nt or a 98-

nt poly(A) tail with (+PLE A20, A98) or without (−PLE A20, A98) a PLE were

translated in HeLa cytoplasmic extract that was supplemented with poly(rA) and

either buffer or hPABP-(His)6. Similar to the results show in Figure 5.7, the

addition of poly(rA) inhibited the translation of −PLE mRNAs in a concentration-

dependent manner. This inhibitory effect was diminished by the addition of 4

144 pmol hPABP-(His)6, and further addition of hPABP-(His)6 (8 pmol) enhanced

translation (Figure 5.9A, left panel). This is in agreement with previous

observations that addition of yeast poly(A) binding protein Pab1p increased the in

vitro translation efficiency in yeast cell extract (91). The fact that the addition of

hPABP-(His)6 could reverse the inhibitory effect of adding poly(rA) showed that

the poly(rA) effect on translation is through competitive binding to the PABP

present in the HeLa extract. For the +PLE mRNAs, the addition of poly(rA)

inhibited the translation of +PLE A98 mRNA as much as that of −PLE mRNAs

(Figure 5.9A, right panel). However, the translation of +PLE A20 mRNA was

enhanced by the addition of 50 ng poly(rA); although the translation of +PLE A20 mRNA was slightly inhibited by the addition of 100 ng poly(rA) (~10%), the inhibition was less severe than the inhibition by 100 ng poly(rA) on the translation of −PLE mRNAs (~30% for both −PLE A20 and −PLE A98 mRNAs). This is more clear when the relative translation for each mRNA in the presence of poly(rA) with or without added hPABP-(His)6 was calculated by normalizing it to the

translation without added poly(rA) or hPABP-(His)6 (Figure 5.9B). Similar to the

results shown in Figure 5.7, in the presence of poly(rA) (and without the addition of hPABP-(His)6), translation of +PLE A20 mRNA was 30-50% more efficient than

translation of −PLE A20 mRNA (p-value < 0.003 with t-Test, combining results from both poly(rA) concentrations). Therefore, the translation of PLE-containing mRNAs with a short poly(A) tail is more resistant to the competitive binding of poly(rA) to PABP in the in vitro translation extract than the translation of −PLE

145 mRNAs with either a short or a long poly(A) tail. The PLE seems to have no

impact on the translation of mRNAs with a long poly(A) tail in the presence of

poly(rA), since the inhibitory effect of poly(rA) on the translation of +PLE A98 mRNA was the same as on the translation of −PLE A20 and −PLE A98 mRNAs.

However, in the presence of competitive poly(rA), having a PLE is advantageous

for the translation of mRNA with a short poly(A) tail.

5.2.3 Effect of Paip2

Poly(rA) competition can only give a general idea of the relative

involvement of poly(A)-binding proteins, and other RNA binding proteins might

also bind to poly(rA) and affect translation. To specifically inhibit the activity of

PABP, Paip2, a selective repressor of PABP-dependent translation, was added

to the in vitro translation extract. A plasmid expressing GST-Paip2 (kindly

provided by Nahum Sonenberg) was transformed to E.coli BL21(DE3)pLysS

strain, and GST-Paip2 was purified from 50 ml bacterial culture using a

GSTrapTM column (Amersham) as shown in Figure 5.10A. The transcripts

containing poly(A) tails of varying lengths with or without a PLE were translated

in vitro in the HeLa cytoplasmic extract supplemented with the purified GST-

Paip2. As shown in Figure 5.10B, for both −PLE and +PLE mRNAs, Paip2 enhanced the translation of non-polyadenylated mRNAs but inhibited the translation of polyadenylated mRNAs in a concentration-dependent manner, with greater effects observed as the length of the poly(A) tail was increased. To

146 compare the effect of Paip2 on the translation of each transcript, translation in

the presence of Paip2 was normalized to translation without addition of Paip2

(Figure 5.10C). In spite of the generalized inhibition of translation, both +PLE A14 and +PLE A20 mRNAs showed consistently 20-50% greater translation in the presence of Paip2 than −PLE mRNAs with the same or longer poly(A) (p-value <

0.2 comparing +PLE A14 and −PLE A14 mRNAs, and p-value < 0.1 comparing

+PLE A20 and −PLE A20 mRNAs with t-Test, combining results from both GST-

Paip2 concentrations). Consistent with the poly(rA) competition results shown in

Figure 5.7, this experiment indicates that the inhibition of PABP results in better

translation of PLE-containing mRNA with a short poly(A) tail.

To confirm that the suppression of Paip2 on translation observed above

was PABP-dependent, the purified recombinant hPABP-(His)6 was added back

to the in vitro translation extract to examine if Paip2 translation inhibition could be

restored. The results are shown in Figure 5.11A. Similar to the observation in

Figure 5.10, Paip2 inhibited translation in a concentration-dependent manner,

with greater effects observed for A98 mRNAs than for A20 mRNAs. This inhibitory

effect was decreased and finally eliminated with the addition of increasing amounts of hPABP-(His)6; this demonstrates that Paip2 suppresses translation

through interacting with PABP. Similar to the results shown in Figure 5.10 and

the results obtained with poly(rA) (Figure 5.7 and 5.9), although Paip2 inhibited

the translation of +PLE A20 mRNA, the inhibition was less severe than the

inhibition on the translation of −PLE A20 transcripts. This is better illustrated in

147 Figure 5.11B, where normalizing the translation in the presence of GST-Paip2 to

the translation in the absence of GST-Paip2 showed that +PLE A20 mRNA was

translated better than −PLE mRNAs with the same or longer poly(A) (p-value <

0.07 with t-Test, combining results from both GST-Paip2 concentrations). Taken together, all these results indicate that inhibiting the activity of PABP had a less

severe negative impact on the translation of PLE-containing mRNA with a short

poly(A) tail than on non-PLE-containing mRNA. This supports the idea that the

PLE functionally substitutes for PABP-bound poly(A) to stimulate the translation of short poly(A) mRNA. The low efficiency of this process observed in vitro and in mRNA-transfected cells could be the result of inefficient loading of PLE-binding proteins that would normally become associated during nuclear processing.

148

Figure 5.1 Impact of U2AF on the translation of PLE-containing mRNAs. A. The polysome profile of U2AF65 is shown. The cytoplasmic extract of CHO cells was separated on a 15-40% linear sucrose density gradient, and the fractions were collected from the bottom of the gradient. The direction of sedimentation is indicated by the arrow above the diagram. The absorbance profile at 254 nm (OD254 profile) is shown in the upper diagram. Protein from every odd-numbered fraction was recovered by TCA precipitation, and the distribution of U2AF65 was analyzed by Western blot, which is shown in the lower diagram. The band below U2AF65 could be a degradation product or a protein that cross-reacted with the U2AF65 antibody. B. Capped firefly luciferase mRNAs containing poly(A) tails of different lengths with (+PLE) or without (−PLE) a PLE were incubated with buffer alone (white bars) or 30 fmol of purified U2AF (black bars) for 30 min on ice prior to translation. The values shown are the fold translation for each of the indicated mRNAs, without or with the added U2AF, normalized to the translation of −PLE A0 mRNA in the absence of added U2AF. The translation of −PLE A0 mRNA in the absence of added U2AF was arbitrarily set to 1 to facilitate comparison. The error bars represent the standard deviation from the mean calculated from triplicate determinations.

149

Figure 5.1 Impact of U2AF on the translation of PLE-containing mRNAs.

150

Figure 5.2. Impact of SF3b on the translation of PLE-containing mRNAs. A. The distribution of SF3b-155 on a 15-40% sucrose density gradient is shown. Shown above is the OD254 profile, and the arrow indicates the direction of sedimentation. Shown below is a Western blot. It was the same membrane in Figure 5.1 that was stripped and re-blotted with antibody against SF3b-155. The majority of SF3b-155 was present in the mRNP fractions, but a small population sedimented with the heavy polysomes. B. Capped firefly luciferase mRNAs containing either a 20-nt or a 98-nt poly(A) tail with (+PLE) or without (−PLE) a PLE were incubated with either buffer (white bars) or purified SF3b protein complex (gray and black bars with the amount indicated to the right of the graph) prior to in vitro translation. The values shown are the fold translation for each of the indicated mRNAs, without or with the added SF3b, normalized to the translation of −PLE A20 mRNA in the absence of added SF3b. The translation of −PLE A20 mRNA in the absence of added SF3b was arbitrarily set to 1 to facilitate comparison. The error bars represent the standard deviation from the mean calculated from triplicate determinations.

151

Figure 5.2. Impact of SF3b on the translation of PLE-containing mRNAs.

152

Figure 5.3 Impact of La protein on the translation of PLE-containing mRNAs. Capped firefly luciferase mRNAs containing poly(A) tails of different lengths with (+PLE) or without (−PLE) a PLE were incubated with either buffer (white bars) or purified human La protein ( 30 fmol, gray bars; 120 fmol, black bars) prior to in vitro translation. The values shown are the fold translation for each of the indicated mRNAs, without or with the addition of La, normalized to the translation of −PLE A0 mRNA in the absence of added La. The translation of −PLE A0 mRNA without the addition of La was arbitrarily set to 1 to facilitate comparison. The error bars represent the standard deviation from the mean calculated from triplicate determinations.

153

Figure 5.3 Impact of La protein on the translation of PLE- containing mRNAs.

154

Figure 5.4. Impact of a dominant negative La mutant on translation. A. GST-La(226-348) is a dominant negative deletion mutant of human La (indicated by GST-LaDN). It was expressed in E.coli BL21(DE3)pLysS and purified using a GSTrapTMFF column (Amersham). The bound protein was eluted with 10 mM reduced glutathione, and 0.5 ml elution fractions were collected. Two µl of the total lysate (Tot) and flow-through fractions (FT), and 10 µl of the wash (W) and elution fractions were separated by 10% SDS-PAGE, followed by staining with GelCode® Blue Stain Reagent (Pierce). GST-La(DN) is designated by an arrow, and the lower bands could be degradation products. Lane M contains a broad- range protein marker (New England Biolabs). Elution fractions 2 and 3 were pooled and dialyzed against MC buffer (Chapter 2). B. Capped firefly luciferase mRNAs containing poly(A) tails of different lengths with (+PLE) or without (−PLE) a PLE were translated in vitro in the presence of either buffer (white bars) or 4 pmol GST-LaDN (black bars). The values shown are the fold translation for each of the indicated mRNAs, without or with GST-LaDN, normalized to the translation of −PLE A0 mRNA in the presence of buffer. The translation of −PLE A0 mRNA in the presence of buffer was arbitrarily set to 1 to facilitate comparison. The error bars represent the standard deviation from the mean calculated from triplicate determinations.

155

Figure 5.4. Impact of a dominant negative La mutant on translation.

156

Figure 5.5. The impact of PLE-binding proteins on translation is not specific to firefly luciferase reporter mRNA. Thirty femtomoles of each firefly (F-Luc) and Renilla (R-Luc) luciferase mRNA containing a 5’ m7GpppG cap and a 78-nt poly(A) tail were translated in HeLa cytoplasmic extract in the presence of buffer (white bars) or one of the PLE-binding proteins (black bars). The luciferase activity produced by each transcript without the addition of PLE-binding proteins was arbitrarily set to 1 to facilitate comparison. The error bars represent the standard deviation from the mean calculated from triplicate determinations. A. Translation of both luciferase mRNAs with 30 fmol purified U2AF. B. Translation of both luciferase mRNAs with 150 fmol purified SF3b. C. Translation of both luciferase mRNAs with 120 fmol purified La.

157 A.

B.

C.

Figure 5.5. The impact of PLE-binding proteins on translation is not specific to firefly luciferase reporter mRNA.

158

Figure 5.6. Translation in PABP-depleted Krebs cell extract. Capped firefly luciferase mRNAs containing either a 20-nt or a 98-nt poly(A) tail with (+PLE) or without (−PLE) a PLE were translated in control (PABP+) and PABP-depleted (PABP−) Krebs cell extract (kindly provided by Drs. Yuri Svitkin and Nahum Sonenberg). A. The fold translation of each transcript is shown. To facilitate comparison, the luciferase activity produced by −PLE A0 mRNA in the control (PABP+) Krebs cell extract was arbitrarily set to 1. The error bars represent the standard deviation from the mean calculated from triplicate determinations. B. To determine the impact of depleting PABP on the translation of each individual mRNA, the results obtained in A were graphed by normalizing the translation of each transcript in the PABP− extract to that in the control PABP+ extract. For the sake of comparison, the luciferase activity produced by each mRNA in the control Krebs cell extract (PABP+) was arbitrarily set to 1.

159 Figure 5.6. Translation in PABP-depleted Krebs cell extract.

160

Figure 5.7. Impact of poly(rA) competition for poly(A)-binding proteins on the translation of PLE-containing mRNAs. In vitro translation was performed without (white bars), or with the addition of 100 ng (gray bars) or 200 ng (black bars) of poly(rA) to each reaction. A. The values shown are the fold translation for each of the indicated mRNAs, without or with added poly(rA), normalized to the translation of −PLE A0 mRNA in the presence of buffer. The translation of −PLE A0 mRNA in the presence of buffer was arbitrarily set to 1 to facilitate comparison. The error bars represent the standard deviation from the mean calculated from triplicate determinations. B. To determine the impact of poly(rA) on the translation of each individual mRNA, the ratios of translation of each transcript in the presence of added poly(rA) versus that in the presence of buffer were graphed using the results obtained in A. For the sake of comparison, the value of the buffer-only control for each mRNA was set to 1.

161

Figure 5.7. Impact of poly(rA) competition for poly(A)-binding proteins on the translation of PLE-containing mRNAs.

162

Figure 5.8. Purification of hPABP-(His)6. The recombinant hPABP-(His)6 was expressed in E. coli BL21(DE3)pLysS and purified using a HiTrapTM chelating column charged with NiCl2 (Amersham). The bound protein was eluted in the buffer containing a 50-500 mM imidazole gradient generated by an FPLC system, and 0.5 ml elution fractions were collected. Two µl of the total lysate (Tot) and flow-through fractions (FT) and 10 µl of the wash (W) and elution fractions were separated by 10% SDS-PAGE, followed by staining with TM GelCode Blue Stain Reagent (Pierce). The hPABP-(His)6 band is designated by an arrow. Lane M contains the Precision Plus Protein Standard (Bio-Rad). Elution fractions 2 and 3 were pooled and dialyzed against MC buffer (Chapter 2).

163

Figure 5.8. Purification of hPABP-(His)6.

164

Figure 5.9. The impact of poly(rA) on translation is reversed by addition of hPABP-(His)6. Capped firefly luciferase mRNAs containing either a 20-nt or a 98-nt poly(A) tail with (+PLE) or without (−PLE) a PLE were translated in the absence or presence of poly(rA). The purified recombinant hPABP-(His)6 (Figure 5.8) was added to translation reaction mixture in combination with 100 ng poly(rA). The error bars represent the standard deviation from the mean calculated from triplicate determinations. A. The values shown are the fold translation for each of the indicated mRNAs, in the presence of poly(rA) alone and in combination with hPABP-(His)6, normalized to the translation of −PLE A20 mRNA in the absence of poly(rA) and hPABP-(His)6. The translation of −PLE A20 mRNA in the absence of poly(rA) and hPABP-(His)6 was set to 1 to facilitate comparison. The amount of poly(rA) and hPABP-(His)6 added to each reaction is listed to the right of the graph, with poly(rA) in the left column and hPABP- (His)6 (designated as PABP) in the right column. The results are shown as follows: no poly(rA) and no hPABP-(His)6, white bars; 50 ng poly(rA) and no hPABP-(His)6, light gray bars; 100 ng poly(rA) and no hPABP-(His)6, medium gray bars; 100 ng poly(rA) and 4 pmol hPABP-(His)6, dark gray bars; 100 ng poly(rA) and 8 pmol hPABP-(His)6, black bars. B. To determine the impact of poly(rA) on the translation of each individual mRNA, the translation of each transcript in the presence of poly(rA) alone and in combination with hPABP-(His)6 was normalized to that with buffer alone from the results obtained in A. For the sake of comparison, the translation of each mRNA with buffer alone was set to 1. The results are shown as follows: −PLE A20, empty diamonds with a dashed line; −PLE A98, empty squares with a solid line; +PLE A20, solid diamonds with a dotted line; +PLE A98, solid squares with dashed/dotted line. The amount of added poly(rA) and hPABP-(His)6 (indicated as PABP) are shown on the x axis.

165 Figure 5.9. The impact of poly(rA) on translation is reversed by addition of hPABP-(His)6.

166

Figure 5.10. The impact of Paip2 inhibition of PABP on the translation of PLE-containing mRNAs. A. GST-Paip2 was expressed in E.coli BL21(DE3)pLysS and purified through an Amersham GSTrapTMFF column. The bound protein was eluted with 10 mM reduced glutathione, and 0.5 ml elution fractions were collected. Two µl of the total lysate (Tot) and flow-through fractions (FT), and 10 µl of the wash (W) and elution fractions were separated by 10% SDS-PAGE, followed by staining with GelCode Blue Stain Reagent (Pierce). GST-Paip2 is designated by an arrow, and the lower bands could be degradation products. Lane M contains a broad-range protein marker (New England Biolabs). Elution fractions 2 and 3 were pooled and dialyzed against MC buffer. B. The HeLa cytoplasmic extract was incubated on ice for 30 min with buffer (white bars), or with 2 pmol (gray bars) or 8 pmol (black bars) of Gst-Paip2 before starting the in vitro translation. The fold difference in translation was determined as in Fig. 5.7A by normalizing the translation of each transcript to that of −PLE A0 mRNA in the absence of GST-Paip2. The error bars represent the standard deviation from the mean calculated from triplicate determinations. C. The impact of Paip2 on the translation of each individual mRNA was determined as in Fig. 7B by normalizing each dataset to the values obtained for the buffer control. For the sake of comparison, the buffer control for each mRNA was set to 1.

167

Figure 5.10. The impact of Paip2 inhibition of PABP on the translation of PLE-containing mRNAs.

168

Figure 5.11. Inhibition of Paip2 on translation is reversed by addition of hPABP-(His)6. Capped firefly luciferase mRNAs containing either a 20-nt or a 98-nt poly(A) tail with (+PLE) or without (−PLE) a PLE were translated in the absence or presence of GST-Paip2. The purified recombinant hPABP-(His)6 (Figure 5.8) was added to translation reaction mixture in combination with 8 pmol GST-Paip2. The error bars represent the standard deviation from the mean calculated from triplicate determinations. A. The values shown are the fold translation for each of the indicated mRNAs, in the presence of GST-Paip2 alone and in combination with hPABP-(His)6, normalized to the translation of −PLE A20 mRNA in the absence of poly(rA) and hPABP-(His)6. The translation of −PLE A20 mRNA in the absence of GST-Paip2 and hPABP-(His)6 was set to 1 to facilitate comparison. The amount of GST-Paip2 and hPABP-(His)6 added to each reaction is listed to the right of the graph, with GST-Paip2 in the left column (designated as Paip2) and hPABP-(His)6 in the right column (designated as PABP). The results are shown as follows: no GST-Paip2 and no hPABP-(His)6, white bars; 4 pmol GST-Paip2 and no hPABP-(His)6, light gray bars; 8 pmol GST-Paip2 and no hPABP-(His)6, medium gray bars; 8 pmol GST-Paip2 and 4 pmol hPABP-(His)6, dark gray bars; 8 pmol GST-Paip2 and 8 pmol hPABP- (His)6, black bars. B. To determine the impact of Paip2 on the translation of each individual mRNA, the values obtained in A using extracts containing GST- Paip2 and hPABP-(His)6 were normalized to the value obtained with buffer only control. For the sake of comparison, the translation of each mRNA with buffer was set to 1. The results are shown as follows: −PLE A20, empty diamonds with a dashed line; −PLE A98, empty squares with a solid line; +PLE A20, solid diamonds with a dotted line; +PLE A98, solid squares with dashed/dotted line. The amount of added poly(rA) and hPABP-(His)6 (indicated as PABP) are shown on the x axis.

169

Figure 5.11. Inhibition of Paip2 on translation is reversed by addition of hPABP-(His)6.

170

CHAPTER 6

DISCUSSION

6.1 The PLE enhances pre-mRNA 3’ processing efficiency

The 3’ cleavage/polyadenylation of pre-mRNA is a highly complex process that requires tens of factors acting in cis and in trans (Chapter 1). The efficiency of 3’ processing is related to the level of gene expression, as the polyadenylation signal directly influences the production of mature mRNA for translation (146). A number of sequences upstream of the AAUAAA polyadenylation signal (USEs) modulate the efficiency of 3’ end formation, either as enhancers or as repressors

(reviewed in (8)). USEs that increase 3’ processing efficiency are common in viral mRNAs, and they are also present in cellular mRNAs including human C2 complement (147), lamin B2 (148) and collagen (15). These USEs are U-rich and they may serve as recognition sites for protein factors that stabilize the polyadenylation complex (8).

The poly(A) limiting element (PLE) located upstream of the AAUAAA poly(A) signal is a USE that has been previously shown to regulate the poly(A) tail length. The study described in Chapter 3 was focused on examining the

171 impact of a PLE on the efficiency of pre-mRNA 3’ processing. The fact that the

PLE-containing albumin and transferrin mRNAs are very abundant in Xenopus

liver suggests that the 3’ processing of PLE-containing mRNAs is very efficient.

In addition, the 5’ pyrimidine-rich region of the PLE, which is the portion required

for poly(A) length control (133), shares similarity to a group of U-rich USEs that

stimulate 3’ processing. For example, the pyrimidine-rich sequence in the

Xenopus transferrin PLE is U3AU2CUCA (119), which is similar to the human

collagen USE consensus sequence UAU2-5GUNA (15). As shown in Figure 3.1,

the presence of a PLE increased the steady state level of the β-globin reporter

mRNA about 50% in both the cytoplasmic and the nuclear fractions when

compared to the control mRNA lacking a PLE. However, the PLE has no

influence on transcription (Figure 3.2), splicing, or export (suggested by Figure

3.1). Moreover, quantitative RT-PCR showed that there was about 50% less unprocessed (uncleaved) PLE-containing pre-mRNA than the control pre-mRNA lacking a PLE (Figure 3.3). RNase protection assay also showed that the ratio of mature mRNA versus uncleaved pre-mRNA from PLE-containing construct was higher than the ratios of constructs without a PLE or with an inactive PLE mutant

(Figure 3.4). Taken together, these results indicate that the PLE enhances 3’ processing and that the stimulatory effect of the PLE on 3’ processing leads to an increase in mRNA accumulation. The stimulation by the PLE on 3’ processing

(cleavage) efficiency was also observed in vitro, as the presence of a PLE increased the cleavage rate about 20% compared to the control input pre-mRNA

172 lacking a PLE (Figure 3.5). Four copies of the PLE further increased the 3’

cleavage rate in vitro. It was observed that the transcript containing four copies

of the PLE was cleaved 80% faster than the control input pre-mRNA containing

four copies of MutG, an inactive mutant of the PLE (Figure 3.6). These results

from the in vivo and the in vitro experiments have shown that the PLE enhances

the efficiency of pre-mRNA 3’ processing in addition to its function in regulating

the poly(A) tail length.

Unfortunately, it is still unclear how the PLE regulates pre-mRNA 3’

processing. One of the PLE interacting proteins is U2AF, which modulates the

poly(A) length control by the PLE (127). Contradictory results have been

obtained in previous studies about the functions of U2AF in pre-mRNA 3’

processing. One report showed that U2AF65 promoted 3’ processing when it

was tethered to the β-globin gene upstream of the AAUAAA poly(A) signal (126).

However, two pieces of evidence suggested a negative effect of U2AF on 3’ processing. First, a U2AF65 tethered to the upstream of the adenovirus L3

poly(A) signal inhibited 3’ polyadenylation by interacting with the poly(A)

polymerase (PAP) and inhibiting its activity (125;149). Second, U2AF65 inhibited

the expression of the human papillomavirus late gene when bound to the negative regulatory element (NRE) upstream of its poly(A) site, presumably through inhibiting the 3’ polyadenylation (150). These contradictory results

suggested that U2AF regulates the 3’ processing by a complicated mechanism

that may require other proteins. It is alluring to hypothesize that the U2AF65

173 bound to the PLE enhances the efficiency of 3’ cleavage while it suppresses the poly(A) addition activity of PAP to limit the poly(A) tail to less than 20-nt.

However, U2AF does not directly restrict the poly(A) tail length of the PLE- containing mRNA. It is more likely that U2AF transiently binds to the PLE and recruits other protein(s) to regulate the poly(A) tail length (127). Whether U2AF is involved in the PLE-mediated stimulation of 3’ processing efficiency needs to be examined by further experiments. Two potential experiments could be performed to analyze if the stimulation of PLE on 3’ processing would be affected by inhibition of U2AF: The first is to silence the expression of U2AF65 with siRNA in vivo; the second is to use oligo(dT) sepharose to deplete U2AF from the HeLa nuclear extract for in vitro 3’ cleavage assays. It is possible that the elevated 3’ processing efficiency observed for PLE-containing mRNAs results from a transient association of U2AF with the PLE just upstream of the AAUAAA.

The other PLE-binding proteins identified to date are SF3b and La.

Whether they function in 3’ processing of mRNAs has not been reported, although it has been shown that La functions in the 3’ processing of transcripts produced by RNA polymerase III (such as tRNAs). Future experiments using siRNA to silence the expression of those PLE-binding proteins could be performed to examine if they play a role in the PLE-mediated stimulation of 3’ processing efficiency.

174 6.2 The PLE in combination with a short poly(A) tail functionally substitute for a long poly(A) tail in stimulating translation in vivo

The long poly(A) tail on most eukaryotic mRNAs acts as an enhancer of translation by recruiting multiple copies of PABP to the 3’ end of the mRNA (62)

(92). However, Xenopus albumin mRNA containing the poly(A) limiting element

(PLE) and a poly(A) tail of less than 20-nt produces the most abundant protein in

Xenopus liver (114;117). This raised the possibility that the PLE could function synergistically with a short poly(A) tail to substitute for a long poly(A) tail to stimulate translation. This hypothesis was examined in the studies described in

Chapters 4 and 5. As shown in Figures 4.1 and 4.2, the presence of a PLE imparted a short poly(A) tail on the intronless luciferase reporter mRNA, and the

PLE-containing mRNA with a short poly(A) tail produced the same amount of luciferase as the control non-PLE-containing mRNA with a long poly(A) tail. Thus the PLE plus a short poly(A) tail does functionally substitute for a long poly(A) tail, indicating there is no inherent bias for translation against PLE-containing mRNAs with short poly(A) tails in living cells.

Translation is primarily controlled at initiation (59;62), and profiling the distribution of mRNAs across mRNP and polysome-bound complexes on sucrose density gradients is a standard assay for measuring initiation efficiency. The experiment in Figure 4.3 demonstrates that the PLE-containing luciferase mRNA with a short poly(A) tail is bound equally well by ribosomes as the control non-

PLE-containing mRNA with a long poly(A) tail. Thus, translation initiates equally

175 well on the PLE-containing mRNA with a short poly(A) tail and on the control

mRNA with a long poly(A) tail. Further evidence to support an efficient initiation

on the PLE-containing mRNAs with short poly(A) tails was seen in the polysome

profile for Xenopus albumin mRNA, which is expressed with a <20 nt poly(A) tail

from a transfected minigene (116). All the results indicate that the PLE works together with the short poly(A) tail to functionally replace a long poly(A) tail bearing multiple copies of PABP in vivo.

Although the PLE-stimulated translation of short poly(A) mRNA could not be fully replicated in vitro (Figures 4.9 and 4.10, with further discussion in the next section), the presence of a PLE buffered the inhibitory effect of excess poly(rA) (Figures 5.7 and 5.9) or Paip2 (Figures 5.10 and 5.11). In both cases the repression of PABP activity led to the inhibition of translation efficiency of both +PLE and −PLE mRNAs, but the inhibition on the translation of PLE- containing mRNAs with short poly(A) tails was less severe when compared to the control −PLE mRNAs with either short or long poly(A) tails. These data were highly reproducible, indicating that the PLE functions in a manner independent of bound PABP to enhance the translation of mRNAs with short poly(A) tails.

Therefore, the translation of PLE-containing, short poly(A) mRNA is at an advantage in conditions of limited PABP. This could be biologically significant.

For example, the level of PABP is limited in murine erythroleukemia cells (MEL cells) during differentiation (151) and in Xenopus oocytes at early stages of embryogenesis (152). Although it is still unknown if there are PLE-containing

176 mRNAs with short poly(A) tails in those cells, an mechanism analogous to the

PLE/short poly(A)-mediated translation stimulation would be advantageous in those cases.

6.3 Translational stimulation of short poly(A) mRNA by the PLE requires the nuclear experience

To further examine the relationship between poly(A) tail length and translation of PLE-containing mRNA, a cap- and poly(A)-dependent in vitro translation system was developed using HeLa cell cytoplasmic extract. It was important to develop an in vitro assy because it is not possible to control the absolute length of the poly(A) tail on processed mRNA in vivo. In this system, translation required that the input transcripts have a 5’ m7GpppG cap. In

addition, the translation efficiency increased in proportion to the length of poly(A)

tail on the transcripts, with a maximum of 27-fold stimulation of A98 mRNA compared to A0 mRNA (Figure 4.9 , left panel). However, in this system, the

translation of +PLE mRNAs with a short poly(A) tail (A14 or A20) never

approximated the translation of control −PLE mRNAs with longer poly(A) tails

(Figures 4.9 and 4.10). This was not due to differences in mRNA stability, since there were only small differences in mRNA recovery following in vitro translation

(Figure 4.9). Similar results were obtained when mRNAs were transfected

directly into cells (Figure 4.11). Together these data indicate that there is

something fundamentally different about the translation of a PLE-containing

177 mRNA that has been transcribed, processed and exported from the nucleaus

versus the same mRNA transcribed in vitro. In other words, for the PLE to stimulate the translation of a short poly(A) mRNA, this mRNA has to have had a nuclear experience.

Next, the series of experiments described in Chapter 5 were performed to examine if the addition of nuclear PLE-binding proteins would restore the PLE- mediated translational stimulation in the in vitro translation assays. The nuclear

PLE-binding proteins identified so far include U2AF, SF3b and La. However,

none of these PLE-binding proteins stimulated PLE-mediated translation of short

poly(A) mRNAs (Figures 5.1-5.4). These results suggest that the PLE-mediated

translational stimulation of the short poly(A) mRNAs may not be as simple as the

binding of translation activator(s) to the PLE in a sequence- or structure- specific

manner. It is more likely that the proteins necessary for efficient translation of

PLE-containing mRNAs are dynamically deposited during mRNA maturation in

the nucleus. This is analogous to the recent reports showing that proteins of the

exon junction complex (EJC) stimulate the translation of intron-containing mRNAs (153-155). The EJC is a highly dynamic complex composed of three core proteins (Y14, magoh and eIF4AIII) and other peripheral components.

Many of the peripheral components join this complex only transiently at different

mRNA metabolism stages (reviewed in (156)). The EJCs are deposited at a

specific position approximately 20- to 24-nt upstream of the exon-exon junctions

during splicing. Then, the EJCs accompany the spliced mRNAs to the

178 cytoplasm, where the majority of EJCs are removed during the pioneer round of

translation (157;158). The EJC has been studied extensively in the four years

since its discovery, and it has been shown that the EJC is important for mRNA

surveillance, localization and translation yield. However, it is still a puzzle how the EJC is deposited specifically at the exon-exon junctions. Binding of the EJC to the mRNA is neither sequence- nor structure- specific since the EJC is a general RNA binding complex. This could explain why no EJC component has been recovered by RNA affinity chromatography using transcripts bearing multiple copies of the PLE. It is possible that the EJC or an EJC-like factor

essential for the efficient translation of PLE-containing mRNA with short poly(A)

tails requires that the mRNA undergoes a nuclear experience before it is

efficiently deposited onto this mRNA.

The 3’ processing event appears to be the nuclear experience critical for

efficient translation of the PLE-containing short poly(A) mRNA, since the PLE

seems to have no impact on transcription or splicing (Figures 3.1 and 3.2) but it participates in the poly(A) tail length regulation and enhances 3’ cleavage efficiency (Chapter 3). The 3’ processing of pre-mRNA is a very complicated process that requires tens of protein factors. Although no report has shown any direct relationship between 3’ processing and translation, it is possible that 3’ processing leaves the mature mRNA with an EJC or an EJC-like molecule marker, since the poly(A) signal serves to define the last exon during splicing.

179 Notably, two different U2 splicing components, U2AF (127) and SF3b

(unpublished data), were identified by different approaches used to purify PLE- binding proteins. More interestingly, these proteins associate with heavy polysomes (Figures 5.1 and 5.2). Although no stimulatory function of those proteins has been found in PLE-mediated short poly(A) mRNA translation, it is possible that those proteins transiently bind to the PLE and recruit the EJC or an

EJC-like factor to the PLE-containing mRNAs for efficient loading of these mRNAs to polysomes. This is similar to the transitory roles that U2AF and SF3b proteins play in pre-mRNA splicing when they recruit the U2 snRNP to the 3’ splicing site.

Similar to the PLE-containing mRNA with a short poly(A) tail, the translation of cellular IRES-containing mRNAs (c-myc and BiP mRNAs) also requires a nuclear experience (159;160). More interestingly, poly(A)-tail- mediated translational stimulation on these IRES-containing mRNAs is independent of intact eIF4G and PABP (159). Although it is still unknown if the translation of PLE-containing mRNAs requires intact eIF4G, this translation is less dependent of PABP activity. Such PABP-independent translation could be another mechanism used by the cell to guarantee efficient translation of certain mRNAs.

How do nuclear processing events affect cytoplasmic translation? One possibility is that nuclear events affect the formation of mRNP complexes which then decide the fate of the mRNA. For example, a recent report showed that

180 Sam68 (Src associated during mitosis of 68 kDa) enhanced the 3’ processing of

HIV-1 RNA. In addition, this nuclear nonshutting protein Sam68 also seemed to stimulate translation, probably by inducing the formation of translational efficient mRNP complex (161). For the PLE-containing mRNA, the nuclear factor that enhances its 3’ processing efficiency might function in a similar way as Sam68 to recruit EJC-like factors to deposit onto the mRNA for active translation in the cytoplasm.

6.4 Summary - The PLE and a short poly(A) tail: a novel mechanism to regulate gene expression?

The majority of vertebrate mRNAs have a long poly(A) tail covered by multiple copies of the poly(A) binding protein, which stabilizes the mRNA and

stimulates translation (62;72;92). However, a family of mRNAs has been

identified that possesses the poly(A) limiting element (PLE) and short poly(A)

tails (116;119). Genebank searches performed before the completion of any

metazoan genomes identified several PLE-containing mRNAs (119), and a more

recent and comprehensive bioinformatics analysis has increased this estimate to over 100 mRNAs (unpublished data). In addition, Choi et al. (162) identified a

number of mRNAs that contain short poly(A) tails when they compared mRNAs

recovered by binding to eIF4E versus selection on oligo(dT). Interestingly, most

of these do not have sequence elements related to the PLE, suggesting that the

181 short poly(A) mRNA phenotype might be more widespread than previously thought.

Based on the study described in this dissertation, PLE-containing mRNA with a short poly(A) tail is 3’ cleaved more efficiently than and translated as well as control mRNA with a long poly(A) tail. The results from this study also suggest that the PLE-containing mRNA with a short poly(A) tail is transcribed, spliced and exported as efficiently as control mRNA with a long poly(A) tail. The

PLE-containing mRNAs with short poly(A) tails are very stable too, as evidenced by the observation that the PLE-containing albumin mRNA in Xenopus liver is highly abundant and fairly stable until estrogen stimulation (114). This is also supported by other unpublished studies in the Schoenberg lab using PLE- containing human β-globin reporter genes. All of these results suggest that PLE- containing genes are expressed using a novel mechanism, which is distinct from the general expression pathway used for expression of other genes encoding mRNAs with long poly(A) tails.

Having a short poly(A) tail could be advantageous for quick regulation of gene expression. For example, the translation of CPE-containing mRNAs with a short poly(A) tail can be quickly activated by cytoplasmic polyadenylation upon external stimulation. Such post-transcriptional activation of gene expression is faster than the regulation at the transcription level, since the transcription, processing and export steps are omitted. This quick response is especially beneficial for embryo development and activities in the central nervous system.

182 Different from the CPE-containing mRNAs, the PLE-containing mRNAs are

translationally active even with a short poly(A) tail. In the case of the PLE-

containing albumin mRNA in Xenopus liver, a large amount of protein is efficiently produced from a large amount of mRNA before estrogen stimulation.

Upon estrogen stimulation, the albumin mRNA undergoes rapid degradation initiated by an endonuclease PMR-1 (130;131). Although it is unknown whether the PLE and a short poly(A) tail facilitate this process, having a short poly(A) tail is generally helpful for quick shut down of gene expression, as degradation of mRNAs usually begins with deadenylation (163).

A unique short poly(A) tail also distinguishes the mRNA for targeted regulation. For example, an oligo(A) at the 3’ end of the histone mRNA stem loop structure silences histone translation during Xenopus oogenesis (95). As shown in this study, the PLE plus a short poly(A) tail functionally substitutes for a long poly(A) tail in translation, and this PLE-mediated translational stimulation is independent of PABP, unlike the translational stimulation by a long poly(A).

Such PABP-independent translation enables a certain group of mRNAs to be selected for expression under PABP-deficient conditions, such as during cell differentiation, when most protein synthesis is supressed. It would be interesting to find out whether the mRNAs being actively translated in cells with limited

PABP have the PLE and a short poly(A) tail.

183 In summary, this study examined the 3’ processing and translation of PLE-

containing genes. It shows that the PLE functions as a 3’ processing enhancer

and stimulates translation of mRNA in the context of a short poly(A) tail.

However, the PLE-mediated stimulation of translation requires a nuclear processing experience for the PLE-containing mRNA. The PLE-containing mRNAs with short poly(A) tails are expressed and regulated by a unique and complicated pathway, and more details remain to be uncovered to fully understand this pathway. A model of the PLE-mediated translational activation of mRNA with a short poly(A) tail is proposed in Figure 6.1.

184

Figure 6.1. The PLE-mediated regulation of gene expression. In the nucleus, the PLE-binding proteins U2AF and SF3b themselves or a factor X recruited by the PLE-binding proteins enhances the 3’ cleavage efficiency. The factor X inhibits the activity of PAP and limits the poly(A) tail to be less than 20 nt. This inhibition might be by preventing PAP from switching activity to the fast and progressive manner. During the 3’ processing, the PLE-containing mRNA with a short poly(A) tail is marked by an EJC-like factor (or the factor X is an EJC-like factor). The EJC-like factor accompanies the PLE-containing mRNA with a short poly(A) tail to the cytoplasm where it functions as a translation activator.

185

U2AF 7 5’ m GpppN PLE SF3b

Activate 3’ cleavage efficiency U2AF X 7 + 5’ m GpppN PLE SF3b

Inhibit PAP activity U2AF X PAP 7 5’ m GpppN PLE OH SF3b

EJC-like 5’ m7GpppN PLE An (n<20) Nucleus

Cytoplasm

eIF4G + Activate translation eIF4E eIF4A

PABP EJC-like PLE An (n<20)

Figure 6.1. The PLE-mediated regulation of gene expression.

186

LIST OF REFERENCES

1. Cougot, N., S. Babajko, and B. Seraphin. 2004. Cytoplasmic foci are sites of mRNA decay in human cells. J.Cell Biol. 165:31-40.

2. Sheth, U. and R. Parker. 2003. Decapping and decay of messenger RNA occur in cytoplasmic processing bodies. Science 300:805-808.

3. Moskaitis, J. E., T. D. Sargent, L. H. Smith, Jr., R. L. Pastori, and D. R. Schoenberg. 1989. Xenopus laevis serum albumin: sequence of the complementary deoxyribonucleic acids encoding the 68- and 74-kilodalton peptides and the regulation of albumin gene expression by thyroid hormone during development. Mol.Endocrinol. 3:464-473.

4. Wahle, E. and W. Keller. 1996. The biochemistry of polyadenylation. Trends Biochem.Sci. 21:247-250.

5. Keller, W. 1995. No end yet to messenger RNA 3' processing! Cell 81:829-832.

6. Manley, J. L. 1995. A complex protein assembly catalyzes polyadenylation of mRNA precursors. Curr.Opin.Genet.Dev. 5:222-228.

7. Colgan, D. F. and J. L. Manley. 1997. Mechanism and regulation of mRNA polyadenylation. Genes Dev. 11:2755-2766.

8. Zhao, J., L. Hyman, and C. Moore. 1999. Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol.Mol.Biol.Rev. 63:405-445.

9. Sheets, M. D., S. C. Ogg, and M. P. Wickens . 1990. Point mutations in AAUAAA and the poly (A) addition site: effects on the accuracy and efficiency of cleavage and polyadenylation in vitro. Nucleic Acids Res. 18:5799-5805.

10. Wilusz, J., S. M. Pettine, and T. Shenk. 1989. Functional analysis of point mutations in the AAUAAA motif of the SV40 late polyadenylation signal. Nucleic Acids Res. 17:3899-3908.

187 11. MacDonald, C. C. and J. L. Redondo. 2002. Reexamining the polyadenylation signal: were we wrong about AAUAAA? Mol.Cell Endocrinol. 190:1-8.

12. Chen, F., C. C. MacDonald, and J. Wilusz. 1995. Cleavage site determinants in the mammalian polyadenylation signal. Nucleic Acids Res. 23:2614-2620.

13. Chen, F. and J. Wilusz. 1998. Auxiliary downstream elements are required for efficient polyadenylation of mammalian pre-mRNAs. Nucleic Acids Res. 26:2891-2898.

14. Lou, H., D. M. Helfman, R. F. Gagel, and S. M. Berget. 1999. Polypyrimidine tract-binding protein positively regulates inclusion of an alternative 3'-terminal exon. Mol.Cell Biol. 19:78-85.

15. Natalizio, B. J., L. C. Muniz, G. K. Arhin, J. Wilusz, and C. S. Lutz. 2002. Upstream elements present in the 3'-untranslated region of collagen genes influence the processing efficiency of overlapping polyadenylation signals. J.Biol.Chem. 277:42733-42740.

16. Gunderson, S. I., K. Beyer, G. Martin, W. Keller, W. C. Boelens, and L. W. Mattaj. 1994. The human U1A snRNP protein regulates polyadenylation via a direct interaction with poly(A) polymerase. Cell 76:531-541.

17. Gunderson, S. I., M. Polycarpou-Schwarz, and I. W. Mattaj. 1998. U1 snRNP inhibits pre-mRNA polyadenylation through a direct interaction between U1 70K and poly(A) polymerase. Mol.Cell 1:255-264.

18. Murthy, K. G. and J. L. Manley. 1995. The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'-end formation. Genes Dev. 9:2672-2683.

19. Ryan, K., O. Calvo, and J. L. Manley. 2004. Evidence that polyadenylation factor CPSF-73 is the mRNA 3' processing endonuclease. RNA. 10:565-573.

20. Chen, Z., Y. Li, and R. M. Krug. 1999. Influenza A virus NS1 protein targets poly(A)-binding protein II of the cellular 3'-end processing machinery. EMBO J. 18:2273-2283.

21. Zarudnaya, M. I., I. M. Kolomiets, and D. M. Hovorun. 2002. What nuclease cleaves pre-mRNA in the process of polyadenylation? IUBMB.Life 54:27-31.

188 22. Kaufmann, I., G. Martin, A. Friedlein, H. Langen, and W. Keller. 2004. Human Fip1 is a subunit of CPSF that binds to U-rich RNA elements and stimulates poly(A) polymerase. EMBO J. 23:616-626.

23. Takagaki, Y., J. L. Manley, C. C. MacDonald, J. Wilusz, and T. Shenk. 1990. A multisubunit factor, CstF, is required for polyadenylation of mammalian pre-mRNAs. Genes Dev. 4:2112-2120.

24. Takagaki, Y. and J. L. Manley. 1997. RNA recognition by the human polyadenylation factor CstF. Mol.Cell Biol. 17:3907-3914.

25. Takagaki, Y. and J. L. Manley. 1992. A human polyadenylation factor is a G protein beta-subunit homologue. J.Biol.Chem. 267:23471-23474.

26. Ruegsegger, U., K. Beyer, and W. Keller. 1996. Purification and characterization of human cleavage factor Im involved in the 3' end processing of messenger RNA precursors. J.Biol.Chem. 271:6107-6113.

27. Ruegsegger, U., D. Blank, and W. Keller. 1998. Human pre-mRNA cleavage factor Im is related to spliceosomal SR proteins and can be reconstituted in vitro from recombinant subunits. Mol.Cell 1:243-253.

28. de Vries, H., U. Ruegsegger, W. Hubner, A. Friedlein, H. Langen, and W. Keller. 2000. Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors. EMBO J. 19:5895-5904.

29. Edmonds, M. 2002. A history of poly A sequences: from formation to factors to function. Prog.Nucleic Acid Res.Mol.Biol. 71:285-389.

30. Wahle, E. 1991. Purification and characterization of a mammalian polyadenylate polymerase involved in the 3' end processing of messenger RNA precursors. J.Biol.Chem. 266:3131-3139.

31. Bienroth, S., W. Keller, and E. Wahle. 1993. Assembly of a processive messenger RNA polyadenylation complex. EMBO J. 12:585-594.

32. Wahle, E. 1995. Poly(A) tail length control is caused by termination of processive synthesis. J.Biol.Chem. 270:2800-2808.

33. Nemeth, A., S. Krause, D. Blank, A. Jenny, P. Jeno, A. Lustig, and E. Wahle. 1995. Isolation of genomic and cDNA clones encoding bovine poly(A) binding protein II. Nucleic Acids Res. 23:4034-4041.

34. Wahle, E. 1991. A novel poly(A)-binding protein acts as a specificity factor in the second phase of messenger RNA polyadenylation. Cell 66:759-768. 189 35. Bentley, D. 2002. The mRNA assembly line: transcription and processing machines in the same factory. Curr.Opin.Cell Biol. 14:336-342.

36. Maniatis, T. and R. Reed. 2002. An extensive network of coupling among gene expression machines. Nature 416:499-506.

37. Hirose, Y. and J. L. Manley. 1998. RNA polymerase II is an essential mRNA polyadenylation factor. Nature 395:93-96.

38. Guo, Z. and F. Sherman. 1995. 3'-end-forming signals of yeast mRNA. Mol.Cell Biol. 15:5983-5990.

39. Minvielle-Sebastia, L. and W. Keller. 1999. mRNA polyadenylation and its coupling to other RNA processing reactions and to transcription. Curr.Opin.Cell Biol. 11:352-357.

40. Ohnacker, M., S. M. Barabino, P. J. Preker, and W. Keller. 2000. The WD-repeat protein pfs2p bridges two essential factors within the yeast pre-mRNA 3'-end-processing complex. EMBO J. 19:37-47.

41. Takagaki, Y. and J. L. Manley. 1994. A polyadenylation factor subunit is the human homologue of the Drosophila suppressor of forked protein. Nature 372:471-474.

42. Sadowski, M., B. Dichtl, W. Hubner, and W. Keller. 2003. Independent functions of yeast Pcf11p in pre-mRNA 3' end processing and in transcription termination. EMBO J. 22:2167-2177.

43. Valentini, S. R., V. H. Weiss, and P. A. Silver. 1999. Arginine methylation and binding of Hrp1p to the efficiency element for mRNA 3'- end formation. RNA. 5:272-280.

44. Chen, S. and L. E. Hyman. 1998. A specific RNA-protein interaction at yeast polyadenylation efficiency elements. Nucleic Acids Res. 26:4965- 4974.

45. Dichtl, B., D. Blank, M. Sadowski, W. Hubner, S. Weiser, and W. Keller. 2002. Yhh1p/Cft1p directly links poly(A) site recognition and RNA polymerase II transcription termination. EMBO J. 21:4125-4135.

46. Raabe, T., K. G. Murthy, and J. L. Manley. 1994. Poly(A) polymerase contains multiple functional domains. Mol.Cell Biol. 14:2946-2957.

190 47. Preker, P. J., J. Lingner, L. Minvielle-Sebastia, and W. Keller. 1995. The FIP1 gene encodes a component of a yeast pre-mRNA polyadenylation factor that directly interacts with poly(A) polymerase. Cell 81:379-389.

48. Barabino, S. M., M. Ohnacker, and W. Keller. 2000. Distinct roles of two Yth1p domains in 3'-end cleavage and polyadenylation of yeast pre- mRNAs. EMBO J. 19:3778-3787.

49. Gross, S. and C. Moore. 2001. Five subunits are required for reconstitution of the cleavage and polyadenylation activities of Saccharomyces cerevisiae cleavage factor I. Proc.Natl.Acad.Sci.U.S.A 98:6080-6085.

50. Brown, C. E. and A. B. Sachs. 1998. Poly(A) tail length control in Saccharomyces cerevisiae occurs by message-specific deadenylation. Mol.Cell Biol. 18:6548-6559.

51. Zhao, J., M. M. Kessler, and C. L. Moore. 1997. Cleavage factor II of Saccharomyces cerevisiae contains homologues to subunits of the mammalian Cleavage/ polyadenylation specificity factor and exhibits sequence-specific, ATP-dependent interaction with precursor RNA. J.Biol.Chem. 272:10831-10838.

52. Preker, P. J., M. Ohnacker, L. Minvielle-Sebastia, and W. Keller. 1997. A multisubunit 3' end processing factor from yeast containing poly(A) polymerase and homologues of the subunits of mammalian cleavage and polyadenylation specificity factor. EMBO J. 16:4727-4737.

53. Hector, R. E., K. R. Nykamp, S. Dheur, J. T. Anderson, P. J. Non, C. R. Urbinati, S. M. Wilson, L. Minvielle-Sebastia, and M. S. Swanson. 2002. Dual requirement for yeast hnRNP Nab2p in mRNA poly(A) tail length control and nuclear export. EMBO J. 21:1800-1810.

54. Minvielle-Sebastia, L., P. J. Preker, T. Wiederkehr, Y. Strahm, and W. Keller. 1997. The major yeast poly(A)-binding protein is associated with cleavage factor IA and functions in premessenger RNA 3'-end formation. Proc.Natl.Acad.Sci.U.S.A 94:7897-7902.

55. Amrani, N., M. Minet, M. Le Gouar, F. Lacroute, and F. Wyers. 1997. Yeast Pab1 interacts with Rna15 and participates in the control of the poly(A) tail length in vitro. Mol.Cell Biol. 17:3694-3701.

56. Munroe, D. and A. Jacobson. 1990. mRNA poly(A) tail, a 3' enhancer of translational initiation. Mol.Cell Biol. 10:3441-3455.

191 57. Fox, C. A. and M. Wickens. 1990. Poly(A) removal during oocyte maturation: a default reaction selectively prevented by specific sequences in the 3' UTR of certain maternal mRNAs. Genes Dev. 4:2287-2298.

58. Sachs, A. B. and R. W. Davis. 1989. The poly(A) binding protein is required for poly(A) shortening and 60S ribosomal subunit-dependent translation initiation. Cell 58:857-867.

59. Arava, Y., Y. Wang, J. D. Storey, C. L. Liu, P. O. Brown, and D. Herschlag. 2003. Genome-wide analysis of mRNA translation profiles in Saccharomyces cerevisiae. Proc.Natl.Acad.Sci.U.S.A 100:3889-3894.

60. Hershey, J. and Merrick W. 2002. Pathway and mechanism of initiation of protein synthesis, p. 33-88. In N. Sonenberg, J. Hershey, and M. B. Mathews (ed.), Translational control of geneexpression. Cold Spring Harbor Laboratory Press.

61. McKendrick, L., V. M. Pain, and S. J. Morley. 1999. Translation initiation factor 4E. Int.J.Biochem.Cell Biol. 31:31-35.

62. Raught, B., A. C. Gingras, and N. Sonenberg. 2002. Regulation of ribosome recruitment in eukaryotes, p. 245-294. In N. Sonenberg, J. Hershey, and M. B. Mathews (ed.), Pathway and mechanism of initiation of protein synthesis. Cold Spring Harbor Laboratory Press.

63. Mamane, Y., E. Petroulakis, L. Rong, K. Yoshida, L. W. Ler, and N. Sonenberg. 2004. eIF4E--from translation to transformation. Oncogene 23:3172-3179.

64. Raught, B. and A. C. Gingras. 1999. eIF4E activity is regulated at multiple levels. Int.J.Biochem.Cell Biol. 31:43-57.

65. Prevot, D., J. L. Darlix, and T. Ohlmann. 2003. Conducting the initiation of protein synthesis: the role of eIF4G. Biol.Cell 95:141-156.

66. Caron, S., M. Charon, E. Cramer, N. Sonenberg, and I. Dusanter- Fourt. 2004. Selective modification of eukaryotic initiation factor 4F (eIF4F) at the onset of cell differentiation: recruitment of eIF4GII and long- lasting phosphorylation of eIF4E. Mol.Cell Biol. 24:4920-4928.

67. Pestova, T. V., I. N. Shatsky, and C. U. Hellen. 1996. Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes. Mol.Cell Biol. 16:6870-6878.

192 68. Lamphear, B. J., R. Kirchweger, T. Skern, and R. E. Rhoads. 1995. Mapping of functional domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral proteases. Implications for cap- dependent and cap-independent translational initiation. J.Biol.Chem. 270:21975-21983.

69. Imataka, H. and N. Sonenberg. 1997. Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. Mol.Cell Biol. 17:6940-6947.

70. Gorlach, M., C. G. Burd, and G. Dreyfuss. 1994. The mRNA poly(A)- binding protein: localization, abundance, and RNA-binding specificity. Exp.Cell Res. 211:400-407.

71. Sachs, A. B., R. W. Davis, and R. D. Kornberg. 1987. A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability. Mol.Cell Biol. 7 :3268-3276.

72. Mangus, D. A., M. C. Evans, and A. Jacobson. 2003. Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biol. 4:223.

73. Deo, R. C., J. B. Bonanno, N. Sonenberg, and S. K. Burley. 1999. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell 98:835-845.

74. Imataka, H., A. Gradi, and N. Sonenberg. 1998. A newly identified N- terminal amino acid sequence of human eIF4G binds poly(A)-binding protein and functions in poly(A)-dependent translation. EMBO J. 17:7480- 7489.

75. Deo, R. C., N. Sonenberg, and S. K. Burley . 2001. X-ray structure of the human hyperplastic discs protein: an ortholog of the C-terminal domain of poly(A)-binding protein. Proc.Natl.Acad.Sci.U.S.A 98:4414-4419.

76. Kuhn, U. and T. Pieler. 1996. Xenopus poly(A) binding protein: functional domains in RNA binding and protein-protein interaction. J.Mol.Biol. 256:20-30.

77. Kozlov, G., J. F. Trempe, K. Khaleghpour, A. Kahvejian, I. Ekiel, and K. Gehring. 2001. Structure and function of the C-terminal PABC domain of human poly(A)-binding protein. Proc.Natl.Acad.Sci.U.S.A 98:4409- 4413.

78. Khanna, R. and M. Kiledjian. 2004. Poly(A)-binding-protein-mediated regulation of hDcp2 decapping in vitro. EMBO J. 193 79. Christensen, A. K., L. E. Kahn, and C. M. Bourne. 1987. Circular polysomes predominate on the rough endoplasmic reticulum of somatotropes and mammotropes in the rat anterior pituitary. Am.J.Anat. 178:1-10.

80. Madin, K., T. Sawasaki, N. Kamura, K. Takai, T. Ogasawara, K. Yazaki, T. Takei, K. Miura, and Y. Endo. 2004. Formation of circular polyribosomes in wheat germ cell-free protein synthesis system. FEBS Lett. 562:155-159.

81. Wells, S. E., P. E. Hillner, R. D. Vale, and A. B. Sachs. 1998. Circularization of mRNA by eukaryotic translation initiation factors. Mol.Cell 2:135-140.

82. Borman, A. M., Y. M. Michel, and K. M. Kean. 2000. Biochemical characterisation of cap-poly(A) synergy in rabbit reticulocyte lysates: the eIF4G-PABP interaction increases the functional affinity of eIF4E for the capped mRNA 5'-end. Nucleic Acids Res. 28:4068-4075.

83. Wei, C. C., M. L. Balasta, J. Ren, and D. J. Goss. 1998. Wheat germ poly(A) binding protein enhances the binding affinity of eukaryotic initiation factor 4F and (iso)4F for cap analogues. Biochemistry 37:1910-1916.

84. Le, H., R. L. Tanguay, M. L. Balasta, C. C. Wei, K. S. Browning, A. M. Metz, D. J. Goss, and D. R. Gallie. 1997. Translation initiation factors eIF-iso4G and eIF-4B interact with the poly(A)-binding protein and increase its RNA binding activity. J.Biol.Chem. 272:16247-16255.

85. Bi, X. and D. J. Goss. 2000. Wheat germ poly(A)-binding protein increases the ATPase and the RNA helicase activity of translation initiation factors eIF4A, eIF4B, and eIF-iso4F. J.Biol.Chem. 275:17740- 17746.

86. Gross, J. D., N. J. Moerke, H. T. von der, A. A. Lugovskoy, A. B. Sachs, J. E. McCarthy, and G. Wagner. 2003. Ribosome loading onto the mRNA cap is driven by conformational coupling between eIF4G and eIF4E. Cell 115:739-750.

87. Mazumder, B., V. Seshadri, and P. L. Fox. 2003. Translational control by the 3'-UTR: the ends specify the means. Trends Biochem.Sci. 28:91-98.

88. Mazumder, B., P. Sampath, V. Seshadri, R. K. Maitra, P. E. DiCorleto, and P. L. Fox. 2003. Regulated release of L13a from the 60S ribosomal subunit as a mechanism of transcript-specific translational control. Cell 115:187-198.

194 89. Mazumder, B., V. Seshadri, H. Imataka, N. Sonenberg, and P. L. Fox. 2001. Translational silencing of ceruloplasmin requires the essential elements of mRNA circularization: poly(A) tail, poly(A)-binding protein, and eukaryotic translation initiation factor 4G. Mol.Cell Biol. 21:6440-6449.

90. Borman, A. M., Y. M. Michel, C. E. Malnou, and K. M. Kean. 2002. Free poly(A) stimulates capped mRNA translation in vitro through the eIF4G- poly(A)-binding protein interaction. J.Biol.Chem. 277:36818-36824.

91. Otero, L. J., M. P. Ashe, and A. B. Sachs. 1999. The yeast poly(A)- binding protein Pab1p stimulates in vitro poly(A)-dependent and cap- dependent translation by distinct mechanisms. EMBO J. 18:3153-3163.

92. Sachs, A. 2002. Physical and functional interactions between the mRNA cap structure and the poly(A) tail, p. 447-467. In N. Sonenberg, J. Hershey, and M. B. Mathews (ed.), Pathway and mechanism of initiation of protein synthesis. Cold Spring Harbor Laboratory Press.

93. Gallie, D. R., N. J. Lewis, and W. F. Marzluff. 1996. The histone 3'- terminal stem-loop is necessary for translation in Chinese hamster ovary cells. Nucleic Acids Res. 24:1954-1962.

94. Ling, J., S. J. Morley, V. M. Pain, W. F. Marzluff, and D. R. Gallie. 2002. The histone 3'-terminal stem-loop-binding protein enhances translation through a functional and physical interaction with eukaryotic initiation factor 4G (eIF4G) and eIF3. Mol.Cell Biol. 22:7853-7867.

95. Sanchez, R. and W. F. Marzluff. 2004. The oligo(A) tail on histone mRNA plays an active role in translational silencing of histone mRNA during Xenopus oogenesis. Mol.Cell Biol. 24:2513-2525.

96. Wang, Z. F., T. C. Ingledue, Z. Dominski, R. Sanchez, and W. F. Marzluff. 1999. Two Xenopus proteins that bind the 3' end of histone mRNA: implications for translational control of histone synthesis during oogenesis. Mol.Cell Biol. 19:835-845.

97. Craig, A. W., A. Haghighat, A. T. Yu, and N. Sonenberg. 1998. Interaction of polyadenylate-binding protein with the eIF4G homologue PAIP enhances translation. Nature 392:520-523.

98. Roy, G., G. De Crescenzo, K. Khaleghpour, A. Kahvejian, M. O'Connor-McCourt, and N. Sonenberg. 2002. Paip1 interacts with poly(A) binding protein through two independent binding motifs. Mol.Cell Biol. 22:3769-3782.

195 99. Khaleghpour, K., Y. V. Svitkin, A. W. Craig, C. T. DeMaria, R. C. Deo, S. K. Burley, and N. Sonenberg. 2001. Translational repression by a novel partner of human poly(A) binding protein, Paip2. Mol.Cell 7:205-216.

100. Khaleghpour, K., A. Kahvejian, G. De Crescenzo, G. Roy, Y. V. Svitkin, H. Imataka, M. O'Connor-McCourt, and N. Sonenberg. 2001. Dual interactions of the translational repressor Paip2 with poly(A) binding protein. Mol.Cell Biol. 21:5200-5213.

101. Mendez, R. and J. D. Richter. 2001. Translational control by CPEB: a means to the end. Nat.Rev.Mol.Cell Biol. 2:521-529.

102. Richter, J. D. 2002. Influence of polyadenylation-induced translation on metazoan development and neuronal synaptic function, p. 785-806. In N. Sonenberg, J. Hershey, and M. B. Mathews (ed.), Pathway and mechanism of initiation of protein synthesis. Cold Spring Harbor Laboratory Press.

103. Belsham, G. J. and R. Jackson. 2002. Translation Initiation on picornavirus RNA, p. 869-900. In N. Sonenberg, J. Hershey, and M. B. Mathews (ed.), Pathway and mechanism of initiation of protein synthesis. Cold Spring Harbor Laboratory Press.

104. Kuyumcu-Martinez, N. M., M. E. Van Eden, P. Younan, and R. E. Lloyd. 2004. Cleavage of poly(A)-binding protein by poliovirus 3C protease inhibits host cell translation: a novel mechanism for host translation shutoff. Mol.Cell Biol. 24:1779-1790.

105. Varani, G. and F. H. Allain. 2002. How a rotavirus hijacks the human protein synthesis machinery. Nat.Struct.Biol. 9:158-160.

106. Shatkin, A. J. 2002. Reovirus translational control, p. 915-932. In N. Sonenberg, J. Hershey, and M. B. Mathews (ed.), Pathway and mechanism of initiation of protein synthesis. Cold Spring Harbor Laboratory Press.

107. Tan, S., M. Gale, Jr., and M. Katze. 2002. Translational reprogramming during influenza virus infection, p. 933-950. In N. Sonenberg, J. Hershey, and M. B. Mathews (ed.), Pathway and mechanism of initiation of protein synthesis. Cold Spring Harbor Laboratory Press.

108. Burgui, I., T. Aragon, J. Ortin, and A. Nieto. 2003. PABP1 and eIF4GI associate with influenza virus NS1 protein in viral mRNA translation initiation complexes. J.Gen.Virol. 84:3263-3274.

196 109. Iizuka, N., L. Najita, A. Franzusoff, and P. Sarnow. 1994. Cap- dependent and cap-independent translation by internal initiation of mRNAs in cell extracts prepared from Saccharomyces cerevisiae. Mol.Cell Biol. 14:7322-7330.

110. Preiss, T., M. Muckenthaler, and M. W. Hentze. 1998. Poly(A)-tail- promoted translation in yeast: implications for translational control. RNA. 4:1321-1331.

111. Bergamini, G., T. Preiss, and M. W. Hentze. 2000. Picornavirus IRESes and the poly(A) tail jointly promote cap-independent translation in a mammalian cell-free system. RNA. 6:1781-1790.

112. Gallie, D. R. 1991. The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev. 5:2108-2116.

113. Gray, N. K., J. M. Coller, K. S. Dickson, and M. Wickens. 2000. Multiple portions of poly(A)-binding protein stimulate translation in vivo. EMBO J. 19:4723-4733.

114. Schoenberg, D. R., J. E. Moskaitis, L. H. Smith, Jr., and R. L. Pastori. 1989. Extranuclear estrogen-regulated destabilization of Xenopus laevis serum albumin mRNA. Mol.Endocrinol. 3:805-814.

115. Cunningham, K. S., M. N. Hanson, and D. R. Schoenberg. 2001. Polysomal ribonuclease 1 exists in a latent form on polysomes prior to estrogen activation of mRNA decay. Nucleic Acids Res. 29:1156-1162.

116. Das, G. J., H. Gu, E. Chernokalskaya, X. Gao, and D. R. Schoenberg. 1998. Identification of two cis-acting elements that independently regulate the length of poly(A) on Xenopus albumin pre-mRNA. RNA. 4:766-776.

117. Rao, M. N., E. Chernokalskaya, and D. R. Schoenberg. 1996. Regulated nuclear polyadenylation of Xenopus albumin pre-mRNA. Nucleic Acids Res. 24:4078-4083.

118. Pastori, R. L., J. E. Moskaitis, S. W. Buzek, and D. R. Schoenberg. 1992. Differential regulation and polyadenylation of transferrin mRNA in Xenopus liver and oviduct. J.Steroid Biochem.Mol.Biol. 42:649-657.

119. Gu, H., G. J. Das, and D. R. Schoenberg. 1999. The poly(A)-limiting element is a conserved cis-acting sequence that regulates poly(A) tail length on nuclear pre-mRNAs. Proc.Natl.Acad.Sci.U.S.A 96:8943-8948.

120. Gu, H. A novel regulatory mechanism for nuclear polyadenylation: PLEs and PLEBPs 2001. Ph.D thesis. The Ohio State University 197 121. Zorio, D. A. and T. Blumenthal. 1999. Both subunits of U2AF recognize the 3' splice site in Caenorhabditis elegans. Nature 402:835-838.

122. Wu, S., C. M. Romfo, T. W. Nilsen, and M. R. Green. 1999. Functional recognition of the 3' splice site AG by the splicing factor U2AF35. Nature 402:832-835.

123. Guth, S., T. O. Tange, E. Kellenberger, and J. Valcarcel. 2001. Dual function for U2AF(35) in AG-dependent pre-mRNA splicing. Mol.Cell Biol. 21:7673-7681.

124. Reed, R. 2000. Mechanisms of fidelity in pre-mRNA splicing. Curr.Opin.Cell Biol. 12:340-345.

125. Vagner, S., C. Vagner, and I. W. Mattaj. 2000. The carboxyl terminus of vertebrate poly(A) polymerase interacts with U2AF 65 to couple 3'-end processing and splicing. Genes Dev. 14:403-413.

126. Millevoi, S., F. Geraghty, B. Idowu, J. L. Tam, M. Antoniou, and S. Vagner. 2002. A novel function for the U2AF 65 splicing factor in promoting pre-mRNA 3'-end processing. EMBO Rep. 3 :869-874.

127. Gu, H. and D. R. Schoenberg. 2003. U2AF modulates poly(A) length control by the poly(A)-limiting element. Nucleic Acids Res. 31:6264-6271.

128. Wolin, S. L. and T. Cedervall. 2002. The La protein. Annu.Rev.Biochem. 71:375-403.

129. Golas, M. M., B. Sander, C. L. Will, R. Luhrmann, and H. Stark. 2003. Molecular architecture of the multiprotein splicing factor SF3b. Science 300:980-984.

130. Pastori, R. L., J. E. Moskaitis, and D. R. Schoenberg. 1991. Estrogen- induced ribonuclease activity in Xenopus liver. Biochemistry 30:10490- 10498.

131. Dompenciel, R. E., V. R. Garnepudi, and D. R. Schoenberg. 1995. Purification and characterization of an estrogen-regulated Xenopus liver polysomal nuclease involved in the selective destabilization of albumin mRNA. J.Biol.Chem. 270:6108-6118.

132. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, and K. Struhl. 1988. Current protocol in molecular biology. John Wiley & Sons.

198 133. Gupta, J. D., H. Gu, and D. R. Schoenberg . 2001. Position and sequence requirements for poly(A) length regulation by the poly(A) limiting element. RNA. 7:1034-1042.

134. Wahle, E. and W. Keller. 1994. 3' End-processing of mRNA, p. 1-34. In S. J. Higgins and B. D. Hames (ed.), RNA processing: A Practical Approach. Oxford University Press, Oxford, UK.

135. Davydova, E. K., V. M. Evdokimova, L. P. Ovchinnikov, and J. W. Hershey. 1997. Overexpression in COS cells of p50, the major core protein associated with mRNA, results in translation inhibition. Nucleic Acids Res. 25:2911-2916.

136. Juge, F., S. Zaessinger, C. Temme, E. Wahle, and M. Simonelig. 2002. Control of poly(A) polymerase level is essential to cytoplasmic polyadenylation and early development in Drosophila. EMBO J. 21:6603- 6613.

137. Yang, F. and D. R. Schoenberg. 2004. Endonuclease-Mediated mRNA Decay Involves the Selective Targeting of PMR1 to Polyribosome-Bound Substrate mRNA. Mol.Cell 14:435-445.

138. Thoma, C., A. Ostareck-Lederer, and M. W. Hentze. 2004. A poly(A) tail-responsive in vitro system for cap- or IRES-driven translation from HeLa cellss In D. R. Schoenberg (ed.), mRNA Processing and metabolism; methods and Protocols. Humana Press, Totowa, NJ.

139. Gallie, D. R., J. Ling, M. Niepel, S. J. Morley, and V. M. Pain. 2000. The role of 5'-leader length, secondary structure and PABP concentration on cap and poly(A) tail function during translation in Xenopus oocytes. Nucleic Acids Res. 28:2943-2953.

140. Michel, Y. M., D. Poncet, M. Piron, K. M. Kean, and A. M. Borman. 2000. Cap-Poly(A) synergy in mammalian cell-free extracts. Investigation of the requirements for poly(A)-mediated stimulation of translation initiation. J.Biol.Chem. 275:32268-32276.

141. Svitkin, Y. V. and N. Sonenberg. 2004. An efficient system for cap- and poly(a)-dependent translation in vitro. Methods Mol.Biol. 257:155-170.

142. Svitkin, Y. V., H. Imataka, K. Khaleghpour, A. Kahvejian, H. D. Liebig, and N. Sonenberg. 2001. Poly(A)-binding protein interaction with elF4G stimulates picornavirus IRES-dependent translation. RNA. 7:1743-1752.

199 143. Gama-Carvalho, M., M. P. Carvalho, A. Kehlenbach, J. Valcarcel, and M. Carmo-Fonseca. 2001. Nucleocytoplasmic shuttling of heterodimeric splicing factor U2AF. J.Biol.Chem. 276:13104-13112.

144. Will, C. L., H. Urlaub, T. Achsel, M. Gentzel, M. Wilm, and R. Luhrmann. 2002. Characterization of novel SF3b and 17S U2 snRNP proteins, including a human Prp5p homologue and an SF3b DEAD-box protein. EMBO J. 21:4978-4988.

145. Meerovitch, K., Y. V. Svitkin, H. S. Lee, F. Lejbkowicz, D. J. Kenan, E. K. Chan, V. I. Agol, J. D. Keene, and N. Sonenberg. 1993. La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate. J.Virol. 67:3798-3807.

146. Edwalds-Gilbert, G., J. Prescott, and E. Falck-Pedersen. 1993. 3' RNA processing efficiency plays a primary role in generating termination- competent RNA polymerase II elongation complexes. Mol.Cell Biol. 13:3472-3480.

147. Moreira, A., Y. Takagaki, S. Brackenridge, M. Wollerton, J. L. Manley, and N. J. Proudfoot. 1998. The upstream sequence element of the C2 complement poly(A) signal activates mRNA 3' end formation by two distinct mechanisms. Genes Dev. 12:2522-2534.

148. Brackenridge, S. and N. J. Proudfoot. 2000. Recruitment of a basal polyadenylation factor by the upstream sequence element of the human lamin B2 polyadenylation signal. Mol.Cell Biol. 20:2660-2669.

149. Ko, B. and S. I. Gunderson. 2002. Identification of new poly(A) polymerase-inhibitory proteins capable of regulating pre-mRNA polyadenylation. J.Mol.Biol. 318:1189-1206.

150. Dietrich-Goetz, W., I. M. Kennedy, B. Levins, M. A. Stanley, and J. B. Clements. 1997. A cellular 65-kDa protein recognizes the negative regulatory element of human papillomavirus late mRNA. Proc.Natl.Acad.Sci.U.S.A 94:163-168.

151. Hensold, J. O., D. Barth-Baus, and C. A. Stratton. 1996. Inducers of erythroleukemic differentiation cause messenger RNAs that lack poly(A)- binding protein to accumulate in translationally inactive, salt-labile 80 S ribosomal complexes. J.Biol.Chem. 271:23246-23254.

152. Zelus, B. D., D. H. Giebelhaus, D. W. Eib, K. A. Kenner, and R. T. Moon. 1989. Expression of the poly(A)-binding protein during development of Xenopus laevis. Mol.Cell Biol. 9:2756-2760.

200 153. Wiegand, H. L., S. Lu, and B. R. Cullen. 2003. Exon junction complexes mediate the enhancing effect of splicing on mRNA expression. Proc.Natl.Acad.Sci.U.S.A 100:11327-11332.

154. Nott, A., S. H. Meislin, and M. J. Moore. 2003. A quantitative analysis of intron effects on mammalian gene expression. RNA. 9:607-617.

155. Nott, A., H. Le Hir, and M. J. Moore. 2004. Splicing enhances translation in mammalian cells: an additional function of the exon junction complex. Genes Dev. 18:210-222.

156. Tange, T. O., A. Nott, and M. J. Moore. 2004. The ever-increasing complexities of the exon junction complex. Curr.Opin.Cell Biol. 16:279- 284.

157. Le Hir, H., E. Izaurralde, L. E. Maquat, and M. J. Moore. 2000. The deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19:6860-6869.

158. Lejeune, F., Y. Ishigaki, X. Li, and L. E. Maquat. 2002. The exon junction complex is detected on CBP80-bound but not eIF4E-bound mRNA in mammalian cells: dynamics of mRNP remodeling. EMBO J. 21:3536-3545.

159. Thoma, C., G. Bergamini, B. Galy, P. Hundsdoerfer, and M. W. Hentze. 2004. Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP. Mol.Cell 15:925-935.

160. Stoneley, M., T. Subkhankulova, J. P. Le Quesne, M. J. Coldwell, C. L. Jopling, G. J. Belsham, and A. E. Willis. 2000. Analysis of the c-myc IRES; a potential role for cell-type specific trans-acting factors and the nuclear compartment. Nucleic Acids Res. 28:687-694.

161. McLaren, M., K. Asai, and A. Cochrane. 2004. A novel function for Sam68: enhancement of HIV-1 RNA 3' end processing. RNA. 10:1119- 1129.

162. Choi, Y. H. and C. H. Hagedorn. 2003. Purifying mRNAs with a high- affinity eIF4E mutant identifies the short 3' poly(A) end phenotype. Proc.Natl.Acad.Sci.U.S.A 100:7033-7038.

163. Parker, R. and H. Song. 2004. The enzymes and control of eukaryotic mRNA turnover. Nat.Struct.Mol.Biol. 11:121-127.

201