SYSTEMATIC REVISION OF THE NEOTROPICAL FRUIT BATS OF THE GENUS Sturnira: A MOLECULAR AND MORPHOLOGICAL APPROACH
By
CARLOS ALBERTO IUDICA
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2000 Copyright 2000
by
Carlos A. ludica This work is dedicated to Maria Eugenia Fullana Jornet, the most important person in my life and to John Frederick Eisenberg, an eminent scientist whose influential company will be missed after his retirement. ACKNOWLEDGMENTS
This project would not have been possible without the help, support, and
encouragement of many people. Most significantly, I thank John F. Eisenberg for suggesting the phylogeny of the entire genus Sturnira as a dissertation subject.
W. Mark Whitten and Norris H. Williams guided me through all the lab work
involved in this project. I thank them also for their willingness to maintain endless
conversations on varied subjects, from science to history, from politics to life. For their suggestions during the planning stage, for assisting on every aspect of my
work, and for helping me to process and interpret the data, I thank the members of my committee: Brian Bowen, Colin Chapman, John F. Eisenberg
(Chairperson), Walter Judd, and Norris H. Williams. Although W. Mark Whitten was not a formal member of my committee, his daily contributions were essential to the development of this work and he deserves an honorary seat on my
committee. I thank Wesley E. Higgins, Juan Manuel Alvarez, Savita Shankar,
Ana "Sam" Bass, and Ginger A. M. Clark for their guidance on statistical and
computer analyses, and for their valuable help in the lab. I am grateful to W.
Mark Whitten and Norris H. Williams for allowing me to have unrestricted access to their computers and to the molecular systematic laboratory at the Florida
Museum of Natural History.
Funding for this project was provided by several agencies, institutions, and
people. I thank The Lincoln Park Zoological Society for their "Scott Neotropical
IV Fund," the National Museum of Natural History and the American Museum of
Natural History for their "Collection Study Grants." Funding also was available through travel awards from the Department of Zoology, the Graduate Student
Council, and the College of Liberal Arts and Sciences of the University of Florida.
The McLaughlin Dissertation Fellowship from the University of Florida partially supported the last stages of this work.
Special thanks are extended to the following institutions and people who kindly provided access to comparative specimens and tissue collections in their care: American Museum of Natural History, New York (Nancy B. Simmons, Karl
F. Koopman, Brian Kraatz); Angelo State Natural History Collections, Angelo
State University, San Angelo (Robert Dowler); Carnegie Museum of Natural
History-Edward O'Neil Research Center, Pittsburgh (Timothy McCarthy, Sue
McLaren, Duane Schlichter, John Wible); Centra de Ecologia, Universidad
Nacional Autonoma de Mexico, Distrito Federal (Rodrigo Medellin, Ricardo
Lopez-Wilches); Florida Museum of Natural History, University of Florida,
Gainesville (Charles A. Woods, Laurie Wilkins, Candace McCaffery); The Field
Museum, Chicago (Bruce D. Patterson, John Phelps); Museum of Natural
Science, Louisiana State University, Baton Rouge (Mark S. Hafner, Shannon K.
Allen, David Reed); Museum of Comparative Zoology, Harvard University,
Cambridge (Maria E. Rutzmoser, Terri McFadden, Gail Pinderhughes); Museum d'histoire naturelle de la Ville de Geneve, Geneve; Museum of Southwestern
Biology, University of New Mexico, Albuquerque (Terri Yates, William Gannon);
Michigan State University, East Lansing; Museo de Historia Natural de la
Universidad Mayor de San Marcos, Lima (Irma Franke, Elena Vivar, Sergio Solari); Museum of Vertebrate Zoology, University of California, Berkeley (James
L. Patton, Carta Cicero); Museum of Zoology, University of Michigan, Ann Arbor
(Phil Myers); United States National Museum of Natural History, Smithsonian
Institution, Washington (Linda Gordon, Alfred L. Gardner, Charles O. Handley,
Jr., Jeffrey F. Jacobs, Don E. Wilson); Oklahoma Museum of Natural History,
University of Oklahoma, Norman (Michael Mares, Janet Braun); Royal Ontario
Museum, Centre for Biodiversity and Conservation Biology, Toronto (Mark
Engstrom, Lim Burton); Texas Cooperative Wildlife Collection, Department of
Wildlife & Fisheries Sciences.Texas A&M University, College Station (Duane
Schlitter, John W. Bickham); The Museum, Texas Tech University, Lubbock
(Nicky Ladkin, Robert Baker, Ricardo Monk); University of Nebraska State
Museum, Lincoln (Patricia Freeman, Thomas Labedz).
Many of my fellow students and colleagues opened their intellects and
invited me to fruitful discussions, creating the best academic environment at
school. Their friendship and support were a constant source of advice. I am
specially indebted to my friends for their comments and encouragement.
My deepest gratitude goes to my wife Maria, whose love, understanding,
patience, and support have been pivotal during these five years. She helped me
out in periods of great stress and encouraged me to pursue and continue my
work through her example of integrity and determination. I am truly grateful to
her.
vi PREFACE
During the course of my masters research (ludica 1994) I observed the important ecological role that bats of the genus Sturnira have as seed dispersers
fruit in northwestern Argentina. I became intrigued by the fact that among those bats there were three allied species with almost the same body size and (from what was known) probably the same dietary requirements. This overview of the ecological role of those bats in that particular rain forest provided the basic
I for information that I used as a preamble for the problem that wanted to work on a Ph.D. dissertation. Together with Sturnira lilium, two other putative species of
Sturnira were supposed to occur sympatrically in the mountain rainforest of northwestern Argentina. Tschudi (1844) described those two allied species as S. erythromos and S. oporaphilum. Not much was known about their ecology, other than what was assumed from studies of other related fruit bats and what was known from S. lilium, a much more common, widespread, and better studied
species. S. erythromos is a well defined species with a restricted distribution on the eastern slopes of the Andes from northwestern Argentina to Ecuador. The other, S. oporaphilum represents a rather controversial taxon assignment (see
below on current status of Sturnira), and little was known about its ecology.
I decided to analyze the status of these three co-occurring species in northwestern Argentina in an effort to resolve their taxonomic status. My Ph.D.
advisor, Dr John F. Eisenberg, suggested that I embrace the entire problematic
VII genus instead of just doing a partial overview of three species of Sturnira.
Without realizing the challenge, I naively embarked in what was a new journey
for me. I then resolved to change my PhD project from being an ecological description of resource partitioning among three sympatric fruit bat species into a systematic review of the phylogeny of the entire genus Sturnira. In 1996 the
molecular systematics of bats was already an accepted taxonomic tool. I decided to explore the evolutionary history of Sturnira by combining at that time the most up-to-date techniques in molecular systematics with the traditional, low- budget (and most "trustworthy" for many), morphological approach. The ultimate goal was to obtain hard evidence to explain and describe the systematic status and phylogenetic relationships among species of the genus Sturnira.
viii .
TABLE OF CONTENTS
Page
ACKNOWLEDGMENTS iv
PREFACE vii
ABSTRACT xii
1 INTRODUCTION 1
Systematic Background and Current Status of Sturnira 1
The Importance of a Phylogeny Based on DNA: Why Use the Cytochrome b Gene? 6
2. MATERIALS AND METHODS 16
Morphological Data 16
Molecular Data 18 DNA Extraction, Polymerase Chain Reaction (PCR), and Sequencing 18 DNA isolation and extraction 18 Gene amplification, PCR, and sequencing 22 Search Strategies 24
3. RESULTS 35
All Available DNA Sequences and Selected Specimens 35 The Large Data Set: 133 Specimens (4 Outgroup Species and 129 Sturnira Specimens) 35 The Small Data Set: 37 Specimens (4 Outgroup Species and 33 Sturnira Specimens) 40 The DNA data set 40 The morphological data set 42 Combined data--DNA and morphological data sets 43 Pairwise Distances 45 Patterns of Character Evolution: Selected Cases 46
ix DISCUSSION 185 The Corvira Complex 1 89
The Ludovici Complex 1 90
The Luisi Complex 1 94 Lilium The Complex 1 97 The Entire "Well Defined Lingual Cusps" Group 198 The Remaining Species 199 Pairwise Distances 201 The Whole Picture: The Genus Sturnira 201 Final Remarks 203
APPENDIX 1 INSTITUTIONAL NAMES 219
APPENDIX 2 MORPHOLOGICAL CHARACTERS 221
APPENDIX 3 SPECIMENS MEASURED 223
APPENDIX 4 QUALITATIVE CHARACTERS 243
APPENDIX 5 CHARACTER MATRIX 247
APPENDIX 6 TISSUE SAMPLES 248
APPENDIX 7 LIST AND FORMULAE OF STOCK SOLUTIONS USED IN THE DNA EXTRACTION OF TISSUE SAMPLES 261
APPENDIX 8 FINAL SEQUENCES 262
REFERENCES 272
BIOGRAPHICAL SKETCH 284 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
SYSTEMATIC REVISION OF THE NEOTROPICAL FRUIT BATS OF THE GENUS Sturnira: A MOLECULAR AND MORPHOLOGICAL APPROACH
By
Carlos Alberto ludica
December 2000
Chairperson: John Frederick Eisenberg Major Department: Zoology
The Neotropical fruit bat tribe Stenodermatini consists of 68 species in 19 genera, eleven of which are monotypic and only two genera contain ten or more species. One of those two is the genus Sturnira, which inhabits several landscape types, and has a geographical range extending from Mexico to
Argentina.
Because a comprehensive revision of relationships within this diverse and perplexing genus has not been attempted since 1961, and several new forms subsequently have been discovered, I designed a project to describe the diversity of this group and to resolve the systematic relationships among species of the genus Sturnira. This was done by sequencing the cytochrome b gene, generating a matrix of morphological characters, and combining both data sets into a phylogenetic analysis using a parsimony algorithm.
xi A final successively weighted heuristic analysis produced a single most parsimonious tree of 295 steps with a consistency index of 0.65 and a retention
index of 0.72. Seventy six percent of all clades had bootstrap support values larger than 85%.
Sturnira aratathomasi, S. lilium (sensu lato), S. parvidens, S. luisi, and S. thomasi, constitute a clade of closely related taxa. Sturnira parvidens is a valid species and the sister taxon to S. lilium, a relationship highly supported by bootstrap percentage and decay values. Sturnira bogotensis is also a valid species and forms a highly supported clade with S. erythromos. The highly derived S. mordax forms a moderately supported clade with S. sp. A, another highly derived taxon. Sturnira ludovici should only refer to specimens from
Ecuador and constitutes a highly supported clade with S. oporaphilum. Sturnira
hondurensis, a valid species represented by only Central American specimens is
a sister taxon to the S. oporaphilum-S. ludovici clade and its phylogenetic relationship is highly supported. The subgenus Corvira is distinct from subgenus
Sturnira and should be recognized as such. Both species that comprise Corvira have numerous apomorphies that separate them from the remaining species of
Sturnira. The molecular and morphological data confirm this distinctiveness.
XII CHAPTER 1 INTRODUCTION
Systematic Background and Current Status of Sturnira
The order Chiroptera includes two suborders, the Megachiroptera
represented by the Old World fruit- and nectar-feeding bats, all part of the family
Pteropodidae with 42 genera and 166 species; and the Microchiroptera, with 16 families, 135 genera, and 759 species (Kunz and Pierson 1994). Within
Microchiroptera, six families are exclusively Neotropical, with the most diverse family (Phyllostomidae) containing 49 genera and 148 species. The
Phyllostomidae family can be divided into eight subfamilies, one of which
(Stenodermatinae), contains the only two genera represented by more than 10 species: Artibeus with 17 recognized species, and Sturnira with two subgenera and 12 recognized species (after Koopman 1993).
The type of Sturnira lilium was originally described by Geoffroy Saint-
Hilaire (1810) as Phyllostoma lilium. Gray (1842) created the genus Sturnira using S. lilium to typify the genus, but naming the species as S. spectrum, and
Gervais (1855) used the combined name of S. lilium for the first time. Dobson
(1878) offered a detailed description of morphological features of head, body and hair. He explained that incisors in S. lilium are like those found in Carollia brevicauda. The central upper incisors are unicuspidate, with oblique cusps.
1 2
The outer incisors are short and broad, with anterior surface concave and the summits broadly conical. Either the lower incisors are equal or the middle incisors are slightly larger with straight faintly notched cutting edges. The M1 is larger in antero-posterior diameter at the base, but smaller in vertical extent. The
M3 is scarcely 1/3 the size of M1 , with oval crown wider than longer. The pm1 is larger than pm2 but equal in vertical extent. The m3 equals M3 but is longer than wider. Molars are concave with an outer notched cutting edge. The author also offered measurements from a male adult and stated that this bat inhabited the
Neotropical Region (tropical and subtropical areas), and reported distributional records for specimens from Jamaica (probably Artibeus sp. or another
Stenodermidae), Honduras, several localities in Brazil (Pernambuco, Bahia, Rio de Janeiro, St. Catarina, Minas Gerais, and somewhere in the Rio Napo, border with Ecuador). Dobson's work offered very detailed, high quality figures of skulls and faces of bats (see plate 28-5 and plate 30-4 in Dobson 1878).
Cabrera Latorre (1903) described general characteristics of the three genera represented by one species each in Chile (Glossophaga, Sturnira, and
Desmodus). Specifically for Sturnira lilium, dental formula, synomy, morphological description, and selected measurements are offered. Cabrera
Latorre mentioned that this species inhabited Chile, Paraguay, Brazil, Peru,
Ecuador, and Central America including the Antilles (at least Jamaica). Elliot
(1904) produced a general description of external and cranial morphology of S. lilium. Elliot was another author who used S. lilium to typify the entire genus for which the distribution was then known from Mexico (Jalisco and Veracruz) to
Paraguay and Chile. Miller (1907) again used S. lilium to characterize the entire 3 genus Sturnira, since at that moment, no other "forms" were recognized. Miller
used the "aberrant and highly specialized" dentition of Sturnira to justify the existence of the subfamily Sturnirinae (Miller 1907: 148).
Thomas (1915) described for the first time Corvira bidens, referring this
new species to a new genus allied to Sturnira (particularly to S. lilium). He based
his description on a "somewhat immature" (:311) individual whose size and general appearance was very similar to S. lilium. The type specimen, an
immature male, BM 15.7.11.7 (original # 19) was collected in April 1914 by W.
Goodfellow at Baeza, Upper Coca River, Oriente of N. Ecuador, alt. 6,500'
(1,981mts). The diferences between S. lilium and C. bidens mentioned by
Thomas are 1) only two lower incisors present, bicuspid; 2) other lower teeth shorter antero-posteriorly than in Sturnira; 3) muzzle and interorbital region
narrower; 4) angular process of mandible shorter; 5) upper incisors more disproportionate than in Sturnira, outer ones smaller and narrower, inner pair longer and slenderer, with small supplementary basal cusp postero-externally;
6) premolars and molars slightly separated from each other; 7) premolars evenly spaced, oval shaped, transversely positioned, width about 0.75 of that in S. lilium, and antero-posterior diameter only 0.50 of that in S. lilium; 8) M1 subtriangular, with rounded angles, more carnassial-shaped than in S. lilium; and
9) more triangular shape of ml and better developed cusps on some of the teeth
(a characteristic used by Thomas to assume that Corvira is less specialized than
Sturnira).
Several new entities subsequently have been discovered and described
(i.e., Davis 1980, Gardner and O'Neill 1971, Tamsitt and Valdivieso 1986), but a 4
revision of relationships within this diverse group was not undertaken until the
study of de la Torre (1961). His work was the first attempt to understand the
morphological variation and systematics of Sturnira. The author recognized eight
species of Sturnira, but since his conclusions are based on a partial subset of the
genus, his mention here is only anecdotal.
Owen (1987) presented the second effort to describe the phylogeny of
Sturnira (Figure 1). He recognized two subgenera {Sturnira and Corvira) and
within the subgenus Sturnira his data set revealed two major clades, one
represented by S. lilium and S. aratathomasi, two very similar taxa, which share
several morphological features. The other clade was formed by the remaining
species (included in his analysis) within the subgenus Sturnira, but no resolution
of relationships among the species was offered. The subgenus Corvira, a sister
group of the subgenus Sturnira, included S. nana and S. bidens. Pacheco and
Patterson (1991) addressed the same problem of species relationships with two
different tools, allozymic and morphological data sets. Their conclusions are
summarized in Figure 2. These authors also recognized Corvira as the sister
subgenus to Sturnira. Probably because of the small sample size they
suggested that S. sp. A may belong to a different subgenus, which was
hypothesized to be much closer to subgenus Sturnira than to the subgenus
Corvira. Based on their allozymic data set, they concluded that within the subgenus Sturnira, S. erythromos and S. magna should be included in the same clade, whereas based on morphological evidence, they suggested that S. ludovici-S. oporaphilum and S. bogotensis-S. erythromos "seem to be sister pairs" (Pacheco and Patterson 1991: 117), and that S. lilium, S. luisi, and S. thomasi, form a common lineage.
Koopman (1993) circumscribed the Family Phyllostomidae and recognized
48 genera divided into 8 subfamilies. He described Sturnira with two subgenera
(Sturnira and Corvira) and 12 species. Although he recognized S. bogotensis as a species, apparently not accepting Pacheco and Patterson's (1991) conclusions, he suggested that the correct name should be S. oporaphilum, with
S. bogotensis a synonym of S. oporaphilum. It is not clear where the
geographical limits of S. ludoviciare and eventually he placed S. hondurensis in synomy, probably following Hershkovitz (1949) and also reflecting on the largely accepted current concepts based on superficial morphological characters or simply based on distribution (Baker and Greer 1962; Carter and Jones 1978;
Dalquest 1953; de la Torre 1952; Goodwin 1953; Jones and Owen 1986; Jones et al. 1988; Lukens and Davis 1957; Ramirez-Pulido et al. 1996; Starrett and de la Torre 1964).
Koopman (1994) put Sturnira Gray 1842 in the tribe Stumirini Miller 1907, as part of the subfamily Stenodermatinae Gervais 1855. He recognized two subgenera, subgenus Sturnira Gray 1842 with 10 species, and subgenus Corvira
Thomas 1915 with two species. The author gave a series of apomorphic features to separate the different clades (Figure 3) and listed the known subspecies. No phylogenetic relationships are depicted but he suggested two
major clades based on degree of development of lingual cusps on lower first molars (the "serrated" and "not serrated" groups of de la Torre (1961) may have had some influence on this decision). He did not recognize S. hondurensis or S. 6 bogotensis as separate species, but he added a bit more to our knowledge with the listed subspecies. For S. ludovici, he now recognized two subspecies (S.
ludovici hondurensis and S. /. occidentalis) with distribution north of Panama and
S. /. ludovici present in northern South America.
McKenna and Bell (1997, with Koopman as a contributor) divided the family Phyllostomidae into four subfamilies. One of them, the subfamily
Stenodermatinae, was divided into two tribes (Carolliini and Stenodermatini).
The tribe Stenodermatini in turn was divided into two subtribes, subtribe
Stenodermatina and subtribe Sturnirina, with one genus Sturnira Gray 1842, including subgenus Corvira Thomas 1915, subgenus Sturnirops Goodwin 1938 and subgenus Sturnira Gray 1842. In this work, Koopman suggested that
Sturnira is much more closely related to Uroderma, Vampyressa and Centurio
(same tribe, different subtribe) than to Carollia (a different tribe).
The Importance of a Phylogeny Based on DNA: Why Use the Cytochrome b Gene?
The phylogeny of mitochondrial DNA (mtDNA) sequences should track the historical relationships of the different populations under study. An important distinction to make here is that between a gene tree and a species tree or
organismal phylogeny (sensu Pamilo and Nei 1988; Avise 1989). A gene tree is the phylogeny of haplotypes (unit of inheritance for haploid genotypes) for a specific segment of DNA, whereas an organismal or species tree reflects the evolutionary history of a group or lineage characterized by ancestral-descendant relationships (Nei 1987). 7
A question emerges about which DNA type (nuclear or mtDNA) has the evolutionary rate that will provide resolution at the desired level. Since the introduction of PCR (Polymerase Chain Reaction, Saiki et al. 1988) for amplifying specific segments of DNA, mtDNA sequences have become a favorite genetic marker for both macro- and microevolutionary studies (Avise 1994; Palumbi
1996; Patton et al. 1996; Smith and Patton 1993; Wendel and Doyle 1998).
Although vertebrate mtDNA evolves on average about five to ten times faster
than does most single-copy nuclear DNA, no generalization is valid in terms of rates of evolution. "The pace of mtDNA evolution among animal groups may be linked causally to differences in metabolic rates and/or to the generation length
and body size differences with which metabolic rate is negatively correlated"
(Avise 1994: 103). Many times, the use of mtDNA has proved to be especially versatile for interspecific studies, whereas works including nuclear loci has received far less attention in this kind of investigation (Hillis et al. 1996).
The mitochondrial genome of vertebrates is a circular molecule comprising
13 protein coding genes involved in oxidative phosphorylation, two ribosomal
RNA genes, and 22 transfer RNA genes, as well as the control region (a noncoding section responsible for replication and transcription). The entire molecule is approximately 17,000 base pairs (bp) long in most mammals
(Arnason et al. 1995; Anderson et al. 1982; Janke et al. 1994).
The cytochrome b gene (cyt b) is one of the best known of the proteins associated with the mitochondrial oxidative phosphotylation system (Hatefi 1985) and the knowledge of the structure and function relationships in this protein enhances the utility of this gene for evolutionary investigations (Irwin et al. 1991). 8
The cytochrome b gene has been used extensively in molecular phylogenetic
studies (i.e., Conroy and Cook 2000; Lim and Engstrom 1998; McKnight 1995;
Patton et al. 1996; Peppers and Bradley 2000; Sullivan et al. 1995; Sullivan
1996; Wright et al. 1999), and most specifically, mitochondrial cytochrome b gene has proven useful in deriving phylogenetic hypotheses of relationships of species within genera such as Artibeus, Dermanura, Phyllostomus, Chiroderma,
Rhinophylla, and Carollia (Baker et al. 1994; Van Den Bussche and Baker 1993;
Van Den Bussche et al. 1993, 1998; Wright et al. 1999). As a protein-coding
gene, cyt b displays very little length polymorphism, which facilitates the alignment of sequences from different groups of organisms. Homologous DNA sequences permit comparisons among widely divergent taxa. Because of the widespread use of cyt b and its status as a universal metric, results of a particular study can be compared meaningfully to a larger body of work (Meyer 1994b).
There are several recently published studies on systematic issues of Neotropical bats choosing the entire or partial cyt b sequences instead of a portion of the
nuclear genome as a species-level sampling of variation (i.e., Baker et al. 1994;
Lim and Engstrom 1998; Sudman et al. 1994; Wright et al. 1999). By using the same molecular marker the data can be compared directly, taxonomic hypotheses can be falsified, and the results of this study can be put in a broader context.
Probably representing one of the most extensive sampling efforts for this kind of study, a combined total of over 600 museum specimens encompassing the whole geographical range of the genus were used in this project to address the major purpose of this research, which is to study the diversity and 9 evolutionary history of the genus Sturnira. This was done by a) sequencing cyt b gene, b) generating a matrix of qualitative characters, and c) combining both data sets into a comprehensive phylogenetic analysis. Figure 1 . Phylogeny of Sturnira proposed by Owen (1987) showing the two subgenera {Sturnira and Corvira) and 12 species included in his analyses. The bar on the right indicates an apomorphy that does not coincide with proposed grouping. 11
S. lilium I
(well defined S. aratathomasi lingual cusps)
Sturnira S. luisi
S. thomasi
S. tildae I
S. bogotensis
S. erythromos
Sturnira S. magna
S. ludovici
S.\ mordax
S.V nana Corvira
S. bidens '. ^
OCD 'o>o O -C Q. i_ 1 2 CD i_ | T3 <, . C. , o o
CO I o I 5. 2 0) •c i o 1 I 1 00 00 CO 00 00 5
CO
CO
Oo
< CD 1 CO c o .CO o CD 1 -c CD CO X C E. c £ CD CO 1 O) CD 8 Q. I CO CO 2 5 ^ s o CO o 8> I | 3 CO CO -Q 0) CD cd CO 00 CQ CO CO e • - E .3 2 o 3 -C ** ** CO 00 CO Figure 3. Phylogenetic relationships of the genus Sturnira proposed by Koopman (1994) based on synapomorphies (described). S. thomasi vulcanensis and S. thomasi thomasi have been added after Genoways (1998). 15
S. lilium parvidens
S. lilium lilium
S. lilium angeli S. lilium S. lilium zygomaticus
S. lilium paulsoni
S. lilium luciae
S. lilium serotinus (after Genoways 1998)
(well defined S. luisi lingual cusps) S. thomasi vulcanensis S. thomasi (after Genoways 1998)
S. thomasi thomasi
(after Genoways 1 998)
-S. tildae
S. aratathomasi
Sturnira
(outer lower S. erythromos incisors well- developed and functional, S. oporaphilum^jrrn - oporaphilum bogotensis zygomatic arch always complete) S. oporaphilum oporaphilum
S. ludovici occidentalis
(absence of S. ludovici Sturnira S. ludovici hondurensis vertical notched (uropatagium that defined virtually absent, lingual cusps) S. ludovici ludovici crown of molars with distinct S. mordax longitudinal grooves, cusps -S. magna strictly lateral)
-S. nana Corvira
(outer lower S. bidens incisors vestigial or absent, zygomatic arch weak or incomplete) CHAPTER 2 MATERIALS AND METHODS
Morphological Data
More than 500 voucher specimens were obtained as loaned material from
20 museum and scientific collections (see Appendix 1 for abbreviations, affiliations, and names of institutions and agencies providing specimens for examination). Twenty-five cranial and postcranial quantitative measurements were taken from alcohol-preserved specimens, study skins, and skulls of 16 species from the genus Sturnira for the traditional morphometric analysis (see
Appendix 2 and Figures 4 and 5 for abbreviations and description of each continuous morphological character). The choice of quantitative characters was based on a suit of dimensions and diagnostic characters used by other investigators (Arita 1990; Barone 1966; Bogdanowicz et al. 1997; Davis 1964; de la Torre 1961; Freeman 1981; Legendre 1984; McLellan 1984; Pacheco and
Patterson 1992). Specimens measured for quantitative morphometric analysis totaling 412 individuals (224 females and 188 males) are listed in Appendix 3. All continuous characters were recorded to the closest 0.01 mm with a digital caliper
(Fowler Caliper Ultra-Cal Mark III, Fowler Co., Newton, MA) connected through a cable to an interface (Smartcable) and to a PC loaded with the appropriate software (Wedge for Windows version 1 .1c, 1996 TAL Technologies, Inc.) to
16 17
automatically collect and store the morphological data (using Microsoft Excel 97
for Windows). Data were arranged by species and within species by sex for
further analyses. Values were log-transformed to stabilize variance (Hutcheson
et al. 1995; Mauk et al. 1999). Morphological differences between males and
females were tested within species by multivariate analysis of variance
(MANOVA) on all quantitative characters (Manly 1994). The analysis was
conducted using SPSS version 8.0. The purpose of this analysis was to assess the possibility of pooling males and females within species to increase sample
sizes. A power analysis was also conducted to reduce the chance of type II error
(acceptance of the null hypothesis of no difference between males and females)
in species with inadequate sample sizes. Only tests with a power of 80% or
higher were used to test for sexual dimorphism. These tests showed that significant sexual dimorphism does occur in Sturnira, and therefore males and females were not pooled, with all subsequent analyses being conducted on specimens of a single sex. Because females generally had higher sample sizes,
they were used instead of males in subsequent analyses. After all
measurements were taken and analyzed, it was decided to use only the length of the forearm for this project. The rest of the other quantitative characters present a considerable number of individuals with missing values and/or showed too much intrataxon variation. It has long been accepted that the forearm is a good indicator of absolute body size in bats (Ralls 1976).
When breaking more or less continuous variation into states Stevens
(1991) recommended that character states be delimited by carefully analyzed discontinuities (and not necessarily by looking for absolute gaps) in the character 18
variation, thus "avoiding arbitrary decisions when delimiting states" (Kron and
Judd 1997: 481). Considering that we have small, medium, and large species of
Sturnira, forearm length was tranformed into length classes (0-35 mm,
35-53 mm, and 53 or more mm) to be included in the morphological matrix as
discrete states.
For the qualitative multistate osteological analysis, I used selected
individuals of every species that represent, for each character, all possible states.
The 47 characters used in the present study (see Appendix 4 and Figure 6 for
description of each qualitative character and their states) were scored for four
outgroup species (from 6 individuals) and sixteen ingroup species (from 412
individuals) for phylogenetic analysis and the resulting data matrix (Appendix 5)
generated on MacClade version 3.08a (Maddison and Maddison 1999) was
analyzed using PAUP* version 4.0b4a (Swofford 2000). Details of the analyses
and search strategies are described later in this chapter.
Molecular Data
DNA Extraction, Polymerase Chain Reaction (PCR), and Sequencing
DNA isolation and extraction
In 1996 I asked different mammal collections the status of their Sturnira
holdings. I was particularly interested not just in the dry or alcohol-preserved
specimens, but in frozen or ethanol-preserved (95% EtOH) tissue samples that
matched vouchers. Among the 223 available samples (Appendix 6) total genomic DNA was extracted from 169 frozen and fifteen ethanol-preserved 19
tissue samples (heart, liver, or kidney). The first consecutive 75 processed
samples (60 frozen and fifteen ethanol-preserved tissue samples) were extracted
using a modified phenol-chloroform extraction technique (Hillis et al. 1996), which
consisted of the following steps: tissue was homogenized in 1000 ^L STE buffer
(for this and other stock solution abbreviations, see Appendix 7) with a ground
glass homogenizer. Tissue homogenate was tranfered to a 1 .5 ml_
microcentrifuge tube, in which 50 ^L 20% SDS had been added previously. The
mix was gently shaken. 700 iA. buffered phenol was added and gently but
thoroughly mixed and incubated at room temperature for five minutes. The mix
was centrifuged for 5 min (12,000 g), while the second set of tubes was prepared
for the next step. The aqueous (top) layer was removed with a pasteur pipette
and transfered to a new 1 .5 ml_ labeled tube, trying not to transfer the cellular
debris at the phenol/STE interface. The aqueous phase was re-extracted with
phenol as previously described.
Then 700 iA. PCI was added, gently but thoroughly mixed, incubated at
room temperature for 5 minutes, and centrifuged for 5 min (12,000 g). The aqueous (top) layer was removed with a pasteur pipette and the mix was transfered to a new 1 .5 ml_ tube. The aqueous phase was re-extracted with PCI as described above.
The 700 [A. CI was added, mixed gently, and incubated at room temperature for 5 min. The mix was then centrifuged for 5 min (12,000 g), aqueous phase transfered to a new tube and re-extracted with CI as explained above. About 50 A- (1/10 volume) of 3 M sodium acetate was added and the tube was filled with cold (-20° C) 95% ethanol and shaken. At this point (and only 20
at this point) some stringy DNA may be observable. The sample was incubated
on ice or in a freezer (-20° C) for 10 to 20 min or overnight, after which the tube
was centrifuged for 5 to 10 min (12,000 g). This yielded a small white pellet of
DNA at the bottom of the tube in most cases. The ethanol was decanted and the
DNA pellet (attached at the botton of the tube) was washed with 0.5 ml_ of 70%
ethanol to remove any remaining salts. The sample was spun for 5 min (12,000
g). The ethanol was decanted and the DNA pellet was dryed with a vacuum
centrifuge or by inverting the tubes on a rack for about 1 hour. The dryed pellet
was resuspended in 50 to 250 iA. of warm TE buffer (depending on the size of
the pellet) for up to12 hours.
The remaining 109 frozen tissue samples (of the original 184 frozen or
ethanol-preserved) were digested and their DNA was extracted using Qiagen
DNeasy™ Tissue extraction Kit (Qiagen # 04-1999, Qiagen, Inc., Valencia, CA),
following the manufacturer's recommendations (DNeasy™ Tissue Kit Handbook,
Q 1999: 16-18), with minor modifications. Each sample was incubated at 55 C in
180 mL of buffer ATL and 20 /A. of proteinase K (20 mg/mL) with occasional
vortexing or gentle shaking. Digestion continued for 1 to 3 hours until the tissues were completely lysed. When digestion was complete, 200 fA. of AL buffer was added, the mixture was vortexed and incubated at 70 Q C for 10 min. Two hundred iA. of 100% ethanol were added, the sample was vortexed, and the pH was checked using color pHast indicator strips (EM-Reagent, cat. no. 9583). The
pH was adjusted to pH 6.5 to 7.0 with 0.25 M HCI; a pH greater than 7.0 will prevent adsorption of DNA onto the silica membrane of the Qiagen column. The pH-adjusted sample was passed through the Qiagen column; the column was 21 washed with 500 pL of AW1 buffer, 500 iA. of AW2 buffer and then spun dry.
DNA was eluted twice from the column in 40 to 50 iA. of AE buffer (10 mM TRIS,
9 pH 8.0); column and buffer were incubated for 1 to 5 min at 65 C prior to centrifugation to increase yield of DNA from the membrane.
DNA was extracted from 8 dry specimens (bone and/or skin) and from 6 formalin-preserved voucher specimens. The difficulties of obtaining usable DNA from such specimens are well-known (McArthur and Koop 1999), yet such specimens form a potentially valuable source of data, especially for populations of animals that are not represented in museum collections as frozen or ethanol-
preserved vouchers. During this study, I developed extraction protocols that have routinely yielded amplifiable DNA from up to 66 year old museum skins, bones, and formalin-fixed tissues. These techniques, which are modifications of
Qiagen DNeasy Tissue Extraction procotols, should be directly applicable to other mammal specimens.
Samples from dried specimens included bones (2 ribs or 2 to 3 mm of the diaphysis of a wing bone) or 3 x 2 mm of dry skin with hair. Formalin-preserved tissue samples included 4x3 mm pieces of liver or skin with muscle. All tissue was chopped into small (<0.5mm) pieces; bone was crushed within a folded piece of a 10 x 10 cm weighing paper (Fisher Scientific Co., cat. No. 09-898-12B)
with a pair of needle-nose pliers. Chopped or crushed samples were placed in
1 .5 ml_ tubes and washed in 250 (A. of phosphate-buffered saline (Sambrook et al. 1989) for 10 min at 55 9C with occasional vortexing. The sample was spun briefly and the wash solution decanted. This wash was repeated 3 to 5 times. 22
The repeated washes act to rehydrate the tissues and remove PCR inhibitors
and residual fixatives.
Digestion and extraction was performed with Qiagen DNeasy Tissue
extraction Kit (Qiagen # 04-1999, Qiagen, Inc., Valencia, CA), with modifications
from the previously explained protocol as follows: after incubation at 55 -C with
occasional vortexing or gentle shaking, digestion continued for 24 to 72 hours
(instead of only 1 to 3 hours) until the tissues were completely lysed. During the
digestion, fresh 20 /j.L aliquots of proteinase K were added every ten to twelve
hours until lysis was complete.
Gene amplification, PCR, and sequencing
Sequencing a portion of the cytochrome b gene (ca. 850 bp total length)
was done by amplifying four overlapping regions of ca. 250 bp each. The
outermost primers were those of Paabo et al. (1988) and Edwards et al. (1991),
called here Cytb8F and Cytb7R respectively. Attempts to amplify the entire 850
bp region in one amplification from dry (bone and/or skin) or wet (formalin-
preserved) voucher specimens were unsuccessful, probably due to the highly
degraded template DNA. Consequently, internal primer pairs were designed "ad
hoc" from consensus sequences of Sturnira obtained from fresh tissue samples
of six different species. Those primers were named: bat197F (5'-AGC CAC CGC
ATT 1 CAA CTC HG-3 ), bat210R (5'-CCG TAG TTT ACA TCT CGG CAR-3'), bat380F (5'-TTC GCC GTC ATA GCC ACA-3'), bat420R (5'-TGG TGA TGA CTG
TTG CTC CYC-3'), bat570F (5'-CCT MCT TCC CTT TAT CGT AG-3'), and bat620R (5'-CYG GGT CTG ATG GGA TYC C-3'). 23
Hot-start PCR reactions (50 A) for DNA samples from frozen or ethanol-
preserved tissue samples contained Sigma 10X buffer (5 /uL), 25 mM MgCI 2
(7 iA), 10 mM dNTPs (1 iA), 1 /A of each primer (10 picomoles), 15 /A of a
saturated aqueous betaine solution, 15 A- water, 1 to 5 iA template (depending
on DNA purity and concentration), and 1 unit of Sigma Taq polymerase. The
9 thermocycler program consisted of an initial denaturation at 94 C (3 min)
Q Q Q followed by 35 cycles of 94 C (1 min), 52 C (1 min), 72 C (1 min), ending with
a final elongation at 72 9C for 3 min. Products were visualized on a 1% agarose
electrophoresed gel stained with ethidium bromide. The PCR products were
cleaned using Qiagen Qiaquick columns (QIAquick™ Spin Handbook 1999: 19).
Products were cycle sequenced using PE/Applied Biosystems Big Dye-terminator
mix according to manufacturer's protocols, except that cycle sequencing
reactions were scaled down to 5 /A. Both strands were sequenced to assure
accuracy in base calling. Labeled products were analyzed with an automated
DNA sequencer (Applied Biosystems, Inc. model 373a and 377, ABI, Foster City,
California) at the DNA Sequencing Core Laboratory (DSEQ) at the University of
Florida. Negative (template-free PCR reactions) and positive (known DNA
samples) controls were used to test for contamination. For bone, skin, or
formalin-preserved voucher specimens the thermocycler had a variation of its
Q program, with 39 cycles at 94 C for 1 min, instead of 35 cycles.
Sequences are read by a laser scanner as a series of dye-labeled fragments on an acrylamide gel. Thus, the raw data consists of electropherograms, with fluorescent peaks interpreted by support software as either A, T, G, or C. Data are stored as both electropherograms and sequence 24 files, so that ambiguities can be checked against the original scanner output.
Because the data are computer-resident at all times, errors introduced in data entry and manual transfer are effectively eliminated. Sequence files from the automated sequencer can be converted directly to a format appropriate for phylogenetic and statistical analyses. Individual DNA (complementary and overlapping) sequences were edited and assembled using "Sequence
Navigator™" version 1.0.1 and "AutoAssembler™" version 1.3.0 (ABI software packages, Foster City, California) on an Apple iMac computer. Sequences were aligned manually using an iMac computer with "Sequence Navigator™" version
1.0.1 and by final visual inspection in PAUP* version 4.0b4a (Swofford 2000) using an "ad hoc" font (BKGCucIc) developed by Ron Sogin (Sogin personal communication). Gaps were coded as missing data. The end of matrices were trimmed to exclude sequencing artifacts. The final aligned sequences are available from the author (Appendix 8), and representatives will be submitted to
GenBank upon acceptance of corresponding manuscripts.
Search Strategies
Four complete sets of phylogenetic analyses were conducted: (1) an
analysis including 133 taxa and 778 bp of cytochrome b; (2) an analysis of all discrete morphological characters, including 47 characters and 37 taxa (4 outgroups and 33 specimens of Sturnira); (3) a molecular analysis of the same
taxa of 37 the previous analysis and 778 molecular characters; and (4) a combined analysis including 37 taxa and 825 characters (the combined 778 molecular and 47 morphological characters). 25
The first analysis was designed to provide a starting point by evaluating
relationships based solely on molecular data from all sequences available for this
study. The second analysis was designed in the same way with the idea of
evaluating relationships, but using morphological characters present in selected
taxa. The third analysis was based on the same selected taxa of the previous
one but including only molecular data and was aimed at obtaining phylogenetic
relations that may or may not be congruent with the morphological analysis. The
fourth analysis represents the principal goal of this study-a morphological
character-molecular data combined analysis. The main purpose was to evaluate
the effects that both data sets may have on the outcome of a phylogenetic
analysis. Many authors recently have stressed the importance of combining
independent sources of data and offered a clear rationale for merging different
data sets (Graham et al. 1998; Huelsenbeck et al. 1996; Sanderson and
Donoghue 1989; Soltis et al. 1998; Wiens 1998).
Although one only needs one outgroup to root a phylogenetic tree (Nixon
and Carpenter 1993), two or more outgroups are frequently used in cladistic
analyses to test for ingroup monophyly and to establish character polarity
(Maddison et al. 1984; Simmons and Geisler 1998). For outgroups I chose
Uroderma bilobatum, Vampyressa pusilla, and Centurio senex within the tribe
Stenodermatini, and for representatives from another subfamily, Carolliinae, I
sequenced Carollia perspicillata and scored and measured for inclusion in the
morphological data set Carollia brevicauda, Carollia perspicillata, and Carollia subrufa. ,
26
PAUP* version 4.0b4a (Swofford 2000) was used for cladistic parsimony
analyses with the following search strategies: each matrix (three separate and
the combined morphology and DNA) was subjected to 1 ,000 replicates of
random taxon entry additions, with the multiple trees (MULTREES) option, using
subtree pruning and regrafting (SPR) swapping, holding ten trees per replicate to
minimize time spent swapping on suboptimal islands. The shortest trees from
this search were used as starting trees and up to 10,000 trees (tree limit due to
computer memory limitations) were swapped to completion using SPR. All Fitch
(equally weighted) trees were saved to file.
Because successive weighting de-emphasizes patterns created by
homoplasious sites, and thus gives weight to sites that are more consistent (see
Lledo et al. 1998 for convincing reasons for using successive weighting), I
applied reweighting strategies using all shortest trees, with a base weight of 1
based on rescaled consistency index (RC) and best fit on any of the trees using
the menu command in PAUP*. Each round of analyses consisted of 10
replicates of random taxon entry, MULTREES on, SPR swapping, holding 10
trees per replicate. The shortest trees collected in each of these ten replicates were used as starting trees to collect all the shortest successively weighted (SW) trees, which were swapped to completion. Reweighting schemes were repeated
until tree length, consistency index (CI), and retention index (Rl) remained the same in two successive rounds as calculated in PAUP*. Other weighting schemes were also used to estimate phylogenetic relationships among taxa
(weighting transversions over transitions by 1:0, 3:1, 5:1, and 10:1) and results were compared against hypotheses generated with the SW scheme. The 27
confidence of each clade was evaluated through 1 ,000 replicates of heuristic
bootstrap analysis (Felsenstein 1985) on both SW and Fitch trees using SPR
swapping, MULTREES on, and holding only 10 trees per replicate. Support of
clades also was evaluated using the total support or decay index (Bremer 1988,
1994). To measure tree stability in terms of supported resolution, each matrix
was subjected to 1 ,000 replicates of random taxon entry additions, MULTREES
on, and SPR swapping. Tree scores were recorded and trees were saved (as
rooted trees) to file. Autodecay version 4.01 (Eriksson 1998) was run under the
following PAUP* search parameters as follow: addseq=random, nrep=100,
rseed=1, Nchuck=5, ChuckScore=100. The resulting file was executed in PAUP*
and posteriorly the decay value was extracted for each node in Autodecay. Final
decay values were viewed, edited, saved, and printed with TreeView version 1.5
(Page 1996).
Based on the assumption that the trees from the combined (SW) analyses
are the best estimate of the phylogeny (in part due to higher overall support
values), it will make sense in a study like this one to follow and determine the
patterns of character evolution of each meaningful qualitative multistate
osteological character (estimated using MacClade version 3.08a, Maddison and
Maddison 1999) on one of these trees, rather than using trees produced from analyses of separate data sets. However, it is important to mention here that
although I combined molecular and morphological data, I did not find a topology where relationships among different species (or species groups) of Sturnira were highly supported and resolved at all levels. Therefore, the lack of a unique, final, and meaningful tree on which to base my analysis of character evolution at this 28 stage would force me to make only a preliminary interpretation at best, and my results should be regarded as such.
Quantitative pairwise comparisons among all taxa were made for the cytochrome b gene. Those comparisons included percentage of sequence divergence within and between taxa. Sequence-divergence values were obtained using the two-parameter model of Kimura (1980) using PAUP* version
4.0b4a (Swofford 2000). Evolutionary relationships among haplotypes were assessed with a neighbor-joining tree (Saitou and Nei 1987) using PAUP* with the option rates for variable sites at a gamma 0.5 and ties broken randomly.
Support for nodes in dendrograms was assessed with bootstrap resampling of the neighbor-joining tree using 100 replicates.
Using the single most parsimonious tree from a cladistic analysis of a combined cytochrome b gene and a qualitative multistate osteological data set
(successively weighted parsimony) of 37 individuals representing Sturnira
species and related outgroup taxa, I investigated the patterns of character evolution of each qualitative character using MacClade version 3.08a (Maddison and Maddison 1999). Data set from the character matrix (Appendix 5) containing all character states present in four outgroup species and sixteen ingroup species of the genus Sturnira was loaded into MacClade and invoking "GO TO TREE
WINDOW," "GET TREE FILE," and "TRACE CHARACTER" commands it was possible to trace each character mapped on the SW-combined tree. A brief description of each meaninful tree is provided in the Results section. Figure 4. Abbreviations and the recording points of 18 cranial quantitative measurements (see Appendix 2 for description of each continuous morphological character) taken from skulls of 15 species (recognized here) of bats of the genus Sturnira, A) lateral view of skull, B) lateral view of mandible, C) dorsal view of mandible, D) ventral view of skull, E) dorsal view of skull, F) detail of ventral view of right upper molars. 30 Figure 5. Abbreviations and the recording points of external facial and body measurements referred to in text (see Appendix 2 for description of each continuous morphological character) taken from alcoholic specimens and study skins of 15 species (recognized here) of bats of the genus Sturnira. A) nose-leaf of Sturnira tildae, B) left wing and body of Sturnira erythromos. 32
B BOS
' 'Ik h^I1
< ¥:% \\>L3M
* L4M X ;>; X >L5M / Va
BOH Figure 6. Terminology used in this work refering descriptions on topography of first upper the molar tooth. A) upper left molars, B) lower left first molar. M1 : tooth. molar tooth, M2: second upper molar tooth, ml : first lower molar 34
LABIAL metacone
paracone
POSTERIOR
ANTERIOR
protocone hypocone
LINGUAL
LINGUAL paraconid
metaconid
entoconid
protoconid POSTERIOR
ANTERIOR B
LABIAL hypoconid CHAPTER 3 RESULTS
For each separate and combined cladistic analysis, Table 1 presents the
number of aligned positions in the matrix, the number of variable sites, the
number of phylogenetically informative sites, and the percentage of sites that are
variable. For each portion of every analysis (Fitch and/or successively
weighted), I report the number of trees, number of steps, consistency index (CI),
retention index (Rl), and the average number of changes per variable site (tree
length divided by the number of variable sites). The following descriptions are
based on combinations of both equally weighted and successively weighted (SW)
parsimony analyses. The topologies obtained using different weighting schemes
resulted in very similar hypothesized relationships among taxa, and therefore I derived my descriptions using only SW schemes. When mentioning polytomies on the description of my results (and later on the discussion) I will be referring to real polytomies or else to weakly supported dichotomies that I purposely colapsed into a polytomy in an attempt to be more conservative.
All Available DNA Sequences and Selected Specimens
The Large Data Set: 133 Specimens (4 Outgroup Species and 129 Sturnira Specimens)
After trimming ambiguous sequences at each end of the DNA fragment, a total of 778 bp was usable and compared for all taxa. Of those 778 positions,
35 36
299 (38%) represent variable sites and within that, 231 sites (30% of all positions
or 77% of all variable sites) were phylogenetically informative. This matrix does
not contain any indels. The following sixteen species recognized here were
represented by different number of individuals per species (given within
parentheses): S. aratathomasi (1), S. bidens{2), S. bogotensis(3), S.
erythromos (9), S. hondurensis (20), S. (ilium (48), S. ludovici(2), S. Iuisi(4), S.
magna (7), S. mordax{\), S. nana (3), S. oporaphilum (6), S. thomasi(3), S.
tildae (16), and two undescribed species made available to me through the
courtesy of Timothy J. McCarthy and Luis Albuja (here denoted as S. sp. A (2)
and S. sp. B (2), respectively).
Equally weighted heuristic searches (Fitch criterion) yielded 910 equally
parsimonious trees of 1021 steps (CI: 0.41 and Rl: 0.85). Figure 7 shows one of
those 910 equally parsimonious trees. Terminal branches that defined species
such as S. bogotensis, S. magna, S. sp. B, S. erythromos, S. tildae, S. sp. A,
southeastern and northern neotropical specimens of S. lilium, Ecuadorean,
Panama-Costa Rican, and Guatemala-Honduran specimens of S. ludovici-
hondurensis, S. bidens, and S. nana received very strong support (bootstrap of
100 and two-digits decay values). Sturnira oporaphilum, S. hondurensis, the
entire northern region clade S. ludovici-hondurensis, S. mordax, and
northeastern South American and Panama-Costa Rican specimens of S. lilium,
S. luisi, S. thomasi and S. aratathomasi received only moderate to no support, for many different reasons, which will be explained below. Clearly, S. bidens and
S. nana stand alone as the sister group of the remaining species of Sturnira.
Details of the diversity of sequences and specimens used in this analysis are 37
depicted in Figures 8 through 14. From these seven trees one can notice the
occurrence of a large polytomy (indicated by asterisks) among species (deep
level), which may reflect the inability of the cytochrome b gene to resolve
phylogenetic relationships between species other than S. bidens and S. nana.
Figure 8 shows a detailed account of each specimen used in this analysis
for S. magna, S. bogotensis, and S. mordax. More individual tissue samples of
S. mordax were not available for this analyses due to permit-related problems.
The position of the "mordax" branch is not completely resolved. All specimens of
S. bogotensis form a monophyletic group as well as all of S. magna. However,
there are two major groups within the "magna clade". The individual of S. magna
from Peru (on the top line of the clade) is from southern Peru, whereas the other
S. magna from Peru is in fact from the amazonian border between Peru and
Ecuador. This may indicate geographical partitioning of populations.
Several conclusions can be drawn from Figure 9. All specimens of S.
oporaphilum form a monophyletic clade highly supported by bootstrap and decay
values. Some degree of geographical partitioning is evident. The same is true
for all specimens of S. ludovici from Ecuador (country of the type locality, see
Anthony 1924). The node that groups together S. oporaphilum and S. ludovici
from Ecuador is moderately supported. The remainding 20 specimens
representing S. ludovici - S. hondurensis from Guatemala, El Salvador,
Honduras, Panama, and Costa Rica clustered into two major clades. The node that groups together these two clades is well supported. One of those clades
(specimens from Panama and Costa Rica) is a well defined, highly supported clade. The other, including all specimens from Guatemala, El Salvador, and 38
Honduras is also well defined, highly supported, and includes two separated
clades, one well defined and supported (bootstrap value of 99 and decay value of
5) and the other moderately supported (bootstrap value of 71 and decay value of
2). A common node between the clade formed by S. oporaphilum and S. ludovici
from Ecuador and all Central American specimens is moderately supported.
Figure 1 shows all specimens used for S. sp. B and S. erythromos. Both
are represented by well defined, monophyletic clades related to one another.
The position of both clades compared with other clades is not resolved
(polytomy).
Figure 1 1 shows the clade formed by specimens of S. tildae with a series
of nested internal clades, with three main groups: a terminal clade represented
by 12 specimens from Bolivia, Ecuador, Venezuela, Guyana, Suriname and
French Guiana, a sister group to the previous clade represented by three
individual sequences from Trinidad and Tobago, and one individual from Brazil
standing as a sister clade of the two most internal clades aforementioned.
Sturnira tildae is part of an unresolved polytomy formed by all previously
mentioned clades representing S. magna, S. bogotensis, S. mordax, S.
oporaphilum, all S. ludovici, S. sp. A and B, and S. erythromos. However,
internally each of those clades display high bootstrap support and decay values.
Figures 12 and 13 depict a group of highly supported clades represented by a complex of species (S. thomasi, S. luisi, S. lilium, and S. aratathomasi). Its relative position within the genus Sturnira is not well resolved and the monophyly of the group is only moderately supported. In fact, Figure 12 displays several subclades with surprisingly high support values. The entire group of clades 39
depicted in the upper portion of this figure is branching off a node with a
bootstrap value of 92, which contains five internal nodes with bootstrap values
above 85%. Although weakly supported, there is another cluster of populations
(lower clade) that are intriguing because they may the sister group to this
previously mentioned group of clades that it became more divergent
morphologically (perhaps an ancestor-descendent line). In Figure 13, two clades
emerge with high resolution and support values, those represented by specimens
of S. lilium from Brazil, Bolivia, and Paraguay (type locality for S. lilium lilium),
and those specimens of S. lilium Irom Costa Rica, Honduras, El Salvador,
Guatemala, and Mexico (type locality for S. lilium parvides). The position of the
specimen representing S. aratathomasi is not resolved but is part of this complex
of species (S. thomasi, S. luisi, S. lilium, and S. aratathomasi).
The clades of S. nana and S. bidens are shown in Figure 14. All
specimens belonging to the subgenus Sturnira are the sister group of S. nana
and all subgenus Sturnira and S. nana are supported as the sister group of S.
bidens. The node between the entire genus Sturnira and the outgroup species is
relatively well supported.
By performing successively weighted (SW) analyses I expected to
decrease the effects of highly homoplasious characters. I also expected the
number of trees to decrease "because those created by characters that changed frequently are eliminated as less parsimonious" (Lledo et al, 1998: 24). However, the heuristic SW search produced 1291 equally parsimonious trees of 337 steps
(CI: 0.62 and Rl: 0.90). Figure 15 shows one of those 1291 equally parsimonious trees. The topology of the Fitch and SW trees was slightly 40
different. While on the Fitch trees the entire subgenus Sturnira was part of a
large unresolved polytomy sister to S. nana, on these SW trees (shown in Figure
15) the large polytomy was partially resolved. Within the subgenus Sturnira the
complex of species S. thomasi, S. luisi, S. lilium, and S. aratathomasi form an
unresolved polytomy that is sister to another polytomy composed of specimens
from S. magna, S. bogotensis, S. sp. A and B, S. oporaphilum, S. ludovici-
hondurensis, S. erythromos, S. mordax and S. tildae. Within the most internal
polytomy, S. oporaphilum and S. ludovici from Ecuador are sister taxa. Sturnira
ludovici-hondurensis from Guatemala, El Salvador, and Honduras are sister taxa
of S. ludovici from Panama-Costa Rica. And S. oporaphilum-S. ludovici from
Ecuador form a sister clade of S. ludovici-hondurensis from Guatemala, El
Salvador, and Honduras, and S. ludoviciirom Panama-Costa Rica. Twelve
nodes in Figure 15 had improved resolution and support after SW analysis.
The Small Data Set: 37 Specimens (4 Outgroup Species and 33 Sturnira Specimens)
The DNA data set
From a total of 778 positions in the matrix, 266 (34%) represent variable
sites and within that total, 213 (27% of all positions or 80% of all variable sites)
were phylogenetically informative. This matrix is a subset of the previous DNA
data set (with 133 samples) generated with the sole purpose to have a comparable data matrix with the same number of individuals used on the qualitative multistate osteological analysis. With the exception of S. sp. B, which is represented by one specimen, all other species of Sturnira are represented here (and in the subsequent data sets of this section) by two individuals. 41
Equally weighted heuristic search (Fitch criterion) yielded two equally
parsimonious trees (or two equally parsimonious hypotheses) of 782 steps (CI:
0.48 and Rl: 0.64) shown in Figures 16 and 17. Figure 16 shows very strong
support (bootstrap and decay values) for terminal branches of S. aratathomasi,
S. luisi, S. thomasi, S. lilium, S. magna, S. bogotensis, S. erythromos, S. mordax,
S. sp. A, S. tildae, S. ludovici, S. oporaphilum, S. hondurensis, S. nana, and S.
bidens. The "S. lilium - S. aratathomasi complex" remains part of a large
unresolved polytomy at a deep level between clades. The "S. ludovici complex"
however, forms a moderately supported clade (73% Fitch bootstrap) including S.
ludovici, S. oporaphilum, and S. hondurensis. The clade formed by S. magna
and S. bogotensis is weakly supported as well as the clade formed by specimens
of S. lilium from North and South America. Sturnira nana forms a sister clade to
all species of the subgenus Sturnira and this group is a sister group of S. bidens.
The entire genus Sturnira seems to be monophyletic with good support (87%
Fitch bootstrap and a decay value of 6). The position of S. sp. B is not stable or
resolved. Figure 17 does not provide notable differences in support or resolution.
A successively weighted heuristic analysis did produce a topology only
slightly different from the previous equally weighted Fitch trees (Figures 16 and
17). It produced a single most parsimonious tree of 260 steps (CI: 0.70 and Rl:
0.75) shown in Figure 18. The bootstrap analysis of this SW data set yielded
higher level of support (75% of all clades in bootstrap consensus had values
larger than 85%) than did the same unweighted data set or the SW DNA data set
with samples. It 133 did partially resolve the polytomy that included the entire subgenus Sturnira into three main clusters of species. However, the 42
phylogenetic position of those three groups is not resolved. One of them, the
"lilium-aratathomasi complex" displays weak bootstrap support. Another, a group
of species including S. magna, S. bogotensis, S. erythromos (these three species
form a weakly supported clade), S. mordax, S. sp. A (these two species also
form a weakly supported clade), S. sp. B, and S. tildae display weak bootstrap
support as well. The third group, the "ludovici complex" shows high bootstrap
values across all nodes. It improved the resolution (with weak bootstrap support)
of five nodes and weakly resolved five additional nodes (see arrowheads on
Figure 18).
The morphological data set
This matrix has only 47 characters; however, all 47 sites are variable
(100% of the total) and 46 (98% of the total) represent phylogenetically
informative sites. As in the previous data set, with the exception of S. sp. B,
which is represented by one specimen, all other putative species of Sturnira are
represented here by two individuals, which indicates the number of individuals
per species to needed show all possible character states displayed in one
species.
Equally weighted heuristic search (Fitch criterion) yielded two equally parsimonious trees (or two equally parsimonious hypotheses) of 257 steps (CI:
0.28 and Rl: 0.62). Those two slightly different topologies (or hypotheses) resulting from this analysis are shown in Figures 19 and 20. Overall support is weak and only S. aratathomasi, S. magna, S. sp. A, S. nana, S. bidens, S. oporaphylum, S. hondurensis, S. thomasi, S. /tv/s/ and S. lilium have weak to well 43
supported clades. In both hypotheses Uroderma bilobatum and Vampyressa
pusilla clustered together, and with Carollia spp. are integrated with the large
unresolved polytomy that includes all specimens of the genus Sturnira.
A successively weighted heuristic analysis did produce a topology slightly
different from the previous equally weighted Fitch trees depicted in Figures 19
and 20. It produced a single most parsimonious tree of 42 steps (CI: 0.39 and
Rl: 0.74) that is shown in Figure 21. Within the general large polytomy, this
analysis indicates an internal cluster (weakly supported) composed of S. nana, S.
bidens (these two species form a weakly supported clade), S. oporaphilum, S.
bogotensis, S. erythromos, S. sp. A, S. mordax, S. hondurensis, S. ludovici, and
S. magna. The remainder of the tree is similar to the previous Figures 19 and 20
with the exception of a weakly supported branch sister to the entire polytomy
represented by an individual of S. lilium from El Salvador. Centurio senex is
sister taxon to the rest of the specimens included in this analysis. In nine
instances the bootstrap analysis of this SW data set yielded a higher level of
support than did the equally same weighted data set. Overall, it did not produce
a highly supported hypothesis (only a third of the clades have more than 85%
bootstrap support) and it did not resolve most of the polytomies.
Combined data-DN A and morphological data sets
The combined data matrix has a total of 825 positions with 313 (38%) variable sites and within those variable sites, 259 (31% of all positions or 83% within variable sites) were phylogenetically informative. This matrix was generated by running in PAUP* a copy of the previous DNA data set (with 37 44
taxa) and a copy of the qualitative multistate osteological data set (also with the
same 37 taxa).
Equally weighted heuristic search of this combined matrix under Fitch
criterion yielded four equally parsimonious trees of 1078 steps (CI: 0.41 and Rl:
0.61). These four trees are shown in Figures 22, 23, 24 and 25. Overall, all
topologies are highly congruent, with similar high support values for almost all
terminal branches. In all four hypotheses, strong support is shown for the entire
Sturnira clade as a monophyletic group clearly separated from all species of the
outgroup clade. The outgroup formed by Vampyressa pusilla, Uroderma
bilobatum, Centurio senex, and Carollia perspicillata is well defined and highly
supported too. An internal, large polytomy is also present in all trees and the
phylogenetic positions of clades along 5 nodes (see arrowheads pointing at those
nodes on Figures 22, 23, 24 and 25) are not resolved.
All trees have a weakly supported but consistent clade constituted by S.
nana and S. bidens, sister group to the rest of the species of Sturnira. Within
subgenus Sturnira is a well supported clade of S. ludovici, S. oporaphilum, and S.
hondurensis. All trees displayed a poorly resolved clade constituted by highly
supported internal clades that comprised S. lilium (specimens from North and
South America), S. /u/'s/and S. thomasi, and S. aratathomasi. The four last mentioned species in turn made a sister clade of S. tildae, a clade that also shows weak support values on the common node. In all four trees, S. erythromos and S. bogotensis are together in a weakly supported clade. All species of the subgenus Sturnira always form a clade, which shows little resolution basally. 45
A successively weighted heuristic analysis produced a single most
parsimonious tree of 295 steps (CI: 0.65 and Rl: 0.72) shown in Figure 26. Its
topology is similar in many ways to the four previous trees, but the bootstrap
analysis of this SW combined data set yielded much higher level of support (76%
of all clades in bootstrap consensus with values larger than 85%) than did any of
the single data sets or the four previous equally weighted Fitch trees. Seven
nodes showed improved support values and the polytomy on the clade formed by
S. mordax and S. sp. A (seen on Figures 22, 23, 24, and 25) is resolved,
although with weak support values. Sturnira tildae still is the sister taxon of the
aratathomasi-lilium-luisi-thomasi group but without statistical support. The final
result of a combined, successively weighted data set is a highly supported set of
clades with improved resolution at all levels within Sturnira and even between
outgroup species and Sturnira clades.
Pairwise Distances
Mean percentage of sequence divergence for all pairwise comparisons
revealed a wide range of nucleotide divergence values among representatives of the genus Sturnira (Table 2). Mean sequence divergence between subgenera was 1 1 .7% with the greatest value of 1 6.4% between S. bidens and S. magna and the lowest value of 9.4% between S. nana and S. sp. B. Mean sequence divergence within the subgenus Corvira was 9.7%. The subgenus Sturnira was divided in the two clades defined by de la Torre (1959) and Koopman (1994) as species with "well defined lingual cusps on lower molars" and species with
"vestigial or absence of vertical notches that defined lingual cusps" (see Figure 46
74). Mean sequence divergence within species with "well defined lingual cusps
on lower molars" was 5.5% with the greatest value of 1 1 .2% between S. tildae
and S. lilium from Mexico and the lowest value of 0.1% between S. lilium from
Peru and S. lilium from Suriname. Mean sequence divergence within species
with "vestigial or absence of vertical notches that defined lingual cusps" was
7.7% with the greatest value of 1 1 .2% between S. erythromos and S. ludovici
from Guatemala and the lowest value of 0.4% between S. ludovici f rom
Guatemala and S. ludovici from Honduras. Mean sequence divergence between
species of the subgenus Sturnira (species with "well defined lingual cusps on
lower molars" and species with "vestigial or absence of vertical notchs that
defined lingual cusps") was 8.9% with the greatest value of 13.5% between S.
magna and S. lilium from Mexico and the lowest value of 6.0% between S.
mordax and S. lilium from Suriname.
Patterns of Character Evolution: Selected Cases
Each of the 47 qualitative multistate osteological characters was plotted
and investigated the on single most parsimonious tree (295 steps, CI: 0.65, Rl:
0.72) from a cladistic analysis of the combined (DNA and morphology) data set
(successively weighted parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Trying only to highlight synapomorphies that may assist in the definition or characterization of one or a group of species, three trees suggest evidence to separate (or link) elements of the outgroup to elements of the ingroup. Figure 29 shows Centurio senex as the only taxon having a flat distal edge on the upper inner incisors. The state "pointed" seems to be the 47
plesiomorphic condition for the entire clade and the rounded state evolved at
least five times within Sturnira. Figure 31 depicts character number five (see
Appendix 4 for definition), in which state "2 lobes with secondary postero-external
basal cusp" seems to be an autapomorphy for the "Corvira" clade (S. nana and
S. bidens). "Two lobes" seem to represent the plesiomorphic condition, and "no
lobes (or pointed distal edge of upper inner incisors)" is expressed once in the
outgroup (Carollia spp.) and twice within the ingroup (S. aratathomasi and S.
hondurensis). Figure 43 displays all states for character number 17, in which the
condition "horizontal surface of ml is tilted towards its labial side" is only
expressed in S. sp. B. The same surface tilted towards its lingual side seems to
be the plesiomorphic condition for this character and having a horizontal surface
appears several times scattered throughout Sturnira species, but it is well
established on individuals of the three species forming the "ludovici clade."
Mapping the length of the forearm on the same tree (Figure 46) reveals that the ancestral form of the entire clade was of medium size and that based only on size, S. nana is easily identifiable as the smallest taxon of the Sturnira group, and S. aratathomasi and S. magna are the largest ones. Character number distinguishes 22 S. magna from all other species (Figure 48). All other
Sturnira species seems to share the plesiomorphic condition for this character, with the exception of S. sp. B, which shares equal relative length of M1 and M2 with three of the four taxa of the outgroup. Only S. aratathomasi and S. sp. A display a relatively long rostrum (autapomorphic for character number 33) within
Sturnira species (Figure 59). Carollia spp. are the only taxa within the outgroup displaying this state. A relatively short rostrum seems to be the ancentral 48 condition. Figure 60 shows that a squarish condition of the nasal aperture may be plesiomorphic and that S. oporaphilum displays a "trapezoidal" condition and
S. aratathomasi an elongated one. In Figure 67 we can see another
autapomorphy useful to separate one of the outgroups (Carollia spp.) from all others. The plesiomorphic condition for this character seems to be a smaller
relative size of M2 when compare with M1 . Another apomorphy (in this case for
S. aratathomasi) is shown in Figure 68. No occipital crest seems to be the ancestral condition for the entire clade. All individuals of S. luisi scored for character number 46 (Figure 72) presented the state "presence of a divided cusp on metaconid of m2." Some individuals of S. lilium, S. tildae, and S. hondurensis display the same condition as well. No division on the cusp of m2 seems to be the ancestral condition for the character. The distribution of other characters are shown in Figures 27 through 73. 49
Table 1 Values and statistics . from PAUP* analyses of separate and combined data matrices. CI: consistency index, Rl: retention index, SW: successively weighted.
DNA Morphology DNA Combined
Number of specimens 133 37 37 37
Number of included positions in matrix 778 47 778 825
3 Number of variable sites 299(38%) 47(100%) 266(34%) 313(38%)
Number of phylogenetically informative sites 231 46 213 259 b c
(77 , 30 ) (98,98) (80,27) (83,31)
Number of trees (Fitch) 910 2 2 4
Number of steps 1021 257 782 1078
CI 0.41 0.28 0.48 0.41
Rl 0.85 0.62 0.64 0.61
Average number of changes per d variable site 3.4 5.5 2.9 3.4
Number of trees (SW) 1291 1 1 1
Number of steps (SW) 337 42 260 295
CI (SW) 0.62 0.39 0.70 0.65
Rl (SW) 0.90 0.74 0.75 0.72
Number of clades in bootstrap consensus 6 with >85% support 34(51%) 5(33%) 24(75%) 22(76%) a Number of parsimony-informative characters + number of parsimony- b uninformative characters, Percentage c within variable sites, Percentage of all d positions in matrix, e Number of steps/number of variable sites, Calculated from SW bootstraped trees. ,
50
Table 2. Percentage of sequence divergence for all pairwise comparisons using the Kimura 2-parameter algorithm (1980) in PAUP* (Kimura 2-parameter distance matrix, rates assumed to follow gamma distribution with shape parameter = 0.5). Haplotype numbers follow: 1 Centurio senex, 2 Carollia perspicillata, 3 Uroderma bilobatum, 4 Vampyressa pusilla, 5 {S.)turnira aratathomasi 1 , 6 S. aratathomasi 2, 7 S. magna 1 , 8 S. magna 2, 9 S. ludovici 1,10
1 1 S. ludovici 2,11 S. hondurensis 1 , 1 2 S. hondurensis 2, 1 3 S. lilium 1 , 1 4 S. lilium 2, 5 S. lilium 39, 1 6 S. Iilium_ 1 , 1 7 S. luisi 1 , 1 8 S. falsi 2, 9 S. thomasi 1
20 S. thomasi 2, 21 S. mordax 1 , 22 S. mordax 2, 23 S. sp. A 1 , 24 S. sp. A 2, 25 S. sp. B, 26 S. erythromos 1 , 27 S. erythromos 2, 28 S. bogotensis 1 , 29 S. bogotensis 2, 30 S. oporaphilum 1 , 31 S. oporaphilum 2, 32 S. tildae 1 , 33 S. tildae 2, 34 S. nana 1 , 35 S. nana 2, 36 S. bidens 1 , 37 S. bidens 2.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
1 2 24.9 3 24.0 24.0 - 4 23.7 27.0 18.4 - 5 21.7 22.6 21.2 24.1 - 6 21.7 22.6 21.2 24.1 - - 7 20.9 23.5 21.5 21.6 13.0 13.0 - 8 20.7 21.0 21.5 22.4 12.1 12.1 30 - 9 17.9 20.4 18.9 21.2 11.1 11.1 9.7 8.5 - 10 17.8 20.1 19.2 21.5 11.0 11.0 10.1 85 04 - 11 19.5 20.7 21.5 19.5 12.3 12.3 10.7 9.1 66 6.6 - 12 19.6 20.9 22.4 21.5 11.2 11.2 11.6 9.7 66 6.8 2.7 - 13 22.0 20.1 20.3 22.7 10.6 10.6 10.9 99 89 93 9.5 8.7 - 14 22.0 22.4 21.5 24.5 92 92 11.8 11.4 9.1 93 98 9.6 63 - 15 22.6 19.6 19.8 23.0 98 9.8 10.9 9.5 8.5 89 93 85 0.8 5.8 - 16 22.1 21.8 21.2 24.7 89 89 11.5 11.1 89 9.1 9.5 93 6.1 03 5.6 - 17 21.6 21.2 20.3 22.1 7.3 73 9.1 89 7.2 78 94 8.4 6.7 58 6.0 5.6 - 18 21.6 21.2 20.3 22.1 73 73 9.1 89 7.2 7.8 9.4 84 6.7 5.8 6.0 5.6 - - 19 21.6 21.9 20.1 21.9 7.3 7.3 9.7 98 80 86 10.1 9.4 76 60 6.9 5.8 1.8 1.8 - 20 21.6 21.9 20.1 21.9 7.3 7.3 97 98 80 8.6 10.1 94 76 6.0 69 5.8 1.8 18 - - 21 18.9 19.7 20.2 22.2 95 95 86 65 5.8 58 7.8 7.8 78 82 7.1 80 6.9 69 73 7.3 - 22 18.9 19.7 20.2 22.2 9.5 9.5 86 6.5 58 58 7.8 7.8 78 8.2 7.1 8.0 6.9 6.9 7.3 7.3 - - - 23 20.8 20.1 20.8 22.0 93 93 87 8 1 8 1 8.5 10.0 10.1 8 1 85 8.1 8.2 7.7 7,7 8.2 82 4.9 4.9 24 20.4 19.6 19.7 21.2 9.6 96 85 7.4 78 82 9.2 94 7.4 7.8 7.4 75 7.0 70 75 7.5 45 4.5 0.6 - 25 18.8 21.0 20.0 20.9 9.4 9.4 7,9 72 74 74 7.8 7.6 8.3 87 7.9 8.5 74 7.4 82 82 5.5 5.5 6.7 65 - . 26 23.9 22.0 20.5 22.0 9.8 98 9.9 79 9.2 87 10.6 11.3 8.5 97 8.1 9.5 9.1 9 1 8.8 8.8 67 6.7 68 69 6.0 - 27 23.5 22.5 19.6 20.4 10.5 10.5 98 7.8 86 8.2 10.0 10.7 82 92 8.0 8.9 8.6 86 8.7 8.7 7.0 7.0 7.4 7 1 58 1.1 28 20.5 22.8 19.7 23.8 12.0 12.0 89 70 6.8 70 10.2 10.4 9.1 99 87 9.7 7.9 7,9 86 86 6.9 6.9 7.8 7.8 7.8 7.6 7.3 - 29 20.0 21.8 19.7 23.3 11.5 11.5 87 67 6.3 65 9.8 9.8 8.3 9.3 79 9.1 7.2 72 7.8 7.8 6.2 62 7.4 7.1 7,3 7.2 7.1 1.0 - - 30 19.3 20.5 19.7 22.5 11.3 11.3 10.1 9.3 43 4.7 6.5 6 1 87 89 83 87 80 80 8.0 8.0 65 6.5 8.4 7.8 8,2 9.5 9.4 9,5 8.7 - 31 18.6 20.3 19.7 21.9 11.1 11.1 10.3 9.5 4.4 49 7 1 6.3 8.1 9.1 78 8.9 7.8 78 82 8.2 6.3 63 82 76 80 9.8 9.6 97 8.9 1 2 32 21.3 22.5 21.4 22.6 93 9.3 10.9 9.3 83 87 11.4 10.8 9.1 93 8.7 9.0 8.1 8,1 8.5 8.5 63 6.3 73 74 70 7.7 8.0 8.1 7.2 95 89 - 7,0 - 33 21.8 21.3 20.9 22.0 8.6 8.6 11.0 9.5 8 1 83 10.8 11.0 8.5 8.7 8.5 84 7.7 7.7 82 8.2 6.5 6.5 73 74 7.9 8.2 8.8 7.8 9.3 8.7 0.6 34 21.9 18.6 19.7 17.7 12.0 12.0 13.8 14.1 9.2 95 12.3 12.0 12.2 11.5 11.7 11.3 9.7 97 99 9.9 10.2 10.2 9.7 10.0 92 11.7 11.2 12.8 12.5 10.7 10.7 10.1 10.1 - 35 22.3 19.6 19.5 19.0 12.3 12.3 13.6 13.6 9.3 9.5 12.5 11.4 10.6 10.7 10.2 10.4 7.6 7.6 8.6 8.6 9.8 9.8 10.3 9.9 9 1 11.4 10.4 12.8 11.8 10.8 10.6 10.3 9.7 0.1 36 20.1 19.4 19.4 20.9 13.5 13.5 15.5 15.5 11.6 12.0 12.3 11.7 11.8 12.5 11.6 12.2 10.6 10.6 10.0 10.0 11.1 11.1 11.4 11.4 10.4 12.5 13.0 12.7 11.8 12.7 12.1 13.3 12.7 9.8 9.5 37 23.5 20.1 20.8 21.7 14.5 14.5 15.8 16.4 13.0 13.7 12.8 10.9 12.6 13.0 12.3 12.7 10.9 10.9 10.7 10.7 12.0 12.0 12.4 12.4 10.7 13.9 14.3 13.5 12.6 13.7 13.0 13.7 13.5 9.7 9.8 2.3 Figure 7. One of 910 equally parsimonious trees of 1021 steps (CI: 0.41, Rl: 0.85) from a cladistic analysis of cytochrome b gene data set (Fitch parsimony) of
133 individuals representing Sturnira species and related outgroup taxa. " S." before each specific epithet stands for Sturnira. Bootstrap percentage (of 1000 replicates) and decay index (Bremer support) values are listed above each branch. Values below branches are Fitch lengths. Asterisks indicate polytomies (unresolved nodes). Values within parentheses are number of individuals representing each species. Bars on the right indicate the figure number that shows detailed information on each species clade displaying all available individuals. 52 73/3 96/10 Q. _29j- 20_ -Uroderma bilobatum O 83/5 Vampyressa pusilla "Centurio senex O) Carollia perspicillata "3 100/15 o -S. magna (7) 71 20 oo
100/15 32? -S.bogotensis (3) 70 21 i—S.mordax (1) ! \2. Qfi/fi 70 74/2 S.oporaphilum (6) 1 8 10 13 S.ludovici Ecuador ^16 (2) 99/5 70/3 |o> S.hondurensis Honduras (8) 0} 11 1— 100/11 70 12 4 88/3 71/2 5*i 6 S.ludovici Guatemala (8) 100/9 S.ludovici Costa Rica 11 (4) 100/14 S.sp. B (2) 71 15 Z> 71 100/12 a S.erythromos 2q (9) I
73
100/17 -S.tildae 24 (16) 100/14 3 — S.sp. A yf (2) D 94/4 g-S.thomasi Guadeloupe (5)
55/1 3 2-S.luisi Panama (14) CN S.lilium serotinus 72/2 3 14 99/5
S.lilium paulsoni 92/0
L S.lilium Suriname(13)
74 56/5 12 100/12 S.lilium Paraguay ^g (10)
52/2 61/2 5 19 mn/14 Ib S.lilium Mexico (13) 15 * /Q 100/15 "22— S.aratathomasi (1) u^. -S.nana 100/12 26 (3) 22 -S.bidens (2) D a Figure 8. Numerical values, abbreviations, and symbols are as indicated in figure 7. Detailed information of phylogenetic relationships of all specimens available for S. magna and S. bogotensis. 1
54 96/10 73/3 20 Uroderma bilobatum 83/5 29 Centurio senex Vampyressa pusilla
I 4 Carollia perspicillata S. magna Peru 16 S.magna Ecuador
100/15 S.magna Ecuador 20 56 S.magna Ecuador
80 S.magna Ecuador 71 S.magna Peru S.magna Ecuador S.bogotensis Peru 8 S.bogotensis Peru
70 S.bogotensis Peru S.mordax \£. 70 Qfi/fi 74/2 g S.oporaphilum (6) 4 6 i mn/1^lu ^g S.ludovici Ecuador (2) 99/5 70/3 S.hondurensis Honduras 6 (8) 11 100/11 12 88/3 71/2 „ , 71 g g S.ludovici Guatemala (8)
S.ludovici Costa Rica (4) 100/14 1 S.sp. B 15 (2) 73 71 4 100/12 S.erythromos 20 (9)
100/17 .... ,„_. S.tildae(16) 24 100/14 1 S.sp. 17 A (2) 72/2 94/4 S.thomasi Guadeloupe 14 5 (5) 55/1
3! 92/0 S.luisi Panama 6 2 (14)
74 S.lilium Suriname (13) 56/5 7 12 100/12 S.lilium Paraguay 19 (10)
52/2 61/2 5 7 19 100/14 S.lilium Mexico (13) 15 70 100/15 S.aratathomasi(l) bnar,a(3) 32 100/12 26 ou tM 22 S.bidens (2) Figure 9. Numerical values, abbreviations, and symbols are as indicated in figure 7. Detailed information of phylogenetic relationships of all specimens available for S. oporaphilum, S. ludovici, and S. hondurensis. 1
56 73/3 96/10 29 20 Uroderma bilobatum 83/5 Centurio senex Vampyressa pusilla 4 Carollia perspicillata 100/15 S. magna 71 20 (7) 100/15 S.bogotensis 21 (3) S.mordax (1) , S.oporaphilum Peru S.oporaphilum Bolivia 96/6 S.oporaphilum Bolivia 3 8 2 S.oporaphilum Bolivia 74/2 9 S.oporaphilum Bolivia 6 2 S.oporaphilum Peru 100/13 S.ludovici Ecuador J 70 "•6 S.ludovici Ecuador S.ludovici Guatemala S.ludovici Guatemala 3 S.ludovici Guatemala 99/5 S.ludovici El Salvador 6 S.hondurensis Honduras S.hondurensis 1 00/1 Honduras 12 S.ludovici El Salvador 3 S.hondurensis Honduras 2 S.ludovici Guatemala S.ludovici Guatemala 70/3 ,_ 2 S.ludovici Guatemala 11 J S.hondurensis Honduras 2 2S- nondurensis Honduras 4 2 71/2 S.ludovici El Salvador ^S.ludovici Guatemala 88/3 3 6 3 S.ludovici Guatemala 2jS./udo vici Costa Rica
100/9 1 S.ludovici Costa Rica 11 S.ludovici Panama 100/14 _ D/ox S.ludovici S.sp. B(2) Costa Rica 71 15 73 4 100/12 72/2 9 S.erythromos 20 (9) 14 100/17 S.tildae 24 (16) 100/14 S.sp. 17 A (2) 94/4 S.thomasi Guadeloupe (5) 55/1 5
3 6 1 /1 56/5 92/0 S.luisi Panama 2 (14) 12 6
74 S.lilium Suriname(13)
100/12 S.lilium Paraguay (10) 52/2 61/2 19 19 5 100/14 S.lilium Mexico (13) 15 70 100/15 S.aratathomasi (1) S.nana 32 100/12 26 ou (3) 22 S.bidens (2) Figure 10. Numerical values, abbreviations, and symbols are as indicated in figure 7. Detailed information of phylogenetic relationships of all specimens available for S. sp. B and S. erythromos. 58 73/3 96/10 29 20 Uroderma bilobatum 83/5 Centurio senex Vampyressa pusilla 4 Carollia perspicillata 100/15 S. magna 71 20 (7) 7 100/15 S.bogotensis 21 (3) S.mordax (1) 96/6 5 74/2 o S.oporaphilum (6) 6 100/13 S.ludovici Ecuador 16 (2) 70/3 99/5 S.hondurensis Honduras (8) 11 6 100/11 12 88/3 71/2 S.hondurensis Guatemala 70 3 (8) 4 100/9 S.hondurensis Costa Rica 11 (4)
100/14 S. sp. B Ecuador 1 15 S. sp. B Ecuador
g S.erythromos Peru
1 , S.erythromos Peru 71 9 71 4 . S.erythromos Peru 4 2 S.erythromos Peru
1 S.erythromos Argentina 2 S.erythromos Bolivia 100/12
20 . S.erythromos Bolivia
S.erythromos Bolivia 73 72/2 9 S.erythromos Peru 14 100/17 S.tildae 24 (16) 100/14 S.sp. 17 A (2) 94/4 5 S.thomasi Guadeloupe (5) 55/1 3 56/5 92/0 S.luisi Panama 2 (14) 12 6
74 S.lilium Suriname(13) 7 100/12 S.lilium Paraguay (10) 52/2 61/2 19 19 5 7 100/14 S.lilium Mexico (13) 15 70 100/15 S.aratathomasi (1) S.nana 32 100/12 26 (3) 22 S.bidens (2) Figure 1 1 . Numerical values, abbreviations, and symbols are as indicated in figure 7. Detailed information of phylogenetic relationships of all specimens available for S. tildae and S. sp. A. 1
60 73/3 96/10 29 20 Uroderma bilobatum 83/5 Centurio senex Vampyressa pusilla 4 Carollia perspicillata 100/15 S. magna 71 20 (7) 100/15 7 S.bogotensis 21 (3) S.mordax(1) */0 96/6 74/2 S.oporaphilum 4 8 (6) 6 1 1 3 S.ludovici Ecuador 70/3 °J'lb gg/c (2) 11 Snondurensis Honduras (8) 70 100/11 6 88/3 71/2 s.hondurensis Guatemala (8) 6 -) 00/9 * S.hondurensis Costa Rica (4) 100/14 1 S.sp.B (2) 71 15 4 100/12 S.erythromos 20 (9) S.tildae Guyana
* * S.tildae Suriname
S.tildae Guyana
S.tildae French Guiana 1 2 S.tildae Ecuador
. S.tildae Ecuador S.tildae Ecuador 1 1 S.tildae Bolivia S.tildae Bolivia
S.tildae Venezuela 2 2 1 S.tildae Guyana 2 S.tildae Guyana 100/17 1 S.tildae Trinidad 73 24 2 72/2 9 2 S.tildae Trinidad & Tobago 14 S.tildae Trinidad & Tobago S.tildae 4 Brazil 100/14 ^ S. sp. A Ecuador 17 2 S. sp. A Ecuador
94/4 55/1 S.thomasi Guadeloupe 5 (5) 3 61 /1 56/5 92/0 S.luisi Panama 2 (14) 12 6
74 S.lilium Suriname (13) 7 100/12 S.lilium Paraguay (10) 52/2 61/2 19 19 5 7 100/14 S.lilium Mexico (13) 15 70 100/15 S.aratathomasi (1) S.nana 32 100/12 26 (3) 22 S.bidens(2) Figure 12. Numerical values, abbreviations, and symbols are as indicated in figure 7. Detailed information of phylogenetic relationships of all specimens available for S. lilium, S. thomasi, and S. luisi. 62
S.thomasi Guadeloupe
99/5 S.thomasi Guadeloupe
S.lilium angeli Dominica 94/4 63/1 g ij 5 S.lilium zygomaticus Martinique
S.thomasi vulcanensis Montserrat 1
S.luisi Ecuador
66/.) S.luisi Panama
1 S.luisi Panama
55/1 S.luisi Panama
, S.lilium Panama 61/1 2 S.lilium Panama
S.lilium Guyana 87/1 S.lilium Guyana 2 S.lilium Guyana
S.lilium Panama
92/0 S.lilium Panama 86/2 4 6 3 S.lilium Costa Rica
S.lilium serotinus Grenada 99/5 1 6 S.lilium paulsoni St. Vincent
80/1 S.lilium Suriname 3 S.lilium French Guiana 1
S.lilium Tobago 4 S.lilium Peru 1
S.lilium Bolivia
1 - S.lilium Ecuador 1 T 54/1 S.lilium Ecuador 1 S.lilium Peru to figure 13 S.lilium Ecuador 55/1 1 1 65/1 S.lilium Peru
S.lilium Peru Figure 13. Numerical values, abbreviations, and symbols are as indicated in figure 7. Detailed information of phylogenetic relationships of all specimens available for S. lilium and S. aratathomasi. 64
to figure 12 S.lilium Brazil J { 1 ' . S.lilium Paraguay
74 S.lilium Brazil 7 S.lilium Brazil
94/0 S.lilium Brazil 6 52/0 S.lilium Bolivia
1 S.lilium Paraguay 100/12 19 S.lilium Bolivia
S.lilium Paraguay
D S.lilium Brazil
. S.lilium Guatemala
S.lilium Guatemala
. S.lilium Guatemala 52/2 1 5 61/2 _ S.lilium Honduras 7 S.lilium El Salvador
1 ^ S.lilium Mexico
S.lilium Mexico
. S.lilium El Salvador
1 S.lilium El Salvador
. S.lilium Costa Rica 100/14 S. W/'um Guatemala 15
S.lilium Guatemala 1
- S.lilium Mexico 1 70
i S.aratathomasi 32 Colombia Figure 14. Numerical values, abbreviations, and symbols are as indicated in figure 7. Detailed information of phylogenetic relationships of all specimens available for S. nana and S. bidens. 66 73/3 96/10 20, 29,- HZ -Uroderma bil obatum 8 3/5 r Tl "Centurio senex Vampyressa pusilla -Carollia perspicillata 100/15 -S. magna 71 20 (7) 100/15 S.bogotensis 21 (3) ^-S.mordax(1)70 ,2 J8ffl 70 S.oporaphilum 74fl 8 (6) 100/13 S.ludovici Ecuador 16 (2) 99/5 70/3 S.hondurensis Honduras (8) 11 100/11 70 12 4 88/3 71 12 .7—S.ludovici Guatemala (8) —100/9 —S.ludovici Costa Rica (4) y\ 100/14 S.sp.B (2) 71 15 71 100/12 S.erythromos 20 (9)
73
100/17 -S.tildae 24 (16) 100/14 S.sp.A(2) 17 94/4 g-S.thomasi Guadeloupe (5)
55/1 3 —2~S.luisi Panama (14) 92/0
72/2 14 LS.liliumSuriname(13) 74 100/12 S.lilium Paraguay 19 (10)
61/2 52/2 5 56/5 100/14 -S.lilium Mexico (13) 12 15 70 22—S.aratathomasi (1)
S.nana Peru 19 110/15 2 S.nana Peru 26 S.nana Peru
100/12 j S.bidens Ecuador 22 S.bidens 10 Peru Figure 15. One of 1291 equally parsimonious trees of 337 steps (CI: 0.62, Rl: 0.90) from a cladistic analysis of cytochrome b gene data set (successively weighted parsimony) of 133 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Arrowheads show nodes where resolution (and support values) had improved after successively weighted analysis. 68
93 99 6 11r Uroderma bilobatum Centurio senex Vampyressa pusilla Carollia perspicillata
100 S. magna (7) 54 5 100 -S.bogotensis (3) k6 96 84 S.oporaphilum (6)
-— S.ludovici Ecuador 4A w(2) 90 99QQ 2—S.hondurensis Honduras (8) 100 >4 *95 k S.ludovici Guatemala (8) 1 100 —-—S.ludovici Costa Rica (4) S.mordax (1) 100 2 -S.sp. B (2)
59 S.erythromos (9)
100 S.tildae (16) ^_S.sp.A(2) 90 —S.thomasi Northern Lesser Antilles (5)
T66 S.luisi Panama (14) 93 92
S.lilium Suriname (13)
88 100 £ S.lilium Paraguay (10)
55 96
100 P S.lilium Mexico (13) 100 -S.aratathomasi (1) S.nana 100 8 (3) S.bidens (2) Figures 16. One of two (first hypothesis) equally parsimonious trees (782 steps, CI: 0.48, Rl: 0.64) from a cladistic analysis of cytochrome b gene data set (Fitch parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Bars on the right indicate tentative "complex" of species. ! «
70
Centurio senex 70/3 30 95/10 -Uroderma bilobatum 87/6 20 Vampyressa pusilla u>
Carollia perspicillata
^' ara ^awom^si 1 1 00/231 3? 'S. aratathomasi 2 71 100/5l s/"'s/1
97/6 '•S, /u/s/2 71 S. thomasil 100/6 |
S. thomasi 2
100/14 S. lilium 1 21 65/1 S. ////ivm 39 100/15 IS, lilium 114
16 Is. ////urn 2 100/16c S. magna 51/3 S. magna 2
100/171 S. bogotensis 1 71 "iTLsS. bogotensisi 2
71/3 S. erythromos 1 100/14 I 16 14 CS. erythromos 2
S. sp. 18 B
100/1 11 S. mordaxl 13 72 's. mordax2 71 100/15 1—-S. sp. A 1 17 L S. sp. A 2
loo/is s - Wdae 1 54/2 r 12 71 ^4l_ S. Oofin 2
ioo/i3_r S. ludovici 1 15 77/2 S. ludovici 2
S. oporaphilum 1 100/90/9 I— 73/5 Tl L__ 11 S. oporaphilum 2 17 100/12 ~S. hondurensis 1 17 -S. hondurensis 2
100/15[~S- "a"a 1 27 's. nana 2
100/13 S. bidens 1 22 — S. to/cfens 2 Figures 17. One of two (second hypothesis) equally parsimonious trees (782 steps, CI: 0.48, Rl: 0.64) from a cladistic analysis of cytochrome b gene data set (Fitch parsimony) of 37 individuals representing Sturnira species and related
outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Bars on the right indicate tentative "complex" of species. —
72
Centurio senex 70/3 o. Uroderma bilobatum 3 30 95/10 O 87/6 i- O) 20 Vampyressa pusilla 4-* 3 O Carollia perspicillata
S. aratathomasi 1 x 100/23 » 32 S. aratathomasi 2 a E 71 o 5|S. /u/s/1 o '3 97/6 S. luisi 2 re E o 71 1 1 00/6 S. thomasi
¥l S. thomasi 2
\S. lilium 1 21 65/1 'S. ////'t/m 39 J00/15IS. ////u/77 114 16 \S. lilium 2 100/161 S. magna 1 20 c S. magna 2 51/3
S. bogotensis 1 71 100/17 I 71 18 L-S. bogotensis 2
71/3 S. erythromos 1 71 100/14 I 17 14 CS. erythromos 2
S. sp. B 18
100/11 1 S. mo^ax*) 13 72 'S. mordax2 71 { 1 100/15 1 S. sp. A 17 L s _ sp A 2
100/18 r s - Wdae1 54/2 22 C S. 2 12 SUae
100/13 S. ludovici 1 15 l_ 77/2 S. ludovici 2
100/9 S. oporaphilum 1 73/5 11 C -S. oporaphilum 2 11 15 100/1: S. hondurensis 1 18 •S. hondurensis 2
100/151" S. nana 1 26 'S. nana 2
100/13 S. bidens 1 24 — S. Wctens 2 Figure 18. The single most parsimonious tree of 260 steps (CI: 0.70, Rl: 0.75) from a cladistic analysis of cytochrome b gene data set (successively weighted parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Bars on the right indicate tentative "complex" of species. Arrowheads show nodes where resolution (and support values) had improved after successively weighted analysis. 74
Centurio senex 91 10 Uroderma bilobatum 97 100
Vampyressa pusilla
- Carollia perspicillata
,S. aratathomasi Iqq 1 X ~~Q I 1 S. aratathomasi 2 a E 56 o 100 \S.luisi1 u
"55 2 Is. 99 luisil re '54 E 100 S. thomasi 1 o |
re 'S. thomasi 2 **
100 \S. lilium 1 2 ? 69 'S. lilium 39 E 100 IS. ////ivm114 3 IS. lilium 2 100 S. magna 1
75 CS. magna 2
100 S. bogotensis 1 '61 L S. bogotensis 2 99 100 S. erythromos 1
C-S. erythromos 2
S. sp. B
100 S. mordax 1
70 'S. morafax 2 61 S. sp. A 1 I— rL S. sp. A 2
S. tildae 1 95 S. tildae 2
100 -S. /L/dov/c/1 C 8Z S. ludovici 2 2 100 S. oporaphilum 1 97 3 r S. oporaphilum 2
100 ~S. hondurensis 1
S. hondurensis 2
100 r S. nana 1
7 lc S. nana 2
100 S. bidens 1 10 -S. bidens 2 Figures 19. One of two (first hypothesis) equally parsimonious trees (257 steps, CI: 0.28, Rl: 0.62) from a cladistic analysis of a qualitative multistate osteological data set (Fitch parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. 76 -Centurio senex Carollia spp. 72 100/11 S. aratathomasi 1 72 15 i S. aratathomasi 2
S. magna 1 97/4 •Uroderma bilobatum | 57/2
' ' S. magna 2 Vampyressa pusilla 71 i-S. mordax 1
1 71 rS. mordax 2
S S A 1 71 92/3j - P-
*" S. sp. A 2 71 S. nana 7 100/7
t1 S. nana 2 71 —
S. bidens 1 60/1
S. bidens 2
S. ludovici 71 1
£1 S. ludovici 2
-S. hondurensis 1 72 72 53/3 — S. hondurensis 2
S. erythromos 1
'ifC S. bogotensis 1 72 72 S. erythromos 2
S. bogotensis 2 I— 1
72 95/3 S. oporaphilum 1 8 €S. oporaphilum 2
71 -S. sp. B
— S. tildae 2 11 71 -S. tildae 1
S. thomasi 1 71 68/2 £ S. thomasi 2
72 82/2 S. liliuml
CS. luisi 1 71 -S. Iilium39
S. lilium 1 2 1— S. luisi 2 S. liliuml 14 Figures 20. One of two (second hypothesis) equally parsimonious trees (257 steps, CI: 0.28, Rl: 0.62) from a cladistic analysis of a qualitative multistate osteological data set (Fitch parsimony) of 37 individuals representing Stumira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. —
78 Centurio senex
72 -Carollia spp. 4 S. aratathomasi 1 72 100/11 r 15 —S.L aratathomasi 2 57/2 i Uroderma bilobatum Q 6 ma na 7 1 - 9 Vampyressa pusilla 97/4 I
' S. magna 2 71 rS. mordax 1
1 71 rS. mordax 2
71 92/3 S. sp. A 1
S. sp. A 2 71 S. nana 1 100/7
' 71 — S. nana 2
72 S. bidens 1
fl -S. bidens 2
S. ludovici 1 71
S. ludovici 2
72 -S. sp. B 3 *,. r-S. erythromos 1
* I— S. bogotensis 1
— S. erythromos 2
72 — S. bogotensis 2
— ^' PoraPhilum 1 95/3 I 4 72 I— S. oporaphilum 2
-S. hondurensis 53/3 1 71 S. hondurensis 2 [ — S. tildae 2 */i S. tildae 1
^7omas/ 68/2 \^' '
3 I I '— S. thomasi2
72 S. Miurn 1 82/2 I
€S. luisi 1 71 -S. Iilium39 L S. lilium 2 1 I — S. luisi 2 -S. HliumlU Figure 21 . The single most parsimonious tree of 42 steps (CI: 0.39, Rl: 0.74) from a cladistic analysis of a qualitative multistate osteological data set (successively weighted parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Arrowheads show nodes where resolution (and support values) had improved after successively weighted analysis. — 4
80
Centurio i senex 1 Carollia spp.
100 S. aratathomasi 1
i S. aratathomasi 2
k ma na 100 l^' 9 1 74 Uroderma bilobatum 1 -S. magna 2 Vampyressa pusilla i-S. mordax 1
1 rS. mordax 2
98 S. sp. A 1
S. sp. A 2
S. nana 1 100
63 -S. nana 2
oq iS. bidens 1
nrL.«-S. 6/c/ens 2
-S. ludovici 79 1
—S. ludovici 2
55 -S. hondurensis 1 62 L80_ — S. hondurensis 2
S. erythromos 1
S. bogotensis 1
S. erythromos 2
-S. bogotensis 2
g4 I S. oporaphilum 1
1 Lq,-S. oporaphilum 2
-S. sp. B
— S. tildae 2
S. tildae 1
S. thomasi 1 74
c S. thomasi 2
75 S. liliuml
cS. luisi 1 S. Iilium39 S. lilium 2 1— S. luisi 2 S. lilium 11 Figures 22. One of four (first hypothesis) equally parsimonious trees (1078 analysis of combined cytochrome b steps, CI: 0.41 , Rl: 0.61) from a cladistic a gene data set and a qualitative multistate osteological data set (Fitch parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Arrowheads are pointed at unresolved nodes of well-supported internal clades. s 2
82
Centurio senex 67/1 Uroderma bilobatum 95/12 98/10 35 27 26 Vampyressa pusilla Carollia perspicillata
S. aratathomasi 1 100/34 40 S. aratathomasi 2 S////Um7 100/181
62/1 23 1 — S. lilium 39 15 78/4 11 S. lilium 2 100/13 1
17 | S. lilium 114 */1 51/1 13 15 S. /u/s/ 7 98/5iTL8/5 P 91/5 S. /u/'s/
*/1 100/7pS.op/7 r thomasi 1 13 iol S. thomasi 2 S. tildae 1 100/15 — 19 S. tildae 2 S. sp. B
S. mordax 1 99/89/8 I
'*/1 13L.SS. mordax 2
S A 1 — - P- */1 100/16 r 26 €S. sp. A 2
-S. magna 1 100/18
22 S. magna 2
-S. erythromos 1 100/13 11 23 -S. erythromos 2 60/2 73/5 14 -S. bogotensis 1 20 100/16 19 —S. bogotensis 2
S. ludovici 1 100/11 19 c S. ludovici 2 67/2
S. oporaphilum 1 100/17 85/5 20 19 —S. oporaphilum 2 14 S. hondurensis 1 100/13 — 20 S. hondurensis 2 nana 1 100/20 t-S. 36 S. nana 2 65/2 16 —S. bidens 1 100/16
31 S. bidens 2 Figures 23. One of four (second hypothesis) equally parsimonious trees (1078 steps, CI: 0.41, Rl: 0.61) from a cladistic analysis of a combined cytochrome b gene data set and a qualitative multistate osteological data set (Fitch parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Arrowheads are pointed at unresolved nodes of well-supported internal clades. — — ^ 2
84
67/1 -Centurio senex Uroderma bilobatum 98/10 35 95/12 "31- 27 — r^r-Vampyressa pusilla Caro//«perap/c///ate ioo/34 rS aratathor 40 S. aratathomasi 2 Slilium1 100/181 62/1 23 I S. lilium 39 15 78/4 — 11 S. lilium 100/13100/13 1— 2
71 S. ium 774
15 S. /u/'s/ 7 98/58/5 51/1 P TTL. S. /u/'s/ 2 15 91/5
S. thomasi 1 100/71 71 1 0T-S. thomasi 13
100/15 -S. tildae 1 19 cI S. tildae 2 12 S. sp. B
S. erythromos 1 100/13 17 60/2 S. erythromos 2
S. bogotensis 1 71 100/16 7 25 -S. bogotensis 2
-S. magna 1 100/18 27 S. magna 2
S. mordax 1 99/8 i— 13 >-S. mordax 2 73/5 71
20 S sp - A 1 100/161 - 26 CS. sp. A 2
S. ludovici 100/11 i— 1 19 l S. ludovici 2 67/2
— ®" oporGphilu™ 1 100/17 I 12 85/5 19 S. oporaphilum 2 14 —
S. hondurensis 1 100/13 19 S. hondurensis 2 100/20 S. nana 1 36 65/2 CS. nana 2
16 S. bidens 1 100/16 31 S. bidens 2 Figures 24. One of four (third hypothesis) equally parsimonious trees (1078 analysis of a combined cytochrome b steps, CI: 0.41 , Rl: 0.61) from a cladistic gene data set and a qualitative multistate osteological data set (Fitch parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Arrowheads are pointed at unresolved nodes of well-supported internal clades.
I —
86
67/1 -Centurio senex Uroderma bilobatum 98/10 34 95/12 27 26 Vampyressa pusilla -Carollia perspicillata 100/34 r^- ^ratathomasi 1 40 i S. aratathomasi 2
S. liliuml 100/18 62/1 23 C S. lilium 39 15 78/4 11 S. lilium 2 100/1330/13 I 17|_ 71 S. lilium 114 15 S. luisi 1 51/1 98/58/5 P 14 TT~l_ S. luisi 91/5 2
100/7T S. thomasi 1
71 "lot S. thomasi 2 12 100/15 S. tildae 1 19 CS. tildae 2
-S. sp. B
100/18 -S. magna 1
28 -S. magna 2 71 71 — S. mordax 1 99/89/8 I
13L.QS. mordax 2 71
;S sp - A 1 100/16 rI - 26 I— S. sp. A 2
100/13 S. erythromos 1 19 c S. erythromos 2 73/5 60/2 20 11 100/11 S. bogotensis 1 23 -S. bogotensis 2
100/11 r—S. ludovici 1 19 67/2 S. ludovici 2
100/17 S. oporaphilum 1 85/5 19 20 C S. oporaphilum 16 2 -S. 100/13 hondurensis 1 19 •S. hondurensis 2 100/20 S. nana 1 35 CS. nana 2 65/2 S. bidens 1 17~L 100/16 32 -S. bidens 2 Figures 25. One of four (fourth hypothesis) equally parsimonious trees (1078 analysis of a combined cytochrome b steps, CI: 0.41 , Rl: 0.61) from a cladistic gene data set and a qualitative multistate osteological data set (Fitch parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Arrowheads are pointed at unresolved nodes of well-supported internal clades. 1 —
88
67/1 -Centurio senex Uroderma bilobatum 98/10 34 95/12 27 30 ampyreSSa pUSilla Carollia perspicillat% S aratatnomasi 100/34 T ' 1 40 S. aratathomasi 2 -S. liliuml 62/1 100/18 15 23 cS. lilium 39 78/4 11 5S. lilium 2 100/13 1 17 71 I S. lilium 114
51/1 15 S. luisi 1 98/58/5 14 iT|_P 91/5 S. luisi 2
S tnomasi ' 71 100/7|"00/7 r ' 11 lOL S. thomasi 2 100/15 -S. tildae 1 19 C' S. tildae 2 S. sp. B
S. erythromos 1 100/13 1 T8l__ 60/2 S. erythromos 2 11 '71 100/16 S. bogotensis 1 24 -S. bogotensis 2
S. mordax 1 99/89/8 I 15L_c 71 S. mordax 2
100/16 — S. sp. A 1 I 24 I— S. sp. A 2 73/5 20 100/18 S. magna 1 28 •S. magna 2
- S. ludovici 1 100/150/1 1 18 l__ 67/2 S. ludovici 2
100/1 S. oporaphilum 1 16 85/5 20 *r S. oporaphilum 15 2 -S. hondurensis 100/13 1 20 S. hondurensis 2
100/20 S. nana 7 35 65/2 cS. nana 2 15 S. bidens 1 100/16 32 r S. bidens 2 Figure 26. The single most parsimonious tree of 295 steps (CI: 0.65, Rl: 0.72) from a cladistic analysis of a combined cytochrome b gene data set and a qualitative multistate osteological data set (successively weighted parsimony) of 37 individuals representing Sturnira species and related outgroup taxa. Numerical values, abbreviations, and symbols are as indicated in figure 7. Bars on the rigth indicate tentative "complex" of species. Names on terminal branches reflect proposed taxonomic nomenclature suggested herein. Arrowheads show nodes where resolution (and support values) had improved after successively weighted analysis. 90
-Centuriosenex 95 10 Uroderma bilobatum 99 JLQJL
1 Vampyressa pusilla
Carollia spp. 26
-T-.— S. aratathomasi 11
100 S. lilium 65 7 81
100 S. parvidens
99 S. luisi ^3-3 x '97 2 E 100 % S ° S. thomasi ^ 2
100 S. tildae 6
-S. sp. B
—g— S. erythromos 74
100 „ . . y— S. bogotensis
—— S. mordax 67
100 S. sp. A
100 S. magna 93
100 4 S. ludovici 84 100 98 S. oporaphilum 12 100 S. hondurensis
100 S. nana _58 4 100 C Mrf ^2 5. bidens Figures 27. Phylogenetic reconstruction of character one (the way lower inner incisors are divided) on the single most parsimonious tree of 295 steps (CI: 0.65, data set and Rl: 0.72) from a cladistic analysis of a combined cytochrome b gene parsimony) a qualitative multistate osteological data set (successively weighted taxa. of 37 individuals representing Sturnira species and related outgroup See Appendix 4 for explanation of each character-state value. Pattern of character evolution was performed using MacClade version 3.08a (Maddison and Maddison 1999). "S." before each specific epithet stands for Sturnira. Rl: retention index, a way to describe how characters vary over a chosen phylogenetic tree (Judd et al. 1999). 42
92
Centurio senex Uroderma bilobatum O Vampyressa pusilla O Carollia spp. S. aratathomasi 1 S. aratathomasi 2 \qS. liliuml \qS. Iilium39 pS. Iilium2
q& Iilium 11 pS. /u/s/ 7 IqS. /ute/2 S. thomasi 1 \qS. thomasi pS. Wdae 7 IqS. Wdae 2 pS. sp. B
S. erythromos 1 q S. erythromos 2 pS. bogotensis 1 pS. bogotensis 2 pS. mordax 1 qS. mordax 2
S. sp. A 1 S. sp. A 2 pS. magna 1 p S. magna 2 pS. ludovici 1 pS. ludovici 2
S. oporaphilum 1 S. oporaphilum 2
S. hondurensis 1 S. hondurensis 2 pS. nana 1 pS. nana 2 pS. bidens 1 pS. bidens 2 Figures 28. Phylogenetic reconstruction of character two (number of lobes present on distal edge of lower incisors) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 94
on Centurio senex inne 5 Nurr ~ d Uroderma bilobatum o 11 1 CTmm .. to I Vampyressa pusilla co ro tal er o8 n9 nci i I Carollia spp. c 3f aratathomasi 1 sors edge flS. lob |S. aratathomasi 2 & 2, co lS. //'//umf gS. Iilium39 nCD § lS. Ium2 CD CO -i CD3 B S. Iilium114 m S. luisil lS. /iy/s/2 g S. thomasi 1 I S. thomasi 2 m S. tildae 1 U S. tildae 2 m S. sp. B >S. erythromos 1 I S. erythromos 2 >S. bogotensis 1 I S. bogotensis 2 gS. mordax 1 I S. mordax 2 lS. sp. A 7 |S. sp. A 2 >S. magna 1 I S. magna 2 S. ludovici 1 I S. ludovici 2 S. oporaphilum 1 S. oporaphilum 2 S. hondurensis 1 S. hondurensis 2 ^S. nana 7 I S. nana 2 >S. bidens 1 S. bidens 2 Figures 29. Phylogenetic reconstruction of character three (shape of distal edge of upper inner incisors) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
96
J3 Centurio senex H Uroderma bilobatum O05 Vampyressa pusilla ^Camilla spp.
flS. aratathomasi 1 flS. aratathomasi 2 flS. //7/um7 B S. Iilium39 >S. ////urn 2 n S. Iilium 11 S. /u/s/' 7 D S. /L//S/2 hS. thomasi 1 gS. thomasi 2 HS. Mdae 7 S. Wc/ae 2 S. sp. B igS. erythromos 1 S. erythromos 2
qS. bogotensis 1 S. bogotensis 2
^S. mordax 1 I S. mordax 2 BS. sp. A 7 H S. sp.A2 ^S. magna 1 I S. magna 2 I S. ludovici 1 I S. ludovici 2 gS. oporaphilum 1 S. oporaphilum 2 gS. hondurensis 1 S. hondurensis 2 flS. nana 7 I S. nana 2 ^S. bidens 1 m S. bidens 2 Figures 30. Phylogenetic reconstruction of character four (orientation of upper inner incisors comparing to each other) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 98
Centurio senex Uroderma bilobatum Vampyressa pusilla QCarollia spp.
jS. aratathomasi 1 jS. aratathomasi 2 qS. liliuml gS. Iilium39 igS. Iilium2 n S. liliuml 14 qS. luisi 1 n S. luisi 2 S. thomasi 1 gjS. thomasi 2 hS. tildae 1 lS. tildae 2 n S. sp. B gS. erythromos 1 S. erythromos 2
qS. bogotensis 1 S. bogotensis 2
qS. mordax 1 S. mordax 2 igS. sp. A 1 nS. sp. A 2 S. magna 1 S. magna 2
S. ludovici 1 S. ludovici 2
g|S. oporaphilum 1 hS. oporaphilum 2 ^S. hondurensis 1 I S. hondurensis 2 qS. nana 1 S. nana 2
S. bidens 1 S. bidens 2 Figures 31 . Phylogenetic reconstruction of character five (number of lobes present on distal edge of upper inner incisors) on the single most parsimonious
tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
100
Centurio senex Uroderma bilobatum Vampyressa pusilla BjCaro///a spp. ^S. aratathomasi 1
flS. aratathomasi 2
gS. //7/t/A77 "/ H S. //7/tym39 Q S. ////urn 2 Q S. HIiurn 11 S. /u/s/ 7
S. thomasi 1 S. thomasi 2 H S. Mctee f S. Wdae2 Q S. sp. B qS. erythromos 1 S. erythromos 2
S. bogotensis 1 S. bogotensis 2 S. mordax 1 S. mordax 2 qS. sp. A ? Q S. sp.A2 S. magna 1 S. magna 2 S. ludovici 1 S. ludovici 2 S. oporaphilum 1 S. oporaphilum 2 EjS. hondurensis 1 I S. hondurensis 2 flS. nana 7 I S. nana 2 cr "O ? Q) o jS. bidens 1 co CO —r tf S. bidens 2 CD ro o n CD L. 1 O CO CD O u X -5 CD Q. 3 0) CD 3 Figures 32. Phylogenetic reconstruction of character six (direction of upper inner incisors on side view of the skull) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
102
CO Centurio senex C ii Uroderma bilobatum 11 = CO O Vampyressa pusilla en oo Carollia spp.
forward S. aratathomasi 1 equivoca downwar S. aratathomasi 2
S. IHiurn 1 S. Iilium39 S. lilium 2 S. iiiium 11
S. luisi 1 S. luisi 2
S. thomasi 1 S. thomasi 2
S. tildae 1 S. tildae 2 |S. sp. B
jS. erythromos 1 >S. erythromos 2 >S. bogotensis 1 I S. bogotensis 2 qS. mordax 1 qS. mordax 2 qS. sp. A 1 S. sp. A 2 S. magna 1 qS. magna 2
S. ludovici 1 rjS. ludovici 2
gS. oporaphilum 1 I S. oporaphilum 2 rjS. hondurensis 1 S. hondurensis 2 flS. nana 1 I S. nana 2 bS. bidens 1 S. bidens 2 Figures 33. Phylogenetic reconstruction of character seven (degree of development of metaconid on ml) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 104
Centurio senex U Uroderma bilobatum U Vampyressa pusilla Carollia spp.
S. aratathomasi 1 D S. aratathomasi 2 DS. liliuml DS. Iilium39 DS. lilium 2 DS. liliuml 14 DS. luisil DS. Iuisi2 D S. thomasi 1 D S. thomasi 2 DS. tildae 1 DS. tildae 2 DS. sp. B HS. erythromos 1 S. erythromos 2 DS. bogotensis 1 D S. bogotensis 2
DS. mordax 1 D S. mordax 2 S. sp. A 1 S. sp.A2 DS. magna 1 D S. magna 2 D S. ludovici 1 ES. ludovici 2
IS. oporaphilum 1 S. oporaphilum 2 S. hondurensis 1 S. hondurensis 2 US. nana 1 US. nana 2
DS. bidens 1 DS. bidens 2 Figures 34. Phylogenetic reconstruction of character eight (degree of development of entoconid on ml) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 2 4
106
ID Centurio senex \UUroderma bilobatum Vampyressa pusilla DCarollia spp. IIS. aratathomasi 1 MS. aratathomasi 2 IDS. liliuml IDS. Iilium39 IDS. lilium 2 IDS. lilium 11 IDS. luisi 1 IDS. luisi ID S. thomasi 1 IDS. thomasi 2 MS. tildae 1 IIS. tildae 2 IDS. sp. B S. erythromos 1 S. erythromos 2 S. bogotensis 1 S. bogotensis 2 OS. mordax 1 S. mordax 2 S. sp. A 1 S. sp. A 2 OS. magna 1 \0 S. magna 2 IDS. ludovici 1 ID S. ludovici 2 S. oporaphilum 1 S. oporaphilum 2 IBS. hondurensis 1 MS. hondurensis 2 S. nana 1 S. nana 2 IDS. bidens 1 IBS. bidens 2 Figures 35. Phylogenetic reconstruction of character nine (distinct separation between metaconid and entoconid on ml) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
108
"JD Centurio senex IDUroderma bilobatum II Vampyressa pusilla JD Caro///a spp.
IDS. aratathomasi 1 JD S. aratathomasi 2 IDS. liliuml JDS. Iilium39 IDS. lilium 2 JDS. lilium 11 IDS. ftj&f JDS. ^2 ID S. thomasi 1 JDS. thomasi 2 IDS Wc/ae ^ JDS. tildae 2 )ns. sp. B
JDS. erythromos 1 MS. erythromos 2
}OS. bogotensis 1 )DS. bogotensis 2 JDS. mordax 1 II S. mordax 2 IIS. sp. A 1 IIS. sp. A 2
IDS. magna 1 IDS. magna 2
ID S. ludovici 1 US. ludovici 2
US. oporaphilum 1 DS. oporaphilum 2 HS. hondurensis 1 1 S. hondurensis 2 S. nana 7 IS nana 2 DS. bidens 1 D S. /b/dens 2 Figures 36. Phylogenetic reconstruction of character ten (presence of "shelf" on metacone on M1) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27.
• 110
o -d 7) Centurio senex D Uroderma bilobatum oen D Vampyressa pusilla UCarollia spp.
US. aratathomasi 1 S. aratathomasi 2
DS. IHiurn 1 DS. Iilium39
US. IHiurn 2 DS.IiliumlU DS. luisil S. luisi 2 U S. thomasi 1 US. thomasi 2 DS. tildae 1 DS. tildae 2 DS. sp. B
S. erythromos 1 U S. erythromos 2
US. bogotensis 1 U S. bogotensis 2 DS. mordax 1 U S. mordax 2 US. sp. A 1 US. sp. A 2 DS. magna 1 U S. magna 2 D S. ludovici 1 DS. ludovici 2
DS. oporaphilum 1 D S. oporaphilum 2 DS. hondurensis 1 D S. hondurensis 2 US. nana 1 US. nana 2
US. bidens 1 US. bidens 2 Figures 37. Phylogenetic reconstruction of character eleven (presence of "shelf" on metacone on M2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. ^
112
5 3 7 Centurio senex 2. <3 en U Uroderma bilobatum o 0) n CD b U Vampyressa pusilla " Z> < nee o CD :one mCarollia spp. C/> o o S. aratathomasi 1 "O : o 3 o' o 0} US. aratathomasi 2 ^ . "1 c N> C/> US. liliuml CD — 5" CD cp_ OS. Iilium39 D ^*^, -^2 D US. Iilium 2 0) » o 3 OS. Iilium114 US. luisi 1 US. luisi 2 U S. thomasi 1 US. thomasi 2 US. tildae 1 US. tildae 2 US. sp. B US. erythromos 1 U S. erythromos 2 US. bogotensis 1 U S. bogotensis 2 US. mordax 1 U S. mordax 2 US. sp. A 1 US. sp. A 2 US. magna 1 U S. magna 2 US. ludovici 1 US. ludovici 2 US. oporaphilum 1 US. oporaphilum 2 US. hondurensis 1 U S. hondurensis 2 US. nana 1 US. nana 2
US. bidens 1 US. bidens 2 (maximum maxillary Figures 38. Phylogenetic reconstruction of character twelve which numerical values, width at M1) on the single most parsimonious tree, abbreviations, and symbols are as indicated in figure 27. 2
114
ID Centurio senex DUroderma bilobatum Vampyressa pusilla CarolHa spp.
DS. aratathomasi 1 IDS. aratathomasi 2 S. liliuml DS. Iilium39 DS. lilium 2 DS.IiliumlU
IDS. luisi 1 DS.Iuisi2
DS. thomasi 1 DS. thomasi
DS. tildae 1 US. tildae 2 S. sp. B
IDS. erythromos 1 IDS. erythromos 2
IDS. bogotensis 1 DS. bogotensis 2 IDS. mordax 1 S. mordax 2 S. sp. A 1 S. sp. A 2 DS. magna 1 DS. magna 2
S. ludovici 1 S. ludovici 2
S. oporaphilum 1 S. oporaphilum 2
DS. hondurensis 1 S. hondurensis 2 DS. nana 1 DS. nana 2
S. bidens 1 S. bidens 2 Figures 39. Phylogenetic reconstruction of character 13 (maximum maxillary width at M2 or similar width at M1 and M2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 2
116
0) w DO § ^
I I Centurio senex
I Uroderma bilobatum )0 Vampyressa pusilla )oCarollia spp.
IS. aratathomasi 1 s. aratathomasi 2
OS. IHiurn 1 s. Iilium39 s. lilium 2 \S.lilium114 JDS. luisi 1 inS. luisi 2
IS. thomasi 1 IS. thomasi 2 IS. Wdae 7 IS. ttWae 2 ]DS. sp. B
IS. erythromos 1 IS. erythromos 2
)OS. bogotensis 1 )0 S. bogotensis 2
]DS. mordax 1 IS. mordax 2 ]DS. sp. A 1 )0S. sp. A 2 JDS. magna 1 IS. magna 2 JDS. ludovici 1 )0S. ludovici
JDS. oporaphilum 1 )0S. oporaphilum 2
\S. hondurensis 1 ]OS. hondurensis 2 IS. nana 7 IS. nana 2 JDS. bidens 1 )0S. bidens 2 Figures 40. Phylogenetic reconstruction of character 14 (differences in alignment of upper molars and premolars) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 2
118
Centurio senex
ED Uroderma bilobatum E Vampyressa pusilla UCarollia spp.
US. aratathomasi 1 S. aratathomasi 2 US. liliuml US. Iilium39 US. Iilium2 US.IiliumlU
US. luisi 1 US. luisi 2
US. thomasi 1 US. thomasi US. tildae 1 US. tildae 2 DS. sp. B
DS. erythromos 1 OS. erythromos 2
DS. bogotensis 1 D S. bogotensis 2
DS. mordax 1 US. mordax 2 US. sp. A 1 US. sp. A 2 DS. magna 1 S. magna 2
DS. ludovici 1 US. ludovici 2
US. oporaphilum 1 U S. oporaphilum 2
US. hondurensis 1 D S. hondurensis 2 US. nana 1 US. nana 2
DS. bidens 1 DS. bidens 2 Figures 41 . Phylogenetic reconstruction of character 15 (presence of zygomatic arch) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. * 4
120
"0 go — Centurio senex (D o 1 CO U Uroderma bilobatum CD b 3 * U Vampyressa pusilla O CD s8 UCarollia spp.
-**o S. aratathomasi 1 4 OS. aratathomasi 2 <8 US. liliuml 3 DS. Iilium39 0) r-h DS. lilium 2 o' US. lilium 11 0)T o US. luisi 1 3- US. luisi 2 U S. thomasi 1 US. thomasi 2 US. tildae 1 US. tildae 2 US. sp. B
DS. erythromos 1 U S. erythromos 2
US. bogotensis 1 U S. bogotensis 2
US. mordax 1 US. mordax 2 US. sp. A 1 US. sp. A 2 US. magna 1 U S. magna 2 U S. ludovici 1 US. ludovici 2 US. oporaphilum 1 U S. oporaphilum 2
US. hondurensis 1 U S. hondurensis 2 US. nana 1 US. nana 2 US. bidens 1 US. bidens 2 Figures 42. Phylogenetic reconstruction of character 16 (degree in which ml is tilted) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 122
Centurio senex 5 CD • • mi n !=?. CQ D Uroderma bilobatum o LLU LJ i_i CD CD D Vampyressa pusilla CO Q. CD CO Q 3 3 o c 5' DCarollia spp. C CD o <' ^*. 3- DS. aratathomasi 1 3"$ o DS. aratathomasi 2 o CD o' 0) Q. o' IT US. IHiurn 1 c o c 3 US. Iilium39 ^ CD ^ _i. o" CD US. Iilium2 c 3 DS. HliumlU CD BS. luisi 1 --^3 luisi 0) US. 2 US. thomasi 1 BS. thomasi 2 US. tildae 1 US. tildae 2 DS. sp. B
DS. erythromos 1 D S. erythromos 2
DS. bogotensis 1 U S. bogotensis 2
DS. mordax 1 D S. mordax 2 US. sp. A 1 US. sp. A 2 DS. magna 1 DS. magna 2 BS. ludovici 1 US. ludovici 2
US. oporaphilum 1 US. oporaphilum 2 BS. hondurensis 1 B S. hondurensis 2 DS. nana 1 DS. nana 2 DS. bidens 1 BS. bidens 2 Figures 43. Phylogenetic reconstruction of character 17 (direction in which ml is tilted) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. n 4
124
3 g D Centurio senex Uroderma bilobatum p D ~ D Vampyressa pusilla CD ZT o' -Q o 03 3 DCarollia spp. C CQ C = 1 n' 81 & OS. aratathomasi o o 92 o 13 D S. aratathomasi 2 0) :5" o' DS. liliuml o ( , c g C DS. Iilium39 o CD — DS. lilium 2 3 CD c DS. lilium 11 jiT CD m OS. luisi 1 I DS. luisi 2 DS. thomasi 1 DS. thomasi 2 DS. tildae 1 MS. tildae 2 DS. sp. B
DS. erythromos 1 DS. erythromos 2
DS. bogotensis 1 US. bogotensis 2
DS. mordax 1 DS. mordax 2 DS. sp. A 1 US. sp. A 2 DS. magna 1 DS. magna 2
DS. ludovici 1 US. ludovici 2
US. oporaphilum 1 US. oporaphilum 2
DS. hondurensis 1 U S. hondurensis 2 DS. nana 1 DS. nana 2
DS. bidens 1 DS. bidens 2 Figures 44. Phylogenetic reconstruction of character 18 (direction in which m2 is tilted compared with ml) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 126
o Centurio senex D Uroderma bilobatum D Vampyressa pusilla UCarollia spp. DS. aratathomasi 1 DS. aratathomasi 2 DS. liliuml DS. Iilium39 DS. Iilium2 US. Iilium114 DS. luisi 1 S. luisi 2 D S. thomasi 1 D S. thomasi 2 DS. tildae 1 MS. tildae 2 US. sp. B
DS. erythromos 1 DS. erythromos 2
DS. bogotensis 1 S. bogotensis 2 DS. mordax 1 DS. mordax 2 US. sp. A 1 US. sp.A2
US. magna 1 U S. magna 2 US. ludovici 1 US. ludovici 2 DS. oporaphilum 1 DS. oporaphilum 2 US. hondurensis 1 US. hondurensis 2 US. nana 1 US. nana 2 US. bidens 1 DS. bidens 2 Figures 45. Phylogenetic reconstruction of character 19 (direction in which m2 is tilted) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 128 o CO
)D Centurio senex |l Uroderma bilobatum ll Vampyressa pusilla )nCarollia spp.
IDS aratathomasi 1 ll S. aratathomasi 2 ||S. liliuml lis. Iilium39
|1S. ////t/m 2 IDS. liliuml 14
||S. /ty/'s/ f IIS. Iuisi2 ||S. thomasi 1 US. thomasi 2 JDS. tildae 1 IIS. tildae 2 )ns. sp. B lis erythromos 1 lis erythromos 2 JDS. bogotensis 1 )DS. bogotensis 2 IIS. mordax 1 US. mordax 2 )DS. sp. A 1 US. sp. A 2 JDS. magna 1 ids. magna 2
IDS. ludovici 1 IS. ludovici 2
IIS. oporaphilum 1 US. oporaphilum 2 DS. hondurensis 1 US. hondurensis 2 DS. nana 1 DS. nana 2 DS. bidens 1 US. bidens2 Figures 46. Phylogenetic reconstruction of character 20 (forearm length classes) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27.
• 130
Centurio senex Uroderma bilobatum CD O D Vampyressa pusilla UCarollia spp.
US. aratathomasi 1 US. aratathomasi 2 US. liliuml US. Iilium39 US. lilium 2 DS. liliuml 14 DS. luisi 1 OS. luisi 2
DS. thomasi 1 S. thomasi 2 US. tildae 1 US. tildae 2 DS. sp. B HS. erythromos 1 D S. erythromos 2 OS. bogotensis 1 D S. bogotensis 2 DS. mordax 1 US. mordax 2 US. sp. A 1 US. sp. A 2 S. magna 1 U S. magna 2 DS. ludovici 1 D S. ludovici 2 US. oporaphilum 1 US. oporaphilum 2
US. hondurensis 1 U S. hondurensis 2 OS. nana 1 DS. nana 2
DS. bidens 1 DS. bidens 2 Figures 47. Phylogenetic reconstruction of character 21 (relative length of M3 compared to M2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. T ^ r 2 4
132
o § CD I lliiiil iii; 0) < oo 3 ® pi Centurio senex -Q ^ ^ ^ ^ CD o CO CO CO CO Uroderma bilobatum C °- CD M 1—•> 3" < ^ l\3 -Q il Vampyressa pusilla o CO c 3; 05. O (Q o 3; 0) —4* MCarollia spp. 0) — Q. 3. CD S. aratathomasi 1 o' C/> ID c l\3 JD S. aratathomasi 2 ro CD N> S" O mS. liliuml 3 ***** ,«— o ~o "O C mS. Iilium39 a c — >B o' CD mS. Iilium2 c CD C 13 jHS. 1ilium 11 CD 3 CD -Br -5 vaS. luisi 1 0) mS. luisi p S. thomasi 1 In S. thomasi 2 pS. tildae 1 ES. tildae 2 IBS. sp. B JHS. erythromos 1
lE3 S. erythromos 2
)EJS. bogotensis 1 lEaS. bogotensis 2
pS. mordax 1 )U S. mordax 2 JEDS. sp. A 7 )I3S. sp. A 2 )EDS. magna 1 IE S. magna 2
IHS. ludovici 1 IH S. ludovici 2
IE3S. oporaphilum 1 IH S. oporaphilum 2 HS. hondurensis 1 IHS. hondurensis 2
fflS. nana 7 HS. nana 2 S. bidens 1 S. bidens 2
. Figures 48. Phylogenetic reconstruction of character 22 (relative length of M2 compared to M1) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. ' 4
134
5 comp o Relat Centurio senex L 111 D Uroderma bilobatum o> < o8! • I\ s s ^ 5 D Vampyressa pusilla : ro k> ro
=• ii Carollia spp. <: ro rr £. O (Q c3 CD ^ S. aratathomasi 1 c 31 i i S S. aratathomasi 1 S ~ -* 2 B. ^ T3 o S. liliuml ^ "^ 9. S S. Iilium39 -l "O ^ ro ^ o' CD S. lilium 2
ture S. lilium 11 n/a) picture S. luisi 1 n/a S. luisi 2 D "— S. thomasi 1 Hr S. thomasi 2 S. tildae 1 S. tildae 2 DS. sp. B
US. erythromos 1 US. erythromos 2
US. bogotensis 1 US. bogotensis 2
US. mordax 1 US. mordax 2 US. sp. A 1 US. sp. A 2
DS. magna 1 DS. magna 2
S. ludovici 1 S. ludovici 2
S. oporaphilum 1 S. oporaphilum 2
S. hondurensis 1 S. hondurensis 2 S. nana 1 S. nana 2
S. bidens 1 S. bidens 2 Figures 49. Phylogenetic reconstruction of character 23 (relative degree on development of occipital condyles) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 136
Q 9- J3 D Centurio senex nUroderma bilobatum D Vampyressa pusilla nCarollia spp. S. aratathomasi 1 S. aratathomasi 2 DS. liliuml OS. Iilium39
DS. IHiurn 2 DS. Iilium114 DS. luisi 1 OS. luisi 2 S. thomasi 1 S. thomasi 2 S. tildae 1 US. tildae 2 US. sp. B S. erythromos 1 U S. erythromos 2 S. bogotensis 1 S. bogotensis 2
S. mordax 1 U S. mordax 2 US. sp. A 1 US. sp. A 2 S. magna 1 U S. magna 2 DS. ludovici 1 DS. ludovici 2 S. oporaphilum 1 U S. oporaphilum 2 US. hondurensis 1 S. hondurensis 2 S. nana 1 S. nana 2 S. bidens 1 S. bidens 2 Figures 50. Phylogenetic reconstruction of character 24 (relative degree on development of proccess paroccipitalis) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 138
D "O Q- J3 0) O Q ID Centurio senex Uroderma bilobatum D Vampyressa pusilla Carollia spp.
DS. aratathomasi 1 O S. aratathomasi 2 DS. liliuml S. Iilium39 S. lilium 2 S. liliuml 14
S. luisi 1 S. luisi 2 D S. thomasi 1 DS. thomasi 2 IS. tildae 1 \S. tildae 2 \S. sp. B
IS. erythromos 1 \S. erythromos 2
\S. bogotensis 1 \S. bogotensis 2
\S. mordax 1 \S. mordax 2 IS. sp. A 1 S. sp. A 2 S. magna 1 S. magna 2 S. ludovici 1 S. ludovici 2
S. oporaphilum 1 S. oporaphilum 2
S. hondurensis 1 S. hondurensis 2 S. nana 1 S. nana 2
S. bidens 1 S. bidens 2 Figures 51 . Phylogenetic reconstruction of character 25 (shape of maxillary tuberosity) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 42
140
D Centurio senex M Uroderma bilobatum M Vampyressa pusilla UCarollia spp. OS. aratathomasi 1 OS. aratathomasi 2 MS. liliuml MS. Iilium39 MS. Hlium2
OS. Iilium 11 MS. luisi 1 US.Iuisi2
MS. thomasi 1 MS. thomasi DS. tildae 1 MS. tildae 2 DS. sp. B
S. erythromos 1 MS. erythromos 2
OS. bogotensis 1 M S. bogotensis 2 MS. mordax 1 MS. mordax 2 MS. sp. A 1 MS. sp. A 2
OS. magna 1 OS. magna 2
OS. ludovici 1 S. ludovici 2
MS. oporaphilum 1 MS. oporaphilum 2
MS. hondurensis 1 MS. hondurensis 2 MS. nana 1 MS. nana 2
OS. bidens 1 OS. bidens 2 Figures 52. Phylogenetic reconstruction of character 26 (development of postero-lateral edge on palate in relation to distal end of M3) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 142
D Centurio senex o Uroderma bilobatum Vampyressa pusilla o CD 03 W ^ Q. aCarollia spp. i S. aratathomasi 1 111o 2. S ICD » O CD C/> — S. aratathomasi 2 SL £=* « CD ////i/mf y ft) DS. o' o S. Iilium39
S. ////urn 2 S. Iilium114
CD DS.Iuisil S. /u/s/2
S. thomasi 1 S. thomasi 2 S. Mdae 7 S. Wcfee 2 DS. sp. B BS. erythromos 1 B S. erythromos 2 BS. bogotensis 1 D S. bogotensis 2 DS. mordax 1 DS. mordax 2 DS. sp. A 7 DS. sp. A 2 S. magna 1
i In S. magna 2
S. ludovici 1 D S. ludovici 2 DS. oporaphilum 1 BS. oporaphilum 2 DS. hondurensis 1 S. hondurensis 2 DS. nana 1 OS. nana 2 DS. bidens 1 DS. bidens 2 Figures 53. Phylogenetic reconstruction of character 27 (development of saggital crest as viewed on males) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
144
< " O ^l Centurio senex || 5 y^nn Uroderma bilobatum CD 5 — Q. 5T o /y^VjD Vampyressa pusilla en CD CB oo _ — "O 5" o CD / \JD CarolHa spp. 0) i^. ^- D o 3 CD < CD "O CD X1D S. aratathomasi 1 O 2. 0> 3 8 3. O =3 S/sAUS. aratathomasi 2 03 "» CD ^ 2, CO ///-pS. liliuml CO //ssAUS. Iilium39 /ySnuS. lilium 2 / NJDS. lilium 11 \ S~pS. luisi 1 V^vJDS. /i7/'s/2 N^O^nn S. thomasi 1 \X\jD S. thomasi 2 OsNnnS. Mafae 7 ^^\JDS. Wdae2 NJDS. sp. B \ /~pS. erythromos 1 \^^sJD S. erythromos 2 N^nnS. bogotensis 1 \J0S. bogotensis 2 \ S~pS. mordax 1 S/^aJD S. mordax 2 \\Snns. sp. a ? sXNjds. sp. A 2 ^O^nnS. magna 1 nJD S. magna 2 j^]US. ludovici 1 / iUD S. ludovici 2 \\flOS. oporaphilum 1 \\jDS. oporaphilum 2
>|J]/nnS. hondurensis 1 NbbS. hondurensis 2 \ y~]QS. nana 1 \^\jDS. nana 2 \^]DS. bidens 1 XJDS. bidens 2 Figures 54. Phylogenetic reconstruction of character 28 (development of nucal crest) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 146
2 O Centurio senex I Uroderma bilobatum Vampyressa pusilla Carollia spp. DS. aratathomasi 1 D S. aratathomasi 2 DS. liliuml S. Iilium39 S. lilium 2 DS. Iilium114 DS. luisi 1 S. luisi 2
DS. thomasi 1 S. thomasi 2 DS. tildae 1 DS. tildae 2 DS. sp. B DS. erythromos 1 DS. erythromos 2 DS. bogotensis 1 D S. bogotensis 2 US. mordax 1 U S. mordax 2 US. sp. A 1 US. sp. A 2 DS. magna 1 DS. magna 2 D S. ludovici 1 DS. ludovici 2 DS. oporaphilum 1 DS. oporaphilum 2
DS. hondurensis 1 D S. hondurensis 2 US. nana 1 US. nana 2 US. bidens 1 US. bidens 2 Figures 55. Phylogenetic reconstruction of character 29 (relative size of occipital protuberance close to nucal crest) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. t
148
o "O — DO 5 CD O CD O) c 03 o ID Centurio senex CO CD CO oo 03 DJ Uroderma bilobatum CO w E. 0) 3 £ = CD o N Vampyressa pusilla CD CD MmCarollia spp. S. aratathomasi 1 2 8 UUS. aratathomasi 2 CD CD 9. IS. ////umf o Er 0) 5nS. Iilium39 3 — c ////urn o IS 2 0> IlS. Iilium114
uuS. luisi 1 IlS. luisi 2 S. thomasi 1 IlS. thomasi 2 rpS. tildae 1 IlS. f/7dae 2 IlS. sp. B nnS. erythromos 1 JD S. erythromos 2 nnS. bogotensis 1 IS. bogotensis 2 S. mordax 1 UM S. mordax 2 UUS. sp. A 7 IlS sp. A 2 S. magna 1 ll S. magna 2
S. ludovici 1 IlS ludovici 2 nnS oporaphilum 1 JD S. oporaphilum 2 UUS. hondurensis 1 ! S. hondurensis 2 HDS. nana 7 JDS. nana 2 S. bidens 1 UUS. bidens 2 Figures 56. Phylogenetic reconstruction of character 30 ("brakes" on outline of nucal crest) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. L 42
150
5 1 dd 5 o 1 Centurio senex CO bilobatum =3' CO Uroderma o d' = CD Vampyressa pusilla IV) — CO ** — u Carollia spp. d' =3' CD CD OS. aratathomasi 1 CO c 5' S. aratathomasi 2
CD DS. IHiurn 1 DS. Iilium39
S. I Hiurn 2 S. tiiium 11 nS. luisi 1 S. luisi 2
S. thomasi 1 US. thomasi US. tildae 1 US. tildae 2 US. sp. B S. erythromos 1 S. erythromos 2 DS. bogotensis 1 S. bogotensis 2 OS. mordax 1 U S. mordax 2 US. sp. A 1 US. sp. A 2
S. magna 1 S. magna 2 nS. ludovici 1 US. ludovici 2 S. oporaphilum 1 S. oporaphilum 2 OS. hondurensis 1 S. hondurensis 2 DS. nana 1 DS. nana 2 S. bidens 1 US. bidens 2 Figures 57. Phylogenetic reconstruction of character 31 (presence of palatine perforations) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
152
-o u Centurio senex 5 • ^ ^1 -i CD ^«l Uroderma bilobatum o O CD ho Vampyressa pusilla 03 ^^^^1 en CD 5 *< SO CD CD \jD Carollia spp. CO ^y 3 O ^^r S. aratathomasi 1 (/> Xin ^W /aJH S. aratathomasi 2 0) 0) ^7 //mmS. liliuml W ///^\US. Iilium39 CD /V/V]DS' ///,t;/7? 2 \JD S. ////'urn ft y^/^y S - f N\\|j>K yffi" ww ^/S^XNJMlQnS. /u/s/' 2 S. thomasi 1 UMS. thomasi 2 ^ W^IS. f/Vdae 7 ^ \V)DS. Mc/ae2 . ^^^ \JDS. sp. B
(k ^i^_ ^P s - erythromos 1 EW ^^^WlS. erythromos 2 ^^k. ^ a ^- bogotensis 1 EW^EW ^1 S. bogotensis 2 ^^k^^^^ M*S- mordax 1 ^^^^k^WlS- mordax 2 ^i^^^piS. sp. A -/ llS. sp. A 2 ^^ ^kpiS. magna 1 ^^k ^ilS. magna 2 ^^k ^P'S- ludovici 1 CD . ludovici 2 CO ^^^ ^^JOS. S. oporaphilum 1 ^^k ^^^VJD S. oporaphilum 2 ^^k ^%|PB ^- hondurensis 1 ^^^ VJD S. hondurensis 2 ^^^ ^mmS. nana 1 ^fci^WS. nana 2 ^^fllS. bidens 1 llS. bidens 2 Figures 58. Phylogenetic reconstruction of character 32 (relative shape of pm1 compared to pm2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 154
2 3D Centurio senex 2 CD » U Uroderma bilobatum T3I S Vampyressa pusilla nCarollia spp. S. aratathomasi 1 nS. aratathomasi 2 S. liliuml US. Iilium39 US. Iilium2 US. HliumlU S. luisi 1 US. luisi 2 U S. thomasi 1 S. thomasi 2 US. tildae 1 S. tildae 2 US. sp. B S. erythromos 1 D S. erythromos 2 OS. bogotensis 1 D S. bogotensis 2 OS. mordax 1 D S. mordax 2 DS. sp. A 1 DS. sp. A 2 S. magna 1 U S. magna 2 S. ludovici 1 US. ludovici 2 S. oporaphilum 1 S. oporaphilum 2 S. hondurensis 1 U S. hondurensis 2 S. nana 1 US. nana 2 US. bidens 1 U S. bidens 2 Figures 59. Phylogenetic reconstruction of character 33 (relative shape of rostrum in upper and lateral views) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
156
3J UCenturio senex I U Uroderma bilobatum Vampyressa pusilla en U O nCarollia spp. S. aratathomasi 1 q S. aratathomasi 2 S. liliuml S. Iilium39 US. Iilium2
US. 1ilium 11 S. luisi 1 US. luisi 2 U S. thomasi 1 S. thomasi 2 US. tildae 1 US. tildae 2 US. sp. B S. erythromos 1 US. erythromos 2 S. bogotensis 1 S. bogotensis 2 US. mordax 1 U S. mordax 2 DS. sp. A 1 DS. sp. A 2 S. magna 1 S. magna 2
S. ludovici 1 S. ludovici 2
S. oporaphilum 1 U S. oporaphilum 2 S. hondurensis 1 U S. hondurensis 2 S. nana 1 S. nana 2
S. bidens 1 US. bidens 2 Figures 60. Phylogenetic reconstruction of character 34 (relative shape of nasal aperture) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
158
0) DO i Centurio senex 5 n n a CD CD oT U Uroderma bilobatum c^ o i i i i r^- c D Vampyressa pusilla CO CD CD .a (D UCarollia O 0) spp. T3 c 3 3" CD OS. aratathomasi 1 J CO 0) N 0) o O 3" CD D S. aratathomasi 2 CD Q. O US. liliuml 5L US. Iilium39 w US. lilium 2 0) US. lilium 11 US. luisi 1 US. luisi 2 U S. thomasi 1 U S. thomasi 2 US. tildae 1 US. tildae 2 as. sp. b HS. erythromos 1 U S. erythromos 2 DS. bogotensis 1 US. bogotensis 2
DS. mordax 1 D S. mordax 2 US. sp. A 1 US. sp. A 2 DS. magna 1 D S. magna 2 US. ludovici 1 US. ludovici 2 US. oporaphilum 1 US. oporaphilum 2 US. hondurensis 1
ED S. hondurensis 2 US. nana 1 U S. nana 2 DS. bidens 1 DS. bidens 2 (relative shape of upper Figures 61 . Phylogenetic reconstruction of character 35 premolars in lateral view) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 2
160
< "5 3J Centurio senex D Uroderma bilobatum D Vampyressa pusilla CO DCarollia spp. OS. aratathomasi 1 DS. aratathomasi 2
US. IHiurn 1 US. Iilium39 US. Iilium2 US. Iilium114 US. luisi 1 US. luisi 2 DS. thomasi 1 OS. thomasi DS. tildae 1 DS. tildae 2 DS. sp. B DS. erythromos 1 D S. erythromos 2 DS. bogotensis 1 D S. bogotensis 2 DS. mordax 1 D S. mordax 2 DS. sp. A 1 DS. sp. A 2 S. magna 1 U S. magna 2 D S. ludovici 1 DS. ludovici 2 DS. oporaphilum 1 DS. oporaphilum 2 DS. hondurensis 1 DS. hondurensis 2 DS. nana 1 D S. nana 2 DS. bidens 1 DS. bidens 2 Figures 62. Phylogenetic reconstruction of character 36 (relative size of upper premolars) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 162
£ J3 Centurio senex Uroderma bilobatum U Vampyressa pusilla CO DCarollia spp.
DS. aratathomasi 1 DS. aratathomasi 2 US. liliuml US. Iilium39 US. Iilium2 US. liliuml 14 US. luisi 1 US. luisi 2 US. thomasi 1 US. thomasi 2 US. tildae 1 US. tildae 2 OS. sp. B
OS. erythromos 1 D S. erythromos 2 DS. bogotensis 1 OS. bogotensis 2
US. mordax 1 US. mordax 2 US. sp. A 1 US. sp. A 2 US. magna 1 US. magna 2 DS. ludovici 1 DS. ludovici 2 DS. oporaphilum 1 DS. oporaphilum 2 DS. hondurensis 1 D S. hondurensis 2 S. nana 1 S. nana 2 S. bidens 1 S. bidens 2 Figures 63. Phylogenetic reconstruction of character 37 (relative shape of corpus of upper premolars in lateral view) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 164
< "2 2 3J Centurio senex o I D Uroderma bilobatum Ul D Vampyressa pusilla o nCarollia spp.
S. aratathomasi 1 DS. aratathomasi 2 S. liliuml DS. Iilium39
DS. I ilium 2 US. Iilium114 DS. luisi 1 DS. luisi 2 OS. thomasi 1 QS. thomasi 2 US. tildae 1 DS. tildae 2 nS. sp. B DS. erythromos 1 S. erythromos 2 DS. bogotensis 1 OS. bogotensis 2 DS. mordax 1 S. mordax 2 US. sp. A 1 S. sp. A 2 S. magna 1 S. magna 2 DS. ludovici 1 DS. ludovici 2 DS. oporaphilum 1 DS. oporaphilum 2 DS. hondurensis 1 OS. hondurensis 2 DS. nana 1 OS. nana 2 MS. bidens 1 S. bidens 2 Figures 64. Phylogenetic reconstruction of character 38 (relative shape of distal end of upper premolars in lateral view) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 166
a 3 jj JD Centurio senex jD Uroderma bilobatum in Vampyressa pusilla en )nCarollia spp.
JDS. aratathomasi 1 )D S. aratathomasi 2 ||S. liliuml US. Iilium39
||S. //'//urn 2 idS. Iilium114
IIS. /(v/'s/ 7 US. /1//S/2 IIS. thomasi 1 US. thomasi 2 IIS. Wdae y IIS. Wdae2 llS. sp. B
IDS. erythromos 1 IDS. erythromos 2 IDS. bogotensis 1 IDS. bogotensis 2
S. mordax 1 S. mordax 2 IIS. sp. A) US. sp. A 2
DS. magna 1 D S. magna 2 US. ludovici 1 US. ludovici 2
US. oporaphilum 1 I S. oporaphilum 2 DS. hondurensis 1 DS. hondurensis 2 DS. nana 1 DS. nana 2 US. bidens 1 US. bidens 2
i Figures 65. Phylogenetic reconstruction of character 39 (relative shape of M1 in ventral view) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 168
JMM Centurio senex 1 ^flb> Uroderma bilobatum Vampyressa pusilla ~ to J^^m* 0) CO ^^UCarollia spp. "o £ Y CD ^ ^fll S. aratathomasi 1 N = O » ^^kuS. aratathomasi 2
CD ^T/~pS. ////u/nf ^/yJnS. Iilium39 yfjj^MiS. ////um 2 lr ^BiS. Iilium114 jK vTPS- /w/s/f )WUS. luisi 2 \f~\0S. thomasi 1 ^vStaS. thomasi2 \\^1DS. tildae 1 \\JDS. tildae 2 NJDS. sp. B \ SIRS, erythromos 1 y^s^mUS. erythromos 2 \^nnS. bogotensis 1 ^S. bogotensis 2 \ y~PS. mordax 1 \^S*JnS. mordax 2
\N^MS. sp. A ) \\^1S. sp. A 2 N^IDS. magna 1 NJDS. magna 2
^mms. ludovici 1 ^MlS. ludovici 2
"N^bfllS. oporaphilum 1 \\^nS. oporaphilum 2 \^1DS. hondurensis 1 \jDS. hondurensis 2 ^ ^M*S. nana 1 ^^MlS naA7d 2 ^fcfllS. bidens 1 ^kuS. bidens 2 Figures 66. Phylogenetic reconstruction of character 40 (relative shape of M2 compared to M1) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
170
Centurio senex D Uroderma bilobatum D Vampyressa pusilla D Carollia spp. DS. aratathomasi 1 DS. aratathomasi 2 DS. liliuml US. Iilium39 DS. Hiurn 2 OS. Mum 11 US. luisi 1 DS.Iuisi2
S. thomasi 1 D S. thomasi 2 DS. tildae 1 DS. tildae 2 DS. sp. B
DS. erythromos 1 DS. erythromos 2
DS. bogotensis 1 D S. bogotensis 2 IS. mordax 1 IS. mordax 2 IS. sp. A 1 IS. sp. A 2
IS magna 1 IS. magna 2
IS. ludovici 1 IS. ludovici 2
IS. oporaphilum 1 IS. oporaphilum 2 DS. hondurensis 1 D S. hondurensis 2 US. nana 1 US. nana 2
US. bidens 1 US. bidens 2 Figures 67. Phylogenetic reconstruction of character 41 (relative size of M2 compared to M1) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. i 4
172
s ^ 3J D Centurio senex -»• N> CD O 0) D Uroderma bilobatum o ID o b < D Vampyressa pusilla 5" 3 CD — §H Carollia o V> spp. CQ SB g -^ CD = n' S. aratathomasi 1 CD CD Q. O nS. aratathomasi 2 qS. liliuml DS. Iilium39
OS. I Hiurn 2
DS. liHum 11 OS. luisi 1 DS. luisi 2 D S. thomasi 1 DS. thomasi 2 DS. tildae 1 DS. tildae 2 DS. sp. B DS. erythromos 1 D S. erythromos 2 US. bogotensis 1 DS. bogotensis 2 DS. mordax 1 D S. mordax 2 OS. sp. A 1 DS. sp. A 2 S. magna 1 nS. magna 2 D S. ludovici 1 D S. ludovici 2 DS. oporaphilum 1 OS. oporaphilum 2 OS. hondurensis 1 D S. hondurensis 2 OS. nana 1 S. nana 2
nS. bidens 1 OS. bidens 2 Figures 68. Phylogenetic reconstruction of character 42 (development of occipital crest) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 2
174
Centurio senex Uroderma bilobatum Vampyressa pusilla Carollia spp.
DS. aratathomasi 1 D S. aratathomasi 2
S. IHiurn 1 S. Iilium39 S. lilium 2 S.liliumlU S. luisi 1 S. luisi 2
S. thomasi 1 S. thomasi 2 S. tildae 1 S. tildae 2 DS. sp. B
MS. erythromos 1 S. erythromos 2 US. bogotensis 1 D S. bogotensis 2 US. mordax 1 S. mordax 2 S. sp. A 1 US. sp. A 2 S. magna 1 US. magna 2
US. ludovici 1 US. ludovici US. oporaphilum 1 US. oporaphilum 2 US. hondurensis 1 U S. hondurensis 2 US. nana 1 US. nana 2
US. bidens 1 US. bidens 2 Figures 69. Phylogenetic reconstruction of character 43 (development of metaconid on m2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 176
3 D ID Centurio senex o ID Uroderma bilobatum CO ID Vampyressa pusilla OCarollia spp.
IDS. aratathomasi 1 IDS. aratathomasi 2 IDS. liliuml DS. Iilium39 IDS. Wium 2 IDS. HliumlU DS. luisi 1 DS. luisi 2 S. thomasi 1 DS. thomasi 2 DS. tildae 1 OS. tildae 2 DS. sp. B
S. erythromos 1 S. erythromos 2
US. bogotensis 1 S. bogotensis 2 US. mordax 1 US. mordax 2 US. sp. A 1 US. sp. A 2 US. magna 1 US. magna 2 US. ludovici 1 US. ludovici 2
US. oporaphilum 1 US. oporaphilum 2
US. hondurensis 1 U S. hondurensis 2 US. nana 1 US. nana 2 US. bidens 1 US. bidens 2 Figures 70. Phylogenetic reconstruction of character 44 (development of entoconid on m2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 4
178
CD O )D Centurio senex o I )D Uroderma bilobatum )D Vampyressa pusilla )oCarollia spp. ] S. aratathomasi 1 klS. aratathomasi 2 JDS. Miurn 1 inS. Iilium39 JDS. lilium 2 fas. lilium 11 JDS. /y/s/ 1 )DS.Iuisi2 JD S. thomasi 1 )D S. thomasi 2 IDS. tf/tfae f IDS. Wdae 2 llS. sp. B IIS. erythromos 1 US. erythromos 2 US. bogotensis 1 II S. bogotensis 2 IDS mordax 1 S. mordax 2 IDS. sp. A f IDS. sp. A 2 IDS. magna 1 DS. magna 2
S ludovici 1 S. ludovici 2
US. oporaphilum 1 MS. oporaphilum 2
MS. hondurensis 1 DS hondurensis 2 MS. nana 1 MS. nana 2 MS. bidens 1 MS. bidens 2 Figures 71 . Phylogenetic reconstruction of character 45 (relative separation between metaconid and entoconid on m2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 180
go 3 3 3 1 n ro p 1 u etac elati' JD Centurio senex CD =J O ID Uroderma bilobatum CJ1 §5 -O O CD co Vampyressa pusilla 03 Cl JD T3 CD % ^> fl) "O )OCarollia spp. "8 CD 3 0) £ Z3 t-^ ^HJ JDS. aratathomasi 1 — 0) CD =?-. r-4- )D S. aratathomasi 2 13 O o' ^ D O7f JDS. liliuml O CD SnS. Iilium39 13 --f id JDS. ////'urn 2 ween )DS. liliuml 14 on JDS. /u/'s/ 7 ins. fcds/2 JDS. thomasi 1 IDS. thomasi 2 JDS. tildae 1 IIS. tildae 2 Ids. sp. B JDS. erythromos 1 lis. erythromos 2 JDS. bogotensis 1 IIS. bogotensis 2 IIS. mordax 1 US mordax 2 IIS. sp. A 1 IDS. sp. A 2 IIS magna 1 IIS. magna 2 I S. ludovici 1 US. ludovici 2
IIS. oporaphilum 1 IS oporaphilum 2
IS. hondurensis 1 s. hondurensis 2 DS. nana 1 IS. nana 2 S bidens 1 S. bidens 2 Figures 72. Phylogenetic reconstruction of character 46 (presence of divided cusps on metaconid on m2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 182
|l Centurio senex II Uroderma bilobatum ll Vampyressa pusilla II Carol'Ha spp. lis aratathomasi 1 lis. aratathomasi 2 IDS. liliuml US. Iilium39 ||S. Mum 2 lis. Iilium114
JDS. /u/'s/ 7 )DS. Iuisi2 II S thomasi 1 lis thomasi 2 JDS tildae 1 US. tildae 2 lis sp. B IIS erythromos 1 US erythromos 2 IIS. bogotensis 1 US. bogotensis 2 S. mordax 1 US mordax 2 IIS. sp. A 1 IIS. sp. A 2 IIS. magna 1 IIS. magna 2 I S. ludovici 1 US. ludovici 2
US. oporaphilum 1 IS. oporaphilum 2 S hondurensis 1 ns. hondurensis 2 IS. nana 1 IS nana 2 S bidens 1 US. bidens 2 Figures 73. Phylogenetic reconstruction of character 47 (presence of divided cusps on entoconid on m2) on the single most parsimonious tree, which numerical values, abbreviations, and symbols are as indicated in figure 27. 184
Centurio senex U Uroderma bilobatum U Vampyressa pusilla UCarollia spp. US. aratathomasi 1 US. aratathomasi 2 OS. liliuml US. Iilium39 US. Iilium2 US. liliuml 14 US. luisi 1 US. luisi 2 U S. thomasi 1 D S. thomasi 2 US. tildae 1 US. tildae 2 US. sp. B US. erythromos 1 U S. erythromos 2 US. bogotensis 1 U S. bogotensis 2 US. mordax 1 U S. mordax 2 US. sp. A 1 US. sp. A 2 US. magna 1 U S. magna 2 US. ludovici 1 US. ludovici 2 US. oporaphilum 1 US. oporaphilum 2 US. hondurensis 1 U S. hondurensis 2 US. nana 1 US. nana 2 US. bidens 1 US. bidens 2 CHAPTER 4 DISCUSSION
The major purpose of this study is to establish the phylogenetic relationships among taxa of the genus Sturnira and to circunscribe and identify
all species that belong to this genus. For these purposes, it is necessary to define the concept of species used in this context. Historically this is a reproductively isolated set of populations (Mayr and Ashlock 1991). Adding the genetic perspective, a species could be defined as a group of individuals with few or no intermediaries between other such groups, that form identifiable genetic clusters with a strong correlation between multiple loci that are divergent between clusters, and with breaks in the distribution of haplotype clades across
clusters. This definition is equivalent to the genotypic cluster species concept of
Mallet (1995) and is very similar to both, the definition of evolutionary significant units suggested by Moritz (1994), and the concept of genealogical species of
Baum and Shaw (1995). A mitochondrial gene and a morphological data matrix
are not sufficient to fully define a species cluster. However, if any gene is a partial estimate of the phylogeny of the species (Maddison 1996), then one can
propose that the gene trees found with mtDNA do represent gene clusters, and if
we define these gene clusters as species then it would be valid to assume that the reconstruction of the phylogeny of Sturnira based on mtDNA and morphology could provide an approach to the real genetic history of the group.
185 186
A final tree, the one shown in Figure 74 summarizes the most current
phylogenetic hypothesis of the genus Sturnira and the changes proposed in this
work. Main clades can be divided based on the listed autapomorphies (after
Koopman, 1994). This tree is plotted on a bootstrap diagram (see Material and
Methods for construction protocols, with bootstrap values after successively
weighted parsimony) and depict a conservative view of the phylogenetic
relationships among the sampled taxa and reveals the identity of well established
species within the genus Sturnira. I never expected to be able to resolve the
entire evolutionary history of Sturnira with the cytochrome b gene. It was already
clear six years ago that no single gene can be assumed to resolve all
phylogenetic issues, and cytochrome b is not an exception (Meyer 1994a,
1994b). However, it has been suggested by several researchers (Chase et al.
1995; Soltis and Soltis 1998) that combining data sets may provide a better
supported hypothesis than any of the resulting trees searched from individual
data sets. In short, "the more the better" (Soltis, personal communication).
Since particular characteristics used to reconstruct a phylogeny can be
difficult to detect when only one type of data is available (Graham and Barrett
1995), adding more data from different sources reinforces our confidence in
reconstructing the evolutionary history of organisms. It may even function in
some cases to highlight deficiencies in the capacity of certain classes of data to
permit the accurate reconstruction of historical events.
In this study, morphological data was neither congruent nor incongruent
with molecular data; it was simply inconclusive due to a high degree of homoplasy. One would have tended to refrain from performing a combined 187 analysis; however Chase et al. (1995) suggested otherwise. At first, trees produced by two independent data sets may be judged to be highly incongruent and that indicates that these data sets are apparently not suitable candidates for direct combination into one analysis. The authors called this " a prime example of molecules versus morphology" (Chase et al. 1995: 691). They suggest that one perform the combined analysis since "a matrix can contain more than one signal and that a minority signal in one matrix can agree with and be enhanced by combination with another independent data set" (Chase et al. 1995: 691). In other words, a simple examination of tree topologies may not provide sufficient information to determine that two or more data sets should not to be combined, since certain overshadowed "signals" could be uncovered only when data sets are combined (Chase et al. 1995).
I combined two data sets to obtain what I consider a unique, most parsimonious tree that summarizes my contribution to this field. Figure 74 summarizes this contribution in the most conservative way possible. This tree only serves the purpose of showing the highly supported clades, which were resolved through this analysis. On the tree in Figure 74 the phylogenetic relationship of such taxa as S. tildae, S. sp. B, or S. magna is not clear. For comparative purposes (comparison between Figures 1, 2, and 3) Figure 74 serves to explain the robust advances in our understanding of the evolutionary history of the genus Sturnira.
Owen (1987) suggested that there were enough reasons to support the separation of two subgenera (Sturnira and Corvira) within Sturnira and he also perceived the existence of two major clades within the subgenus Sturnira (Figure 188
feature related to the 1 ). He characterized the difference by synapomorphic degree of lingual cusps development on the lower first molars. Unfortunately, his
second clade is constituted by everything else, a mismatch of taxa with no
resolved relationships. Nevertheless, his was the first attempt to put together the
elements that could guide us toward a better understanding of the evolutionary
history of this group. Pacheco and Patterson (1991) published a seminal work in
which they confronted the phylogenetic problem of Sturnira "directly to its eyes".
Unfortunately, their inadequate sample size limited their conclusions to a sketchy
phylogenetic hypothesis (Figure 2) in which they add, nonetheless, several
important contributions. They continued to develop what Gardner and O'Neil
(1969) and Owen (1987) suggested as two well substantiated subgenera within
Sturnira. They highlighted that S. erythromos and S. magna belong to the same
clade, that within that same clade, S. erythromos is closely related to S.
bogotensis (recognizing this taxon name), and that S. oporaphilum is closely
related to S. ludovici (using S. ludovici specimens from Colombia, Ecuador, and
Venezuela). In addition, they suggested that S. lilium, S. luisi, and S. thomasi
belong in a different clade and are closely related to S. tildae, without being able
to specify S. tildae's position within that second clade.
Their contribution is enormous, but surprisingly enough, a few years later,
when Koopman produced two systematic summaries (1993, 1994), he simply
chose to ignore their advances. Koopman's ideas are summarized in Figure 3,
where the main synapomorphies accompany each of the major nodes. Koopman
never recognized S. bogotensis as a species, neither did he separate S. ludovici
from S. hondurensis, although to be fair in this case, he suggested three 189 subspecies of S. ludovici, based on differences in distribution, but without stressing any morphologically unique features of each taxon.
Based on this previous work, I decided to resolve the phylogenetic
relationships of the group with morphological and molecular data sets. I add several contributions to the resolution and understanding of this "diverse and
perplexing genus" (Pacheco and Patterson 1991: 102) and I elaborate on each of them in the following section.
The Corvira Complex
Corvira was first describe as a new genus by Thomas (1915) and the type
by original designation was C. bidens. This author pointed at the external
resemblance of C. bidens and S. lilium, yet stressed the series of differences in cranial and dental features. In fact, based on teeth morphology, Thomas
suggested that perhaps Corvira is a less specialized group than Sturnira
(Thomas 1915). However, Hershkovitz (1958) and de la Torre (1961) included
C. bidens in the genus Sturnira with no subgeneric division. By 1969 Gardner
and O'Neill preferred to retain Corvira as a subgenus in Sturnira, basically to
"emphasize the uniqueness of S. bidens" (Gardner and O'Neill 1969: 1).
S. nana was always a well defined, valid species, represented in
museums by a few specimens from Peru. No fresh tissue was ever available from this taxon and this project is the first in which molecular data from S. nana are included in a systematic study. Although no surprising results emerge from this new data set, the position of S. nana and its phylogenetic relationships with the rest of the group is confirmed. 190
Many authors (Davis 1980; Gardner and O'Neil 1969; 1971; Jones and
Carter 1976; Koopman 1994; Molinari and Soriano 1987; Nowak and Paradiso
1983; Owen 1987; Pacheco and Patterson 1991) recognize the existence of the
subgenus Corvira as such and its relationship with the subgenus Sturnira (see
Figures 1, 2, and 3). My results, summarized in Figure 74 confirm that S. nana and S. bidens should be assigned to the subgenus Corvira, an hypothesized sister clade of Sturnira.
The Ludovici Complex
Regardless of the analysis type used (molecular data with 133 specimens or smaller morphological data sets) the three component species of this complex always emerge as well defined and as part of a highly supported clade (Figures
7, 9, 18, 21 and 26). When Anthony (1924) described Sturnira ludovici he based his definition of this new taxon not just on what was the most common descriptive features at that moment (hair color differences), but also used shape of the
toothrows and "detailed differences in the dentition" (Anthony 1 924: 9) to compare S. ludovici and S. lilium from several countries in South America.
Shamel (1927) described a new subspecies of S. lilium, named S. /. bogotensis from the highlands of Colombia, based on an adult female (holotype: USNM
251989) similar to the three "topotypes" (USNM 251986, 251987 and 251988), skin and skull, collected at Estacion La Uribe, Bogota, Colombia. The type
specimen is missing the left occipital condyle, it is an old individual (very heavy tooth wear pattern), and its left zygomatic arch is incomplete. 191
Goodwin (1938, 1940) described a new genus and species, Sturnirops mordax, from an adult male from the Atlantic lower slopes of Costa Rica and a new species, Sturnira hondurensis from the western side of Honduras. The author stressed the point that this new species "approaches" (Goodwin 1940: 2)
S. ludovici from Ecuador but in no way may be it considered the same taxon. He reiterated the same information in 1942 and 1946 (Goodwin 1942, 1946) extending the range of S. hondurensis to Puntarenas, Costa Rica, and mentioned that the Costa Rican specimens "are smaller than any in the type series of S. hondurensis" (Goodwin 1946: 318).
It was not until 1949 that Hershkovitz, disregarding the opinion of the previously mentioned three authors, lumped Sturnira lilium bogotensis, Sturnira hondurensis (with its probable two subspecies as suggested by Goodwin (1946)),
Sturnirops mordax, and Sturnira ludovici into one taxon (Sturnira ludovici), without further justification. This action obscured several good species and a complex of species-subspecies under the name of another (already well defined) valid species (Sturnira ludovici), whose morphological features and geographical
distribution were enough to maintain it separate from this group.
Sturnira (Sturnirops) mordax was taken out of this group after Cabrera
(1958) merged Sturnirops into Sturnira (with little explanation) and later Davis et al. (1964) clarified its taxonomic status justifying both that Sturnirops is not a valid genus and that Sturnira mordax is a well-differentiated species of Sturnira
(Davis et al.1964: 381-382). My analysis concurs with Davis et al. (1964).
Numerous authors followed Hershkovitz's (1949) lumping actions with regard to
S. ludovici (Baker and Greer 1962; Carter and Jones 1978; Dalquest 1953; de la 192
Torre 1952; Goodwin 1953; Jones and Owen 1986; Jones et al. 1988; Lukens and Davis 1957; Rami'rez-Pulido et al. 1996; Starrett and de la Torre 1964), while others suggested merging S. ludovici into or regarding as synonyms of S.
oporaphilum, S. bogotensis, S. hondurensis, and/or S. erythromos (de la Torre
1961; Jones and Carter 1978; Koopman 1978; 1993; Myers and Wetzel 1983).
Contrary to the main stream of thought, such authors as Anderson et al.
(1982) and Pacheco et al. (1995) made an effort to resolve some of the confusion concerning the taxonomy of the bats in western South America. In addition, certain authors with vast experience with the group suggested that S.
ludovici is "an Andean endemic" (McCarthy et al. 1993: 218) or, in other words,
that it is "restricted to northern South America" (Timm et al. 1989: 76). They added that S. ludovici represented a composite species (Timm et al. 1989; Timm and Laval 1998), and that the Central American bats under the name S. ludovici may prove to be distinct species for which the name S. hondurensis would be available (McCarthy et al. 1993; Timm and Laval 1998). My data confirms the latter claims, which are summarized in Figure 75.
Sturnira sp. A forms another relatively well supported clade with S. mordax. This clade could be characterized by a series of autapomorphies that may summarize a derived condition within the genus Sturnira. This may help explain the difference some authors have suggested concerning S. mordax, which at that time seemed enough justification to propose the creation of a new genus (Goodwin 1938).
Thanks to the advent of molecular tools in systematics my results indicate new relationships among S. ludovici (sensu stricto) and its allied species. All 193
individuals of S. ludovici from Ecuador form a well defined, highly supported
sister clade to the one formed by all individuals of S. oporaphilum from Bolivia
and Peru (no tissue samples from individuals from NW Argentina were available
at this time, but I anticipate those haplotypes to be part of the same oporaphilum
clade). The evidence indicates that both are valid species, based on
morphological and molecular characters, and that they are closely related to
each other. However, more samples will be needed to define the geographic
distribution of each species. On the other hand, a moderately resolved clade
formed by all individuals from east and northeast of Guatemala, west and central
Honduras, and one record from Montecristo National Park (north of El Salvador)
seems to be the highly supported sister group of a well defined and also highly
supported clade consisting of individuals from central and south Guatemala,
northern El Salvador, and western Honduras. These two sister clades, in turn
are a sister group to a very well supported clade consisting of individuals from
Panama and Costa Rica, which happens to be the southernmost limit of the
described S. hondurensis (Goodwin 1946). This clade may well be another
undescribed species or subspecies as noted by Goodwin (1946).
The two sister clades (from Costa Rica-Panama and Guatemala-El
Salvador-Honduras) show bootstrap and decay values comparable with any of
the well defined, valid species of the genus Sturnira. I recommend resurrecting
the original name of Sturnira hondurensis for what was considered recently (from
1949 and on) the northern portion of S. ludovici (Panama northward to Mexico).
In addition, I further suggest that S. hondurensis may comprise two or perhaps
three distinct species and/or subspecies. Intensive sampling on the political 194 boundary between El Salvador, Honduras, and Guatemala first and later extending this intensive sampling into Mexico, Nicaragua, Costa Rica, and
Panama may provide us with the information necessary to unveil this enigmatic group within the genus Sturnira.
The Luisi Complex
For the lack of a better name, I called it the Luisi complex, but in reality it
is not constituted just by individuals of S. luisi. Several individuals of what are considered today as S. lilium belong also to this complex of species and/or subspecies as well individuals of S. thomasi. Figures 76 and 77 display a detailed, although incomplete, picture of a tentative phylogenetic hypothesis and
distributional records, in which every specimen available for this analysis is shown. The entire clade is well supported by a high (92%) bootstrap value and
form a large polytomy. Within this polytomy, from a total of 1 1 branches only two show a bootstrap support equal or higher than 90%. Those two branches
correspond to two independent groups of Sturnira composed of all insular species (or subspecies) from the Lesser Antilles (Figure 77). One clade displays two internal branches, one for a specimen from Montserrat {Sturnira thomasi vulcanensis, after Pedersen et al. 1996 and Genoways 1998), sister to the other branch composed of two specimens of S. thomasi from Guadeloupe, one
specimen of Sturnira lilium angeli (from Dominica) and one of S. /. zygomaticus
(from Martinique). The other well supported branch presents S. lilium serotinus
(from Grenada) sister taxon of S. /. paulsoni (from St. Vincent). 195
Morphologically, they all seem derived from a common ancestral stock, a
"lilium-luisi-Wke" species, which probably colonized or moved across the area in different temporal events or "waves" into the islands of the Lesser Antilles, the
Panamanian Isthmus, and the Guianas. These two highly supported branches
seem to be the result of an incomplete data set revealing a subtle pattern that
may only be demonstrated by addition of more samples and the sequences of
more genes. It may be suggested, however, that one of the insular groups (from
Grenada and St. Vincent), not being part of the other insular specimens,
represents the evidence of a separate "wave" of colonization into the Lesser
Antilles from a continental stock. To elaborate further, I suggest (following
Jones and Phillips 1970, 1976; Koopman 1968) that all insular species and
subspecies are derived from individuals of "S. luisi sensu lato" from the
northeastern tip of continental South America. The further the islands are from
the point of entry (assumed to be Trinidad and Tobago), the more derived the
species are and probably the longest they have been isolated from the original
stock and more likely to be different species (see also Baker and Genoways
1978; Baker et al. 1984; Genoways and Jones 1975; Jones and Phillips 1970).
The two subspecies that form the group from Grenada and St. Vincent may
represent more recent departures from the continental stock and morphological
features that separate them from the "ancestral" S. lilium-luisi-Wke species are not
so obvious as to be detected or quantified yet (see Jones and Phillips 1976)
using traditional morphology.
The next clade of interest is the one formed by all individuals of S. luisi
from Panama and Ecuador (Figure 77) and "Sturnira cf. luisi' from Panama, 196
Costa Rica, and Guyana (this last one group of individuals corresponding to the
Panama-Guyana clade of Ditchfield (1996)). More samples from Venezuela and
extensive samples from Colombia may help define the identity and limits of this
taxon (Figure 77). Davis (1980) described S. luisi based on one holotype from
Costa Rica and several more paratypes (four from Costa Rica, five from
Ecuador, and four from Peru). Neither the morphological characteristics
(autapomorphies?) offered to separate S. luisi from the rest, nor the features in
his key to species seems to hold up when studying a large series. Considering
the variation within S. lilium (sensu lato) and the so called S. luisi (sensu stricto),
particularly between females and males, one can easily find individuals of S.
lilium with long rostrum (usually on males) and straight zygomatic arches all with
different degrees of development on the metaconid of the first lower molars.
Within S. luisi, looking at a large series of individuals from the same locality,
morphological features seem to be as variable for S. luisi as they are among
large series of individuals from the same locality of S. lilium (see also Davis 1980;
de la Torre 1 961 ; Jones et al. 1 988).
The rest of the individuals included in Figure 76 (originally identified as S.
lilium) are all considered here S. luisi sensu lato, are all part of unresolved
populations, and could be recognized as "geographical races" (Figure 77).
Additional study may clarify relationships within this clade and eventually S. luisi could be broken into several more narrowly delimited entities. 197
The Lilium Complex
From the creation of the genus Sturnira (Gray 1842), S. spectrum (=lilium) typifies the genus. The type specimen from Asuncion, Paraguay, was described
by Geoffroy Saint-Hilaire (1810) as a Phyllostoma lilium and Gervais (1855) used the combined name of Sturnira lilium for the first time. Based on morphological features, almost every author has consistently agreed that the middle American
subspecies is S. /. parvidens and that the South American subspecies is S. /.
lilium (Baker and Genoways 1978; Brosset and Dubost 1967; Jones et al. 1988;
Koopman 1994; Pirlot and Leon 1965; Pirlot 1967, 1968).
Figures 78 and 79 summarize my results regarding this group and based
on those results I suggest that all individuals of this species from Brazil,
Paraguay, and Bolivia be considered S. lilium. Specimens from Paraguay,
Bolivia, and southeastern Brazil constitute a well defined and highly supported
clade separate from the rest of the Sturnira specimens (see also Ditchfield 1996).
The rest of the previously called "S. lilium" group included a lineage with 13
specimens ranging from southern Costa Rica north to Mexico and form a clade
with high support values. This clade should be called Sturnira parvidens.
Goldman (1917) recognized some size differences (narrow skull and molariform
teeth) between the Paraguayan and the Mexican forms and suggested
separating these individuals (the northern race, Goldman 1917: 116) into a new
subspecies within S. lilium. Using mitochondrial DNA sequences, Ditchfield
(1996) explained that S. lilium presents great phylogeographic structure and that
most likely it is a composite species. He further announced that three well
defined clades exist among what we understand today as S. lilium, the Mexican 198 clade, the Guiana-Panamanian clade, and the Brazilian clade with strong regional structuring. "The suggested regional variation at the mitochondrial level does not seem to correspond to currently recognized subspecies boundaries"
(Ditchfield 1996: 70-71).
The southernmost limit of S. parvidens has been suggested by various authors to be Panama (Goldman 1920; Goodwin 1942), north of South America,
but no specification ( Villa-Ramirez 1967), and even Colombia (Felten 1956;
Tamsitt and Valdivieso 1963a [they inadvertently made a typographical error and
called it Sturnira parvidens lilium]; 1963b; Valdivieso 1964). Support (bootstrap percentages and decay values) of those two clades (S. lilium and S. parvidens) is similar to the support of other clades of well defined and valid species within the genus.
The Entire "Well Defined Lingual Cusps" Group
This group is the one formed by all species having well defined lingual cusps on the lower molar teeth and by the presence of vertical notches (modified after Koopman 1994). This morphological autapomorphy unites S. lilium, S. parvidens, S. luisi sensu lato, S. tildae, and S. aratathomasi. All five, already well-defined species are continental with the exception of S. thomasi (a subclade of S. luisi), which is an endemic of Montserrat and Guadeloupe (Baker and
Genoways 1978; Baker et al. 1984; Genoways 1998; Genoways and Jones
1975; Jones and Phillips 1970, 1976; Pedersen et al. 1996) and S. tildae, which has been collected from Trinidad and Tobago (Carter et al. 1981 ; de la Torre
1959; Goodwin and Greenhall 1961; 1964). Regardless of the difference in size 199
(S. aratathomasi is the largest species in the genus) this shared feature may indicate common ancestry (Figure 33, 35, 69, and to a lesser degree Figure 70), which may be related to resource use or perhaps the way they manipulate their food. Most of the species in this clade also have been collected mainly from the lowlands, as opposed to the other clade, with vestigial or no vertical notches defining the lingual cusps on the lower molars, that is composed of mainly mid- to
high-elevation species.
The Remaining Species
Four of the other five branches include eight different species (Figure 74).
They all share vestigial or no vertical notches defining lingual cusps on the lower
molars, and most of them (with few exception) inhabit mid- to high-elevation
ranges. The three species forming the ludovici complex were discussed above.
There is also as a part of this polytomy a large species member, S. magna. Its
presence in this group points at the fact that the "large species" of Sturnira (S.
aratathomasi and S. magna) represent two different branches (or events) in the
evolutionary history of this group.
Sturnira mordaxaud S. sp. A, two well defined, valid species, constitute a
moderately supported clade that probably comprises the most highly derived group of species. Morphologically, they both share a series of features that not only make them different from congeneric species but also reveal certain characteristics that we may use to identify in other groups as highly derived forms. An elongated rostrum seems to be a "landmark" feature that could be pointing at other derived characters among species of Sturnira. This feature has 200
probably emerged two times during the evolutionary history of Sturnira. Once
within this clade (S. sp. A and S. mordax) and once within the Luisi complex (S.
thomasi). The three species that display the relatively longest rostrum seem to
have in common a distribution in the foothills of mountainous areas and are
generally isolated or non-sympatric with other congeneric species. Sturnira sp. A
is from mid-elevation in the foothills of Cordillera Toisan in Ecuador (McCarthy
personal communication), S. mordax from mid-elevation on the slopes of hilly
areas in Costa Rica and Panama, and to a lesser degree S. thomasi (a member
of the Luisi complex) from the foothills of the islands of Guadeloupe and
Montserrat (Lesser Antilles).
Another "mountain" group is the one that comprises S. erythromos and S.
bogotensis. S. erythromos has been recognized as a species since Tschudi
(1844). Koopman (1993, 1994) recognized it as part of this clade (Figure 3), but
no phylogenetic relationship has been proposed. Unfortunately, that is not the
case for the other species, S. bogotensis. Shamel (1927) describe it as a
subspecies of S. lilium. From there is was regarded by several authors (de la
Torre 1961; Jones and Carter 1976; Koopman 1978, 1993; Myers and Wetzel
1983) as part of a unclear group made up of S. oporaphilum, S. bogotensis, S.
hondurensis, S. erythromos, and/or S. ludovici. Eventually Pacheco and
Patterson (1991) concluded that S. bogotensis-S. erythromos could be considered a sister pair (Figure 2). As mentioned before, Koopman (1993, 1994) suggested the correct name for all individuals of S. bogotensis and S. oporaphilum was S. oporaphilum, assigning a subspecific category to S.
oporaphilum bogotensis (Figure 3). Based on my results I can confidently 201
propose the use of S. bogotensis to recognize at least all individuals from
Colombia and Peru (see above for previous synonyms).
Pairwise Distances
Percentage of sequence divergence (Table 2) shows that the two species
of the subgenus Corvira fall within the range of other putative species. Within the
taxa in the group formed by species with "well defined lingual cusps" S. tildae
showed the highest values of sequence divergence, suggesting that may be the
sister species of all others from this group. Following in decreasing numerical
order are S. aratathomasi, S. parvidens, and S. lilium, a group of species (and
subspecies) composed of S. thomasi, S. luisi, S. lilium serotinus, and three more
taxa. The low mean sequence divergence-values, which range between 4.5%
and 3.7% (see Figures 76 and 77) of the latter group implies a close phylogenetic
relationship among their members.
The group of species with "vestigial or absence of vertical notches that
defined lingual cusps" (Figure 74) presents higher values of sequence
divergence (compare with the previous group) with no mean percentage
sequence divergence-values below 6.5%. This may indicate that speciation
events in most of the species in this group occurred prior to those in the group of
species and subspecies with "well defined lingual cusps".
The Whole Picture: The Genus Sturnira
Although Figure 26 summarizes several important results of this work that will contribute towards a better understanding of the phylogeny of the genus 202
Sturnira, in reality Figure 74 is the one that displays what we should consider the most current phylogenetic hypothesis of this genus and the changes proposed.
In it are listed some of the autapomorphies that could assist in separating the different clades (subgenus and species) after Koopman (1994) and the contributions to our knowledge towards the evolutionary history as well as the
systematic position of all known species of Sturnira.
1 - Sturnira aratathomasi, S. lilium (sensu lato), S. parvidens, and S. luisi
(sensu lato), all constitute a clade of close related species and
subspecies. Additional sampling and careful molecular analyses
are needed to evaluate monophyly of the group, specific
boundaries within S. lilium, S. parvidens and the allied taxa
("Sturnira luisi' complex), and the permanent placement of S. tildae.
All the "lilium-luisi'-Wke bats should be refered as to S. luisi sensu
lato and treat S. thomasi and S. lilium serotinus-paulsoni as
geographical races or insular subclades within S. luisi.
2- S. parvidens has the status of a valid species and should be regarded a
such. It is the sister taxon to S. lilium and this relationship is highly
supported by bootstrap percentage and decay values.
3- S. bogotensis is also a valid species and should be regarded as such.
It forms a tight and well resolved clade with S. erythromos.
4- The highly derived S. mordax forms a moderately supported clade with
S. sp. A, another highly derived taxon. 203
5- S. ludovici should only refer to specimens from Ecuador (the specific
boundaries shall be defined soon). It constitutes a well defined,
highly supported clade with S. oporaphilum.
6- S. hondurensis should be considered a valid species. It is represented
by all Central American specimens, although the specific and
subspecific boundaries shall be defined soon, since this may be a
case of a group of cryptic species. It is a sister taxon to the S.
oporaphilum-S. ludovici clade and this phylogenetic relationship is
highly supported.
7- The subgenus Corvira is distinct from subgenus Sturnira and should be
recognized as such. Both species that comprise this subgenus
have numerous autapomorphies that separate them from the rest of
Sturnira species. The molecular and morphological data confirm
this distinctiveness.
Final Remarks
As systematists (molecular and/or morphological) depend more and more on museum collections and zoological parks as sources of material for analysis, the need for appropriate voucher specimens and information is greater with each passing day. In trying to reconstruct the phylogeny of mammals or discern the evolutionary pattern of certain species, we systematists (particularly molecular ones) have been often irresponsible about thoroughly documenting the sources of material used in a study or providing specimens to serve as permanent records of the animals included in the study. As noted and pointed out previously 204
(Chase et al. 1993; Steppan and Sullivan 2000), misidentified material may become apparent because of unexpected placement in phylogenetic trees;
however if errors go undetected and worse, without appropriate vouchering, the true identity of a misidentified specimen cannot be determined. When errors are not corrected, they may be translated in perpetuity by other investigators, who may arrive at false conclusions by using data from misidentified specimens
(Mares and Braun 2000). It is essential that all workers responsibly voucher their
specimens, and all such journals as the Journal of Mammalogy and Acta
Chiropterologica must require citation of voucher information as a condition for
publication and all sequences should be accessioned in a major repository (i.e.,
GenBank) and be available to the reader by the time the research is published
(Soltis and Soltis 1998).
The real importance of DNA patterns is not just in clarifying specific or
generic limits, but rather it is in providing the foundation for examining the evolutionary effects of specific morphological characters. A robust, thorough, and well resolved phylogeny is critical to understand the diversity of forms observed in this genus. We do not know the specific details on the ecology of
each species of this genus. For a few of them, it is been suggested that they may play an important role as seed dispersal of key plant species in the first stages of the natural recolonization of gaps in the tropical and subtropical
rainforests. To know and understand their phylogenetic relationships is one of the first steps towards the protection of our natural heritage.
The diversity of body sizes, different teeth cusps, tooth row arrangements, band coloration on hairs, rostrum and cranium shapes, development of 205 zygomatic arches, and sagittal and occipital crests present in different species is a mechanism of functional isolation that may reduce competition for food or increase resource partitioning. This diversity of morphological features provided characters that earlier workers used to define the genus and the various species.
Using morphological data to generate a phylogenetic hypothesis that explains the evolutionary history of a particular group has been one way to approach a problem. Since Sturnira was defined as a genus (Gray 1842), based on S. spectrum (=lilium) as the type species for the genus, morphological features were used to base any relationship between species. By means of purely morphological taxonomy, Koopman (1993, 1994) and others have explained several of the questions that derived from a survey of the entire
Sturnira genus. However, using only traditional taxonomic tools proved insufficient to unveil those cryptic taxa masquerading under defined species complexes. Using molecular data to produce phylogenetic hypotheses is yet another approach to resolve what traditional morphology did not. This is not to say that from now on morphological studies should be considered obsolete and non-informative. On the contrary, several of my suggestions, as results of combining molecular and morphological data sets, agree with what was said almost 50 to 100 years ago by "pure morphologists", meaning that the
information was, and is still there. The molecular and morphological data set used in this work largely agree with currently accepted concepts based on traditional morphology and moreover, seem to reveal yet other unresolved dilemmas. Previous attempts to understand the evolution of this group have failed to provide a complete picture. With the addition of DNA information, this 206 area of research will be placed in a more robust evolutionary framework than was previously possible. Figure 74. The most current phylogenetic hypothesis of the genus Sturnira and the changes proposed in this work. Autapomorphies (after Koopman, 1994) are listed to assist the reader in separating the main clades. Numerical values, abbreviations, and symbols are as indicated in figure 7. This tree is plotted on a bootstrap diagram (with bootstrap values after successively weighted parsimony) and depict a conservative view of the phylogenetic relationships among species of Sturnira. 208
ISSP-S. aratathomasi 32 100/12 S. lilium 81/2 19 100/14 S. parvidens 15 65/1 99/1 pi S. luisi 15 66/1 — (well defined lingual cusps) S. Panama-C.Rica-Guyana \ 1 D S. NE coast cCO 1 97/1 m^-S. tildae 24 Sturnira (subgenus) (outer lower incisors /14 S. sp. B well-developed and 15 functional, zygomatic ims. ludovici arch always complete) 8 84/2 93/5 100/17 20 S. oporaphilum 98/3 20 11 100/11 S. hondurensis 100/3 12 ^^-S. hondurensis (vestigial or Panama-C. Rica absence of l^-S. mordax vertical notched 67/1 12 that defined 100/14 lingual cusps) S. sp. A 99/10 17 46 Sturnira (genus) 100/12 S. erythromos 20 (uropatagium 74/2 virtually absent, crown of molars ^^S. bogotensis 21 with distinct 100/15 longitudinal S. magna H 20 grooves, cusps strictly lateral) 100/15 S. nana 26 58/2 15 Corvira (subgenus) 100/12 S. bidens (outer lower incisors 22 vestigial or absent, zygomatic arch weak or incomplete) Figure 75. A partial picture of the tree depicted in figure 9 plotted on a bootstrap tree displaying a conservative view of the phylogenetic relationships among all specimens available for S. oporaphilum, S. ludovici, and S. hondurensis (the ludovici complex). Numerical values, abbreviations, and symbols are as indicated in figure 7. Decay and/or bootstrap values not available for all nodes. The name of the country is listed after the original scientific name for each specimen. Bars on the right indicate tentative species or "complex" of species and nomenclatural changes. A star indicates that the specimens included on that bar could represent a probable new taxon, but sampling is needed. 210 -S.oporaphilum Peru 91 S.oporaphilum Bolivia 94 -S.oporaphilum Bolivia 63 62 96/6 -S.oporaphilum Bolivia -S.oporaphilum Bolivia 84/2 -S.oporaphilum Peru •S.ludovici Ecuador 100/13 16 S.ludovici Ecuador S.ludovici Guatemala S.ludovici Guatemala S.ludovici Guatemala 99/5 S.hondurensis Honduras 62 S.hondurensis Honduras I 90/3 99/5 11 S.ludovici El Salvador S.hondurensis Honduras 1 I •S.ludovici El Salvador % (J 2 .52 S.ludovici Guatemala * 66 S.ludovici Guatemala 100/11 90 # a 12 S.ludovici Guatemala 54 S.hondurensis Honduras S.hondurensis Honduras 94 56 2 -a S.ludovici El Salvador 79/2 95/3 S.ludovici Guatemala -S.ludovici Guatemala S.ludovici Costa Rica 56 S.ludovici Costa Rica 100/9 S.ludovici Panama 11 * S.ludovici Costa Rica I Figure 76. A partial picture of the tree depicted in figure 12 plotted on a bootstrap tree displaying a conservative view of the phylogenetic relationships among all specimens available for the luisi complex (including forms formerly recognized as to S. lilium, S. thomasi, and S. luisi). Numerical values, abbreviations, and symbols are as indicated in figure 7. The name of the country (or island) and bars on the right are as indicated in figure 75. 212 S.thomasi Guadeloupe 99/5 S.thomasi Guadeloupe S 5 5 62/1 S.lilium angeli Dominica in 90/4 c 5 1 S.lilium zygomaticus Martinique S.thomasi vulcanensis Montserrat S./u/s/ Ecuador 66/1 S.luisi Panama 1 S.luisi Panama S.luisi Panama S.lilium Panama o S.lilium Panama 66/1 S.lilium Panama 2 wa 88/2 S.lilium Panama c CD 3 S.lilium Costa Rica in S.lilium Guyana 84/1 3 9? S.lilium Guyana 2 6 S.lilium Guyana E S.lilium Grenada a 99/5 serotinus 3 0) CO 6 S.lilium paulsoni St.Vincent C 79/1 S.lilium Suriname f 3 S.lilium French Guiana to S.lilium Tobago figure 78 S.lilium Peru S.lilium Venezuela 60/1 S.lilium Bolivia 1 S.lilium Ecuador S.lilium Ecuador S.lilium Ecuador 55/1 S.lilium Peru 1 63/1 1 S.lilium Peru S.lilium Peru Figure 77. Map of the geographical distribution of individuals representing the Luisi complex showing specimen (circle) localities. Dotted lines delimiting proposed range based on samples sequenced (see figure 76). Questions marks indicate unknown distributional limits. 214 Sturnira thomasi Y*. y Sturnira lilium angeli . $ i Sturnira lilium zygomaticus ( j*. Sturnira lilium paulsoni C-n^^ Sturnira lilium serotinus (Sturnira) Panama-Costa* v. J Rica-Guyana (Sturnira)\N coast of northern South America Cj Proposed range • Specimens locality Figure 78. A partial picture of the tree depicted in figure 13 plotted on a bootstrap tree displaying a conservative view of the phylogenetic relationships among all specimens available for S. lilium and S. parvidens (the lilium complex). Numerical values, abbreviations, and symbols are as indicated in figure 7. The name of the country, bars on the right, and stars are as indicated in figure 75. 216 to figure 76 S.watafoomasi Cp\omb\a_ S.lilium Brazil S.lilium Brazil S.lilium Brazil S.lilium Brazil S.lilium Bolivia S.lilium Paraguay S.lilium Bolivia S.lilium Paraguay oo S.lilium Paraguay S.lilium Brazil . S.lilium Guatemala 55/2 S.lilium Guatemala S.lilium Guatemala S.lilium Guatemala CO S.lilium Guatemala i S.lilium Honduras 100/14 to S.lilium El Salvador 15 * Q. S.lilium El Salvador 5 S.lilium El Salvador 1 S.lilium Mexico CO 63 S.lilium Mexico S.lilium Mexico S.lilium Costa Rica Figure 79. Map of the geographical distribution of S. lilium and S. parvidens showing type (triangle) and specimen (circle) localities for each species. Dotted lines delimiting proposed range based on samples sequenced (see figure 78). Questions marks indicate unknown distributional limits. 218 Sturnira parvidens \ Cj Proposed range a Type locality • Specimens locality APPENDIX 1 INSTITUTIONAL NAMES Acronyms used in this work, complete name, institutional affiliation (if any), state/country, and contact person(s) of institutional sources, which kindly supplied me with the specimens examined. AMNH- American Museum of Natural History, NY, Nancy B. Simmons, Brian Kraatz. ASNHC- Angelo State Natural History Collections, Angelo State University, San Angelo, TX, Robert Dowler. CMNH- Carnegie Museum of Natural History (Edward O'Neil Research Center), Pittsburgh, PA, Duane Schlichter, John Wible, Sue McLaren, Tim McCarthy. UNAM- Centro de Ecologia, Universidad Nacional Autonoma de Mexico, DF, Rodrigo Medellin, Ricardo Lopez-Wilches. FLMNH, Florida Museum of Natural History, University of Florida, FL, Charles A. Woods, Laurie Wilkins, Candace McCaffery. FMNH, The Field Museum, Chicago, IL, Bruce D. Patterson, John Phelps. LSU, Museum of Natural Science, Louisiana State University, Baton Rouge, LA, Mark S. Hafner, Shannon K. Allen, David Reed. MCZ- Museum of Comparative Zoology, Harvard University, Harvard, MA, Maria E. Rutzmoser, Terri McFadden, Gail Pinderhughes. MGENEVE- Museum d'histoire naturelle de la Ville de Geneve, Suisse. MSB- Museum of Southwestern Biology, University of New Mexico, Albuquerque, NM, Terri Yates, William L. Gannon. MSU- Michigan State University, East Lansing. MUSN- Museo de Historia Natural de la Universidad Mayor de San Marcos, Lima, Peru, Irma Franke, Elena Vivar, Sergio Solari. MVZ- Museum of Vertebrate Zoology, University of California, Berkeley, CA, James L. Patton, Carla Cicero. UM- Museum of Zoology, University of Michigan, Ann Arbor, Ml, Phil Myers. USNM- United States National Museum of Natural History, Smithsonian Institution, Washington, DC, Linda Gordon, Alfred L. Gardner, Charles O. Handley, Jr., Jefrey F. Jacobs, Don E. Wilson. OMNH- Oklahoma Museum of Natural History, University of Oklahoma, Norman, OK, Michael Mares, Janet Braun. ROM- Royal Ontario Museum, Centre for Biodiversity and Conservation Biology, Toronto, Ontario, Canada, Mark Engstrom, Lim Burton. 219 220 TCWC- Texas Cooperative Wildlife Collection, Department of Wildlife & Fisheries Sciences,Texas A&M University, College Station, TX, Duane Schlitter, John W. Bickham. TTU- The Museum, Texas Tech University, Lubbock, TX, Nicky Ladkin, Robert Baker, Ricardo Monk. UNSM- University of Nebraska State Museum, Lincoln, NE, Patricia Freeman, Thomas Labedz. . APPENDIX 2 MORPHOLOGICAL CHARACTERS Abbreviations and description of each continuous morphological character measured on selected specimens of the genus Sturnira and allied outgroup species. Limbs (4) 1 Forearm length (FA): Length from olecranon process to shallow notch proximal to thumb (including carpal bones), Figure 5B. 2. Length of third metacarpal (L3M): Length from distal end point of the forearm (to include the carpals) to distal end of respective metacarpal bone, Figure 5B. 3. Length of fourth metacarpal (L4M): Length from distal end point of the forearm (to include the carpals) to distal end of respective metacarpal bone, Figure 5B. 4. Length of fifth metacarpal (L5M): Length from distal end point of the forearm (to include the carpals) to distal end of respective metacarpal bone, Figure 5B. Cranial (12) 5. Greatest length of the skull (GLS): Distance from anteriormost part of rostrum (including incisors), to posteriormost point of skull, Figure 4A. 6. Condyloincisors length (CIL):Distance from anteriormost edge of the upper incisors, to posteriormost projection of the occipital condyles, Figure 4A. 7. Mastoid breadth (MB): Least width of skull at mastoid processes, Figure 4E. 8. Zygomatic breadth (ZB): Greatest width across zygomatic arches, Figure 4E. 9. Postorbital constriction (PC): Least width of the skull at the postorbital constriction, Figure 4E. 10. Palatal length (PL): Shortest distance from the anterior border of incisors to the posterior edge of the palate, Figure 4C. 11. Palatal breadth (PB): Greatest width of palate accross M1 (measured laterally), Figure 4C. 12. Breadth across upper canines (C1C1): Greatest width at cingulum from lateral edges between bases of upper canines, Figure 4E. 13. Maxillary toothrow (MT): Minimum length from anteriormost edge of first upper canine (contact area with incisors) to posteriormost edge of last upper molar, Figure 4C. 14. Breadth accross foramen magnum (BFM): Greatest width from external surface of occipital condyle to the opposite external surface of occipital condyle, Figure 4C. 221 222 15. Braincase length (BCL): Distance from the posterior edge of the palate to the interiormost edge of internal surface of the foramen magnum, Figure 4C. 16. Nasal breadth (NB): Greatest width between internal borders of nasal foramen, Figure 4E. Dental (2) 17. Area of Molar 1 (AM1): Greatest width x greatest length of M1 at crown, Figure 4F. 18. Molar 3 width (M3W): Greatest width of M3 at crown, Figure 4F. Mandibular (4) 19. Length of dentary (LD): Greatest length from anteriormost point on incisors to posteriormost tip of mandibular condyle, Figure 4B. 20. Length of mandibular toothrow (LMT): Length from anterior border of canine to posterior border of last molar, Figure 4B. 21. Height of coronoid process (HCP): Perpendicular height from ventral mandibular border (constriction) to tip of coronoid process, Figure 4B. 22. Dentary width at canines (del): Greatest width between bases of lower canines (ventrally measured), Figure 4D. Noseleaf (3) 23. Breadth of the spear (BOS): Greatest breadth of the spear, Figure 5A. 24. Breadth of the horseshoe (BOH): Greatest breadth of the horseshoe, Figure 5A. 25. Internostril width (INW): Shorter distance between nostrils at its inferiormost edge, Figure 5A. APPENDIX 3 SPECIMENS MEASURED Specimens representing 15 species (S. /u/s/'here has been merged into S. lilium) of the genus sturnira (Totaling 412 individuals measured, 224 females and 188 males) and four additional species (six individuals) used as outgroup. Fields are listed in the following order: collection acronyms, specimen number, nature of specimen, c(arlos)a(lberto)i(udica) number, altitude (in meters), latitude and longitude, country, state, town/dept., locality modifier, collector's name, collector's number, date of collection, sex, personal observations. ** refered to type material (type, paratype, topotypes, etc.). When two or more comas follow, no information was available for that particular field. Abbreviations for nature of specimen follow: al: alcoholic, sa: alcoholic with skull removed, sb: skin, skull, and body skeleton, sc: skin, skull, and alcoholic carcass, sk: skull only, sn: complete skeleton, so: skin only, ss: skin and skull. Sturnira aratathomasi Peterson & Tamsitt 1 968. S 9 USNM, 501064, SS, , 1, 800 MTS, 3 28'N, 76 37'W, COLOMBIA, VALLE DEL CAUCA, RIO FELIDIA, 10 KM SW FELIDIA, APPROX. 15 KM SW CALI, Thomas, M/McMurray, D„ MET 2652, 4-Feb-73, F, FA measured from dry skin. Bosque subtropical muy humedo, cr=35 MM e e ROM, 70874, SS, , 1, 800 MTS, 3 26'N, 76 37'W, COLOMBIA, VALLE DEL CAUCA, PENAS BLANCAS, PICHINDE, 15 KM SW CALI, Thomas, M/McMurray, D., MET 3018, 5-Aug-73, F, bosque subtropical muy humedo, pregnant, fetus aborted (cr: 46, 13.6 grs, FA: 28), measurements taken from label 46349, SA, , , , F, on label , & 3267/237, ROM", , ECUADOR, ARATA THOMAS, PARATYPE, , , reads collector: de Ville, field number 237-B87 or B88 (not clear), accession # 46349, date: April-9-1874, specimen decolored, bleached S S USNM, 501066, SA, , 1, 800 MTS , 3 26'N, 76 37'W, COLOMBIA, VALLE DEL CAUCA, PENAS BLANCAS, PICHINDE, 15 KM SW CALI, Thomas, M/McMurray, D., MET 3022, 6-Aug-73, F, bosque subtropical muy humedo e S USNM, 501065, SS, , 1, 800 MTS , 3 26'N, 76 37'W, COLOMBIA, VALLE DEL CAUCA, PENAS BLANCAS, PICHINDE, 15 KM SW CALI, Thomas, M/McMurray, D., MET 301 9, 6-Aug-73, M, bosque subtropical muy humedo, TESTES= 6MM Q 8 USNM**, 395158, SB**, , 1, 650 MTS, 3 20'N, 76 38'W, COLOMBIA, VALLE DEL CAUCA, PANCE, 2 KM S PANCE, 20 KM SW OF CALI, ARATA & THOMAS, 635, 1-Dec-66, M, TYPE SPECIMEN, MEASUREMENTS FROM LABEL, AS WELL AS FA: 59, CAPTURED W/ MIST NET PVER GROW PASTURE NEAR GUAYABA TREE, TESTES 2X1.5, lower left 11 trilobated, right one w/ a deep groove in the middle a e ROM, 70876, SS, , 1, 800 MTS , 3 26'N, 76 37'W, COLOMBIA, VALLE DEL CAUCA, PENAS BLANCAS, PICHINDE, 15 KM SW CALI, Thomas, M/McMurray, D., MET 3021, 6-Aug-73, M. Sturnira bidens (Thomas 1915). fi S USNM, 513447, SS, , 2, 225, 01 28'N, 78 48'W, ECUADOR, CHIMBORAZO, RIO FELIDIA, 4 KM NE PALLATANGA, GARDNER, A., ALG13266, 13-Aug-76, F, 223 , 224 S e 04'W, VENEZUELA, MERIDA, , 5.5 KM E, 2 KM S OF USNM, 386558, SS, , 2, 640, 08 38'N, 71 TABAY (MIDDLE REFUGIO), SVP-HANDLEY, O, 4369, 6-Apr-66, F, 1 EMBRYO, 23 MM C-R, 9 e VENEZUELA, MERIDA, , 5.5 KM E, 2 KM S OF USNM, 386562, SS, , 2, 550, 08 38'N, 71 04'W, TABAY (MIDDLE REFUGIO), SVP-HANDLEY, O, 4375, 7-Apr-66, F, 1 EMBRYO, 19 MM C-R, LEFTSIDE. 9 S 71 04'W, VENEZUELA, MERIDA, , 5.5 KM E, 2 KM S OF USNM, 386565, SS, , 2, 550, 08 38'N, TABAY (MIDDLE REFUGIO), SVP-HANDLEY, O, 4386, 8-Apr-66, F, e 9 04'W, VENEZUELA, MERIDA, , 5.5 KM E, 2 KM S OF USNM, 386566, SS, , 2, 550, 08 38'N, 71 TABAY (MIDDLE REFUGIO), SVP-HANDLEY, O, 4388, 8-Apr-66, F, 1 EMBRYO, 26 MM C-R. 9 9 MERIDA, , 5.5 KM E, 2 KM S OF USNM, 386568, SS, , 2, 640, 08 38'N, 71 04'W, VENEZUELA, TABAY (MIDDLE REFUGIO), SVP-HANDLEY, C, 4391 , 8-Apr-66, F, 1 EMBRYO, 30 MM C-R. 9 e , 4 KM E USNM, 513445, SS, , 1, 585, 04 02'N, 79 01'W, ECUADOR, ZAMORA-CHINCHIPE, SABANILLA, GARDNER, A., ALG13184, 1-Aug-76, F, DARKER IN COLOR 9 9 ZAMORA-CHINCHIPE, , 4 KM E USNM, 513446, SS, , 1, 585, 04 02'N, 79 01'W, ECUADOR, SABANILLA, GARDNER, A., ALG13185, 1-Aug-76, F, 9 S CMNH, 112824, SA, 175, 2, 350, 00 31'N, 78 37'W, ECUADOR, ESMERALDAS, , RESERVA ECOLOGICA COTACACHI-CAYAPAS, EL ZINC CAMP, MCCARTHY, T.J., 7505, 22-Nov-91, M, SP10654 9 e LSU, 26924, SB, 208, 2, 900, 05 09'S, 79 26'W, PERU, PIURA, CERRO CHINGUELA, ca. 5 KM NE ZAPALACHE, BARKLEY, L.J., 1520, 21 -Jul-80, M, testes: scrota;, 6x4, tragus: 9 9 Q 38'N, 71 04'W, MERIDA, , 5.5 KM E, 2 KM S OF USNM, 366567, SS, , 2, 640, 08 VENEZUELA, TABAY (MIDDLE REFUGIO), SVP-HANDLEY, O, 4390, 8-Apr-66, M, R-UPPER PM2 MISSING, R-ZIGOMATIC ARCH BROKEN, MIST NET OVER STREAM, TESTES 7x5, ONLY 1 PAIR OF LOWER INCISORS. Sturnira (lilium) bogotensis Shamel 1 927. e 9 251987, SS, , 04 45'N, 74 03'W, COLOMBIA, , BOGOTA, ESTACION LA URIBE, USNM*", , NICEFORO, MARIA, Bro.no number, ?-Sep-25, F, FA measurement questionable, TOPOTYPE 9 e FMNH, 128788, SS, 62, 2, 926 MTS, 09 35'S, 77 15'W, PERU, ANCASH, , RIO MOSNA, BETWEEN CHAVIN AND SAN MARCOS, PATTERSON, B.D., 2320, 19-Apr-87, F, tragus: 7, lact e e FMNH, 128789, SS, 63, 1, 560 MTS, 11 54'S, 75 31'W, PERU, LIMA, SAN BARTOLOME, RIMAC VALLEY, PACHECO, V., 301, 8-Apr-87, F, embryo: 22, tragus: 5. S FMNH, 128935, SS, 64, 3, 000 MTS, 11 9 54'S, 75 31'W, PERU, LIMA, SAN BARTOLOME, RIMAC VALLEY, PAMPA DE ZARATE, PACHECO, V., 661, 2-Jun-87, F, tragus: 6, non lactating, FA form label: 46 9 9 SS, , 04 45'N, 74 03'W, , ESTACION LA URIBE, USNM*", 251989, , COLOMBIA, BOGOTA, NICEFORO, MARIA, Bro.no number, ?-Sep-25, F, TYPE, missing left occipital condyle, old individual-teeth pattern very wear, left zygomatic arch incomplete fi 9 USNM***, 251988, SS, , 04 45'N, 74 03'W, COLOMBIA, , BOGOTA, ESTACION LA URIBE, , NICEFORO, MARIA, Bro.no number, ?-Sep-25, *M, FA measurement questionable, TOPOTYPE 9 9 USNM***, 251986, SS, , 04 45'N, 74 03'W, , LA URIBE, , COLOMBIA, BOGOTA, ESTACION NICEFORO, MARIA, Bro.no number, ?-Sep-25, M, SKULL BROKED, FA measurement questionable, TOPOTYPE fi 9 USNM***, 251990, SO, , 04 45'N, 74 03'W, , LA URIBE, , COLOMBIA, BOGOTA, ESTACION NICEFORO, MARIA, Bro.no number, , SKIN ONLY, measurement questionable , FA , , , , i i i i • Sturnira erythromos (Tschudi 1844). 9 S CMNH, 42836, SS, , 22 44'S, 64 , 22'W, ARGENTINA, SALTA, ORAN, 24 KM NW AGUAS BLANCAS, MARES, 1911, 19-Jul-71, F, 9 9 CMNH, 42838, SS, , , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 KM NW AGUAS BLANCAS, MARES, 1913, 19-Jul-71, F, S S CMNH, 42863, SS, , 26 49'S, 13'W, , 65 ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM W S.M. TUCUMAN, MARES, 2211, 29-Sep-72, F, 225 e S MOLLE, 15 KM , 49'S, 13'W, ARGENTINA, TUCUMAN, HORCO CMNH, 42864, SS, , 26 65 W S.M. TUCUMAN, MARES, 2212, 29-Sep-72, F, B S MOLLE, 15 42871, SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO KM W CMNH, , S.M. TUCUMAN, MARES, 2219, 29-Sep-72, F, Q Q DE LULES, 11 42876, SS, , 26 52'S, 65 19'W, ARGENTINA, TUCUMAN, QUEBRADA CMNH, , KM SW SAN PABLO, MARES, 2184, 17-Sep-72, F, S 8 LULES, 11 , 26 52'S, 65 19'W, ARGENTINA, TUCUMAN, QUEBRADA DE CMNH, 42877, SS, , KM SW SAN PABLO, MARES, 2185, 17-Sep-72, F, e e LULES, 11 42878, SS, , 26 52'S, 65 19'W, ARGENTINA, TUCUMAN, QUEBRADA DE CMNH, , KM SW SAN PABLO, MARES, 2187, 17-Sep-72, F, e Q OMNH, 23516, SB, 210, 1, 066 MTS, 26 13'S, 65 17'W, ARGENTINA, TUCUMAN, F, label: TRANCAS, LAS JUNTAS, 22 KM W CHOROMORO, , A1 236, 3-Jul-90, from FA: 42, IADIZA4036, AK 14236 fi S FMNH, 128796, SB, 65, 1, 945 MTS, 06 50'S, 78 01'W, PERU, AMAZONAS, , 19 KM BY ROAD E BALSAS, PACHECO, V., 4.57, 10-May-87, F, from label: FA: 42. CMNH, 42827, AL, ,1,700 MTS, 23e47'S, 64e47'W, ARGENTINA, JUJUY, CALILEGUA, ABRA DE LAS CANAS, 30 KM NW CALILEGUA, MARES, 3370, 26-NOV-76, F, 9 8 CMNH, 42828, AL, , 1, 700 MTS, 23 47'S, 64 47'W, ARGENTINA, JUJUY, CALILEGUA, ABRA DE LAS CANAS, 30 KM NW CALILEGUA, MARES, 3371, 26-NOV-76, F, e e FLMNH, 24239, SA, 238, 2, 250 MTS, 08 40'N, 71 30'W, VENEZUELA, MERIDA, LA CARBONERA, CLOUD FOREST, 6 TO 12 KM SE LA AZULITA, BONACCORSO, F.J., , 20-Jun- 87, F, weight from label, LAT, LONG estimated e e FLMNH, 27282, SA, 239, 2, 250 MTS, 08 40'N, 71 30'W, VENEZUELA, MERIDA, LA CARBONERA, CLOUD FOREST, 6 TO 12 KM SE LA AZULITA, BONACCORSO, F.J., , 20-Jun- 87, F, inner lower incisors missing, LAT, LONG estimated Q e FLMNH, 27388, SA, 235, 2, 250 MTS, 08 40'N, 71 30'W, VENEZUELA, MERIDA, LA CARBONERA, CLOUD FOREST, 6 TO 12 KM SE LA AZULITA, BONACCORSO, F.J., , 20-Jun- 87, F, weight from label, LAT, LONG estimated 9 S LSU, 28171, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2362, 21-Jul-84, F, tragus=6, 1 emb.X 12mm, tissue available, measurements from label S e LSU, 28173, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2364, 21-Jul-84, F, tragus=6, parous, tissue available, measurements from label Q S LSU, 28180, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2386, 24-Jul-84, F, tragus=6, 1 emb.X 12mm, tissue available, measurements from label Q e LSU, 28185, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2428, 31-Jul-84, F, tragus=7, 1 emb.X 12mm, tissue available, measurements from label fi e CMNH, 42830, SS, , 23 59'S, 64 18'W, JUJUY, EL , ARGENTINA, SIMBOLAR, 25 KM SW PALMA SOLA, BARQUEZ-OJEDA, 514, 23-Jun-77, M, e e CMNH, , 22 44'S, 64 42837, SS, , 22'W, ARGENTINA, SALTA, ORAN, 24 KM NW AGUAS BLANCAS, MARES, 1912, 19-Jul-71, M, e S CMNH, 42840, SS, , 22 44'S, 64 22'W, , ARGENTINA, SALTA, ORAN, 24 KM NW AGUAS BLANCAS, MARES, 1916, 19-Jul-71, M, e 9 CMNH, 42858, SS, , , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM W S.M. TUCUMAN, MARES, 2206, 29-Sep-72, M, e e CMNH, 42867, , 26 SS, , 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM W S.M. TUCUMAN, MARES, 2215, 29-Sep-72, M, S fi CMNH, 42870, SS, , 26 49'S, 13'W, , 65 ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM W S.M. TUCUMAN, MARES, 2218, 29-Sep-72, M, e e CMNH, 42874, SS, , 26 49'S, 13'W, , 65 ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM W S.M. TUCUMAN, MARES, 2243, 29-Sep-72, M, 2 e CMNH, , 86379, SS, , 26 37'S, 65 12'W, ARGENTINA, TUCUMAN, EL CADILLAL, RESERVA PROVINCIAL AGUAS CHIQUITAS, BARQUEZ-CAPLLONCH, 613, 18-Oct-78, M, 226 9 e FMNH, 128800, SS, 66, 2, 804 MTS, 06 41'S, 77 47'W, PERU, AMAZONAS, , CA. 20 KM BY ROAD W LEIMEBAMBA, PATTERSON, B.D., 2519, 6-May-87, M, From label, t=5X3 mm, TRAGUS: 6 MM S B FMNH, 128809, SS, 67, 1, 295 MTS, 08 13'S, 77 08'W, PERU, AMAZONAS, RIO UTCUBAMBA, BETWEEN CHURUJA & PEDRO RUIZ, PACHECO, V., 512, 16-May-87, M, subadult, testes: 3X2 mm, tragus: 6. 9 e FMNH, 128811, SS, 68, 1, 244 MTS, 06 55'S, 79 35'W, PERU, CAJAMARCA, RIO ZANA, 2 KM N MONTE SECO, PACHECO, V., 606, 25-May-87, M, TESTES: 4x3mm, tragus: 7mm, FA from label: 44. 9 Q LSU, 28166, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2353, 20-Jul-84, M, tragus=6, testes inguinal X 4mm, tissue available, measurements from label fi 8 LSU, 28167, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2354, 20-Jul-84, M, tragus=6, testes inguinal X 5mm, tissue available, measurements from label e S LSU, 28170, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2357, 20-Jul-84, M, tragus=6, testes inguinal X 7mm, tissue available, measurements from label Q 9 LSU, 28179, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2385, 24-Jul-84, M, tragus=6, testes inguinal X 7mm, tissue available, measurements from label 9 9 LSU, 28182, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2395, 26-Jul-84, M, tragus=6, testes abdominal X 7mm, tissue available, measurements from label 9 9 LSU, 28186, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2433, 1-Aug-84, M, tragus=7, testes scrotal X 12mm, tissue available, measurements from label 9 fi LSU, 28187, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2441 , 3-Aug-84, M, tragus=5, testes inguinal X 6mm, tissue available, measurements from label 9 9 LSU, 28188, SB, 27, 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2446, 4-Aug-84, M, tragus=6, testes inguinal X 4mm, tissue available, measurements from label 9 9 LSU, 28168, SB, , 3, 450, 09 41'S, 76 07'W, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HACIENDA PATY, NNW ACOMAYO, BARKLEY, L.J., 2355, 20-Jul-84, M, POSIBLE NSP.? look further, no upper M3, tragus=5, testes inguinal X 4mm, tissue available, measurements taken from label. Sturnira hondurensis Goodwin 1940. 9 9 CMNH, 79409, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1444, 26-Jun-79, F 9 9 CMNH, 79410, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1446, 27-Jun-79, F 9 9 CMNH, 79414, SS, , 1, 400 M, 20 23N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1451, 27-Jun-79, F 9 9 CMNH, 79415, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1452, 27-Jun-79, F 9 9 CMNH, 111317, , 1, 13 44'N, SS, 590 M, 89 15'W, EL SALVADOR, SAN SALVADOR, , NEAR SUMMIT VOLCAN DE SAN SALVADOR, OWEN, 2073, 28-Apr-93, F Q 9 CMNH, 92484, SS, , 10 25'N, 84 , 25'W, COSTA RICA, ALAJUELA, , 4.2 KM SE CARIBLANCO, MCCARTHY, 6750, 7-Feb-83, F 9 9 CMNH, 92485, SS, , 10 25'N, 84 , 25'W, COSTA RICA, ALAJUELA, , 4.2 KM SE CARIBLANCO, MCCARTHY, 6796, 12-Feb-83, F 9 9 TTU, AL, , 39137, , 08 50'N, 82 46'W, PANAMA, CHIRIQUJ, SANTA CLARA, , BAKER, RJ, 3789, 19-Jan-83, F 3 227 a 9 ANA, LOS PLANES, PARQUE AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA TTU, 62413, , NACIONAL MONTECRISTO, OWEN, JG, 417, 21-Jun-90, F S 15'N, S 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE TTU, 62414, AL, , , 13 88 NACIONAL MONTECRISTO, OWEN, JG, 418, 21-Jun-90, F a S ANA, LOS PLANES, PARQUE , 15'N, 10'W, EL SALVADOR, SANTA TTU, 62415, AL, , 13 88 NACIONAL MONTECRISTO, OWEN, JG, 419, 21-Jun-90, F 9 9 10'W, SANTA ANA, LOS PLANES, PARQUE TTU, 62417, AL, , 13 15'N, 88 EL SALVADOR, , NACIONAL MONTECRISTO, OWEN, JG, 421, 21-Jun-90, F S S 10'W, ANA, LOS PLANES, PARQUE TTU, AL, , 13 15'N, 88 EL SALVADOR, SANTA 62419, , NACIONAL MONTECRISTO, OWEN, JG, 424, 21-Jun-90, F Q e 10'W, ANA, LOS PLANES, PARQUE AL, , 13 15'N, 88 EL SALVADOR, SANTA TTU, 62420, , NACIONAL MONTECRISTO, OWEN, JG, 425, 21-Jun-90, F 9 9 ANA, PLANES, PARQUE , 13 15'N, 88 10'W, EL SALVADOR, SANTA LOS TTU, 62421, AL, , NACIONAL MONTECRISTO, OWEN, JG, 426, 21-Jun-90, F e 9 TTU, 62422, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE , NACIONAL MONTECRISTO, OWEN, JG, 428, 21-Jun-90, F 9 9 TTU, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE 62423, , NACIONAL MONTECRISTO, OWEN, JG, 429, 21-Jun-90, F, 9 Q ANA, TTU, 62424, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA LOS PLANES, PARQUE , NACIONAL MONTECRISTO, OWEN, JG, 431, 21-Jun-90, F, 9 15'N, e 10'W, ANA, PARQUE TTU, AL, , 13 88 EL SALVADOR, SANTA LOS PLANES, 62425, , NACIONAL MONTECRISTO, OWEN, JG, 436, 22-Jun-90, F, 9 S 62426, AL, , 13 15'N, 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE TTU, , 88 NACIONAL MONTECRISTO, OWEN, JG, 437, 22-Jun-90, F, 9 9 TTU, 62427, AL, , 13 15'N, 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE , 88 NACIONAL MONTECRISTO, OWEN, JG, 438, 22-Jun-90, F, 9 9 TTU, 62429, AL, , 13 15'N, 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE , 88 NACIONAL MONTECRISTO, OWEN, JG, 440, 22-Jun-90, F, S 9 TTU, 62433, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE , NACIONAL MONTECRISTO, OWEN, JG, 445, 22-Jun-90, F, 9 9 TTU, 62434, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, , PARQUE NACIONAL MONTECRISTO, OWEN, JG, 446, 22-Jun-90, F, e 9 TTU, 62437, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA ANA, LOS PLANES, PARQUE , NACIONAL MONTECRISTO, OWEN, JG, 449, 22-Jun-90, F, 9 9 CMNH, 79416, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1453, 27-Jun-79, F, 9 9 CMNH, 79411, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1447, 27-Jun-79, M, 9 9 CMNH, 79417, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1454, 27-Jun-79, M, JUVENIL, FA ON LABEL= 43, TESTES 3X2, TRAGUS= 7, LOWER INCISORS PROFOUNDLY BILOBATED S 9 CMNH, 75006, SS, , 21 16'N, 98 47'W, LUIS POTOSI, , 1 , MEXICO, SAN M S TAMAZUNCHALE, ON RIO AMEJAC, JOHNSON, 23, 2-Jan-70, M, Q 9 CMNH, 75007, SS, , 21 16'N, 98 47'W, MEXICO, LUIS POTOSI, , 1 , SAN M S TAMAZUNCHALE, ON RIO AMEJAC, MOORE, 5, 2-Jan-70, M, 9 9 CMNH, 79426, SS, , 465 M, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , 1 M SE OJO DE AGUA, ROGERS, 880, 1-Jun-79, M, 9 9 CMNH, 79427, SS, , 465 M, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , OJO DE AGUA, ROGERS, 901 , 3-Jun-79, M, e 9 CMNH, 1 1 1 31 SS, , , M, 1 44'N, 1 8, 1 590 89 5'W, EL SALVADOR, SAN SALVADOR, , NEAR SUMMIT VOLCAN DE SAN SALVADOR, OWEN, 2079, 28-Apr-93, M, S 9 CMNH, 111319, SS, , 1, 590 M, 13 44'N, 89 15'W, EL SALVADOR, SAN SALVADOR, , NEAR SUMMIT VOLCAN DE SAN SALVADOR, OWEN, 2084, 28-Apr-93, M, S Q MSB, 61891, SB, 36, 1, 350 MTS, 10 36'N, 85 17'W, COSTA RICA, PUNTARENAS, MONTEVERDE, , GANNON, WL, 427, 14-Jan-89, M, lower inner incisors bilobated 9 S LSUMZ, 25179, SB, 1, 50'N, 30, 200, 9 83 52'W, COSTA RICA, CARTAGO, , 4 KM S, 2.5 KM W PARAISO, BARKLEY, L.J., 1974, 31-May-82, M, Tissue available, testes 3 mm, tragus=8. 228 9 e LSUMZ, 25180, SB, 33, 1, 200, 9 50'N, 83 52'W, COSTA RICA, CARTAGO, , 4 KM S, 2.5 KM W PARAISO, BARKLEY, L.J., 1979, 31-May-82, M, On label, S. mordax, tissue available, testes 3 mm, tragus=8. Q SANTA ANA, LOS PLANES, PARQUE TTU, AL, , 13 15'N, 88°10'W, EL SALVADOR, 62412, , NACIONAL MONTECRISTO, OWEN, JG, 416, 21-Jun-90, M, S Q SANTA ANA, LOS PLANES, PARQUE TTU, 62416, AL, , 13 15'N, 88 10'W, EL SALVADOR, , NACIONAL MONTECRISTO, OWEN, JG, 420, 21-Jun-90, M, B fi ANA, LOS PLANES, PARQUE AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA TTU, 62418, , NACIONAL MONTECRISTO, OWEN, JG, 423, 21-Jun-90, M, 9 8 ANA, LOS PLANES, PARQUE , 15'N, 88 10'W, EL SALVADOR, SANTA TTU, 62428, AL, , 13 NACIONAL MONTECRISTO, OWEN, JG, 439, 22-Jun-90, M, fi 2 SANTA ANA, LOS PLANES, PARQUE TTU, 62430, AL, , 13 15'N, 88 10'W, EL SALVADOR, , NACIONAL MONTECRISTO, OWEN, JG, 442, 22-Jun-90, M, 9 15'N, S 10'W, SANTA ANA, LOS PLANES, PARQUE TTU, 62431, AL, , 13 88 EL SALVADOR, , NACIONAL MONTECRISTO, OWEN, JG, 443, 22-Jun-90, M, Q 15'N, S SANTA ANA, LOS PLANES, PARQUE , 10'W, EL SALVADOR, TTU, 62432, AL, , 13 88 NACIONAL MONTECRISTO, OWEN, JG, 444, 22-Jun-90, M, fi 15'N, S ANA, LOS PLANES, PARQUE AL, , 13 88 10'W, EL SALVADOR, SANTA TTU, 62435, , NACIONAL MONTECRISTO, OWEN, JG, 447, 22-Jun-90, M, 9 9 ANA, TTU, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA LOS PLANES, PARQUE 62436, , NACIONAL MONTECRISTO, OWEN, JG, 448, 22-Jun-90, M, 9 9 ANA, PLANES, TTU, 62438, AL, , 13 15'N, 88 10'W, EL SALVADOR, SANTA LOS PARQUE , NACIONAL MONTECRISTO, OWEN, JG, 450, 22-Jun-90, M, 9 9 CMNH, 79418, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1455, 27-Jun-79, M, JUVENIL, FA ON LABEL= 44, TESTES 3X2, TRAGUS= 7, LOWER INCISORS PROFOUNDLY BILOBATED 9 e CMNH, 79412, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1448, 27-Jun-79, M S 9 CMNH, 79413, SS, , 1, 400 M, 20 23'N, 104 49'W, MEXICO, JALISCO, , 12.5 M SW (BY ROAD) TALPA DE ALLENDE, DOWLER, 1449, 27-Jun-79, M. Sturnira lilium (Geoffroy 1810). (sensu lato) 9 9 CMNH, 42831, SS, , 23 59'S, 64 18'W, ARGENTINA, JUJUY, EL SIMBOLAR, 25 KM SW , PALMA SOLA, BARQUEZ-OJEDA, 515, 23-Jun-77, F, Q 9 CMNH, 42833, SS, , 23 59'S, 64 18'W, ARGENTINA, JUJUY, EL SIMBOLAR, 25 KM , SW PALMA SOLA, BARQUEZ-OJEDA, 606, 2-Jul-77, F, 9 9 CMNH, 42835, SS, , 23 59'S, 64 18'W, ARGENTINA, JUJUY, EL SIMBOLAR, 25 , KM SW PALMA SOLA, BARQUEZ-OJEDA, 609, 2-Jul-77, F, 9 9 CMNH, 42839, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 , KM NW AGUAS BLANCAS, MARES, 1914, 19-Jul-71, F, 9 S CMNH, 42843, SS, , 22 44'S, 64 22'W, SALTA, 24 , ARGENTINA, ORAN, KM NW AGUAS BLANCAS, MARES, 1919, 19-Jul-71, F, 9 9 CMNH, 72344, SS, , 24 40'S, 64 35'W, ARGENTINA, SALTA, EL REY, , PN ARROYO DE LOS PUESTOS, 200 MTS DE LA ENTRADA, BARQUEZ, 670, 19-Apr-80, F, e 9 CMNH, 72348, SS, , 24 40'S, 64 35'W, ARGENTINA, SALTA, EL REY, , PN ARROYO DE LOS NOQUES, BARQUEZ, 691 , 20-Apr-80, F, 9 9 CMNH, 72350, SS, , 22 32'S, 49'W, , 63 ARGENTINA, SALTA, PIQUIRENDA VIEJO, 30 KM N TARTAGAL, BARQUEZ, 712, 10-May-80, F, e 9 CMNH, 72351, , 22 32'S, SS, , 63 49'W, ARGENTINA, SALTA, PIQUIRENDA VIEJO, 30 KM N TARTAGAL, BARQUEZ, 723, 11-May-80, F, 9 9 CMNH, 72352, SS, , 22 32'S, , 63 49'W, ARGENTINA, SALTA, PIQUIRENDA VIEJO, 30 KM N TARTAGAL, BARQUEZ, 724, 11-May-80, F, 9 S CMNH, 72353, , 22 32'S, SS, , 63 49'W, ARGENTINA, SALTA, PIQUIRENDA VIEJO, 30 KM N TARTAGAL, BARQUEZ, 725, 11-May-80, F, a 9 CMNH, 72335, SS, , , 24 40'S, 64 35'W, ARGENTINA, SALTA, PN EL REY, ARROYO DE LOS PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 661, 19-Apr-80, F, 1 229 e fi SALTA, PN EL REY, ARROYO DE LOS , 24 40'S, 64 35'W, ARGENTINA, CMNH, 72337, SS, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 663, 19-Apr-80, F, Q e SALTA, PN EL REY, ARROYO DE LOS , 24 40'S, 64 35'W, ARGENTINA, CMNH, 72340, SS*, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 666, 19-Apr-80, F, MANDIBLE MISSING 9 S SALTA, PN EL REY, ARROYO DE LOS 72341, SS, , 24 40'S, 64 35'W, ARGENTINA, CMNH, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 667, 19-Apr-80, F, 8 e SALTA, EL REY, ARROYO DE LOS , 24 40'S, 64 35'W, ARGENTINA, PN CMNH, 72342, SS, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 668, 19-Apr-80, F, fi e SALTA, PN EL REY, ARROYO DE LOS 72343, SS, , 24 40'S, 64 35'W, ARGENTINA, CMNH, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 669, 19-Apr-80, F Q e SALTA, PIQUIRENDA VIEJO, 30 KM N 72354, SS, , 22 32'S, 63 49'W, ARGENTINA, CMNH, , DE TARTAGAL, BARQUEZ, 726, 11-May-80, F e e SALTA, PIQUIRENDA VIEJO, 30 KM N SS, , 22 32'S, 63 49'W, ARGENTINA, CMNH, 72355, , DE TARTAGAL, BARQUEZ, 727, H-May-80, F 9 e SALTA, PIQUIRENDA VIEJO, 30 KM N , 22 32'S, 63 49'W, ARGENTINA, CMNH, 72356, SS, , DE TARTAGAL, BARQUEZ, 728, H-May-80, F 9 e49'W, ARGENTINA, SALTA, PIQUIRENDA VIEJO, 30 KM N CMNH, 72357, SS, , , 22 32'S, 63 DE TARTAGAL, BARQUEZ, 729, 11-May-80, F e S SALTA, PIQUIRENDA VIEJO, 30 KM N SS, , 22 32'S, 63 49'W, ARGENTINA, CMNH, 72358, , DE TARTAGAL, BARQUEZ, 741, 12-May-80, F e 9 SALTA, PIQUIRENDA VIEJO, 30 KM N 72359, SS, , 22 32'S, 63 49'W, ARGENTINA, CMNH, , DE TARTAGAL, BARQUEZ, 746, 13-May-80, F S 9 , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM CMNH, 42860, SS, , W S.M.TUCUMAN, MARES, 2208, 29-Sep-72, F e fi SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM W CMNH, 42861, , S.M.TUCUMAN, MARES, 2209, 29-Sep-72, F e e , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM CMNH, 42862, SS, , W S.M.TUCUMAN, MARES, 2210, 29-Sep-72, F Q S CMNH, 42866, SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM , W S.M.TUCUMAN, MARES, 2214, 29-Sep-72, F 9 S 42869, SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM CMNH, , W S.M.TUCUMAN, MARES, 2217, 29-Sep-72, F 9 B , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 CMNH, 42844, SS, , KM NW AGUAS BLANCAS, MARES, 1920, 19-Jul-71, F S e CMNH, 42845, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 AGUAS , KM NW BLANCAS, MARES, 1921, 19-Jul-71, F e e CMNH, 42846, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 , KM NW AGUAS BLANCAS, MARES, 1922, 19-Jul-71, F e S CMNH, 42848, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 KM AGUAS , NW BLANCAS, MARES, 1925, 19-Jul-71, F S 9 42849, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 CMNH, , KM NW AGUAS BLANCAS, MARES, 1926, 19-Jul-71, F, e 9 CMNH, 78567, SA, 17, , 07 21'N, 62 32'W, VENEZUELA, BOLIVAR, , 8 KM S, 5KM E EL MANTECO, ROBBINS, LW, 10399, 3-Feb-81, F, TK19138, it seems to be S. lilium. B 9 MSB, 57048, SB, 41, 170 MTS, 1 23 S, 67 12' W, BOLIVIA, PANDO, BELLA VISTA, , TALBOT, WA, 59, 26-Jul-86, F, No embryo, tragus=4 14° 16' 9 32' MSB, 55900, SO, 40, 250 MTS, S, 67 W, BOLIVIA, LA PAZ, , RIO BENI, MERCADO T., I, 233, 3-Sep-85, F, 1 embryo, skull lost, seems to be S. lilium 9 05' s CMNH, 83426, SA, , 12 N, 61 43 W, ST. , .5 , GRENADA, GEORGE, KM E VENDOME, GENOWAYS, 4505, 30-May-86, F, 9 e CMNH, 83954, SA, , 04 53'N, 52 17'W, GUIANA, , 1.5 , FRENCH REMIRE, WILLIAMS, , KM NE 7113, 25-Jan-89, F, 9 9 CMNH, 83956, SA, , 04 53'N, 52 17'W, , 1.5 , FRENCH GUIANA, REMIRE, WILLIAMS, , KM NE 7116, 25-Jan-89, F, e 9 CMNH, SA, , 04 53'N, 83957, , 52 17'W, FRENCH GUIANA, , 1.5 REMIRE, , KM NE WILLIAMS, 7117, 25-Jan-89, F, 230 9 e 53'N, 17'W, GUIANA, , 1.5 REMIRE, WILLIAMS, , 52 NE SA, 04 FRENCH , KM CMNH, 83958, , 7118, 25-Jan-89, F, e S WILLIAMS, 83960, SA, , 04 53'N, 52 17'W, FRENCH GUIANA, 1.5KMNEREMIRE, CMNH, , 7120, 25-Jan-89, F, a e WILLIAMS, 83962, SA, , 04 53'N, 52 17'W, GUIANA, 1.5KMNEREMIRE, CMNH, , FRENCH 7122, 25-Jan-89, F, S a 83963, SA, , 04 53'N, 52 17'W, FRENCH GUIANA, 1.5KMNEREMIRE, WILLIAMS, CMNH, , 7123, 25-Jan-89, F, e B WILLIAMS, CMNH, 83964, SA, , 04 53'N, 52 17'W, FRENCH GUIANA, 1.5KMNEREMIRE, , 7124, 25-Jan-89, F, 9 9 CMNH, 83965, SA, , 04 53'N, 52 17'W, FRENCH GUIANA, 1.5KMNEREMIRE, WILLIAMS, , 7126, 25-Jan-89, F, B 22' s 58' CMNH, 98760, SA*, , 9 S, 75 W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 , KM E TINGO MARIA, BAKER ET AL, 3860, 10-Oct-83, F, S.lilium-TMc e S CMNH, 77606, SA, 12, , 05 30'N, 54 03'W, SURINAME, , MAROWIJNE DIST., 3 KM SW ALBINA, ARNOLD, ML, 141, 23-Oct-81, F, TK17597 s e AL, 1 , 22' S, 75 58' W, 9 S, 2 CMNH, 98753, , 9 PERU, LEONCIO PRADO, HUANUCO, KM KM E TINGO MARIA, BAKER ET AL, 3852, 10-Oct-83, F, s 22' s 58' AL, , 9 S, 75 W, 9 S, 2 CMNH, 98754, , PERU, LEONCIO PRADO, HUANUCO, KM KM E TINGO MARIA, BAKER ET AL, 3853, 10-Oct-83, F, s 22' e 58' CMNH, 98761, AL, , 9 S, 75 W, PERU, LEONCIO PRADO, HUANUCO, 9 S, 2 , KM KM E TINGO MARIA, BAKER ET AL, 3861, 10-Oct-83, F, s 22' s 58' CMNH, 98765, AL, , 9 S, 75 W, PERU, PRADO, HUANUCO, 9 S, 2 , LEONCIO KM KM E TINGO MARIA, BAKER ET AL, 3867, 10-Oct-83, F, 8 22' s 58' CMNH, 98766, SA, , 9 S, 75 W, 9 S, 2 , PERU, LEONCIO PRADO, HUANUCO, KM KM E TINGO MARIA, BAKER ET AL, 3868, 10-Oct-83, F, Q 22' s 58' CMNH, SA, , S, 75 W, S, 98771, , 9 PERU, LEONCIO PRADO, HUANUCO, 9 KM 2 KM E TINGO MARIA, BAKER ET AL, 3849, 10-Oct-83, F, on label S. luisi s 22' 9 58' CMNH, 98772, AL, , 9 S, 75 W, PERU, 9 S, 2 , LEONCIO PRADO, HUANUCO, KM KM E TINGO MARIA, BAKER ET AL, 3873, 10-Oct-83, F, s 22' s CMNH, 98782, AL, , S, 75 58' W, , 9 PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM E TINGO MARIA, BAKER ET AL, 3875, 10-Oct-83, F, TK 22820 s 22' s 58' CMNH, 98785, AL, , 9 S, 75 W, , PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM E TINGO MARIA, BAKER ET AL, 3880, 10-Oct-83, F, TK 22825 e 22' s 58' CMNH, 98787, AL, , 9 S, 75 , W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM E TINGO MARIA, BAKER ET AL, 3884, 10-Oct-83, F, TK 22829 s 22' e 58' CMNH, 98790, AL, , 9 S, 75 W, PERU, 9 , LEONCIO PRADO, HUANUCO, KM S, 2 KM E TINGO MARIA, BAKER ET AL, 4315, 10-Oct-83, F, 9 e CMNH, , SA, , 22' S, 75 58' 98791 , 9 W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM E TINGO MARIA, BAKER ET AL, 4316, 10-Oct-83, F, e 22' 9 CMNH, 98793, AL, , S, 75 58' , 9 W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM E TINGO MARIA, BAKER ET AL, 4319, 10-Oct-83, F, s 22' 9 58' CMNH, AL, , S, 98794, , 9 75 W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM E TINGO MARIA, BAKER ET AL, 4320, 10-Oct-83, F, S S CMNH, 98769, SA, 3, , 09 22'S, 75 58'W, PERU, HUANUCO, LEONCIO PRADO, 9 KM S, 2 KM E TINGO MARIA, BAKER, R.J. , 3839, 10-Oct-83, F, TK22784, it is not an erythromos, AND not oporaphilum, it is lilium 9 14' 9 CMNH, SA, , 59' 98767, , 9 S, 75 W, PERU, LEONCIO PRADO, HUANUCO, 6 KM N TINGO MARIA, BAKER ET AL, 3380, 7-Oct-83, F, 9 s CMNH, SA, , 14' 59' 98768, , 9 S, 75 W, PERU, LEONCIO PRADO, HUANUCO, 6 KM N TINGO MARIA, BAKER ET AL, 4006, 7-Oct-83, F, MSB, SB, e 47' s 55150, , 16 S, 38, 63 14 W, BOLIVIA, SANTA CRUZ, , ESTANCIA CACHUELA ESPERANZA, COOK, JA, 1317, 22-Aug-84, F, 1 EMBRYO, 25 MM e 9 CMNH, 90479, SS, , 16 09'N, , 89 05'W, BELIZE, TOLEDO, , EAST EDGE OF AGUACATE VILLAGE, MCCARTHY, 5958, 26-Jul-82, F, CMNH, S S SS, , 16 15'N, 90489, , 88 53'W, BELIZE, TOLEDO, BIG FALL VILLAGE VECINITY, 1.9 KM ENE RIO GRANDE BRIDGE, MCCARTHY, 6533, 18-Sep-82, F, 231 9 S BIG FALL VILLAGE VECINITY, 1 SS, , 16 15'N, 88 53'W, BELIZE, TOLEDO, CMNH, 90499, , KM E RIO GRANDE BRIDGE, MCCARTHY, 6223, 20-Aug-82, F, 9 e ALDEA COFRADIA, , ERAZE- , 19'N, 20'W, HONDURAS, CORTES, CMNH, 60719, SS, , 14 88 SIERRA, 423, 2-Mar-75, F, S S POTOSI, , Ml CIUDAD CMNH, 79389, SS, , 470, 21 59'N, 99 01'W, MEXICO, SAN LUIS 26 W VALLES, ENGSTROM, 942, 22-May-79, F, S 9 , 11 CANDELARIA, , 15 40'N, 92 41'W, MEXICO, CAMPECHE, KM S CMNH, 92752, SS, , SCHMIDT, 85, 19-Jul-84, F, e a , 11 CANDELARIA, 92753, SS, , 15 40'N, 92 41'W, MEXICO, CAMPECHE, KM S CMNH, , SCHMIDT, 91, 19-Jul-84, F, e fi CMNH, 55733, SS, 10, , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, RIO DE ATOYAC, HARVEY, 844, 30-Mar-78, F, Q e , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, RIO DE CMNH, 55734, SS, , ATOYAC, HARVEY, 871, 31-Mar-78, F, e 9 RIO CMNH, 55735, SS, , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, DE , ATOYAC, HARVEY, 872, 31-Mar-78, F, S 9 RIO , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, DE CMNH, 55744, SS, , ATOYAC, SMOLEN, 622, 30-Mar-78, F, S 9 RIO CMNH, 55745, SS, , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, DE , ATOYAC, WILLIAMS, 3421, 1-Apr-78, F, Q 9 CMNH, 79403, SS, , 470, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , 1.5 KM SE OJO DE AGUA, ROGERS, 876, 1-Jun-79, F, 9 S CMNH, 92754, SN, , 15 40'N, 92 41'W, MEXICO, CAMPECHE, , 11 KM S (BY ROAD) , CANDELARIA, SCHMIDT, 94, 19-Jul-84, F, FA taken from skeleton 9 9 CMNH, 93554, SK, , 15 26'N, 92 54'W, MEXICO, CHIAPAS, , 13.1 Ml MAPASTEPEC, , SW SMOLEN, 2939, 4-Jan-82, F, Q e CMNH, 93555, SK, , 15 38'N, 92 39'W, MEXICO, CHIAPAS, , 3.8 Ml PALENQUE, , SW SMOLEN, 3053, 10-Jan-82, F, 9 S SN, , 19 40'N, 30'W, QUINTANA ROO, KOHUNLICH, ASNHC, 6938, 90, 88 MEXICO, , DOWLER, L, , 1-Jun-90, F, tragus=6, FA on label=38, no embryos, FN32616 S e TTU, 44789, SB, 9, , 26 08'N, 99 01'W, MEXICO, TAMAULIPAS, , 3 KM W CALABAZAS, RIO SABINAS, HOLLANDER, RR, 954, 7-Aug-84, F, 9 9 TTU, 45061, SB, 8, , 19 32'N, 105 05'W, MEXICO, JALISCO, CHAMELA, , HAIDUK, KJ, 46, 13- Mar-85, F, 9 9 MSB, 61878, SB, 37, , 10 26'N, 85 48'W, COSTA RICA, GUANACASTE, FLAMINGO BEACH, 2 KM NW BRASILITO, GANNON, WL, 425, 13-Jan-89, F, *4089*, 9 9 UNAM, SS, 20, , 30 58'N, 103 35'W, MEXICO, MICHOACAN, MUN AQUILA, PLAYA SAN TELMO, OWEN, RD ET AL, CSH4089, 14-Aug-92, F, Weight to ear taken from label, FA to L5M taken from dry skin, R zygomatic arch is damaged, TK 43231 , seems to be S. lilium (parvidens? Because is from Mexico??) w, showldered gland patches, reddish-golden, lower incisors bilobated, w, shelf present on M1 9 10' s00' TTU, 46264, AL, , S, 76 W, 1 1 , 09 PERU, HUANUCO, LEONCIA PRADO, KM N, 6 KM E TINGO MARIA, OWEN, RD, 507, 9-Oct-83, F, 938' 931' LSU, 18378, SS, , 335, 05 S, 78 W, PERU, AMAZONAS, BAGUA, HACIENDA VALOR, TALLMAN, D.A., 2069, 3-Oct-73, F, FA taken from skeleton, TRAGUS=7 S a LSU, 25177, SB, , 200, 09 56'N, 84 05'W, COSTA RICA, SAN JOSE, , 14 KM BY ROAD S LA GLORIA, BARKLEY, L.J., 1962, 24-May-82, F, FA taken from skeleton, 1 embryo, 9 mm, tragus=7, tissue available. 9 10' e00' TTU, 46263, AL, 11, , 09 S, 76 W, PERU, HUANUCO, LEONCIA PRADO, 11 KM N, 6 KM E TINGO MARIA, OWEN, RD, 502, 9-Oct-83, F, asumo que es S.l.lilium por ser del Peru! TTU, TK 60906, SB, 77, 170 MTS, 269 45.8' S, 559 52.5' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, O, , 24-Jan-96, F, TK 60906, 1 EMBRYO TTU, TK 60918, SA, 83, 170 MTS, 26 s 45.8' S, 55 s 52.5' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , , LOPEZ-GONZALES, O, 25-Jan-96, F, FA from label, 1 EMB., 18 MM TTU, TK 60939, SA, 85, 170 MTS, 26s 45.8' S, 55s 52.5' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, C, , 28-Jan-96, F, 1 EMBRYO, 36X19 MM , 232 B Q TOBAGO, ST. PATRICK CO., CMNH, 97378, SA, 13, , 11 11'N, 60 47'W, TRINIDAD TOBAGO, GRANGE, SMOLEN, MJ, 4724, 30-Oct-83, F, TK25164 a e 18'W, ARGENTINA, JUJUY, EL SIMBOLAR, 25 KM SW CMNH, 42832, SS, , , 23 59'S, 64 PALMA SOLA, BARQUEZ, 594, 30-Jun-77, M, 9 14' e 59' LEONCIO PRADO, HUANUCO, 6 KM N , 75 W, PERU, CMNH, 98752, SA*, , 9 S, TINGO MARIA, GROEN, 3381 , 7-Oct-83, M, S.lilium-TMc, 8 22' 9 58' W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM CMNH, 98758, AL, , , 9 S, 75 M, E TINGO MARIA, BAKER ET AL, 3858, 10-Oct-83, , fi 22' B 58' W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM , S, 75 CMNH, 98770, SA, , 9 E TINGO MARIA, BAKER ET AL, 4303, 10-Oct-83, M, , 9 22' a 58' LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM , S, 75 W, PERU, CMNH, 98773, SA, , 9 E TINGO MARIA, BAKER ET AL, 3874, 10-Oct-83, M, , e 22' a 58' LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM , S, 75 W, PERU, CMNH, 98779, SA, , 9 E TINGO MARIA, BAKER ET AL, 3869, 10-Oct-83, M, TK 22814, LOWER INCISORS TRILOBATED, ZYG. ARCH BROKEN 9 22' 9 58' LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM , S, 75 W, PERU, CMNH, 98783, AL, , 9 E TINGO MARIA, BAKER ET AL, 3877, 10-Oct-83, M, TK 22822, 8 22' 9 58' W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 KM , S, 75 CMNH, 98789, AL, , 9 E TINGO MARIA, BAKER ET AL, 3887, 10-Oct-83, M, TK 22832, 9° 22' fi 58' W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2 , S, 75 CMNH, 98759, SA*, , KM E TINGO MARIA, BAKER ET AL, 3859, 10-Oct-83, M, S.lilium-TMc, a e LA , 2.3 Ml BY ROAD CMNH, 79373, SS, , 500, 20 10'N, 104 49'W, MEXICO, JALISCO, SW CUESTA, DOWLER, 1395, 25-Jun-79, M, , e Q 2.3 Ml LA JALISCO, , BY ROAD CMNH, 79374, SS, , 500, 20 10'N, 104 49'W, MEXICO, SW CUESTA, DOWLER, 1396, 25-Jun-79, M, , e a 1.5 CMNH, 79398, SS, , 470, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , KM SE OJO DE M, AGUA, ROGERS, 871, 1-Jun-79, , a a 17'W, VERACRUZ, , 1.5 SE OJO DE CMNH, 79399, SS, , 470, 15 17'N, 92 MEXICO, KM AGUA, ROGERS, 872, 1-Jun-79, M, a a 17'W, , 1.5 SE OJO DE CMNH, 79400, SS, , 470, 15 17'N, 92 MEXICO, VERACRUZ, KM AGUA, ROGERS, 873, 1-Jun-79, M, , a a DE AGUA, RIO DE , 30'N, 97 59'W, MEXICO, VERACRUZ, OJO CMNH, 55741, SS, , 16 2-Apr-78, M, ATOYAC, HARVEY, 950, , a B RIO DE , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, CMNH, 55742, SS, , ATOYAC, HARVEY, 958, 2-Apr-78, M, , a a RIO DE , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, CMNH, 55743, SS, , ATOYAC, SMOLEN, 621, 30-Mar-78, M, , a e AGUA, RIO DE 55746, SS, , 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE CMNH, , ATOYAC, WILLIAMS, 3422, 1-Apr-78, M, e a , 1.5 DE CMNH, 79401, SS, , 470, 15 17'N, 92 17'W, MEXICO, VERACRUZ, KM SE OJO AGUA, ROGERS, 874, 1-Jun-79, M, a CMNH, 79402, SS, , 470, 15 17'N, 92=1 7'W, MEXICO, VERACRUZ, , 1.5 KM SE OJO DE AGUA, ROGERS, 875, 1-Jun-79, M, a a CMNH, 79404, SS, , 470, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , 1.5 KM SE OJO DE AGUA, ROGERS, 877, 1-Jun-79, M, B a CMNH, 79405, SS, , 470, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , 1.5 KM SE OJO DE AGUA, ROGERS, 878, 1-Jun-79, M, a a CMNH, 79406, SS, , 470, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , 1.5 KM SE OJO DE AGUA, ROGERS, 879, 1-Jun-79, M, a a CMNH, 79407, SS, , 470, 15 17'N, 92 17'W, MEXICO, VERACRUZ, , 1.5 KM SE OJO DE AGUA, ROGERS, 869, 1-Jun-79, M, S a CMNH, 79408, SS, , 470, 16 30'N, 97 59'W, MEXICO, VERACRUZ, OJO DE AGUA, , ROGERS, 902, 3-Jun-79, M, a a SA, , 15 16'N, 92 17'W, CHIAPAS, , 12 CMNH, 93431, , MEXICO, KM N BERRIOZABAL, SMOLEN, 2973, 6-Jan-82, M, a a CMNH, 92755, SN, , 19 00'N, 90 30'W, MEXICO, CAMPECHE, , 19-Jul-84, M, , , SCHMIDT, 99, 8 233 S 9 Ml PALENQUE, 39'W, CHIAPAS, , 3.8 SW , 15 38'N, 92 MEXICO, CMNH, 93556, SK, , SMOLEN, 3099, 10-Jan-82, M, 9 S MSB, 75549, SB, 35, 8, 19 35'N, 96 22'W, MEXICO, VERACRUZ, MORRO DE LA MANCHA 6-5 on label FIELD STATION, , ZALLES, M., 162, 9-Nov-92, M, Testes (?) 8 9 E ALAMOS, BY ROAD, 50'N, 39'W, SONORA, , 18 KM MSB, 53755, SB, 34, , 26 105 MEXICO, ON RIO CUCHUJAQUI, ENGLE, K., 7, 27-Oct-80, M, Very young individual, clear dorsal pelage, sharp dentition. e fi ROAD, SONORA, , 18 KM E ALAMOS, BY MSB, 53760, SB, 44, , 26 50'N, 105 39'W, MEXICO, ON RIO CUCHUJAQUI, WARREN, DJ, 54, 27-Oct-80, M, Testes 5x4 e Q RIO TAMAULIPAS, , 3 KM CALABAZAS, AL, , 26 08'N, 99 01'W, MEXICO, W TTU, 44790, , SABINAS, HOLLANDER, RR, 957, 8-Aug-84, M, e a CALABAZAS, RIO , TAMAULIPAS, , 3 KM SB, , 26 08'N, 99 01'W, MEXICO, W TTU, 44791 , SABINAS, HOLLANDER, RR, 958, 8-Aug-84, M, e e LORENZO, 36'W, VALLE, , 13 KM SSW SAN TTU, AL, , 14 08'N, 88 HONDURAS, 61103, , BRADLEY, RD, 636, 9-Aug-91, M, e 9 S, 1 .5 OF 1 1 ROO, , 6 KM KM SB, , 4'N, 89 01 'W, MEXICO, QUINTANA W ASNHC, 6949, 91 , from label testes= 5x4, TRES GARANTIAS, DOWLER, L, , 4-Jun-90, M, tragus=6, FA 38, scrotal, FN32678 S 9 , ESCARCEGA, ASNHC, 6935, SN, 89, , 18 37'N, 90 43'W, MEXICO, CAMPECHE, 7 KM W DOWLER, L, , 6-Jun-90, M, tragus=6, FA from label 40, testes= 7x4, scrotal, FN32725 e a LSU, 25178, SB, 28, 200, 09 56'N, 84 05'W, COSTA RICA, SAN JOSE, , 14 KM BY ROAD S LA GLORIA, BARKLEY, L.J. , 1963, 24-May-82, M, FA taken from skeleton, testes, 4 mm, tragus=7, tissue available. e 9 49'N, DARIEN, CANA, , HAFNER, D.J., 2422, LSU, 25477, SB, , 500, 07 77 43'W, PANAMA, 25-Jan-83, M, FA taken from skeleton, testes scrotal, 6mm, tragus=6, tissue available. fi S LSU, 25478, SB, 29, 500, 07 49'N, 77 43'W, PANAMA, DARIEN, CANA, , HAFNER, D.J., 1161, 26-Jan-83, M, FA taken from skeleton, testes scrotal, 5mm, tragus=6, tissue available. TTU, TK 60907, SB, 78, 170 MTS, 26s 45.8' S, 559 52.5' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, O, , 24-Jan-96, M, TESTES 6X3, FA FROM LABEL TTU, TK 60908, SB, 79, 170 MTS, 269 45.8' S, 55s 52.5' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, O, , 24-Jan-96, M, SUBADULT, TESTES 4X3, FA FROM LABEL TTU, TK 60909, SB, 80, 170 MTS, 269 45.5' S, 55s 51.7' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, O, , 24-Jan-96, M, TESTES 5X3 TTU, TK 60910, SA, 81, 170 MTS, 269 45.5' S, 55s 51.7' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, O, , 24-Jan-96, M, TTU, TK 60919, SA, 84, 170 MTS, 269 45.5' S, 55s 51.7' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, O, , 26-Jan-96, M, FA FROM LABEL TTU, TK 60940, SB, 86, 170 MTS, 269 45.5' S, 55s 51 .7' W, PARAGUAY, ITAPUA, PN SAN RAFAEL, , LOPEZ-GONZALES, O, , 28-Jan-96, M, TESTES 6X3, FA FROM LABEL 9 14' s 57' MVZ, 185642, AL, 160, , 23 S, 46 W, BRAZIL, SAO PAULO, JAPI, SERRA DO JAPI E ERMIDA, MUNICIPIO JUNDAI, DITCHFIELD, A., 452, 18-Nov-93, M, 9 45' 9 MSB, 55899, SB, 39, 675 MTS, 20 S, 63 13 W, BOLIVIA, CHUQUISACA, , 1.5 KM NW PORVENIR, YATES, T.L, 1225, 9-Jul-85, M, a e CMNH, 42834, SS, , 23 59'S, 64 18'W, JUJUY, EL 25 , ARGENTINA, SIMBOLAR, KM SW PALMA SOLA, BARQUEZ-OJEDA, 607, 2-Jul-77, M, e 9 CMNH, 42841, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, 24 , ORAN, KM NW AGUAS BLANCAS, MARES, 1917, 19-Jul-71, M, 9 9 CMNH, 42842, SS, , 22 44'S, 64 22'W, 24 , ARGENTINA, SALTA, ORAN, KM NW AGUAS BLANCAS, MARES, 1918, 19-Jul-71, M e 9 CMNH, 72345, SS, , 24 40'S, 64 35'W, , ARGENTINA, SALTA, PN EL REY, ARROYO DE LOS NOQUES, BARQUEZ, 688, 20-Apr-80, M 9 9 CMNH, , 24 64 72346, SS, , 40S, 35'W, ARGENTINA, SALTA, PN EL REY, ARROYO DE LOS NOQUES, BARQUEZ, 689, 20-Apr-80, M 9 9 CMNH, 72347, , 24 40'S, SS, , 64 35'W, ARGENTINA, SALTA, PN EL REY, ARROYO DE LOS NOQUES, BARQUEZ, 690, 20-Apr-80, M 234 8 S SALTA, PIQUIRENDA VIEJO, 30 KM N 72349, SS, , 22 32'S, 63 49'W, ARGENTINA, CMNH, , TARTAGAL, BARQUEZ, 711, 10-May-80, M e e SALTA, PN EL REY, ARROYO DE LOS 72334, SS, , 24 40'S, 64 35'W, ARGENTINA, CMNH, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 660, 19-Apr-80, M 9 e35'W, ARGENTINA, SALTA, PN EL REY, ARROYO DE LOS , 24 40'S, 64 CMNH, 72336, SS, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 662, 19-Apr-80, M Q e SALTA, EL REY, DE LOS , 24 40'S, 64 35'W, ARGENTINA, PN ARROYO CMNH, 72338, SS, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 664, 19-Apr-80, M 9 e SALTA, PN EL REY, ARROYO DE LOS 72339, SS, , 24 40'S, 64 35'W, ARGENTINA, CMNH, , PUESTOS, 200 MTS DE ENTRADA, BARQUEZ, 665, 19-Apr-80, M a e MOLLE, 15 KM 42865, SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO W CMNH, , S.M.TUCUMAN, MARES, 2213, 29-Sep-72, M 9 e MOLLE, 15 KM SS, , 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO W CMNH, 42872, , 26 S.M.TUCUMAN, MARES, 2241 , 29-Sep-72, M 9 S MOLLE, SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMANTUCUMAN, HORCO CMNH, 42873, , 15 KM W S.M.TUCUMAN, MARES, 2242, 29-Sep-72, M e 9 MOLLE, 42875, SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMANTUCUMAN, HORCO CMNH, , 15 KM W S.M.TUCUMAN, MARES, 2247, 29-Sep-72, M 9 9 24 42847, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, KM NW AGUAS CMNH, , BLANCAS, MARES, 1923, 19-Jul-71, M 9 9 42850, SS, , 22 44'S, 64 22'W, ARGENTINA, SALTA, ORAN, 24 KM NW AGUAS CMNH, , BLANCAS, MARES, 1927, 19-Jul-71, M fi S CMNH, 42859, SS, , 26 49'S, 65 13'W, ARGENTINA, TUCUMAN, HORCO MOLLE, 15 KM , W S.M. TUCUMAN, MARES, 2207, 29-Sep-72, M s 05' 9 43' CMNH, 63413, SA, 5, , 12 N, 61 W, GRENADA, ST. GEORGE, , .5 KM E VENDOME, GENOWAYS, 4161, 25-May-80, M 9 9 , 04 53'N, 52 17'W, GUIANA, , 1.5 NE REMIRE, WILLIAMS, SA, FRENCH , KM CMNH, 83955, , 7115, 25-Jan-89, M 9 e SA, , 04 53'N, 52 17'W, GUIANA, , 1.5 NE REMIRE, WILLIAMS, CMNH, 83959, FRENCH , KM , 7119, 25-Jan-89, M e S SA, , 04 53'N, 52 17'W, GUIANA, , 1.5 NE REMIRE, WILLIAMS, CMNH, 83961, FRENCH , KM , 7121,25-Jan-89, M. Sturnira ludovici Antony 1 924. 9 S CMNH, 78562, SA, , 07 2rN, 62 32'W, VENEZUELA, BOLIVAR, , .5 KM E EL MANTECO, , HAIDUK, 355, 30-Jan-81,F, , 9 fi CMNH, 78563, SA, , 07 21'N, 62 32'W, VENEZUELA, BOLIVAR, , .5 E EL MANTECO, , KM HAIDUK, 356, 30-Jan-81, F, , 9 9 CMNH, 78565, SA, , 07 21'N, 62 32'W, VENEZUELA, BOLIVAR, , .5 E EL , KM MANTECO, HAIDUK, 358, 30-Jan-81,F,, S 9 CMNH, 112825, SC, , 970 MTS, 01 00'N, 78 14'W, ECUADOR, CARCHI, EL PAILON, PAI RIVER, MCCARTHY & MANZANO, 7712, 20-Dec-91, F, SP 10775, FA on label=46.1, juvenil CMNH, 112826, SC, 177, 970 MTS, 01 900'N, 78 S 14'W, ECUADOR, CARCHI, EL PAILON, PAI RIVER, MCCARTHY & MANZANO, 7730, 20-Dec-91, F, SP 10784, FA on label= 45.1 Q e CMNH, 112827, SA, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY, 7512, 23-Nov-91, F, SP 10659, pregnant (looks full term) e fi CMNH, 112828, SB, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY & MANZANO, 7519, 24-Nov-91, F, SP 10660, FA on label= 47.1 e 9 CMNH, 112831, SA, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY, 7524, 25-Nov-91, F, SP 10663, 9 fi CMNH, 112832, SB, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY & MANZANO, 7525, 25-Nov-91, F, , FA on label= 45.9 , , 235 948'N, fi27'W, ECUADOR, ESMERALDAS, CRISTAL, CMNH, 112837, SA, , 1, 200 MTS, 00 78 OVER STREAM, IN PASTURE, MCCARTHY, 7886, 1-Jan-92, F, SP 10851, Q fi ESMERALDAS, , E OF CMNH, 112840, AL, , 700 MTS, 00 48'N, 78 27'W, ECUADOR, CRISTAL, W OF SLOPES ABOVE LITA, MCCARTHY, 7880, 1-Jan-92, F, SP 10849, skull is with alcoholic specimen Q 2 BARINAS, , 25 KM -BY ROAD- NW , 08 45'N, 70 24'W, VENEZUELA, CMNH, 78557, SS, , BARINITAS, HAIDUK, 354, 22-Feb-81, M, e e BOLIVAR, , .5 E EL MANTECO, SA, , 07 21'N, 62 32'W, VENEZUELA, KM CMNH, 78561, , HAIDUK, 351, 30-Jan-81 , M, e 8 BOLIVAR, , .5 E EL MANTECO, SA, , 07 21'N, 62 32'W, VENEZUELA, KM CMNH, 78564, , HAIDUK, 357, 30-Jan-81, M, fi 2 BOLIVAR, , .5 E EL MANTECO, SA, , 07 21'N, 62 32'W, VENEZUELA, KM CMNH, 78566, , HAIDUK, 360, 30-Jan-81 , M, e Q BARINAS, , 25 -BY ROAD- SA, , 08 45'N, 70 24'W, VENEZUELA, KM NW CMNH, 78572, , BARINITAS, HAIDUK, 359, 22-Feb-81, M, S fi BARINAS, , 25 -BY ROAD- 78573, SA, , 08 45'N, 70 24'W, VENEZUELA, KM NW CMNH, , BARINITAS, HAIDUK, 361, 22-Feb-81, M, , S B CMNH, 112829, SA, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY, 7520, 24-Nov-91, M, SP10661, FA on label= 47.6 S Q CMNH, 112830, SA, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY, 7523, 25-Nov-91, M, SP10662, Q 8 CMNH, 112833, SB, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY & MANZANO, 7526, 25-Nov-91, M, , FA on label = 49.5, testes 6x4 Q S CMNH, 112834, SA, , 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO PIEDRAS, MCCARTHY, 7547, 26-Nov-91, M, LAS , 9 S CMNH, 112835, SB, 178, 1, 200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, LOS PAMBILES CAMP, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, RIO LAS PIEDRAS, MCCARTHY & MANZANO, 7561, 27-Nov-91, M, SP 10677, FA on label= 48.6, testes 7.5x5 9 fi CMNH, 112836, SA, , 1, 200 MTS, 00 48'N, 78 27'W, ECUADOR, ESMERALDAS, CRISTAL, IN 1-Jan-92, M, OVER STREAM, PASTURE, MCCARTHY, 7882, , e S CMNH, 112838, SC, 176, 700 MTS, 00 48'N, 78 27'W, ECUADOR, ESMERALDAS, , E OF CRISTAL, W OF SLOPES ABOVE LITA, MCCARTHY, 7789, 30-Dec-91, M, SP 10805, FA on label= 47.2, testes 7x5.5 e Q CMNH, 112839, SC, , 700 MTS, 00 48'N, 78 27'W, ECUADOR, ESMERALDAS, , E OF CRISTAL, W OF SLOPES ABOVE LITA, MCCARTHY, 7790, 30-Dec-91, M, SP 10806, FA on label= 45.5, testes 6x4 S S MCZ"**, 27333, SS, , 1, 218 MTS, 00 07'N, 78 44'W, ECUADOR, PICHINCHA, , NEAR GUALEA, W SIDE PICHINCHA MOUNTAIN, S6DERSTROM, LUDOVIC, 310, 1-Jun-23, M, TOPOTYPE, M1 much wider at metacone than at paracone., 8 9 MCZ, 27334, SS, , 610 MTS, 00 02'S, 78 48'W, ECUADOR, PICHINCHA, , PACHIJAL (RIO?), BELOW MINDO, S6DERSTROM, LUDOVIC, 249, 1-Dec-24, M, ALTHOUGH ALT. ON LABEL IS 61 MTS, ON THE MAP, MINDO IS BETWEEN 1 , 200 AND 1 , 500 MTS., . Sturnira magna de la Torre 1966. S S LSU, 28261, SB, , 110 MTS, 03 00'S, 72 30'W, PERU, LORETO, , QUEBRADA ORAN, 5 KM N RIO AMAZONAS, 85 KM NE IQUITOS, CHUPASKO, J.M., 51, 8-Jun-84, F, Tissue available, non-parous, measurements from label, tragus=8. S CMNH, AL, , 98775, , 09°22'S, 75 58'W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2KM E TINGO MARIA, BAKER, RJ, ET AL, 3622, 1 0-Oct-83, F, 236 9 Q LEONCIO PRADO, HUANUCO, 9 KM S, 2KM SA, , 09 22'S, 75 58'W, PERU, CMNH, 98776, , E TINGO MARIA, BAKER, RJ, ET AL, 3623, 14-Oct-83, F, e05' fi 37'W, ECUADOR, NAPO PASTAZA, LIMON COCHA, MSU, 20420, SS?, , 300 MTS, S, 76 trilobated, McCarthy's loan from Michigan , FUGLER, C., 16784, 22-Jul-65, F, lower incisors Tim State University 9 a 20' , ESTACION ROM, 104000, SB, , 150 MTS, S, 73 30'W, ECUADOR, NAPO, P.N.YASUNI, CIENTIFICA ONKONE GARE, 38 KM S POMPEYA SUR, ENGSTROM, REID, SORNOZA, F37088, 6-Jan-95, F, slight shelf on M1, lactating, tragus:9mm, some ext. meas. from label, Alt. Approx. Q30' 9 , P.N.YASUNI, 42 KM S, 1 ROM, 104043, SA, , 150 MTS, S, 74 30'W, ECUADOR, NAPO, KM E POMPEYA SUR, ENGSTROM, REID, SORNOZA, F37148, 10-Jan-95, F, PREGNANT, alt. approx., TRAGUS: 9mm s 9 SALADERO, ROM, 104514, SB, , 150 MTS, 2O S, 73 30'W, ECUADOR, NAPO, EL P.N.YASUNI, 76 KM S POMPEYA SUR, ENGSTROM, REID, SORNOZA, F37361, 19-May-95, F, slight shelf on M1, 1 emb:25 mm, tragus:8mm, some ext. meas. from label, alt. Approx. 938' S ROM, 105622, SB, , 150 MTS, S, 76 27'W, ECUADOR, NAPO, , P.N.YASUNI, 35 KM S POMPEYA SUR, ENGSTROM, LIM, SORNOZA, F37867, 16-Feb-96, F, slight shelf on M1, subadult, tragus:9mm, some ext. meas. from label, alt. Approx. 9 S N LSU, 28262, SB, , 1 10 MTS, 03 00'S, 72 30'W, PERU, LORETO, , QUEBRADA ORAN, 5 KM RIO AMAZONAS, 85 KM NE IQUITOS, CHUPASKO, J.M., 200, 25-Jun-84, F, Tissue available:LHK, 1 embryo on left horn, 45 mm, aborted, tragus=8. 9 858'W, 9 KM S, CMNH, 98774, SS, 19, , 09 22'S, 75 PERU, LEONCIO PRADO, HUANUCO, 2KM E TINGO MARIA, BAKER, RJ, ET AL, 3449, 10-Oct-83, M, S 9 98777, AL, , 09 22'S, 75 58'W, PERU, LEONCIO PRADO, HUANUCO, 9 KM S, 2KM E CMNH, , TINGO MARIA, BAKER, RJ, ET AL, 3650, 14-Oct-83, M, 9 S 41' 1 ROM, 105683, SB, , 150 MTS, S, 76 24'W, ECUADOR, NAPO, , P.N.YASUNI, KM S ESTACION CIENTIFICA YASUNI, ENGSTROM, LIM, SORNOZA, F37929, 20-Feb-96, M, Testes: 8x7slight shelf on M1, tragus:8mm, some ext. meas. from label, alt. Approx 945' e ROM, 105763, SA, , 300, S, 76 46'W, ECUADOR, NAPO, , P.N.YASUNI, 30 KM NE ESTACION CIENTIFICA ONKONE GARE, ENGSTROM, LIM, SORNOZA, F40056, 26-Feb-96, M, Testes: 4x2, tragus:8mm, some ext. meas. from label, alt. approx. 9 9 USNM, 339996, SS, , 275 MTS, 10 34S, 75 24'W, PERU, PASCO, OXAPAMPA, SAN JUAN, TUTTLE, A.L., 1837, 13-Aug-64, M, TESTES 7x6 9 07' 9 57' USNM, 574614, AL, , 300 MTS, 01 S, 76 W, ECUADOR, PASTAZA, TIGUINO , 130 KM S OF COCA, JACOBS, J.F., 745, 27-Aug-90, M, S Q LSU, 28288, SB, , 110 MTS, 03 00'S, 72 30'W, PERU, LORETO, , QUEBRADA ORAN, 5 KM N RIO AMAZONAS, 85 KM NE IQUITOS, BARKLEY, L.J., 2165, 8-Jun-84, M, Tissue available, testes inguinal, 8 mm, tragus=8. 9 9 LSU, 28289, SB, 32, 110 MTS, 03 00'S, 72 30'W, PERU, LORETO, , QUEBRADA ORAN, 5 KM N RIO AMAZONAS, 85 KM NE IQUITOS, BARKLEY, L.J., 2171, 9-Jun-84, M, Tissue available, testes abdominal, 4 mm, tragus=9; weight from label=34 grs., but it seems a mistake, it is a young adult-subadult. Sturnira mordax (Goodwin 1938). 9 9 CMNH, 92487, SS, 211, , 10 25'N, 84 25'W, COSTA RICA, ALAJUELA, , 4.2 KM SE CARIBLANCO, MCCARTHY, T.J., 6794, 12-Feb-83, F, preg., AK7069, field measuremenst from tag, but not FA S S USNM, 562841, SS, , 1, 000 MTS, 10 18'N, 84 05'W, COSTA RICA, HEREDIA, SAN MIGUEL, P.N.BRAULIOCARRILLO, 3.5 KM S, 11.5 KM E OF S. MIGUEL, WILSON, D.E., 6390, 6-Apr- 86, F, present a shelf or muesca on M1 9 9 USNM, 562843, SS, , 1, 000 MTS, 10 18'N, 84 05'W, COSTA RICA, HEREDIA, SAN MIGUEL, P.N.BRAULIOCARRILLO, 3.5 KM S, 11.5 KM E OF S. MIGUEL, WILSON, D.E., 6392, 6-Apr- 86, F, present a shelf or muesca on M1, menos pronunciada que en especimen anterior e 9 USNM, 562844, SS, , 1, 000 MTS, 10 18'N, 84 05'W, COSTA RICA, HEREDIA, SAN MIGUEL, P.N.BRAULIOCARRILLO, 3.5 KM S, 11.5 KM E OF S. MIGUEL, WILSON, D.E., 6393, 6-Apr- 86, F, present a shelf or muesca on M1 237 e 18'N, S05'W, COSTA RICA, HEREDIA, SAN MIGUEL, USNM, 562833, SS, , 700 MTS, 10 84 P.N.BRAULIO CARRILLO, 1 KM S, 11.5 KM E OF S. MIGUEL, WILSON, D.E., 6371, 4-Apr-86, F, no present muesca, con una pieza extra on labial side of RM3 S 18'N, 84 fi 05'W, COSTA RICA, HEREDIA, SAN MIGUEL, USNM, 562835, SS, , 1, 000 MTS, 10 P.N.BRAULIO CARRILLO, 3.5 KM S, 11.5 KM E OF S. MIGUEL, LAVAL, R.K., 3424, 9-Apr-86, F, on label: 1 embryo 26, present a shelf or muesca on M1 e 9 PUNTARENAS, SAN VITO DE JAVA, SA, , 50'N, 82 58'W, COSTA RICA, USNM, 349926, , 08 FINCA LAS CRUCES, NEAR SAN VITO DE JAVA, WILSON, D.E., 2757, 14-Jul-73, F, no present muesca, specimen badly damage (teeth and occipital condyle, zygomatic arches. Q e 58'N, 40'W, PANAMA, BOCAS DEL TORO, , FISH USNM, 520702, SS, , 1, 500 MTS, 08 82 CAMP, ENDERS, R.K., 1011, 26-Mar-76, F, present a slight shelf or muesca on M1, 1 EMBRYO:11mm S 9 57'N, 42'W, PANAMA, BOCAS DEL TORO, , USNM, 520706, SS, , 1, 676-1, 800 MTS, 08 82 MIDWAY(=LOWER CAMP 2180 M 1975), ENDERS, R.K., 1023, 27-Mar-76, F, embryo: 12 mm 9 17'N, 81 952'W, PANAMA, BOCAS DEL TORO, USNM, 541096, SS, , 1, 425-1, 500 MTS, 08 CHIRIQUi, 25 KM NNE SAN FELIX, PINE, R.H., 8302, 13-Jun-80, F, mammae enlarged, abundant shoulder secretion on prepared skin Q S RICA, ALAJUELA, , 4.2 KM SE CARIBLANCO, SS, , 10 25'N, 84 25'W, COSTA CMNH, 92488, , MCCARTHY, T.J., 6795, 12-Feb-83, F, preg., 1 emb, AK7070, field measurements from tag, but not FA e e RICA, ALAJUELA, , 4.2 SE CARIBLANCO, , 10 25'N, 84 25'W, COSTA KM CMNH, 92486, SS, , MCCARTHY, T.J., 6783, 12-Feb-83, M, testes 4X2, AK7060, field measurements from tag, but not FA 9 e DEL TORO, , FISH USNM, 520703, SS, , 1, 500 MTS, 08 58'N, 82 40'W, PANAMA, BOCAS CAMP, ENDERS, R.K., 1012, 24-Mar-76, M, present a slight shelf or muesca on M1 9 9 DEL TORO, , FISH USNM, 520704, SS, , 1, 500 MTS, 08 58'N, 82 40'W, PANAMA, BOCAS CAMP, ENDERS, R.K., 1015, 25-Mar-76, M, present a slight shelf or muesca on M1 9 e 38'W, CHIRIQUI', , 1.5 KM E CUESTA USNM, 331577, SS, , 850 MTS, 08 41'N, 82 PANAMA, DE PIEDRA, TYSON, E.L., 939, 5-Apr-62, M, present a slight shelf or muesca on M1 , lower inner incisors slightly trilobated 9 9 46'N, 38'W, CHIRIQUI', , 6 S EL USNM, 331579, SS, , 1, 100 MTS, 08 82 PANAMA, KM VOLCAN, TYSON, E.L., 1163, 26-Apr-62, M, 9 9 MIGUEL, USNM, 562842, SS, , 1, 000 MTS, 10 18'N, 84 05'W, COSTA RICA, HEREDIA, SAN P.N.BRAULIO CARRILLO, 3.5 KM S, 11.5 KM E OF S. MIGUEL, WILSON, D.E., 6391, 6-Apr- 86, M, present a slight shelf or muesca on M1 9 9 USNM, 562850, SS, , 850 MTS, 10 18'N, 84 05'W, COSTA RICA, HEREDIA, SAN MIGUEL, P.N.BRAULIO CARRILLO, 1 KM S, 11.5 KM E OF S. MIGUEL, LAVAL, R.K., 3437, 11-Apr-86, M, present a slight shelf or muesca on M1 , TESTES: 2X3 mm, UPPER INNER INCISORS bilobated. 9 B USNM, 562836, SS, , 700 MTS, 10 18'N, 84 05'W, COSTA RICA, HEREDIA, SAN MIGUEL, P.N.BRAULIO CARRILLO, 1 KM S, 11.5 KM E OF S. MIGUEL, WILSON, D.E., 6348, 4-Apr-86, M, 9 9 USNM, 562838, SS, , 700 MTS, 10 18'N, 84 05'W, COSTA RICA, HEREDIA, SAN MIGUEL, P.N.BRAULIO CARRILLO, 1 KM S, 11.5 KM E OF S. MIGUEL, WILSON, D.E., 6387, 6-Apr-86, M, present a slight shelf or muesca on M1 , missing R pm2 and m3 2 9 520828, SA, , 1, 900-2, 100 MTS, 08 56'N, 82 42'W, PANAMA, BOCAS DEL TORO, USNM, , FIRST WATER (=UPPER CAMP 1975), ENDERS, R.K., 1030, 28-Mar-76, M, present a slight shelf or muesca on M1 e 9 USNM, 520829, SA, , 1, 900-2, 100 MTS, 08 56'N, 82 42'W, PANAMA, DEL TORO, BOCAS , FIRST WATER (=UPPER CAMP 1975), ENDERS, R.K., 1032, 28-Mar-76, M, present a slight shelf or muesca on M1 9 9 USNM, 520830, SA, , 1, 900-2, 100 MTS, 08 56'N, 82 42'W, PANAMA, BOCAS DEL TORO, , FIRST WATER (=UPPER CAMP 1975), ENDERS, R.K., 1033, 28-Mar-76, M, present a slight shelf or muesca on M1 S 9 USNM*", 250310, SS, , 55'N, 07'W, RICA, , 09 84 COSTA PERALTA, EL SAUCE, FARM ON ATLANTIC RAILROAD, UNDERWOOD, 543, 14-Jul-31, M, TYPE SPECIMEN. . 238 Sturnira nana Gardner & O'Neil 1971 fi e 47'W, PERU, AYACUCHO, HUANHUACHAYO, , LSU, 16521, SS, , 1, 660, 12 44'S, 73 GARDNER, AL, 11692, 8-May-71, F, ON TAG: 54-0-9-1 5-6=1 OGR, NOSE LEAF PARAMETERS MEASURED ON DRY SKIN fi e LSU, 16522, SS, 243, 1, 660, 12 44'S, 73 47'W, PERU, AYACUCHO, HUANHUACHAYO, , 54-0-1 0-1 GARDNER, AL, 1 1 702, 8-May-71 , F, ON TAG: 5-6=9GR, NOSE LEAF PARAMETERS MEASURED ON DRY SKIN S e 47'W, PERU, AYACUCHO, HUANHUACHAYO, , LSU, 16524, SS, , 1, 660, 12 44'S, 73 GARNER, AL, 11708, 9-May-71, F, ON TAG: 53-0-8-15-5=?, NOSE LEAF PARAMETERS MEASURED ON DRY SKIN RIO SANTA ROSA, LSU, 16519, S&PS, 240, 1, 006, , PERU, AYACUCHO, SAN JOSE, GARDNER, AL, 11620, 30-Apr-71, M, ON TAG: 51 -0-8-1 5-6=1 OGR, NOSE LEAF PARAMETERS MEASURED ON DRY SKIN fi a LSU, 16523, SS, 242, 1, 660, 12 44'S, 73 47'W, PERU, AYACUCHO, HUANHUACHAYO, , O'NEIL, JP, 4227, 9-May-71,M, ON TAG: 49-0-6-8=?, NOSE LEAF PARAMETERS MEASURED ON DRY SKIN. Sturnira oporaphilum (Tschudi 1844). Q Q LEONCIO PRADO, 9 KM S, 2 KM E , 58'W, PERU, HUANUCO, CMNH, 98762, AL, , 09 22'S, 75 TINGO MARIA, BAKER ET AL, 3863, 10-Oct-83, F, e Q LEONCIO PRADO, 9 KM S, 2 KM E AL, , 09 22'S, 75 58'W, PERU, HUANUCO, CMNH, 98763, , TINGO MARIA, BAKER ET AL, 3864, 10-Oct-83, F, S B LEONCIO PRADO, 9 KM S, 2 KM E , 22'S, 75 58'W, PERU, HUANUCO, CMNH, 98764, AL, , 09 TINGO MARIA, BAKER ET AL, 3865, 10-Oct-83, F, 9 e 58'W, PERU, LEONCIO PRADO, 9 KM S, 2 KM SA, , 09 22'S, 75 HUANUCO, CMNH, 98784, , E TINGO MARIA, BAKER, R.J., 3878, 10-Oct-83, F, TK 22823 S e58'W, HUANUCO, LEONCIO PRADO, 9 KM S, 2 KM SA, , 09 22'S, 75 PERU, CMNH, 98786, , E TINGO MARIA, BAKER, R.J., 3881, 10-Oct-83, F, TK 22826 fi Q LEONCIO PRADO, 9 KM S, 2 KM SA, , 09 22'S, 75 58'W, PERU, HUANUCO, CMNH, 98788, , E TINGO MARIA, BAKER, R.J., 3885, 10-Oct-83, F, TK 22830 Q a LEONCIO PRADO, 9 KM S, 2 KM SA, , 09 22'S, 75 58'W, PERU, HUANUCO, CMNH, 98792, , E TINGO MARIA, BAKER, R.J., 4318, 10-Oct-83, F, V., AS, , BALSAS, PACHECO, FMNH, 128919, SB, 74, 1, 018 MTS, , PERU, AMAZON 3 KM E 403, 29-Apr-87, F, non-lactating, tragus: 6 mm, FA from label: 46 BY , UTCUBAMBA, 15 ROAD , FMNH, 128920, SB, , 1, 097 MTS, PERU, AMAZONAS, RIO KM N OF PEDRO RUIZ, PACHECO, V., 524, 17-May-87, F, lactating, tragus: 6 mm, FA from label: 44 S 9 RIO ZANA, 2 KM N FMNH, 128926, SB, , 1, 244 MTS, 07 41'S, 79 21'W, PERU, CAJAMARCA, OF MONTE SECO, PACHECO, V., 602, 25-May-87, F, lactating, tragus: 5 mm, FA from label: 45 S38'N, 71 fi 04'W, MERIDA, 4 E USNM, 373798, SS, , 2107 MTS, 08 VENEZUELA, LAMUCUY, KM TABAY, S.I. PROJECT, 4012, 8-Mar-66, F, 1 EMBRYO e a CMNH, 98755, SA*, 2, , 09 22'S, 75 58'W, PERU, HUANUCO, LEONCIO PRADO, 9 KM S, 2 KM E TINGO MARIA, BAKER ET AL, 3855, 10-Oct: 83, M, S.oporaphilum-TMc S Q CMNH, 98756, SA*, , 09 22'S, 75 58'W, PERU, HUANUCO, LEONCIO PRADO, 9 KM S, 2 KM , E TINGO MARIA, BAKER ET AL, 3856, 10-Oct-83, M, S.oporaphilum-TMc e Q CMNH, 98757, SA*, , 09 22'S, 75 58'W, PERU, HUANUCO, LEONCIO PRADO, 9 KM S, 2 KM , E TINGO MARIA, BAKER ET AL, 3857, 10-Oct-83, M, S.oporaphilum-TMc S S CMNH, 98770, SA, , 09 22'S, 75 58'W, PERU, HUANUCO, LEONCIO PRADO, 9 KM S, 2 KM , E TINGO MARIA, BAKER ET AL, 4303, 10-Oct-83, M, MSB, 70584, SB, 43, 960 MTS, 17s 6.5' S, 65 s 33' W, BOLIVIA, COCHABAMBA, EL PALMAR, RIO COCHIMAYU, CHAVEZ, MA, 180, 8-Jul-93, M, testes 6x4, dark brown dorsally, M1 w, shelf e Q CMNH, 98780, SA, , 09 22'S, 75 58'W, PERU, 9 S, 2 , HUANUCO, LEONCIO PRADO, KM KM E TINGO MARIA, BAKER ET AL, 3870, 10-Oct-83, M, TK 22815 239 e fi 58'W, PERU, HUANUCO, LEONCIO PRADO, 9 KM S, 2 KM CMNH, 98781, SA, , , 09 22'S, 75 E TINGO MARIA, BAKER ET AL, 3872, 10-Oct-83, M, TK 22817 927'N, 72B26'W, VENEZUELA, TACHIRA, BUENA VISTA, 35 USNM, 440088, SS, , 2380 MTS, 07 KM S, 22 KM W SAN CRISTOBAL, S.I. PROJECT, 21910, 14-Mar-68, M, incisors bilobated, missing upper , PERU, SYNTYPE, lower MGENEVE, 1021, S**", , , M3's, seems to be a male, eppauleted marks. Sturnira sp. A (undescribed species made available to me through the courtesy of Timothy J. McCarthy and Luis Albuja V.) CMNH, 112804, SB, 225, 1200 MTS, 00 fi 32'N, 78fi 38'W, ECUADOR, ESMERALDAS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7508, 23-Nov-91, F, measures from label, no lact., no preg., tissue available SP 10655 S32'N, Q38'W, ECUADOR, ESMERALDAS, RESERVA CMNH, 112806, SA, , 1200 MTS, 00 78 ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7510, 23-NOV-91, F, SP10657 S S38'W, ECUADOR, ESMERALDAS, RESERVA CMNH, 112808, SS, , 1200 MTS, 00 32'N, 78 ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7528, 25-Nov-91, F, measures from label fi 32'N, 78e38'W, ECUADOR, ESMERALDAS, RESERVA CMNH, 112809, SA, , 1200 MTS, 00 ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7529, 25-Nov-91, F, SP10664 S32'N, 78838'W, ECUADOR, ESMERALDAS, RESERVA CMNH, 112811, SA, , 1200 MTS, 00 ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7531, 25-NOV-91, F, SP10666 S32'N, Q38'W, ECUADOR, ESMERALDAS, RESERVA CMNH, 112813, SS, , 1200 MTS, 00 78 ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7550, 26-Nov-91, F, measures from label, no lact., no preg., tissue available SP 10672 932'N, 78S 38'W, ECUADOR, ESMERALDAS, RESERVA CMNH, 112815, SS, , 1200 MTS, 00 ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J.,7552, 26-Nov-91,F, measures from label, no lact., no preg. e S ESMERALDAS, RESERVA CMNH, 112817, SS, , 1200 MTS, 00 32'N, 78 38'W, ECUADOR, ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7554, 26-Nov-91, F, measures from label, no lact., no preg. Q S 38'W, RESERVA CMNH, 112818, SA, , 1200 MTS, 00 32'N, 78 ECUADOR, ESMERALDAS, ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7557, 27-Nov-91, F, SP10673 932'N, 938'W, ESMERALDAS, RESERVA CMNH, 112819, SA, , 1200 MTS, 00 78 ECUADOR, ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7558, 27-Nov-91, F, SP10674 9 32'N, fi RESERVA CMNH, 112820, SA, , 1200 MTS, 00 78 38'W, ECUADOR, ESMERALDAS, ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7559, 27-NOV-91, F, SP10675 S 9 CMNH, 112805, SS, , 1200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7509, 23-Nov-91, M, measures from label, testes 3.5X2, tissue available SP 10656 e S CMNH, 112807, SA, , 1200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7511, 23-Nov-91, M, SP10658 fi fi CMNH, 112810, SA, , 1200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7530, 25-Nov-91, M, SP10665 , 240 CMNH, 112812, SS, 180, 1200 MTS, 00Q32'N, 78S 38'W, ECUADOR, ESMERALDAS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7549, 26-Nov-91, M, measures from label, testes 3.5X3, tissue available SP 10671 Q32'N, S ESMERALDAS, RESERVA CMNH, 112814, SS, , 1200 MTS, 00 78 38'W, ECUADOR, ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7551 , 26-Nov-91 , M, measures from label, testes 4X2 fi 32'N, e38'W, ESMERALDAS, RESERVA CMNH, 112816, SS, , 1200 MTS, 00 78 ECUADOR, ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7553, 26-Nov-91, M, measures from label, testes 8X6 S fi CMNH, 112821, SA, , 1200 MTS, 00 32'N, 78 38'W, ECUADOR, ESMERALDAS, RESERVA ECOLOGICA COTACACHI-CAYAPAS, TOISAN MTS., ALONG RIO LAS PIEDRAS, LOS PAMBILES CAMP., MCCARTHY, T.J., 7560, 27-Nov-91, M, SP10676. Sturnira sp. B (undescribed species made available to me through the courtesy of Timothy J. McCarthy and Luis Albuja V.) 450-460 e32'N, fi ESMERALDAS, CMNH, 112823, SA, 181, MTS, 00 79 17'W, ECUADOR, , NEAR NUEVA VIDA, 1.9 KM N, 10.4 KM E CODESA-SADE COMPOUND AT RIO ESMERALDAS, MANZANO, I. AND MCCARTHY, T.J., 7709, 11-Dec-91, F, Field data from label, nolact., preg., 1embX13CR, SP10772 e S CMNH, 112822, SS, 226, 450-460 MTS, 00 32'N, 79 17'W, ECUADOR, ESMERALDAS, , NEAR NUEVA VIDA, 1.9 KM N, 10.4 KM E CODESA-SADE COMPOUND AT RIO ESMERALDAS, MANZANO, I. AND MCCARTHY, T.J., 7619, 8-Dec-91, M, Field data from label, SP10721. Sturnira thomasi de la Torre & Schwartz 1 966. Q Q TTU, 19906, SS, 229, , 16 10'N, 61 40'W, GUADELOUPE, BASSE-TERRE, , 1 KM W VERNOU, GENOWAYS, H.H., 2261 , 26-Jul-74, F, tragus=7, lact., TK8271, field measurements taken from label e B 1 TTU, 19907, SS, 230, , 16 10'N, 61 42'W, GUADELOUPE, BASSE-TERRE, , KM S, 4 KM W VERNOW, PATTON, J.C., 487, 24-Jul-74, F, tragus=8, lact., TK 8250, m3 is missing, field measurements taken from label S Q UNSM"*, 20062, SS, 233, , 16 44'N, 62 11'W, MONTSERRAT, ST. GEORGE, , .8 KM S HARRIS, PARADISE ESTATES, PEDERSEN, S.C., 261, 14-May-94, F, TYPE SPECIMEN FOR S.t.vulcanensis, 1 EMBRYO e e USNM*", 361883, SS, , 366 MTS, 16 17'N, 61 43'W, GUADELOUPE, BASSE-TERRE, SOFAIA, LESSER ANTILLES, FRENCH LEEWARD ISLANDS, SCHWARTZ, A., 5413, 26-Jan-63, M, HOLOTYPE SPECIMEN, tragus=6, missing m3, but probably never had it. Sturnira tildae de la Torre 1 959. B fi CMNH, 63842, SS, 24, , 04 55'N, 55 11'W, SURINAME, BROKOPONDO, BROWNSBERG NATURE PARK, 8 KM S, 2 KM W BROWNSWEG, GENOWAYS, 3613, 24-Sep-79, F, TK10462, 1 emb. X 13mm a e CMNH, 63844, SS, , 02 02'N, , 56 08'W, SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, , GROEN, 1027, 16-Aug-79, F, e Q CMNH, 63846, SS, , 02 02'N, 08'W, , 56 SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, , GROEN, 1039, 17-Aug-79, F, e S CMNH, 63847, SS, , 02 02'N, 56 08'W, , SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, , GROEN, 1040, 17-Aug-79, F, S CMNH, , 63848, SS, , 02°02'N, 56 08'W, SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, , WILLIAMS, 4652, 17-Aug-79, F, no emb. e e CMNH, , 02 02'N, 63851, SS, , 56 08'W, SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, WILLIAMS, 4657, 17-Aug-79, F, no emb. 9 S CMNH, 76801, SS, , 600 MTS, 3 54'N, 56 10'W, SURINAME, SARAMACCA, TAFELBERG, ARROWHEAD BASIN, GROEN, 2851, 31-Oct-81, F, 241 e B 13'W, SURINAME, BROKOPONDO, BROWNSBERG , 04 53'N, 55 CMNH, 53824, SA, , NATURE PARK, 3 KM S, 20 KM W AFOBAKKA, DE LA FUENTE, 1923, 7-Jul-77, F, S 9 BROWNSBERG SA, , 04 53'N, 55 13'W, SURINAME, BROKOPONDO, CMNH, 53825, , NATURE PARK, 3 KM S, 20 KM W AFOBAKKA, DE LA FUENTE, 1924, 7-Jul-77, F, fi S BROWNSBERG , 04 53'N, 55 13'W, SURINAME, BROKOPONDO, CMNH, 53826, SA, , NATURE PARK, 3 KM S, 20 KM W AFOBAKKA, DE LA FUENTE, 1928, 7-Jul-77, F, 9 9 DISTRICT, RANCH , 15'N, 02'W, SURINAME, BROKOPONDO UM, , AL, 57, 05 55 BABOENHOL, ON MAIN ROAD THAT GOES FROM AIRPORT TO THE DAM, NEAR GOOD FOREST, MYERS, P., 7471, H-Mar-96, F, S e DISTRICT, RANCH , 15'N, 02'W, SURINAME, BROKOPONDO UM, , SA, 61, 05 55 BABOENHOL, ON MAIN ROAD THAT GOES FROM AIRPORT TO THE DAM, NEAR GOOD FOREST, MYERS, P., 7484, 11-Mar-96, F, S e AMNH, 268554, SN, 142, 25 MTS, 05 16'N, 52 55'W, FRENCH GUIANA, PARACOU, , 12 KM SSE OF SINNAMARY, SIMMONS, N.B., 801, , F, FA & digits measured from skeleton e 9 SURAMA, 30 ROM, 97994, SN, 129, , 04 20'N, 58 51'W, GUYANA, POTARO-SIPARUNI, KM NE OF SURAMA, ENGSTROM, MD; REID, FA; LIM, BK, 33495, 5-Oct-90, F, FA & digits measured from skeleton e e A.M., , BOIM, OLALLA, MCZ, 32361, SN, , 02 49'S, 55 10'W, BRAZIL, RIO TAPAJOS, 6855, , 21-Dec-32, F, SKIN LOST, Uroderma bilobatum in original label. In 1967, labeled as S. tildae, which seems to be the case. Very similar to S.lilium but a bit robust and larger. Collected in hueco arbol fresco, encima del agua, 74, no tiene (tail?), 17 (ear or HF?) e fi 11 N, E TTU, SA, , 09 12'S, 76 56'W, PERU, HUANUCO, LEONCIA PRADO, KM 6 KM 46276, , TINGO MARIA, OWEN, RD, 501, 9-Oct-83, F, e S CMNH, 63843, SS, , 02 02'N, 56 08'W, SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, , , GROEN, 1023, 16-Aug-79, M.TK10113 fi S 63845, SS, , 02 02'N, 56 08'W, SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, , CMNH, , GROEN, 1038, 17-Aug-79, M, e S , 02'N, NICKERIE, SIPALIWINI AIRSTRIP, CMNH, 63849, SS, 02 56 08'W, SURINAME, , , WILLIAMS, 4654, 17-Aug-79, M, tragus=6 9 B SS, , 02 02'N, 56 08'W, SURINAME, NICKERIE, SIPALIWINI AIRSTRIP, , CMNH, 63850, , WILLIAMS, 4656, 17-Aug-79, M, tragus=6 a e CMNH, 53823, SA, , 04 53'N, 55 13'W, SURINAME, , BROKOPONDO, BROWNSBERG NATURE PARK, 3 KM S, 20 KM W AFOBAKKA, DE LA FUENTE, 1922, 7-Jul-77, M, B 9 CMNH, 97379, SA, 14, , 10 08'N, 61 02'W, TRINIDAD AND TOBAGO, TRINIDAD, MAYARO CO., 1.5 KM S, 3 KM W GUAYAGUAYARE, GROEN, J.A., 3980, 2-NOV-83, M, TK25220, misidentified as S. lilium 9 9 CMNH, 97387, SA, 26, , 10 35'N, 61 12'W, TRINIDAD TOBAGO, TRINIDAD, NARIVA CO., ARENA RESERVE, 4.5 KM S, 4.5 KM W CUMUTO, GROEN, J.A., 3880, 26-Oct-83, M, AK8169, TK25130 9 9 CMNH, 97389, SA, , 10 38'N, 61 17'W, TRINIDAD TOBAGO, TRINIDAD, ST. , GEORGE CO., 10.5 KM N ARIMA, , 4694, , M, TK25143, AK8178 9 e ROM, 100981, SN, 133, , 07 22'N, 60 29'W, GUYANA, BARIMA-WAINI, BARAMITA, OLD WORLD, LIM, BK; ROBERTSON, CJ, 34979, 3-Oct-92, M, FA FROM LABEL & digits were measured from skeleton 9 9 UNM, 68389, SB, 42, 253 MTS, 14 52'S, 67 07'W, BOLIVIA, BENI, , 35 KM NW OF YACUMA, on road to Rurrenabaque, SUBIETA, M., 8, 13-Jul-92, M, NK25366, upper inner incisors edge is horizontal and trilobated, greyish-ashe dorsally and grey-brownish ventrally. 9 9 TTU, 46283, SA, 23, , 09 12'S, 76 56'W, PERU, HUANUCO, LEONCIA PRADO, 11 KM N, 6 KM E TINGO MARIA, OWEN, RD, 506, 9-Oct-83, M, AK8010, TK22691, ZYG. ARCHES BROKEN, LOWER JAW RAMA SEPARATED, UPPER INCISORS & MOLARS BROKEN. Outgroup Carollia brevicauda (Schinz 1821). 9 9 FLMNH, 16256, SN, , 55'N, , 08 67 25'W, VENEZUELA, GUARICO, , 40 KM S OF CALABOZO, FUNDO MASAGUARAL RANCH, HERMANSON, J., JH106, 6-JUL-81, F, NON- 242 LACTATING AND NO EMBRYO, FROM LABEL: 66-7-13-21, FA: 41, 16GRS, LLANOS, RAINY SEASON. Carollia perspicillata (Linnaeus 1758). a 61 Q02'W, TRINIDAD & TOBAGO, TRINIDAD, MAYARO, FLMNH, 6553, SB, , , 10 08'N, GUAYAGUAYARE, WING, J AND WING, E., ESW114, 25-AUG-59, F, FROM LABEL: 67- 14-12-19, FA: 44, TR: 6. Carollia subrufa (Hahn 1905). 8 Q PETEN, TIKAL, , RICK, A.M., AMR 6882, SB, , 17 13'N, 89 38'W, GUATEMALA, FLMNH, , 79, 5-JUL-60, M, FROM LABEL: 96-13-20-13, TR: 7, 16.7 GRS, TESTES 3.5X2.5, CORPUS EPIDIDYMIS TUBULARIS NOT VISIBLE. Centurio senex Gray 1842. a S RIO FLMNH, 24817, SB,,, 17 33'N, 89 02'W, BELIZE, , ORANGE WALK, GALLON JUG, BRAVO MANAGEMENT AREA, APPROX. 30 KM N OF GALLON JUG, REID, F., ENGSTROM, M, WILKINS, L, BEL-LW 19, 19-MAY-90, F, FROM LABEL: 55-0-14, 15 GRS, NO EMBRYOS, RIPARIAN CORRIDOR IN SECONDARY BROADLEAF FOREST, FN29967ROM WAS PREVIOUS COLLECTION NUMBER. Uroderma bilobatum Peters 1866. 8 S FLMNH, 24810, SB,,, 17 33'N, 89 02'W, BELIZE, , ORANGE WALK, GALLON JUG, RIO BRAVO MANAGEMENT AREA, APPROX. 30 KM N OF GALLON JUG, REID, F., ENGSTROM, M, WILKINS, L, BEL-LW 11, 16-MAY-90, F, FROM LABEL: 65-0-10, NONSCROTAL TESTES: 5X3, SECONDARY BROADLEAF FOREST, FN29960ROM WAS PREVIOUS COLLECTION NUMBER. Vampyressa pusilla (Wagner 1843). S e FLMNH, 24812, SB,,, 17 33'N, 89 02'W, BELIZE, , ORANGE WALK, GALLON JUG, RIO BRAVO MANAGEMENT AREA, APPROX. 30 KM N OF GALLON JUG, REID, F., ENGSTROM, M, WILKINS, L, BEL-LW 20, 19-MAY-90, F, FROM LABEL: 48-0-9, 7 GRS., NONSCROTAL TESTES: 3X2, RIPARIAN CORRIDOR IN SECONDARY BROADLEAF FOREST, FN29968ROM WAS PREVIOUS COLLECTION NUMBER. APPENDIX 4 QUALITATIVE CHARACTER List of each qualitative character (number and explanation) and character-state values used in morphological matrix (see appendix 5). Character 1- the way lower inner incisors are divided; (0) equal, or (1) unequal Character 2- number of lobes present on distal edge of lower incisors; (0) 2, or (1)3 Character 3- shape of distal edge of upper inner incisors; (0) flat, or (1) pointed, or (2) rounded Character 4- orientation of upper inner incisors comparing to each other; (0) straight, or (1) convergent, or (2) divergent Character 5- number of lobes present on distal edge of upper inner incisors; (0) 3, or (1) 2, or (2) 0, or (3) 2 with secondary postero-external basal cusp Character 6- direction of upper inner incisors on side view of the skull; (0) forward, or (1) downward 7- degree of development of metaconid on ml well, or Character ; (0) (1) incipient, or (2) absent Character 8- degree of development of entoconid on ml well, or incipient, ; (0) (1) or (2) absent Character 9- distinct separation between metaconid and entoconid on ml; (0) clear, or (1) incipient, or (2) no separation Character 10- presence of "shelf" on metacone on M1; (0) yes, or (1) no (see Figure 3A) Character 11- presence of "shelf" on metacone on M2; (0) yes, or (1) no (see Figure 3A) Character 12- maximum maxillary width at M1; (0) yes, or (1) no 243 244 Character 13- maximum maxillary width at M2 (or similar width at M1 and M2); (0) yes, or (1) no Character 14- differences in alignment of upper molars and premolars; (0) between all dental pieces, or (1) between PM2 and M1, or (2) between PM1 and PM2, or (3) between M1 and M2, or (4) almost no differences Character 15- presence of zygomatic arch; (0) yes, or (1) no Character 16- degree in which ml is tilted; (0): much, or (1): little, or (2) not tilted Character 17- direction in which ml is tilted; (0) lingual, or (1) labial, or (2) horizontal 18- is tilted compared with ml different side, Character direction in which m2 ; (0) or (1) same side Character 19- direction in which m2 is tilted; (0) lingual, or (1) labial, or (2) horizontal Character 20- forearm length classes; (0) small (0-35 mm), or (1) medium (35-53 mm), or (2) large (>53 mm) Character 21- relative length of M3 compared to M2; (0) M3=M2, or (1) M3 half M2, or (2) M3 third M2, or (3) M3 quarter M2, or (4) M3 two thirds M2, or (5) no M3 22- relative length of compared to M1 M2=M1 , or M2 half Character M2 ; (0) (1) M1,or(2) M2 two thirds M1 Character 23- relative degree on development of occipital condyles; (0) poorly (small condyles), or (1) well Character 24- relative degree on development of proccess paroccipitalis; (0) incipient, or (1) well Character 25- shape of maxillary tuberosity; (0) rounded, or (1) pointed, or (2) absent Character 26- development of postero-lateral edge on palate in relation to distal end of M3; (0) does not reaches distal end of M3, or (1) reaches distal end of M3, or (2) surpasses distal end of M3, or (3) absent Character 27- development of saggital crest (as viewed on males); (0) well, or (1) incipient, or (2) absent Character 28- development of nucal crest; (0) well, or (1) incipient 245 Character 29- relative size of occipital protuberance (close to nucal crest); (0) large, or (1) small or absent Character 30- "brakes" on outline of nucal crest; (0) the entire crest is in one line, or (1) in 2 lines Character 31- presence of palatine perforations; (0) yes, or (1) no Character 32- relative shape of pm1 compared to pm2 (on lateral view); (0) pm1=shape of pm2, or (1) pm1 different shape of pm2 Character 33- relative shape of rostrum (in upper and lateral views); (0) long, or (1) short Character 34- relative shape of nasal aperture; (0) elongated, or (1) squarish, or (2) trapezoidal Character 35- relative shape of upper premolars (in lateral view); (0) = shape, or (1) different shape Character 36- relative size of upper premolars; (0) = size, or (1) different size Character 37- relative shape of corpus of upper premolars (in lateral view); (0) triangular, or (1) squarish Character 38- relative shape of distal end of upper premolars (in lateral view); (0) pointed, or (1) rounded Character 39- relative shape of M1 (in ventral view); (0) squarish, or (1) trapezoidal Character 40- relative shape of M2 compared to M1; (0) equal shape, or (1) different shape 41- relative size of compared to M1 smaller, or larger Character M2 ; (0) (1) Character 42- development of occipital crest; (0) well, or (1) incipient, or (2) absent Character 43- development of metaconid on m2; (0) well, or (1) incipient Character 44- development of entoconid on m2; (0) good to poor, or (1) no entoconid Character 45- relative separation between metaconid and entoconid on m2; (0) clear, or (1) incipient, or (2) no separation Character 46- presence of divided cusps on metaconid on m2; (0) yes, or (1) no Character 47- presence of divided cusps on entoconid on m2; (0) yes, or (1) no 11 APPENDIX 5 CHARACTER MATRIX Character matrix given below contains all characters states present in four outgroup species (*) and sixteen ingroup species. All species considered here are within the family Phyllostomidae (sensu Koopman 1993, 1994; Mckenna and Bell 1997). See appendix 4 for character descriptions. Character Numbers 10 20 30 40 Species *Centurio_senex 000001 0001 001 001 01 01 52000221 1 1 1 1 1 1 1 1 001 1 020001 *Carollia_spp. 01112000011102110101100122111100010000101200011 * Uroderma_bilobatum 001 1 1 1200010120100213001231 11111 1 1010010020001 * Vampyressa_pusilla 011111 22201 1 0301 00205000231 1 1 1 1 01 001 001 0020001 S._aratathomasiJ\ 1 1 1 22001 01101 300001 2321 001 001 0000000001 0000001 S._aratathomasi_2 1 1 1 22001 011011 000022321 001 001 0000000001 0000001 S._magnaj\ 01211011101003010102111111001111111110010210211 S._magna_2 01211011111011010102111112001111111110010210211 S._ludovici_] 00211011101103010101220110001011110001110211211 S._ludovici_2 01211011101103022121220110101101110001110211211 S.^hondurensis^ 10122011101013010101220111001011110000000111211 S._hondurensis_2 10122011101103012121221111101101110000000210101 S.JiliumJ\ 011111 00001 1 0401 0021 1 2001 0001 01 1 1 1 1 1 01 000200000 S._lilium_39 011111 0000001 301 0021 1 201 1 001 0001 111101 00020001 S._lilium_2 01111100011014010021120112011101111101100200011 S._/;7/um_114 011111 0000001 30001 01 2201 1 1 001 1 01 1 1 1 1 001 0020001 S.JuisU 011111 00001 00401 0021 2201 1 0001 011111101 000200001 S._luisi_2 01111100011003010021220112011101111101100200001 S.JhomasU 01111100011014010021321011001111110101000200011 S._thomasi_2 01111100011014010021321011001111110101100200010 S._mordax_1 01211011101003010021121111011010110101010210211 S._mordax_2 01211012211113010021121111011110110101010211211 S._sp._A_1 11111012211103010101121110111110010101110110111 S._sp._A_2 11111012211103022121121110111110010111110110111 S._sp._B 01211101001103011111401100001101110001000101011 S._erythromos_\ 01 1 1 1 1 1 21 1 1 01 301 0021 221 1 1 20001 001 1 00000001 11111 S._erythromos_2 01111122211013010021221112000110110000100111211 S._bogorens/s_1 01 1 1 1 1 0201 1 00301 0001 221 1 1 200001 01 1 00000001 11111 S._bogotensis_2 01111112011003022111221112101110110000100111211 S._oporaphilum_\ 10111112001103022011221111000111120001110111111 S._oporaphilum_2 10111112001103022011221112100101120001110111211 S._tildaej\ 01111101001014010011121102000111110101000200101 S._tildae_2 01110101001013022121121111001101110101000200211 S._nanaJ\ 01213122211013000100421110110011110100110211111 S._nana_2 01213122211013100100421110110011110100110211211 S._bidensj\ 01213111111103010101121110111111110111110211111 S._bidens_2 01213111111101110021121110111111110111110211211 246 APPENDIX 6 TISSUE SAMPLES List of the 223 individuals represented by tissue samples from which dna was available for extraction. Fifteen tissue samples belong to specimens used (considered here as outgroups), whereas 208 were from different specimens of the genus Sturnira. Taxonomic names follow Wilson and Reeder (1993). Fields are separated by a comma and are listed in the following order: cai sample number, genus, species, museum tissue number, museum name where tissue was deposited, museum name where voucher was deposited, voucher specimen number, field number, country, state or dept., town, locality modifier, elevation, latitude and longitude, collector's name, date of collection, sex, and tissue type. When two or more commas follow, no information was available for that particular field. LSU (Museum of Zoology, Louisiana State University), ROM (Royal Ontario Museum), AMNH (American Museum of Natural History), MVZ (Museum of Vertebrate Zoology, University of California), UNSM (University of Nebraska State Museum), FLMNH (Florida Museum of Natural History). 1, STURNIRA, LILIUM, TK 22797, TTU-THE MUSEUM, CARNEGIE MUSEUM, 98753, , PERU, s 22' s 58' HUANUCO, LEONCIO PRADO, 9 KM S 2 KM E TINGO MARIA, , 9 S 75 W, BAKER, RJ ET AL, 10/10/83, FEMALE, LIVER 2, STURNIRA, OPORAPHILUM, TK 22800, TTU-THE MUSEUM, CARNEGIE MUSEUM, 98755, Q 22' 9 9 2 E TINGO MARIA, , 9 S 75 , PERU, HUANUCO, LEONCIO PRADO, KM S KM 58' W, BAKER, RJ ET AL, 10/10/83, MALE, LIVER 3, STURNIRA, OPORAPHILUM, TK 22784, TTU-THE MUSEUM, CARNEGIE MUSEUM, 98769, Q 22' Q 9 2 E MARIA, , 9 S 75 , PERU, HUANUCO, LEONCIO PRADO, KM S KM TINGO 58' W, BAKER, RJ ET AL, 10/10/83, FEMALE, LIVER 4, STURNIRA, LILIUM, TK 34738, TTU-THE MUSEUM, CARNEGIE MUSEUM, 111299, COLONIA ESCALON, OJG220, EL SALVADOR, SAN SALVADOR, SAN SALVADOR, , 13Q 42' N 89s 15' W, OWEN, JG, 9/26/89, FEMALE, LIVER 5, STURNIRA, LILIUM, TK 18602, TTU-THE MUSEUM, CARNEGIE MUSEUM, 63413, , , 5/25/80, MALE, GRENADA, ST GEORGE, , 0.5 KM E VENDOME, , GENOWAYS, HH, LIVER , ZACAPA, RIO 6, STURNIRA, LILIUM, TK 41568, TTU-THE MUSEUM, , , GUATEMALA, RIO, PASABIEN, , MARSHALL, RS, 6/6/92, HONDO, ALDEA SANTA CRUZ , FEMALE, LIVER LILIUM, TEXAS TECH UNIVERSITY, 7, STURNIRA, TK 40384, TTU-THE MUSEUM, 61103, , VALLE, , 12.8 , ET AL, SAN LORENZO, , BRADLEY, RD HONDURAS, KM SSW , MALE, LIVER LILIUM, 27635, TEXAS TECH UNIVERSITY, 8, STURNIRA, TK TTU-THE MUSEUM, 45061, , JALISCO, CHAMELA, , HAIDUK, KJ, 3/13/85, FEMALE, LIVER MEXICO, , , 9, STURNIRA, LILIUM, TK 27085, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, 44789, , MEXICO, TAMAULIPAS, , 3 KM W CALABAZAS, RIO SABINAS, , , HOLLANDER, RR, 8/7/84, FEMALE, LIVER 10, STURNIRA, LILIUM, TK 13104, TTU-THE MUSEUM, CARNEGIE MUSEUM, 55733, , MEXICO, VERACRUZ, , 14 KM N 22 KM E CORDOBA, OJO DE AGUA, RIO DE ATOYAC, , HARVEY, DR, 3/30/78, FEMALE, LIVER , 11, STURNIRA, LILIUM, TK 22698, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, 46263, , 9 12' 56' PERU, HUANUCO, LEONCIO PRADO, , 9 S 75° W, RD, 10/9/83, , OWEN, FEMALE, LIVER 247 , 248 12, STURNIRA, LILIUM, TK 17597, TTU-THE MUSEUM, CARNEGIE MUSEUM, 77606, , WILLIAMS, SL ET AL, 10/23/81, SURINAME, MAROWIJNE, , 3 KM SW ALBINA, ,, FEMALE, LIVER 13, STURNIRA, LILIUM, TK 25164, TTU-THE MUSEUM, CARNEGIE MUSEUM, 97378, , AL, , JA ET TRINIDAD & TOBAGO, TOBAGO, ST PATRICK, GRANGE, , GROEN, 10/30/83, FEMALE, LIVER 14, STURNIRA, TILDAE, TK 25220, TTU-THE MUSEUM, CARNEGIE MUSEUM, 97379, , TRINIDAD & TOBAGO, TRINIDAD, MAYARO, 1.5 KM S 3 KM W GUAYAGUAYARE, , , GROEN, JA ET AL, 11/2/83, MALE, LIVER , VENEZUELA, GUARICO 15, STURNIRA, LILIUM, TK 15026, TTU-THE MUSEUM, , , 4/14/78, , KIDNEY 16, STURNIRA, LUDOVICI, TK 34854, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, MONTECRISTO, , , NACIONAL , 62412, , EL SALVADOR, SANTA ANA, PARQUE OWEN, JG, 6/20/90, MALE, LIVER 17, STURNIRA, LILIUM, TK 19138, TTU-THE MUSEUM, CARNEGIE MUSEUM, 78567, , LW, 2/3/81, , ROBBINS, VENEZUELA, BOLIVAR, , 8 KM S 5 KM E EL MANTECO, , FEMALE, LIVER 18, STURNIRA, LILIUM, TK 22794, TTU-THE MUSEUM, CARNEGIE MUSEUM, 98771, , e 22' s PERU, HUANUCO, LEONCIO PRADO, 9 KM S 2 KM E TINGO MARIA, , 9 S 75 58 W, BAKER, RJ ET AL, 10/10/83, FEMALE, LIVER 19, STURNIRA, MAGNA, TK 22722, TTU-THE MUSEUM, CARNEGIE MUSEUM, 98774, , Q 22' 9 PERU, HUANUCO, LEONCIO PRADO, 9 KM S 2 KM E TINGO MARIA, , 9 S 75 58 W, BAKER, RJETAL, 10/10/83, MALE, LIVER 20, STURNIRA, LILIUM, TK 43231, TTU-THE MUSEUM, UNIVERSIDAD AUTONOMA, , , OWEN, RD CSH4089, MEXICO, MICHOACAN, MUN AQUILA, PLAYA SAN TELMO, , ET AL, 8/14/92, FEMALE, LIVER 21 STURNIRA, LUDOVICI, TK 22506, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, 39136, , PANAMA, CHIRIQUl' 1/19/83, , LIVER , VENEZUELA, GUARICO 22, STURNIRA, SP, TK 15372, TTU-THE MUSEUM, , , 4/27/78, , LIVER 23, STURNIRA, TILDAE, TK 22691, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, 46283, , fi 12' 9 56' PERU, HUANUCO, LEONCIO PRADO, 9 KM S 2 KM E TINGO MARIA, , 9 S 75 W, OWEN, RD, 10/9/83, MALE, LIVER MUSEUM, 24, STURNIRA, TILDAE, TK 10462, TTU-THE MUSEUM, CARNEGIE 63842, , SURINAME, BROKOPONDO, BROWNSBERG NATURE PARK, 8 KM S 2 KM W 9 55' s 1' BROWNSWEG, , 4 N 55 1 W, WILLIAMS, SL ET AL, 9/24/79, FEMALE, LIVER , SMJ4684, TRINIDAD & TOBAGO, 25, STURNIRA, TILDAE, TK 25134, TTU-THE MUSEUM, , , SMOLEN, MJ, 10/28/83, FEMALE, LIVER TOBAGO, ST GEORGE, , , STURNIRA, TILDAE, TK 25130, TTU-THE MUSEUM, CARNEGIE MUSEUM, 97387, 26, , TRINIDAD & TOBAGO, TRINIDAD, NARIVA, 4.5 KM S 4.5 KM W CUMUTO, ARENA , JA AL, 10/26/83, MALE, LIVER RESERVE, , GROEN, ET 27, STURNIRA, ERYTHROMOS, M 1701, LSU-MUSEUM OF NATURAL SCIENCES, LSU-MUSEUM OF NATURAL SCIENCES, 28188, LJB2446, PERU, HUANUCO, UNCHOG, PASS BETWEEN CHURRUBAMBA AND HAD. PATY, NNW ACOMAYO, 3450 MTS, , BARKLEY, LJ, 8/4/84, MALE, NOT RECORDED 28, STURNIRA, LILIUM, M 394, LSU-MUSEUM OF NATURAL SCIENCES, LSU-MUSEUM OF NATURAL SCIENCES, 25178, LJB1963, COSTA RICA, SAN JOSE, , 14 RD KM S LA GLORIA, 200 MTS, , BARKLEY, LJ, 5/24/82, MALE, NOT RECORDED 29, STURNIRA, LILIUM, M 529, LSU-MUSEUM OF NATURAL SCIENCES, LSU-MUSEUM OF NATURAL SCIENCES, 25478, MSH1161, PANAMA, DARIEN, CANAL ZONE, , 500 MTS, , HAFNER, MS, 1/26/83, MALE, NOT RECORDED 30, STURNIRA, LUDOVICI, M 395, LSU-MUSEUM OF NATURAL SCIENCES, LSU-MUSEUM OF NATURAL SCIENCES, 25179, LJB1974, COSTA RICA, CARTAGO, , 4 KM S 2.5 KM W PARAISO, 1200 MTS, , BARKLEY, LJ, 5/31/82, MALE, NOT RECORDED 31, STURNIRA, LUISI, M 924, LSU-MUSEUM OF NATURAL SCIENCES, LSU-MUSEUM OF NATURAL SCIENCES, 27256, LJB1928, PERU, LAMBAYEQUE, LAS JUNTAS, IN 1 249 BARKLEY, QUEBRADA LA PACHINGA, ca. 14 KM N 25 KM E OLMOS, 1000 MTS, , LJ, 9/26/81, FEMALE, NOT RECORDED 32, STURNIRA, MAGNA, M 1770, LSU-MUSEUM OF NATURAL SCIENCES, LSU-MUSEUM OF NATURAL SCIENCES, 28289, LJB2171, PERU, LORETO, QUEBRADA ORAN, LJ, 6/9/84, ca. 5 KM N RIO AMAZONAS 85 KM NE IQUITOS, 110 MTS, , BARKLEY, MALE, NO"1" RECORDED 33, STURNIRA, LUDOVICI, M 396, LSU-MUSEUM OF NATURAL SCIENCES, LSU-MUSEUM 2.5 OF NATURAL SCIENCES, 25180, LJB1979, COSTA RICA, CARTAGO, , 4 KM S KM LJ, 5/31/82, MALE, NOT RECORDED W PARAISO, 1200 MTS, , BARKLEY, 34, STURNIRA, LILIUM, NK 5540, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 18 UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 53755, KE8, MEXICO, SONORA, , , 10/27/80, MALE, NOT RECORDED KM E (by road) ALAMOS, RIO CUCHUJAQUI, , , 35, STURNIRA, LILIUM, NK 27023, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 75549, MZ1 62, MEXICO, e N s 23' W, , 19 35.4 96 , VERACRUZ, , MORRO DE LA MANCHA FIELD STATION, 11/9/92, MALE, NOT RECORDED 36, STURNIRA, LUDOVICI, NK 17824, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 61891, WLG427, COSTA RICA, WL, 1/14/89, PUNTARENAS, MONTEVERDE COMMUNITY, , 1350 MTS, , GANNON, MALE, NOT RECORDED 37, STURNIRA, LILIUM, NK 17818, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 61878, WLG425, COSTA RICA, , 1/13/89, FEMALE, GUANACASTE, FLAMINGO BEACH, 2 KM NW BRASILITAS, , , NOT RECORDED 38, STURNIRA, LILIUM, NK 11773, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 55150, JAC1317, BOLIVIA, SANTA 9 9 47' W, , 8/22/84, , 16 S 63 14 CRUZ, , ESTANCIA CACHUELA ESPERANZA, FEMALE, NOT RECORDED 39, STURNIRA, LILIUM, NK 12591, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 55899, TLY1225, BOLIVIA, Q 45' B 13' YATES, TL, CHUQUISACA, , 1.5 KM NW PORVENIR, 675 MTS, 20 S 63 W, 7/9/85, MALE, NOT RECORDED 40, STURNIRA, LILIUM, NK 13438, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 55900, IMT233, BOLIVIA, LA PAZ , , e s RIO BENI, 250 MTS, 14 16 S 67 32' W, MERCADO T., I, 9/3/85, FEMALE, NOT RECORDED 41, STURNIRA, LILIUM, NK 13901, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 57048, WAT59, BOLIVIA, PANDO, B e 1 23' 12' WA, 7/26/86, FEMALE, NOT BELLA VISTA, , 170 MTS, S 67 W, TALBOT, RECORDED 42, STURNIRA, TILDAE, NK 25366, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 68389, , BOLIVIA, BENI, , 35 KM NW OF YACUMA, on road to Rurrenabaque, 253 MTS, 14Q 52' S 67 fi 07' W, SUBIETA, M, 7/13/92, MALE, NOT RECORDED 43, STURNIRA, OPORAPHILUM, NK 30219, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 70584, MAC 180, BOLIVIA, COCHABAMBA, EL PALMAR, ON RIO COCHIMAYU, 960 MTS, 179 6.5' S 65 s 33' W, CHAVEZ, MA, 7/8/93, MALE, NOT RECORDED 44, STURNIRA, LILIUM, NK 5523, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 53760, DJW54, MEXICO, SONORA, , 18 KM E (by road) ALAMOS, RIO CUCHUJAQUI, ,, WARREN, DJ, 10/27/80, MALE, NOT RECORDED 45, STURNIRA, LUDOVICI, NK 17823, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 61885, , COSTA RICA, , 1350 MTS, , 1/14/89, MALE, PUNTARENAS, MONTEVERDE COMMUNITY, , NOT RECORDED 250 46, STURNIRA, TILDAE, NK 22613, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, CRUZ, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 67055, , BOLIVIA, SANTA PARQUE NACIONAL NOEL KEMPFF MERCADO, 27.5 KM S CAMPAMENTO LOS s 37.75' e 45' MALE, , 7/7/91, NOT RECORDED FIERROS, , 14 S 60 W, 47, STURNIRA, OPORAPHILUM, NK 25508, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, LA PAZ, LA UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 68399, , BOLIVIA, RECORDED , 7/22/92, MALE, NOT , 840 MTS, RESERVA, , 48, STURNIRA, OPORAPHILUM, NK 12703, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 55904, , BOLIVIA, SANTA CRUZ, , 7/20/85, MALE, RECORDED , NOT SAN RAFAEL DE AMBORO, 400 MTS, , 49, STURNIRA, OPORAPHILUM, NK 25441, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, BENI, , BOLIVIA, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 68394, , 1000 MTS, , 7/20/92, FEMALE, NOT RECORDED SERRANIA DE PILON, , 50, STURNIRA, ERYTHROMOS, NK 22764, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 1 UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 67060, , BOLIVIA, SANTA CRUZ, , KM NE ESTANCIA CUEVAS, STA. CRUZ HWY KM 101, 1300 MTS, 18 s 11' S 63s 44' W, , 5/22/91 , FEMALE, NOT RECORDED 51, STURNIRA, ERYTHROMOS, NK 29524, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, PAZ, , 0.5 UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 70337, , BOLIVIA, LA KM 9 8' fi 4' E SAYNANI, RIO ZONGO, 2163 MTS, 16 S 68 W, , 6/2/93, FEMALE, NOT RECORDED 52, STURNIRA, ERYTHROMOS, NK 30211, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 70351, , BOLIVIA, COCHABAMBA, s 6.5' B 33' EL PALMAR, ON RIO COCHIMAYU, 960 MTS, 17 S 65 W, , 7/8/93, FEMALE, NOT RECORDED 53, STURNIRA, SP, NK 14056, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 57284, , BOLIVIA, PANDO, SANTA , 180 MTS, , 8/1/86, FEMALE, NOT RECORDED ROSA, , 54, STURNIRA, SP, NK 21448, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 63527, , BOLIVIA, CHUQUISACA, , 2 B48' s 31' KM SW MONTEAGUDO, 1130 MTS, 19 S 64 W, , 7/14/90, FEMALE, NOT RECORDED 55, STURNIRA, SP, NK 17803, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, UNM-MUSEUM OF SOUTHWESTERN BIOLOGY, 61872, , COSTA RICA, HEREDIA, , 2 GETZEMANI, , 1/8/89, FEMALE, NOT RECORDED KM NE , , ZOOLOGY, , OF 56, STURNIRA, LILIUM, UM-MUSEUM OF ZOOLOGY, UM-MUSEUM , PM4002, PARAGUAY, CAAGUAZU, , 24 KM NNW CARAYAO, ESTANCIA SAN IGNACIO, , MYERS, P, 7/2/79, , NOT RECORDED , 57, STURNIRA, SP, , UM-MUSEUM OF ZOOLOGY, UM-MUSEUM OF ZOOLOGY, , PM7471, SURINAME, BROKOPONDO DISTRICT, RANCH BABOENHOL, ON MAIN ROAD THAT , MYERS, P, 3/1 1/96, GOES FROM AIRPORT TO THE DAM, NEAR GOOD FOREST, , FEMALE, NOT RECORDED 58, STURNIRA, SP, , UM-MUSEUM OF ZOOLOGY, UM-MUSEUM OF ZOOLOGY, , PM7472, SURINAME, BROKOPONDO DISTRICT, RANCH BABOENHOL, ON MAIN ROAD THAT FOREST, , MYERS, P, 3/11/96, GOES FROM AIRPORT TO THE DAM, NEAR GOOD , MALE, NOT RECORDED 59, STURNIRA, SP, , UM-MUSEUM OF ZOOLOGY, UM-MUSEUM OF ZOOLOGY, , PM7473, SURINAME, BROKOPONDO DISTRICT, RANCH BABOENHOL, ON MAIN ROAD THAT AIRPORT TO THE DAM, NEAR FOREST, , MYERS, P, 3/11/96, GOES FROM GOOD , MALE, NOT RECORDED 60, STURNIRA, SP, , UM-MUSEUM OF ZOOLOGY, UM-MUSEUM OF ZOOLOGY, , PM7474, SURINAME, BROKOPONDO DISTRICT, RANCH BABOENHOL, ON MAIN ROAD THAT FROM AIRPORT THE DAM, NEAR , P, 3/1 GOES TO GOOD FOREST, , MYERS, 1/96, MALE, NOT RECORDED 61, STURNIRA, SP, , UM-MUSEUM OF ZOOLOGY, UM-MUSEUM OF ZOOLOGY, , PM7484, SURINAME, BROKOPONDO DISTRICT, RANCH BABOENHOL, ON MAIN ROAD THAT 251 , MYERS, P, 3/11/96, GOES FROM AIRPORT TO THE DAM, NEAR GOOD FOREST, , FEMALE, NOT RECORDED NATURAL HISTORY, FIELD MUSEUM 62, STURNIRA, BOGOTENSIS, , FIELD MUSEUM OF OF NATURAL HISTORY, 128788, BDP2320, PERU, ANCASH, HUARI, RIO MOSNA, BETWEEN CHAVIN AND SAN MARCOS, 3200 MTS, 99 33' S 77e 10' W, PATTERSON, BD, 4/19/87, FEMALE, NOT RECORDED FIELD MUSEUM 63, STURNIRA, BOGOTENSIS, , FIELD MUSEUM OF NATURAL HISTORY, OF NATURAL HISTORY, 128789, VPT301, PERU, LIMA, HUAROCHIRI, SAN BARTOLOME, 1560 MTS, 11 fi 54' S 76s 33' W, PACHECO, V, 4/8/87, FEMALE, NOT RECORDED NATURAL HISTORY, FIELD MUSEUM 64, STURNIRA, BOGOTENSIS, , FIELD MUSEUM OF OF NATURAL HISTORY, 128935, VPT661, PERU, LIMA, HUAROCHIRI, PAMPA DE ZARATE, 3000 MTS, 11 e 54' S769 27' W, PACHECO, V, 6/2/87, FEMALE, NOT RECORDED HISTORY, MUSEO DE 65, STURNIRA, ERYTHROMOS, , FIELD MUSEUM OF NATURAL HISTORIA NATURAL (JAVIER PRADO/LIMA PERU), 128796, VPT457, PERU, AMAZONAS, CHACHAPOYAS, BALSAS, 19 KM BY ROAD E, 2100 MTS, , PACHECO, V, 5/10/87, FEMALE, NOT RECORDED HISTORY, FIELD MUSEUM 66, STURNIRA, ERYTHROMOS, , FIELD MUSEUM OF NATURAL OF NATURAL HISTORY, 128800, BDP2519, PERU, AMAZONAS, CHACHAPOYAS, LIEMEBAMBA, ca 20 KM BY ROAD W, 3100 MTS, 6 s 45' S 77e 48' W, PATTERSON, BD, 5/6/87, MALE, NOT RECORDED HISTORY, FIELD MUSEUM 67, STURNIRA, ERYTHROMOS, , FIELD MUSEUM OF NATURAL OF NATURAL HISTORY, 128809, VPT51 2, PERU, AMAZONAS, BONGARA, RIO UTCUBAMBA, ENTRE CHURUJA Y PEDRO RUIZ, 1400 MTS, 5Q 59' S 77s 56' W, PACHECO, V, 5/16/87, MALE, NOT RECORDED 68, STURNIRA, ERYTHROMOS, , FIELD MUSEUM OF NATURAL HISTORY, FIELD MUSEUM OF NATURAL HISTORY, 128811, VPT606, PERU, CAJAMARCA, SANTA CRUZ, RIO ZANA, 2 KM N MONTE SECO, 1300 MTS, 6e 51' S 799 4' W, PACHECO, V, 5/25/87, MALE, NOT RECORDED HISTORIA 69, STURNIRA, LILIUM, , FIELD MUSEUM OF NATURAL HISTORY, MUSEO DE NATURAL (JAVIER PRADO/LIMA PERU), 128812, VPT469, PERU, AMAZONAS, CHACHAPOYAS, BALSAS, 19 KM BY ROAD E, 2100 MTS, , PACHECO, V, 5/2/87, MALE, NOT RECORDED 70, STURNIRA, LILIUM, , FIELD MUSEUM OF NATURAL HISTORY, FIELD MUSEUM OF NATURAL HISTORY, 128816, VPT536, PERU, AMAZONAS, LUYA, RIO UTCUBAMBA, 15 KM BY ROAD NW PEDRO RUIZ, 1200 MTS, 5s 57' S 789 6' W, PACHECO, V, 5/17/87, MALE, NOT RECORDED HISTORIA 71, STURNIRA, LILIUM, , FIELD MUSEUM OF NATURAL HISTORY, MUSEO DE NATURAL (JAVIER PRADO/LIMA PERU), 1 28833, VPT467, PERU, AMAZONAS, LUYA, RIO UTCUBAMBA, 1.2 KM N Pte. HUINCUCHA, 1850 MTS, , PACHECO, V, 5/15/87, MALE, NOT RECORDED 72, STURNIRA, LILIUM, , FIELD MUSEUM OF NATURAL HISTORY, FIELD MUSEUM OF NATURAL HISTORY, 128838, VPT392, PERU, CAJAMARCA, CELENDIN, HACIENDA LIMON, 3250 MTS, 65 51' S 78e 6' W, PACHECO, V, 4/28/87, FEMALE, NOT RECORDED 73, STURNIRA, LILIUM, , FIELD MUSEUM OF NATURAL HISTORY, FIELD MUSEUM OF NATURAL HISTORY, 128841, VPT587, PERU, CAJAMARCA, SANTA CRUZ, RIO ZANA, 2 KM N MONTE SECO, 1300 MTS, 6e 51' S 79 s 4' W, PACHECO, V, 5/23/87, FEMALE, NOT RECORDED 74, STURNIRA, OPORAPHILUM, , FIELD MUSEUM OF NATURAL HISTORY, MUSEO DE HISTORIA NATURAL (JAVIER PRADO/LIMA PERU), 128919, VPT403, PERU, AMAZONAS, CHACHAPOYAS, BALSAS, 3 KM E, 1100 MTS, , PACHECO, V, 4/29/87, FEMALE, NOT RECORDED 75, STURNIRA, OPORAPHILUM, , FIELD MUSEUM OF NATURAL HISTORY, FIELD MUSEUM OF NATURAL HISTORY, 128920, VPT524, PERU, AMAZONAS, LUYA, RIO , , 252 UTCUBAMBA, 15 KM BY ROAD NW PEDRO RUIZ, 1200 MTS, 5s 57' S 78s 6' W, PACHECO, V, 5/17/87, FEMALE, NOT RECORDED NATURAL HISTORY, FIELD MUSEUM 76, STURNIRA, OPORAPHILUM, , FIELD MUSEUM OF OF NATURAL HISTORY, 128926, VPT602, PERU, CAJAMARCA, SANTA CRUZ, RIO ZANA, 2 KM N MONTE SECO, 1300 MTS, 6s 51' S 79e 4' W, PACHECO, V, 5/25/87, FEMALE, NOT RECORDED 77, STURNIRA, LILIUM, TK 60906, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK SAN RAFAEL, S OF CITY 60906, PARAGUAY, ITAPUA, , PARQUE NACIONAL PARAGUAY, 170 MTS, 26s 45.9' S 55Q 52.5' W, LOPEZ-GONZALEZ, O, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/24/96, FEMALE, NOT RECORDED 78, STURNIRA, LILIUM, TK 60907, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK SAN RAFAEL, S OF CITY 60907, PARAGUAY, ITAPUA, , PARQUE NACIONAL PARAGUAY, 170 MTS, 26s 45.9' S 55s 52.5' W, LOPEZ-GONZALEZ, C, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/24/96, MALE, NOT RECORDED UNIVERSITY, TK 79, STURNIRA, LILIUM, TK 60908, TTU-THE MUSEUM, TEXAS TECH , RAFAEL, S OF CITY 60908, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN PARAGUAY, 170 MTS, 26s 45.9' S 55s 52.5' W, LOPEZ-GONZALEZ, O, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/24/96, MALE, NOT RECORDED 80, STURNIRA, LILIUM, TK 60909, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK RAFAEL, S OF CITY 60909, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN PARAGUAY, 170 MTS, 26s 45.5' S 55s 51.7' W, LOPEZ-GONZALEZ, O, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/24/96, MALE, NOT RECORDED 81 STURNIRA, LILIUM, TK 60910, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK 60910, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN RAFAEL, S OF CITY PARAGUAY, 170 MTS, 26s 45.5' S 55 Q 51.7' W, LOPEZ-GONZALEZ, O, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/24/96, MALE, NOT RECORDED , 6091 82, ARTIBEUS, SP, TK 6091 1 , TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, TK 1 RAFAEL, OF CITY PARAGUAY, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN S s e 170 MTS, 26 45.5' S 55 51.7' W, LOPEZ-GONZALEZ, C, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/24/96, MALE, NOT RECORDED 83, STURNIRA, LILIUM, TK 60918, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK OF CITY 60918, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN RAFAEL, S PARAGUAY, 170 MTS, 26e 45.7' S 55s 52.3' W, LOPEZ-GONZALEZ, C, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/25/96, FEMALE, NOT RECORDED 84, STURNIRA, LILIUM, TK 60919, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK 60919, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN RAFAEL, S OF CITY PARAGUAY, 170 MTS, 26s 45.5' S 55Q 51.7' W, LOPEZ-GONZALEZ, O, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/26/96, MALE, NOT RECORDED 85, STURNIRA, LILIUM, TK 60939, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK 60939, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN RAFAEL, S OF CITY PARAGUAY, 170 MTS, 26Q 45.5' S 55Q 51.7' W, LOPEZ-GONZALEZ, O, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/28/96, FEMALE, NOT RECORDED 86, STURNIRA, LILIUM, TK 60940, TTU-THE MUSEUM, TEXAS TECH UNIVERSITY, , TK 60940, PARAGUAY, ITAPUA, , PARQUE NACIONAL SAN RAFAEL, S OF CITY PARAGUAY, 170 MTS, 26 s 45.5' S 55s 51.7' W, LOPEZ-GONZALEZ, C, PRESLEY, S.J., MORA, I., HOFFMANN, F., 1/28/96, MALE, NOT RECORDED 87, STURNIRA, LILIUM RM 2, MEXICO, MORELOS, OAXTEPEC, INSIDE TOWN, 1600 Q 9 MTS, 18 54' S 98 58' W, MEDELLIN, R„ 1 1/2/96, FEMALE, WING PATCH LILIUM, , 1, MEXICO, MORELOS, OAXTEPEC, INSIDE TOWN, 1600 88, STURNIRA, , , , RM MTS, 18e 54' S 98s 58' W, MEDELLIN, R., 9/28/96, MALE, WING PATCH 89, STURNIRA, LILIUM, FN32725, ASU-ANGELO STATE NATURAL HISTORY COLLECTIONS, ANGELO STATE NATURAL HISTORY COLLECTIONS, 6935, FN32725, MEXICO, CAMPECHE, , 7 KM ESCARCEGA, , DOWLER, R.C., LIM, B., 6/6/90, MALE, W , KIDNEY 90, STURNIRA, LILIUM, FN32616, ASU-ANGELO STATE NATURAL HISTORY COLLECTIONS, ANGELO STATE NATURAL HISTORY COLLECTIONS, 6938, FN32616, MEXICO, 9 253 , DOWLER, R.C., LIM, B., 6/1/90, FEMALE, QUINTANA ROO, KOHUNLICH, , , KIDNEY 91, STURNIRA, LILIUM, FN32678, ASU-ANGELO STATE NATURAL HISTORY COLLECTIONS, ANGELO STATE NATURAL HISTORY COLLECTIONS, 6949, FN32678, MEXICO, 1.5 TRES GARANTIAS, ,, DOWLER, R.C., LIM, QUINTANA ROO, , 6 KM S, KM W B., 6/4/90, MALE, KIDNEY 92, STURNIRA, LILIUM, ROM96276, ROM, ROM, 96276, 30092, MEXICO, CAMPECHE, s 48' a 59' W, ENGSTROM, MD; CHEKUBUL, 3.7 KM SE OF CHEKUBUL, , 18 N 90 DOWLER, RC, 6/9/89, FEMALE, LIVER 93, STURNIRA, LILIUM, ROM0, ROM, ROM, 0, 30421, MEXICO, YUCATAN, LAGUNA BECANCHEN, ,,1 e 53' N 89s 18' W, ENGSTROM, MD; DOWLER, RC, 6/18/89, FEMALE, LIVER 94, STURNIRA, LILIUM, ROM0, ROM, ROM, 0, 33836, MEXICO, QUINTANA ROO, TULUM, 10 LIVER , ENGSTROM, MD, 8/24/91, FEMALE, KM N OF TULUM, , 95, STURNIRA, LILIUM, ROM97429, ROM, ROM, 97429, 30904, MEXICO, QUINTANA ROO, s 41' 87s 44' ENGSTROM, MD; REID, MAJAHUAL, 6 KM S OF MAJAHUAL, , 18 N W, FA; DOWLER, RC, 5/26/90, FEMALE, LIVER 96, STURNIRA, LILIUM, ROM97451, ROM, ROM, 97451, 30926, MEXICO, QUINTANA ROO, e 08' 9 11' MD; LAGUNA NOH-BEC, 2 KM W OF NOH-BEC, , 19 N 88 W, ENGSTROM, REID, FA; DOWLER, RC, 5/27/90, FEMALE, LIVER 97, STURNIRA, LILIUM, ROM98396, ROM, ROM, 98396, 31385, GUATEMALA, EL PROGRESO, EL RANCHO, 10 KM NW OF EL RANCHO, 280 MTS, 14 e 55' N 90 s 06' W, ENGSTROM, MD; REID, FA, 12/27/90, MALE, LIVER 98, STURNIRA, LILIUM, ROM98472, ROM, ROM, 98472, 31461, GUATEMALA, EL PROGRESO, RIO UYUS, 5 KM E OF SAN CRISTOBAL ACASAGUASTLAN, 240 MTS, 149 57 N 899 50' W, ENGSTROM, MD; REID, FA, 1/1/91, MALE, LIVER 99, STURNIRA, LILIUM, ROM99223, ROM, ROM, 99223, 31773, GUATEMALA, EL PETEN, s 9 POPTUN, 1.5 KM S OF POPTUN, 1 KM W OF POPTUN, 515 MTS, 16 18' N 89 20' W, ENGSTROM, MD; REID, FA; LIM, BK, 12/12/91, MALE, LIVER 100, STURNIRA, LILIUM, ROM99284, ROM, ROM, 99284, 31834, GUATEMALA, EL PETEN, 9 12' N s 37' W, ENGSTROM, MD; REID, FA; LIM, BK, TIKAL, , 210 MTS, 17 89 12/14/91, MALE, LIVER 101, STURNIRA, LILIUM, ROM99487, ROM, ROM, 99487, 32336, GUATEMALA, EL PETEN, CAMPO LOS GUACAMAYOS, BIOTOPO LAGUNA DEL TIGRE, 40 KM N OF EL 9 36' s 49' 12/22/91, NARANJO, , 17 N 90 W, ENGSTROM, MD; REID, FA; LIM, BK, FEMALE, LIVER 102, STURNIRA, LILIUM, ROM99616, ROM, ROM, 99616, 32285, GUATEMALA, EL PETEN, EL 9 00' 9 43' MD; REID, FA; LIM, BK, REMATE, , 120 MTS, 17 N 89 W, ENGSTROM, 12/28/91, MALE, LIVER 103, STURNIRA, LILIUM, ROM99787, ROM, ROM, 99787, 34146, GUATEMALA, SOLOLA, s 45' 9 09' PANAJACHEL, , 1560 MTS, 14 N 91 W, ENGSTROM, MD; REID, FA; LIM, BK, 1/7/92, MALE, LIVER 104, STURNIRA, LILIUM, ROM97832, ROM, ROM, 97832, 33333, GUYANA, UPPER TAKUTU-UPPER ESSEQUIBO, KUMA RIVER, 8 KM E OF LETHEM, 8.9 KM S OF s 16' 9 43' LETHEM, KANUKU MOUNTAINS, , 03 N 59 W, ENGSTROM, MD; REID, FA; LIM, BK, 9/23/90, MALE, LIVER 105, STURNIRA, LILIUM, ROM97895, ROM, ROM, 97895, 33396, GUYANA, UPPER 9 45' 9 18' , 03 N 59 W, ENGSTROM, TAKUTU-UPPER ESSEQUIBO, KARANAMBO, , MD; REID, FA; LIM, BK, 9/28/90, MALE, LIVER 106, STURNIRA, LILIUM, ROM102892, ROM, ROM, 102892, 36355, GUYANA, 9 06' s 03' POTARO-SIPARUNI, SURAMA, 5 KM SE OF SURAMA, , 04 N 59 W, ENGSTROM, MD; LIM, BK; DOWLER, RC; BOYD, A; MAXWELL, TC, 7/18/94, FEMALE, LIVER 107, STURNIRA, LILIUM, ROM1 03552, ROM, ROM, 103552, 37015, GUYANA, UPPER 9 18' 9 42' DEMERARA-BERBICE, HILL, , 05 N 58 W, ENGSTROM, MD; LIM, MABURA , BK; DOWLER, RC; BOYD, A; PARRIS, R, 8/14/94, MALE, LIVER 254 108, STURNIRA, LILIUM, ROM98699, ROM, ROM, 98699, 31521, GUYANA, BARIMA-WAINI, s 39' 9 57' MALE, LIVER , 07 N 58 W, LIM, BK; WOODWARD, SM, 3/22/91, KUMAKA, , 109, STURNIRA, LILIUM, ROM98831, ROM, ROM, 98831, 31653, GUYANA, BARIMA-WAINI, 2 40' a 14' , 07 N 59 W, LIM, BK; WOODWARD, SM, 4/6/91, FEMALE, SANTA CRUZ, , LIVER 110, STURNIRA, LILIUM, ROM98862, ROM, ROM, 98862, 31684, GUYANA, BARIMA-WAINI, WAIKEREBI, ,,07S 31'N59Q 23'W, LIM, BK; WOODWARD, SM, 4/10/91, FEMALE, LIVER 111, STURNIRA, LILIUM, ROM101154, ROM, ROM, 101154, 35152, GUYANA, BARIMA-WAINI, s 22' s 29' BARAMITA, OLD WORLD, , 07 N 60 W, LIM, BK; ROBERTSON, CJ, 10/16/92, FEMALE, LIVER 112, STURNIRA, LILIUM, ROM101000, ROM, ROM, 101000, 34998, GUYANA, BARIMA-WAINI, 9 s ' LOG HILL, , 07 23 N 60 32 W, LIM, BK; ROBERTSON, CJ, 10/5/92, FEMALE, , LIVER 113, STURNIRA, LILIUM, ROM101223, ROM, ROM, 101223, 35401, EL SALVADOR, AHUACHAPAN, EL IMPOSIBLE, SANFRNCISCO MENENDEZ, 740 MTS, 13s 51' N 909 00 ' W, ENGSTROM, MD; REID, FA; LIM, BK, 3/2/93, FEMALE, LIVER 114, STURNIRA, LILIUM, ROM101302, ROM, ROM, 101302, 35480, EL SALVADOR, e 9 48' ' AHUACHAPAN, EL REFUGIO EL IMPOSIBLE, , 240 MTS, 13 N 90 00 W, ENGSTROM, MD; REID, FA; LIM, BK, 3/6/93, MALE, LIVER 115, STURNIRA, LILIUM, ROM105875, ROM, ROM, 105875, 40126, ECUADOR, NAPO, Q 39' PARQUE NACIONAL YASUNI, ONKONE GARE, 38 KM S OF POMPEYA SUR, , 00 e S 76 27 ' W, ENGSTROM, MD; LIM, BK; SAND, AS; SORNOZA, F, 6/4/96, MALE, LIVER 116, STURNIRA, LILIUM, ROM1 05245, ROM, ROM, 105245, 37565, ECUADOR, NAPO, s 50' PARQUE NACIONAL YASUNI, EL SALADERO, 76 KM S OF POMPEYA SUR, , 00 s S 76 20 ' W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 10/13/95, MALE, LIVER 117, STURNIRA, LILIUM, ROM105174, ROM, ROM, 105174, 37490, ECUADOR, NAPO, e Q 38' ' PARQUE NACIONAL YASUNI, 37 KM S OF POMPEYA SUR, , 00 S 76 27 W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 10/8/95, MALE, LIVER 118, STURNIRA, LILIUM, ROM1 05695, ROM, ROM, 105695, 37941 -A, ECUADOR, NAPO, Q e 48' ' PARQUE NACIONAL YASUNI, 66 KM S OF POMPEYA SUR, , 00 S 76 24 W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 2/21/96, FEMALE, LIVER 119, STURNIRA, MAGNA?, ROM105705, ROM, ROM, 105705, (37953) 37941-B, ECUADOR, s 48' s ' NAPO, PARQUE NACIONAL YASUNI, 66 KM S OF POMPEYA SUR, , 00 S 76 24 W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 2/21/96, MALE, LIVER 120, STURNIRA, LUISI, ROM1 05807, ROM, ROM, 105807, 40100, ECUADOR, ESMERALDAS, Q 9 ALTO TAMBO, 2 KM S OF ALTO TAMBO, 700 MTS, 00 54' N 78 33 ' W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 3/4/96, MALE, LIVER 121, STURNIRA, LILIUM, ROM1 04204, ROM, ROM, 104204, 38034, PANAMA, CANAL ZONE, 9 Q 6' ' GAMBOA, , 09 79 42 W, LIM, , N BK, 2/18/95, MALE, LIVER 122, STURNIRA, LILIUM, ROM104359, ROM, ROM, 104359, 38218, PANAMA, DARIEN, s s PARQUE NACIONAL DARIEN, ESTACION PIRRE, 100 MTS, 08 00' N 77 43 ' W, LIM, BK; OTOOLE, E, 3/16/95, MALE, LIVER 123, STURNIRA, LUDOVICI, ROM98258, ROM, ROM, 98258, 31247, GUATEMALA, SACATEPEQUEZ, SAN MIGUEL DUENAS, 5 KM W OF SAN MIGUEL DUENAS, 1765 e fi MTS, 14 32' N 91 51 ' W, ENGSTROM, MD; REID, FA, 12/17/90, FEMALE, LIVER 124, STURNIRA, LUDOVICI, ROM99786, ROM, ROM, 99786, 34145, GUATEMALA, SOLOLA, a fi 45' ' PANAJACHEL, , 1560 MTS, 14 N 91 09 W, ENGSTROM, MD; REID, FA; LIM, BK, 1/7/92, FEMALE, LIVER 125, STURNIRA, LUDOVICI, ROM99830, ROM, ROM, 99830, 34189, GUATEMALA, ZACAPA, SAN LORENZO, 2 KM N OF SAN LORENZO, SIERRA DE LAS MINAS, 2150 MTS, 15s s 06' N 90 40 ' W, ENGSTROM, MD; REID, FA; LIM, BK, 1/9/92, FEMALE, LIVER 126, STURNIRA, LUDOVICI, ROM101366, ROM, ROM, 101366, 35544, EL SALVADOR, SANTA ANA, PARQUE NACIONAL MONTECRISTO, BOSQUE NUBLADO, 2200 MTS, e a 14 25' N89 22 ' W, ENGSTROM, MD; REID, FA; LIM, BK, 3/9/93, FEMALE, LIVER 255 127, STURNIRA, LUDOVICI, ROM101461, ROM, ROM, 101461, 35639, EL SALVADOR, SANTA ANA, PARQUE NACIONAL MONTECRISTO, LOS PLANES, 1850 MTS, 149 24' e N 89 22 ' W, ENGSTROM, MD; REID, FA; LIM, BK, 3/12/93, FEMALE, LIVER 128, STURNIRA, LUDOVICI, ROM1 04295, ROM, ROM, 104295, 38145, PANAMA, CHIRIQUI, SANTA CLARA, OJO DE AGUA, 2 KM N OF SANTA CLARA, 1500 MTS, 08 e 52' N 829 45 ' W, LIM, BK; OTOOLE, E, 3/7/95, MALE, LIVER 129, STURNIRA, TILDAE, ROM97994, ROM, ROM, 97994, 33495, GUYANA, 8 s 20' ' POTARO-SIPARUNI, SURAMA, 30 KM NE OF SURAMA, , 04 N 58 51 W, ENGSTROM, MD; REID, FA; LIM, BK, 10/5/90, FEMALE, LIVER 130, STURNIRA, TILDAE, ROM103161, ROM, ROM, 103161, 36624, GUYANA, e Q 06' ' POTARO-SIPARUNI, SURAMA, 5 KM SE OF SURAMA, , 04 N 59 03 W, ENGSTROM, MD; LIM, BK; DOWLER, RC; BOYD, A; MAXWELL, TC, 7/26/94, FEMALE, LIVER 131, STURNIRA, TILDAE, ROM1 04741, ROM, ROM, 104741, 38332, GUYANA, s 28' POTARO-SIPARUNI, IWOKRAMA RESERVE, 25 KM SSW OF KURUPUKARI, , 04 N58 9 47'W, LIM, BK; LEE, TE; ARMITANO, S, 7/11/95, FEMALE, LIVER 132, STURNIRA, TILDAE, ROM1 03366, ROM, ROM, 103366, 36829, GUYANA, UPPER Q 09' e DEMERARA-BERBICE, TROPENBOS, 20 KM SSE OF MABURA HILL, , 05 N 58 42 ' W, ENGSTROM, MD; LIM, BK; DOWLER, RC; BOYD, A; MAXWELL, TC, 8/5/94, MALE, LIVER 133, STURNIRA, TILDAE, ROM1 00981, ROM, ROM, 100981, 34979, GUYANA, e 22' s ' BARIMA-WAINI, BARAMITA, OLD WORLD, , 07 N 60 29 W, LIM, BK; ROBERTSON, CJ, 10/3/92, MALE, LIVER 134, STURNIRA, TILDAE, ROM1 05726, ROM, ROM, 105726, 37976, ECUADOR, NAPO, s 50' PARQUE NACIONAL YASUNI, EL SALADERO, 76 KM S OF POMPEYA SUR, , 00 S S76 20'W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 2/22/96, FEMALE, LIVER 135, STURNIRA, TILDAE, ROM1 05765, ROM, ROM, 105765, 40058, ECUADOR, NAPO, PARQUE NACIONAL YASUNI, 30 KM SW OF ONKONE GARE, 300 MTS, 00e 45' S 76s 46 ' W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 2/26/96, FEMALE, LIVER 136, STURNIRA, MAGNA, ROM1 04000, ROM, ROM, 104000, 37088, ECUADOR, NAPO, PARQUE NACIONAL YASUNI, ESTACION CIENTIFICA ONKONE GARE, 38 KM S OF s 9 39' ' POMPEYA SUR, , 00 S 76 27 W, ENGSTROM, MD; REID, FA; SORNOZA, F, 1/6/95, FEMALE, LIVER 137, STURNIRA, MAGNA, ROM1 04043, ROM, ROM, 104043, 37148, ECUADOR, NAPO, e 41' 9 ' PARQUE NACIONAL YASUNI, 42 KM S, 1 KM E OF POMPEYA, , 00 S 76 26 W, ENGSTROM, MD; REID, FA; SORNOZA, F, 1/10/95, FEMALE, LIVER 138, STURNIRA, MAGNA, ROM104514, ROM, ROM, 104514, 37361, ECUADOR, NAPO, PARQUE NACIONAL YASUNI, EL 9 SALADERO, 76 KM S OF POMPEYA SUR, , 00 50 s S 76 20 ' W, ENGSTROM, MD; REID, FA; SORNOZA, F, 5/19/95, FEMALE, LIVER 139, STURNIRA, MAGNA, ROM105622, ROM, ROM, 105622, 37867, ECUADOR, NAPO, 9 PARQUE YASUNI, 38' 9 ' NACIONAL 35 KM S OF POMPEYA SUR, , 00 S 76 27 W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 2/16/96, FEMALE, LIVER 140, STURNIRA, MAGNA, ROM105763, ROM, ROM, 105763, 40056, ECUADOR, NAPO, PARQUE NACIONAL YASUNI, 30 KM SW OF ONKONE GARE, 300 MTS, 009 45' S 76 e 46 ' W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 2/26/96, MALE, LIVER 141, STURNIRA, MAGNA, ROM105683, ROM, ROM, 105683, 37929, ECUADOR, NAPO, 9 PARQUE NACIONAL YASUNI, 1 KM S OF ESTACION CIENTIFICA 41' YASUNI, , 00 S 9 76 24 ' W, ENGSTROM, MD; LIM, BK; SORNOZA, F, 2/20/96, MALE, LIVER 142, STURNIRA, TILDAE, 268554, AMNH, AMNH, 268554, MBS801, FRENCH GUIANA, , 9 PARACOU, 12 KM SSE OF SINNAMARY, 25 MTS, 05 16.5' N 529 55.4 ' W, SIMMONS, NB, , FEMALE, 143, ARTIBEUS, JAMAICENSIS, 266345, AMNH, AMNH, 266345, , FRENCH GUIANA MALE, 144, CHIRODERMA, TRINITATUM, 268531, AMNH, AMNH, 268531, , FRENCH GUIANA , FEMALE, , 145, RHINOPHYLLA, PUMILIO, 266186, AMNH, AMNH, 266186, , FRENCH GUIANA FEMALE, 256 146, URODERMA, BILOBATUM, 267465, AMNH, AMNH, 267465, , FRENCH GUIANA FEMALE, 147, VAMPYRESSA, BROCKI, 268567, AMNH, AMNH, 268567, , FRENCH GUIANA , FEMALE, 148, VAMPYRUM, SPECTRUM, 267446, AMNH, AMNH, 267446, , FRENCH GUIANA FEMALE, 149, ARTIBEUS, CINEREUS, 267978, AMNH, AMNH, 267978, , FRENCH GUIANA MALE, 150, ARTIBEUS, LITURATUS, 268509, AMNH, AMNH, 268509, , FRENCH GUIANA FEMALE, 151, ARTIBEUS, OBSCURUS, 266281, AMNH, AMNH, 266281, , FRENCH GUIANA FEMALE, 152, CHIRODERMA, VILLOSUM, 268535, AMNH, AMNH, 268535, , FRENCH GUIANA MALE, 153, GLOSSOPHAGA, SORICINA, 267951, AMNH, AMNH, 267951, , FRENCH GUIANA , MALE, 154, ARTIBEUS, GNOMUS, 267986, AMNH, AMNH, 267986, , FRENCH GUIANA MALE, 155, ARTIBEUS, CONCOLOR, 267981, AMNH, AMNH, 267981, , FRENCH GUIANA FEMALE, 156, CAROLLIA, PERSPICILLIATA, 267964, AMNH, AMNH, 267964, , FRENCH GUIANA , , MALE, , 157, STURNIRA, LILIUM, 268547, AMNH, AMNH, 268547, , FRENCH GUIANA MALE, 158, AMETRIDA, CENTURIO, 267976, AMNH, AMNH, 267976, , FRENCH GUIANA, ,,,,,,, MALE, 159, STURNIRA, LILIUM, MVZ185628, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD417, BRAZIL, SAO PAULO, CAJURU, SANTANA-FAZENDA STA. s s CARLOTA, MUN. CAJURU, , 21 24.12' S 47 16.3' W, DITCHFIELD, A., 11/5/93, MALE, 160, STURNIRA, LILIUM, MVZ1 85642, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD452, BRAZIL, SAO PAULO, JAPI, SERRA DO JAPI E ERMIDA, MUN. e 14' s 57' JUNDAI , , 23 S 46 W, DITCHFIELD, A., 1 1/18/93, MALE, 161, STURNIRA, LILIUM, MVZ1 85644, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD578, BRAZIL, SAO PAULO, SAIBADELA, BASE SAIBADELA, FAZENDA INTERVALES, s e MUN.SETE BARRAS, , 24 12' S 47 54 W, DITCHFIELD, A., 12/9/93, MALE, 162, STURNIRA, LILIUM, MVZ185650, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD267, BRAZIL, RIO DE JANEIRO, ITATIAIA, FAZENDA STA.MONICA, 9 39' e 54' MUN. ITATIAIA, , 22 S 42 W, DITCHFIELD, A., 9/21/93, FEMALE, 163, STURNIRA, LILIUM, MVZ1 85658, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, s , AD181, BRAZIL, BAHIA, MASSARANDUPIO, 17' MUN. ENTRE RIOS, , 12 S e 37 50' W, DITCHFIELD, A., 8/3/93, MALE, 164, STURNIRA, LILIUM, MVZ1 85667, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD524, BRAZIL, PARANA, GUARICANA, FAZENDA GUARICANA, GRUPO BAMERINDUS, s 49' e 02' MUN. GUARATUBA, , 25 S 49 W, DITCHFIELD, A., 11/29/93 MALE, 165, STURNIRA, LILIUM, MVZ185911, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, AD065, , BRAZIL, PARAIBA, GUARIBAS, RESERVA GUARIBAS (IBAMA), MATA CABECA DE BOI, MUN. 6° 45' 35° 07' MAMANGUAPE, , S W, DITCHFIELD A 7/17/93, FEMALE, 166, STURNIRA, LILIUM, MVZ185915, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, 9 e , AD208, BRAZIL, BAHIA, CARAVELAS, 41' 14' MUN.CARAVELAS, , 17 S 39 W, DITCHFIELD, A., 8/13/93, MALE, 167, STURNIRA, LILIUM, MVZ1 85920, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, ' BRAZIL, AD241, , BRAZIL, SAO PAULO, ILHABELA, PARQUE ESTADUAL DE ILHABELA, ILHA SAO SEBASTIAO, MUN. ILHABELA, s 46' 9 20' , 23 S 45 W DITCHFIELD, A., 8/29/93, FEMALE, 257 168, STURNIRA, LILIUM, MVZ1 85925, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD290, BRAZIL, RIO DE JANEIRO, FAZENDA SAO JOSE, FAZENDA SAO s 13' Q 45' JOSE DA SERRA, MUN. SUMIDOURO, , 22 S 42 W, DITCHFIELD, A., 9/27/93, FEMALE, 169, STURNIRA, LILIUM, MVZ1 85926, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD339, BRAZIL, SPIRITU SANTO, ARACRUZ, FOREST BELONGING TO 9 fi ARACRUZ CELULOSE, MUN. ARACRUZ, , 19 53' S 40 09' W, DITCHFIELD, A., 10/7/93, FEMALE, 170, STURNIRA, LILIUM, MVZ185928, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD365, BRAZIL, MINAS GERAES, CARATINGA, ESTACAO BIOLOGICA DE s 47' s 57' CARATINGA, FAZENDA MONTES CLAROS, MUN. CARATINGA, , 19 S 41 W, DITCHFIELD, A., 10/17/93, MALE, 171, STURNIRA, LILIUM, MVZ185943, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD547, BRAZIL, PARANA, ITAIPU, REFUGIO STA. HELENA, ITAIPU e 26' s 35' BINACIONAL, MUN. FOZ DO IGUACU, , 25 S 54 W, DITCHFIELD, A., 12/4/93, FEMALE, 172, STURNIRA, LILIUM, MVZ185946, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD552, BRAZIL, PARANA, ARAPOTI, FAZENDA SAO NICOLAU, MUN. 9 02' Q 56' ARAPOTI, , 24 S 49 W, DITCHFIELD, A., 12/7/93, FEMALE, 173, STURNIRA, TILDAE, MVZ185951, MVZ-BERKELEY, CA, MUSEO ZOOLOGIA-USP, BRAZIL, , AD580, BRAZIL, SAO PAULO, SAIBADELA, BASE SAIBADELA, FAZENDA s 9 INTERVALES, MUN.SETE BARRAS, , 24 12' S 47 54' W, DITCHFIELD, A., 12/9/93, MALE, 174, STURNIRA, ANGELI, SP 9397, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, 112363, TJMc7975, e 20' s 22' DOMINICA, ST. PAUL PARISH, , SPRINGFIELD ESTATE, 360 MTS, 15 N 61 w, McCarthy, tj, 7/30/92, female, 175, STURNIRA, BIDENS, SP 10654, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, 112824, TJMc7505, ECUADOR, ESMERALDAS, , TOISAN MOUNTAINS, RESERVA ECOLOGICA COTOCACHI-CAYAPAS, EL ZINC CAMP., 2350 MTS, e 31' N 78e 37 W, MCCARTHY, TJ, 11/22/91, MALE, 176, STURNIRA, LUDOVICI, SP 10805, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, 1 12838, TJMC7789, ECUADOR, ESMERALDAS, , EAST OF CRISTAL, W SLOPES ABOVE LITA, 700 MTS, s 48' e 27' N 78 W, MCCARTHY, TJ, 12/30/91 , MALE, 177, sturnira, ludovici, sp 10784, cmnh-carnegie museum of natural history, cmnh-carnegie museum of natural history, 1 12826, tjmc7730, q q ecuador, carchi, el pailon, rio pailon, 970 mts, 1 0' n 78 14' w, McCarthy, tj, 12/20/91, female, 178, sturnira, ludovici, sp 10677, cmnh-carnegie museum of natural history, cmnh-carnegie museum of natural history, 112835, tjmc7561, ecuador, esmeraldas, los pambiles at rio las piedras, toisan mountains, reserva ecologica cotocachi-cayapas, el zinc camp., s 32' s 38' 1200 MTS, N 78 W, MCCARTHY, TJ, 1 1/27/91 , MALE, 179, STURNIRA, ZYGOMATICUS, SP 9355, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, 112368, TJMc7909, MARTINIQUE, , , ROUTE FORESTIERE DE FOND BARON, .5 KM N d'ABSALON JUNCTION, ALONG HWY N3, N FORT DE FRANCE (NEAR "PUMP BLDG" ALONG RIVIERE DUMANZE IN BAMBOO, 400 MTS, 14s 40' N 61 9 05' W, MCCARTHY, TJ, 7/19/92, MALE, 180, STURNIRA, sp A, SP 10671, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, CMNH-CARNEGIE MUSEUM OF NATURAL HISTORY, 1 12812, TJMc7549, ECUADOR, ESMERALDAS, LOS PAMBILES AT RIO LAS PIEDRAS, TOISAN MOUNTAINS, RESERVA ECOLOGICA COTOCACHI-CAYAPAS, LAS PIEDRAS s RIVER, AT CAMP., 1200 MTS, 32' N 78 a 38' W, MCCARTHY, TJ, 11/26/91, MALE, , , , 258 181, sturnira, sp b, sp 10772, cmnh-carnegie museum of natural history, cmnh-carnegie museum of natural history, 112823, tjmc7709, ecuador, esmeraldas, comunidad de nueva vida, 1.9 km n, 10.4 km e codesa-sade camp. at rio esmeraldas, 455 mts, s 32' n 798 17' w, McCarthy, tj, 12/11/91, female, 208, sturnira, bidens, m 669, lsu-museum of natural sciences, lsu-museum of natural sciences, 26924, ljb 1520a, peru, piura, cerro chinguela, ca. 5 km ne zapalache, 2, 900 mts, , barkley, l.j., 7/21/80, male, 209, sturnira, erythromos, m 1681, lsu-museum of natural sciences, lsu-museum of natural sciences, 28168, ljb 2355, peru, huanuco, unchog, pass between churrubamba and hacienda paty, nnw acomayo, 3, 450 mts, , barkley, l.j., 7/20/84, male, 210, STURNIRA, ERYTHROMOS, AK 14236, TA&M-Texas A&M University, OMNH-OKLAHOMA MUSEUM OF NATURAL HISTORY, 23516, ARG 1236, ARGENTINA, TUCUMAN, TRANCAS-LAS 22 JUNTAS, KM W OF CHOROMORO, 1, 067 MTS, , BRAUN, J.K., 7/3/90, FEMALE, 211, STURNIRA, MORDAX.AK7069, TA&M-Texas A&M University, CMNH, 92487, TJMC6794, RICA, COSTA ALAJUELA, , 4.2 KM SE CARIBLANCO, , MCCARTHY, TJ, 2/12/83, , FEMALE, 212, sturnira, ludovici, sp 13456, cmnh-carnegie museum of natural history, cmnh, , manca815, guatemala, pinalon, sierra de las minas 213, sturnira, ludovici, sp 12730, cmnh-carnegie museum of natural history, cmnh, , tjmc8908, guatemala, la union, zacapa 214, sturnira, ludovici, sp 12634, cmnh-carnegie museum of natural history, cmnh, , tjmc8676, guatemala, izabal, cerro san gil, cerro las escobas-las torres, 940 mts, , mccarthy, tj, , , 215, sturnira, ludovici, sp 12586, cmnh-carnegie museum of natural history, cmnh, , tjmc8618, guatemala, izabal, pozo de agua, , >1, 000 mts, , McCarthy, tj, , 216, sturnira, ludovici, sp 11617, cmnh-carnegie museum of natural history, cmnh, , jvp2095, guatemala, guatemala, finca san agustin las minas, , 1, 500-1, 800 mts, , McCarthy, tj, , 217, sturnira, ludovici, sp 11608, cmnh-carnegie museum of natural history, cmnh, , jvp2085, guatemala, guatemala, finca san agustin las minas, , 1, 500-1, 800 mts, , McCarthy, tj, , 218, sturnira, ludovici, sp 13316, cmnh-carnegie museum of natural history, cmnh, , manca407, honduras, agalta mccarthy, tj, , , 219, sturnira, ludovici, sp 12913, cmnh-carnegie museum of natural history, cmnh, , tjmc9390, honduras, , celaque, , , >2, 000 mts, mccarthy, tj, , , 220, sturnira, ludovici, sp 12899, cmnh-carnegie museum of natural history, cmnh, , tjmc9337, honduras, celaque, , , >2, 000 mts, , mccarthy, tj, , , 221, sturnira, ludovici, sp 11795, cmnh-carnegie museum of natural history, cmnh, , tjmc8111, honduras, lempira, la muralla, , , , mccarthy, tj, , , 222, sturnira, ludovici, sp 11701, cmnh-carnegie museum of natural history cmnh, tjmc8075, , honduras, , celaque, 1, , , 460 mts, mccarthy, tj, , , 223, sturnira, lilium, sp 12815, cmnh-carnegie museum of natural history, cmnh, , tjmc9035, guatemala, izabal, finca semic, , , , mccarthy, tj, 1/1/94, , 224, sturnira, lilium, sp 11595, cmnh-carnegie museum of natural history, cmnh, tjmc8030, , guatemala, guatemala, finca san agustin las minas, , , McCarthy, tj, 1/1/92, 225, sturnira, sp a, sp 10655, cmnh-carnegie museum of natural history cmnh, 112804, tjmc7508, ecuador 226, sturnira, sp b, sp 10721, cmnh-carnegie museum of natural history cmnh, 112822, tjmc7619, ecuador 229, STURNIRA, THOMASI, , TTU, , 19906, HHG2261, GUADELOUPE, BASSE-TERRE 1 KM VERNOU, W , , GENOWAYS, H.H., 7/26/74, FEMALE, BONE&HAIR 259 230, STURNIRA, THOMASI, , TTU, 19907, JCP487, GUADELOUPE, BASSE-TERRE, , 1 , KM W , PATTON, J.C., 7/24/74, FEMALE, VERNOU, , BONE&HAIR 231, STURNIRA, ARATATHOMASI, , ROM, 70874, MET3018, COLOMBIA, VALLE, PENAS , BLANCAS, PICHINDE, 15 KM SW CALI, 1, 800 MTS, , THOMAS, M.E., 8/5/73, FEMALE, BONE&HAIR 232, STURNIRA, ARATATHOMASI, , ROM, 46349, 237-B87 or B88, , ECUADOR ARATA & THOMAS, , FEMALE, FIXED LIVER 233, STURNIRA, , UNSM, 20062, TPMPs-1093, MONTSERRAT, ST. THOMASI, , GEORGE , , 8 S HARRIS, PARADISE ESTATES, , PEDERSEN, S.C., 5/14/94, FEMALE, KM , BONE 234, STURNIRA, LILIUM, , UNSM, 19229, CJP-5142, GRENADA, ST. ANDREW, , 5 , KM W GRENVILLE, BIRCH GROVE, , PHILLIPS GRAND ETANG FOREST RESERVE, , & PEDERSEN, 7/19/89, MALE, FIXED LIVER 235, STURNIRA, ERYTHROMOS, , FLMNH, 27388.00, , VENEZUELA, MERIDA, , LA , , s CARBONERA FIELD STATION, UNIVERSIDAD DE LOS ANDES, 2, 350 MTS, 8 39' N s 71 24' W, BONACCORSO, F.J., 6/20/87, FEMALE, FIXED LIVER 236, STURNIRA, LUDOVICI, , FLMNH, 27387.00, , VENEZUELA, MERIDA, , LA , , s CARBONERA FIELD STATION, UNIVERSIDAD DE LOS ANDES, 2, 350 MTS, 8 39' N 71 fi 24' W, BONACCORSO, F.J., 6/20/87, MALE, FIXED LIVER 237, STURNIRA, LILIUM, , FLMNH, 16259.00, JH 100, , 40 , , VENEZUELA, GUARICO, KM S OF CALABOZO, , HERMANSON, J., 7/5/81, FEMALE, FIXED LIVER , 238, STURNIRA, , , , ERYTHROMOS, , , FLMNH, 24239.00, VENEZUELA, MERIDA, LA CARBONERA FIELD STATION, UNIVERSIDAD DE LOS ANDES, 2, 350 MTS, 8 9 39' N B 71 24' W, BONACCORSO, F.J., 6/20/87, FEMALE, FIXED LIVER 239, STURNIRA, , , ERYTHROMOS, , , , FLMNH, 27282.00, VENEZUELA, MERIDA, LA CARBONERA FIELD STATION, UNIVERSIDAD DE LOS ANDES, 2, 350 MTS, 8 e 39' N a 71 24' W, BONACCORSO, F.J., 6/20/87, FEMALE, FIXED LIVER 240, STURNIRA, NANA, , LSU, 16519, ALG11620, , PERU, AYACUCHO, SAN JOSE, RIO SANTA ROSA, 1, 006 MTS, , GARDNER, AL, 4/30/71, MALE, BONE&HAIR 241, STURNIRA, NANA, , , LSU, 16524, ALG11708, PERU, AYACUCHO, HUANHUACHAYO, , e 5 1, 660 MTS, 12 44' S 73 47' W, GARDNER, AL, 5/9/71, FEMALE, BONE&HAIR 242, STURNIRA, NANA, , , LSU, 16523, JP04227, PERU, AYACUCHO, HUANHUACHAYO, , 1, 660 MTS, 12 fi 44' S 73s 47' W, O'NEIL, JP, 5/9/71, MALE, BONE&HAIR 243, STURNIRA, NANA, , LSU, , 16522, ALG11702, PERU, AYACUCHO, HUANHUACHAYO, , e 44' s 47' 1 , 660 MTS, 12 S 73 W, GARDNER, AL, 5/8/71 , FEMALE, BONE&HAIR 244, STURNIRA, LILIUM, , , FLMNH, 27658, CAM, ARGENTINA, JUJUY, PALO BLANCO, 5 KM SW OF PALO BLANCO "HOUSES", 450 MTS, , IUDICA, CA, 7/25/92, MALE, FIXED LIVER 245, STURNIRA, LILIUM, , USNM, USNM, 580674, 56552, SAINT VINCENT, , ST. ANDREW PARISH 2.4 VERMONT, KM E BY ROAD OF VERMONT, , R.I., , CROMBIE. 8/4/89, FEMALE, NOT RECORDED 246, STURNIRA, LUISI, , USNM, USNM, 464718, 2122, PANAMA, BOCAS DELTORO, ISLA COLON, LA GRUTA, , F.M., , GREENWELL, 2/15/88, FEMALE, NOT RECORDED 247, STURNIRA, LUISI, , USNM, USNM, 578239, 1692, PANAMA, BOCAS DELTORO, PENINSULA VALIENTE, BAHIA AZUL, PIGEON KEY TRAIL, ,, HANDLEY, C.O.Jr., 4/26/90, FEMALE, NOT RECORDED 248, STURNIRA, LUISI, , USNM, USNM, 579051, 1698, PANAMA, BOCAS DELTORO, ISLA POPA, S SHORE, 1 E KM CHANNEL, , SUMWOOD , HANDLEY, C.O.Jr., 3/9/91, FEMALE, NOT RECORDED 249, STURNIRA, MAGNA, , USNM, USNM, 574555, 619, ECUADOR, PASTAZA, TIGUINO, 130 S J.F., KM OF COCA, , , JACOBS, 8/19/90, FEMALE, NOT RECORDED STURNIRA, TILDAE, 250, , USNM, USNM, 574556, 649, ECUADOR, PASTAZA, TIGUINO, 130 S KM OF , J.F., COCA, , JACOBS, 8/21/90, FEMALE, NOT RECORDED 251, STURNIRA, TILDAE, , USNM, USNM, 560796, 14578, VENEZUELA, AMAZONAS, CERRO NEBLINA, BASE CAMP, , , GARDNER, A.L., 2/20/85, MALE, NOT RECORDED. APPENDIX 7 LIST AND FORMULAE OF STOCK SOLUTIONS USED IN THE DNA EXTRACTION OF TISSUE SAMPLES -STE: 100 mM NaCI For 1 liter: 5.84 g NaCI 1 mM EDTA, pH 8.0 50 mL 0.2 M EDTA 50 mM Tris-HCI, pH 8.0 50 mL 1 M Tris autoclave, store in refrigerator or at room temperature -TE: 10 mM Tris-HCI, pH 7.5 For 1 liter: 10 mL 1 M Tris 1 mM EDTA, pH 7.5 5 mL 0.2 M EDTA autoclave, store in refrigerator or at room temperature -Buffered Phenol: Phenol saturated with Tris-HCI buffer (available from GIBCO) store in refrigerator -PCI solution: Phenol, chloroform, isoamyl alcohol (25:24:1), (available from GIBCO) store in refrigerator -CI solution: Chloroform, isoamyl alcohol (24:1) store in refrigerator or at room temperature -SDS: Sodium lauryl sulfate (= sodium dodecyl sulfate) 20% solution (weight/volume). Do not autoclave. Store at room temperature -Sodium Acetate: 3 M solution For 1 liter use 246.1 g NaAc 260 APPENDIX 8 FINAL SEQUENCES Aligned, final sequences representative of every species included on the phylogenetic analysis, including four outgroup species and 24 ingroup individuals. Nomenclature followed original from the specimen's label. Country of origin and c(arlos) a(lberto) i(udica) number is provided for most specimens. Uroderma bilobatum ATGACCAACATTCGAAAAACCCATCCCCTATTAAAAATTATTAACAGCTCCTT TGTAGATCTCCCTGCCCCCTCAAGTCTTTCATCATGATGAAATTTTGGCTCTC TCCTAGGAGTTTGCTTAGGAGTACAAATCCTAACAGGACTATTTCTAGCAAT ACACTACACATCAGATACAGCAACCGCATTCAACTCTGTCACCCACATCTGC CGAGATGTCAATTATGGCTGACTACTCCGATACCTCCACGCCAACGGAGCC TCCATATTCTTTATCTGCCTCTATCTTCATGTAGGCCGAGGCTTATACTATGG TTCCTATACCTACTCAGAAACATGGAATATTGGAATCCTACTCCTTTTCGCTG TAATAGCTACAGCATTCATGGGCTATGTCTTACCATGAGGACAAATATCGTT CTGAGGAGCCACTGTCATCACAAACCTCCTCTCCGCCATCCCCTATATCGG AACAGACCTAGTTCAATGAATCTGAGGCGGCTTCTCCGTAGACAAAGCTAC CCTCACTCGATTCTTTGCCTTCCACTTCCTACTTCCCTTTATCGTAGCAGCTC TAGTAATAGTCCACCTCTTATTCTTACACGAAACAGGTTCCAACAACCCAACA GGCATCCCATCAGACTCAGACATAATCCCCTTCCACCCCTACTAT— ACCATTAAAGACATTCTAGGGTTCTTAATTATACTTACAGCTCTATCATCACT AGTCCTATTCTCACCAGACCTCTTAGGAGACCCAGATAATTATATCCCAG Vampyressa pusilla ATGACCAACATTCGAAAAACTCACCCCCTACTAAAAATTATCAACAGCTCCTT CGTAGACCTTCCTGCCCCTTCAAGTCTTTCATCCTGATGAAACTTTGGTTCT CTCCTAGGAGTATGCTTAGGAGTACAAATCCTCACAGGACTTTTCCTAGCAA TGCACTATACATCTGATACAGCAACTGCATTTAACTCTGTCACCCACATCTG CCGAGACGTAAACTACGGGTGACTTCTCCGATATCTTCATGCTAACGGAGC CTCCATATTCTTTATCTGCCTATATCTCCATGTAGGCCGAGGCCTATACTATG GATCCTACACATACTCAGAAACGTGAAACGTTGGCATTCTTCTCCTATTCGC TGTAATAGCTACAGCTTTCATAGGATATGTATTACCATGAGGACAAATATCCT TCTGAGGGGCTACCGTTATCACCAACCTCCTTTCTGCTATCCCCTACATCGG AACAGAATTAGTCCAATGAATCTGAGGCGGGTTCTCTGTAGACAAAGCAACC CTCACCCGATTCTTTGCCTTTCACTTTCTACTTCCCTTCATTATTACAGCCCT AGTGATAGTCCACCTTCTATTCCTACACGAAACGGGCTCTAATAACCCAACA GGCATCCCATCAGACCCAGATATAATCCCCTTCCACCCTTATTAT— ACTATTAAAGACATCTTAGGTTTTCTAA TTATACTCACAGCCTTATCAGCGCTAGTCCTATTCTCACCAGATCTTCTAGGA GACCCAGATAATTATATCCCCG 261 262 Centurio senex ATGACCAACATTCGAAAAACCCACCCCCTACTAAAAATTATTAACTACTCATT CGTAGACCTTCCCGCACCATCAAGTCTCTCATCATGATGAAACTTTGGTTCC CTTTTAGGAGTGTGCTTAGGCGTACAAATTTTAACAGGACTATTCCTAGCAA TACACTATACATCTGACACAGCTACAGCATTCAACTCTGTTACCCATATCTGC CGAGATGTAAACTACGGATGACTACTACGATACATACACGCTAACGGTGCCT CCATATCTTCTATCTGCCTCTACCTTCACGTAGGACGGGGCCTATATTACGG ATCCTACACATACTCAGAAACATGAAATATCGGTATCCTACTACTATCCCGA GTTATAGCTACAGCCTTCATGGGCTACGTATTACCA Carollia perspicillata ATGACCAACATTCGAAAAACCCACCCACTCCTAAAAATTGTTAATAGCTCATT CGTAGACCTCCCCGCTCCTTCCAGCCTATCTTCCTGATGAAACTTTGGCTCT CTTTTAGGAGTATGCCTAGCTGTCCAAATTTTAACAGGATTATTCCTAGCTAT ACACTATACATCCGACACAGCTACCGCATTCAACTCCGTTACCCATATTTGC CGAGATGTCAACTACGGATGAGTCCTTCGCTATCTTCACGCCAACGGAGCA TCTATATTCTTTATTTGCCTATACTTACATGTAGGCCGAGGCCTATACTACGG ATCCTACACATATTCAGAAACCTGAAACGTCGGTATCCTCCTACTATTTGCC GTTATAGCAACAGCATTCATAGGATATGTCCTACCATGAGGACAAATATCTTT TTGAGGAGCAACAGTCATCACTAACCTTCTCTCAGCCATCCCCTATATTGGA ACAGACCTAGTACAATGAATCTGAGGAGGCTTTTCTGTAGACAAAGCTACCC TCACTCGATTCTTTGCCTTCCATTTCCTACTTCCCTTTGTAGTAGCAGCCCTA GTAATAGTGCATCTCCTATTCCTACACGAAACCGGGTCTAACAACCCAACAG GCATCCCATCAGACTCAGATATAATTCCGTTCCACCCTTACTAC— ACTATCAAAGATATCCTGGGCTTTTTAGTAATACTCACTGCTCTATCAACACT AGTACTATTCTCACCCGACCTCCTAGGAGACCCTGACAATTACACACCAG Sturnira sp. A (from Ecuador, CAI#180) ATGACCA7CATTCGTAAAACTCACCCTCTACTAAAAATTATCAACAACTCACT CGTAGACCTACCCGCTCCATCAAGCCTATCATCATGATGAAACTTCGGCTCT CTTTTAGGAGTATGCTTAGGTGTACAAATTTTGACAGGATTATTCCTAGCAAT GCACTACACATCCGACACAGCTACCGCATTCAACTCTGTAACACACATCTGC CGAGATGTAAACTACGGCTGACTACTTCGATACCTCCATGCCAACGGAGCA TCCATATTCTTCATCTGCCTCTATCTACACGTAGGCCGAGGCCTCTATTACG GATCCTACACATACTCAGAAACATGAAACATCGGCATCCTCCTTCTCTTTAC CGTCATAGCCACAGCATTCATAGGCTACGTCCTTCCATGAGGACAAATATCC TTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCCATCCCCTACATCG GAACCGAACTAGTTCAATGAATCTGAGGCGGCTTCTCCGTAGACAAAGCAA CTCTCACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCAGC CCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAACCCC ACAGGCATCCCATCAGACCCAGACATAATCCCGTTCCACCCTTAGGAC— ACCATTAAAGATATCCTAGGTTTCCTAATCATATTAACAGCCCTATCCGCCCT AGTA?TATTTTCACCCGACCTACTAGG?GACCCAGACAAATACATCCCAG Sturnira sp. B (from Ecuador, CAI#226) ATGACCAACATTCGTAAAACTCACCCCCTACTAAAAATTATCAACAACTCACT CGTAGACCTACCCGCTCCATCAAGCCTCTCATCATGATGAAATTTCGGCTCT CTTTTAGGAGTATGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAAT GCACTACACATCTGATACAGCCACCGCATTCAACTCTGTAACACATATCTGC CGAGACGTAAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAGCA 263 TCCATATTCTTCATCTGCCTCTACCTACACGTAGGCCGAGGCCTCTACTACG GATCCTACACATACTCAGAAACATGAAACATCGGCATCCTCCTTCTCTTCGC CGTTATAGCTACAGCATTCATAGGCTACGTCCTCCCATGAGGACAAATATCC TTCTGGGGGGCAACAGTCATCACCAACCTCCTCTCTGCCATCCCCTACATC GGAACTGAGCTAGTCCAATGAATCTGAGGAGGCTTCTCCGTACACAAAGCA ACCCTCACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCAG CCCTAGTAATAGTCCACCTCCTATTCCTGCACGAAACCGGATCAAACAACCC CACAGGCATTCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAT— ACCATCAAAGACATTCTAGGCTTTCTAATTATATTGACAGTCCTATCCGCCCT AGTATTATTTTCACCTGACCTACTAGGAGACCCAGACAATTACACCCCGG Sturnira aratathomasi (from Colombia, CAI#231) ATGACCAACATTCGAAAAACTCACCCCCTATTAAAAATTATCAACAACTCACT CGTAGACCTCCCTGCTCCATCAAGCCTCTCATCATGATGAAATTTCGGCTCT CTTTTAGGAGTATGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAAT GCACTACACATCAGACACAGCCACCGCATTCGACTCTGTAGCCCATATCTGT CGAGACGTAAACTACGGTTGACTACTCCGATACCTCCATGCCAACGGAGCA TCTATATTTTTCATCTGCCTTTACCTTCATGTAGGACGAGGACTCTATTACGG ATCCTATATATACTCAGAAACATGAAACATCGGCATCCTTCTCCTCTTTGCCG TTATAGCTACAGCATTCATAGGCTACGTCCTTCCATGAGGACAGATATCCTT CTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACATTGGA ACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAGCAACC CTCACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCAGCTC TAGTAATAGTCCACCTTCTATTCCTGCATGAAACCGGATCAAACAACCCCAC AGGCATCCCATCAGACCCGGACATAATCCCGTTCCACCCCTACTAC— ACTATCAAAGACATCCTAGGCTTCCTAGTCATACTAACAGCCTTATCTACCCT AGTCTTATTTTCACCCGACCTATTAGGAGACCCAGACAATTACATTCCAG Sturnira bidens (from Peru, CAI#208) ATGACCAACATTCGAAAAACACACCCCCTACTAAAAATCATCAACAGCTCATT CGTAGACCTCCCCGCCCCATCAAGCCTCTCATCATGATGAAACTTCGGCTCT CTTTTAGGAGTGTGCCTCGGCGTACAGATCCTAACAGGATTATTCCTAGCAA TACATTACACATCCGACACAGCCACCGCATTCAACTCTGTCACCCACATTTG CCGAGACGTAAACTACGGCTGACTCCTCCGATATCTCCACGCCAATGGAGC CTCCATATTCTTTATCTGTCTCTACCTACACGTAGGCCGAGGCCTGTACTAC GGATCCTACACATACTCAGAAACATGAAACGTCGGCATTCTCCTCCTCTTTG CCGTCATAGCTACAGCATTCATAGGTTACGTACTCCCATGAGGACAAATATC ATTCTGAGGGGCAACAGTCATCACCAACCTACTCTCCGCCATCCCCTACATC GGAACAGACTTAGTCCAGTGAATCTGAGGCGGCTTTTCCGTAGACAAAGCA ACCCTTACCCGATTCTTCGCCTTCCACTTCCTCCTTCCTTTTATCGTAGCAGC CCTAGTCATAGTCCACCTCCTATTTCTGCACGAAACCGGATCAAACAACCCC ACAGGCATCCCATCAGACCCCGACATAATTCCATTCCACCCATACTAC— ACCATCAAAGACATTCTAGGCTTCCTAATCATACTCACAGCCCTATCAACTCT AGTTCTATTTTCACCCGACCTACTAGGAGACCCAGACAAGTACATCCCAG Sturnira bogotensis (from Peru, CAI#64) ATGACCAACATTCGTAAAACCCACCCCCTACTAAAAATCATCAACAACTCACT CGTAGACCTACCCGCCCCATCAAGCCTCTCATCATGATGAAACTTTGGCTCT CTTTTAGGAGTGTGCTTAGGCGTACAAATCTTAACAGGATTATTCCTAGCAA TGCACTACACATCCGATACGGCTACCGCATTTAACTCCGTAACACATATCTG 264 CCGAGATGT7AACTACGGCTGACTACTCCGATACCTCCATGCCAACGGAGC ATCCATATTCTTCATCTGCCTTTACCTGCACGTAGGCCGAGGCCTCTACTAC GGATCTTACACATACTCGGAAACATG??ACATTGGTATCCTCCTTCTCTTTGC CGTTATAGCCACAGCATTCATGGGCTACGTCCTTCCATGATGACAAATATCC TTCTGAGGAGCCACAGTCATCACTAACCTCCTCTCCGCCATCCCCTACATCG GAACCGAACTAGTCCAATGAATCTGAGGCGGCTTCTCCGTAGATAAAGCAA CCCTCACCCGATTCTTCGCCTTCCACTTTCTCTTTCCCTTTATCGTAGCAGC CCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAACCCC ACAGGCATCCCATCAGACCCAGACATAATCCCATTCCACCCCTAGTAC— ACCATCGAAGACATTCTAGGCTTCCTAATCATATTAACAGCCCTATCCGCTC TAGTA?TATTCTCACCCGACGTA?TAGGAGACCCAGAC??T?ATACCACAG Sturnira erythromos (from Peru, CAI#66) ATGACCAACATTCGTAAAACTCACCCCCTACTAAAAATTATCAACAACTCACT TGTAGACCTACCCGCCCCATCAAGTCTCTCATCATGATGAAACTTCGGCTCT CTTTTAGGAGTATGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAAT GCACTACACATCCGATACAGCCACCGCATTCAACTCCGTAACACACATCTGT CGAGACGTAAACTACGGCTGACTACTCCGGTATCTCCATGCCAACGGAGCA TCCATATTCTTCATCTGCCTCTACCTACATGTAGGCCGAGGCCTCTACTATG GATCCTACACATACTCAGAAACATGAAACATTGGCATCCTCCTTCTCTTTGC CGTTATAGCCACAGCATTTATAGGCTACGTCCTTCCATGAGGACAAATGTCC TTCTGAGGAGCAACAGTCATCACCAACCTCCTTTCTGCCATCCCCTACATCG GAACCGAATTAGTTCAATGAATCTGAGGCGGCTTCTCCGTAGATAAAGCAAC CCTCACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTATCGTAGCAGCC CTAGTAATAGTTCACCTTTTATTCCTGCATGAAACCGGATCAAACAACCCCA CAGGCATCCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAC— ACCATCAAAGACATCTTAGGTTTCCTAGTTATATTAACAGCCCTATCCACCCT AGTACTATTCTCACCTGACCTACTAGGAGACCCAGACAATTATACTCCAG Sturnira hondurensis (from Honduras, CAI#219) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCTGCCCCATCAAGCCTATCATCATGATGAAACTTCGGCTC TCTTTTAGGAGTATGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAA TGCACTATACATCTGACACAGCCACCGCATTTAACTCTGTGACACATATCTG CCGAGATGTAAACTACGGCTGACTACTCCGATACCTTCACGCTAACGGGGC ATCCATATTCTTCATCTGTCTCTACCTACACGTAGGGCGAGGCCTCTACTAC GGATCCTACACATACTCAGAAACATGAAACGTTGGCATCCTCCTCCTCTTCG CCGTTATAGCTACAGCATTCATAGGTTATGTCCTCCCATGAGGACAAATATC TTTCTGAGGAGCAACAGTCATTACCAACCTCCTCTCTGCCATCCCCTACATC GGAACCGAGTTAGTTCAATGAATCTGAGGCGGCTTCTCCGTAGATAAAGCA ACTCTCACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTATCGTAGCAG CCCTAGTAATAGTCCACCTTCTATTCCTACACGAAACCGGATCAAACAACCC CACAGGCATCCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAC— ACTATCAAAGACATCCTGGGCTTCCTAATTATACTAACAGTCCTATCCGCCC TAGTATTATTCTCACCCGACCTGCTAGGAGACCCAGACAACTACACCCCGG Sturnira lilium (from Panama, CAI#121) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCCGCTCCATCAAGCCTCTCATCATGATGAAACTTCGGTTC TCTCTTAGGAGTGTGCTTAGGCGTGCAAATTTTAACAGGATTATTCCTAGCA 265 ATGCACTACACATCCGACACCGCCACCGCATTCAACTCTGTAACACATATCT GCCGAGATGTAAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAG CATCCATATTCTTCATCTGCCTTTACCTGCATGTAGGCCGAGGCCTCTACTA CGGATCCTATACATACTCAGAAACATGAAACATCGGCATTCTCCTCCTCTTC GCCGTCATAGCCACAGCATTCATAGGCTACGTCCTTCCATGAGGACAGATA TCCTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACA TTGGAACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAG CAACCCTTACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCA GCTCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAACC CCACAGGCATCCCATCAGACCCGGACATAATTCCATTCCACCCCTACTAT— ACCATCAAAGACATCCTCGGCTTCCTAATCATACTAACAGCCCTATCCGCCC TAGTATTATTCTCACCTGACCTACTAGGAGACCCAGACAATTACATCCCAG Sturnira lilium (from Mexico, CAI#35) AT7AACAACATTCGCAGGGACCCCCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCCGCCCCATCAAGCCTTTCATCATGATGAAACTTCGGCTC TCTTTTAGGAGTCTGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAA TGCACTACACATCCGACACAGCCACCGCATTCAACTCTGTAACACATATCTG CCGAGACGTGAACTACGGCTGATTACTCCGATACCTCCATGCCAACGGAGC ATCCATGTTTTTTATCTGCCTTTACCTACATGTAGGCCGAGGCCTCTACTAC GGATCCTATACATACTCAGAAACATGAAACATCGGCATCCTCCTCCTCTTCG CCGTCATAGCCACAGCATTTATGGGTTACGTCCTTCCATGAGGACAGATATC CTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACATC GGAACCGAATTAGTTCAATGAATCTGAGGTGGGTTCTCCGTAGACAAAGCA ACCCTCACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCAG CCCTAGTAATAGTCCACCTTCTCTTCCTGCACGAAACCGGATCAAACAACCC CACAGGTATCCCATCGGACCCGGACATAATCCCATTCCACCCCTACTAC— ACCATCAAAGATATCCTTGGCTTCCTAGTCATACTAACAGTTATATCCGCCCT AGTACTATTTTCACCTGACATATTAGGAGACCCA??CAATTACATCCCAG Sturnira lilium (from Suriname, CAI#12) ATGACCAACATTCGCAAAACCCATCCCCTACTAAAAATCATCAACAACTCACT CGTAGACCTCCCCGCTCCATCAAGCCTTTCATCATGATGAAACTTCGGCTCT CTCTTAGGAGTGTGCTTAGGCGTGCAAATTTTAACAGGATTATTCCTAGCAA TGCACTACACATCCGACACAGCCACCGCATTTAACTCTGTAACACATATCTG CCGAGATGTAAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAGC ATCCATATTCTTCATCTGCCTTTACCTACATGTGGGCCGAGGCCTCTACTAC GGATCCTATACATACTCAGAAACATGAAACATCGGCATTCTCCTCCTCTTCG CCGTCATAGCCACAGCATTCATAGGCTACGTCCTCCCATGAGGACAGATAT CCTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACAT TGGAACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAGC AACCCTCACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCA GCTCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAACC CCACAGGCATCCCATCAGACCCGGACATAATCCCATTCCACCCCTACTAC— ACCATCAAAGACATCCTCGGCTTCCTAATCATACTAACAGCCCTATCCGCCC TAGTACTATTCTCACCCGACCTACTAGGAGACCCAGACAACTACATCCCAG Sturnira lilium (from Guyana, CAI#104) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCCGCTCCATCAAGCCTCTCATCATGATGAAACTTCGGTTC 266 TCTCTTAGGAGTGTGCTTAGGCGTGCAAATTTTAACAGGATTATTCCTAGCA ATGCACTACACATCCGACACCGCCACCGCATTCAACTCTGTAACACATATCT GCCGAGACGTAAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAG CATCCATATTCTTCATCTGCCTTTACCTGCATGTAGGCCGAGGCCTCTACTA CGGATCCTATACATACTCAGAAACATGAAACATCGGCATTCTCCTCCTCTTC GCCGTCATAGCCACAGCATTCATAGGCTACGTCCTTCCATGAGGACAGATA TCCTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACA TTGGAACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAG CAACCCTTACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCA GCTCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAACC CCACAGGCATCCCATCAGACCCGGACATAATTCCATTCCACCCTTACTAT— ACCATCAAAGACATCCTCGGCTTCCTAATCATACTAACAGCCCTATCCGCCC TAGCACTATTCTCACCTGACCTACTAGGAGACCCAGACAATTATATCCCAG Stumira lilium (from Paraguay, CAI#84) ATGAC7AACATTCGTAAAACCCATCCCCTACTAAAAATTATCAACAACTCACT CGTAGACCTCCCCGCCCCATCAAGCCTTTCATCATGATGAAACTTCGGCTCT CTTTTAGGAGTATGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAAT GCACTACACATCCGATACAGCCACCGCATTCAACTCTGTAACACATATCTGC CGAGACGTAAACTACGGCTGACTACTCCGATACCTCCACGCCAACGGAGCA TCTATATTCTTCATCTGCCTTTACCTACATGTAGGCCGAGGCCTCTACTACG GATCCTACACATACTCAGAAACATGAAACGTCGGCATCCTCCTCCTCTTCGC CGTCATAGCCACAGCATTCATAGGTTACGTCCTTCCATGAGGACAAATATCC TTCTGAGGAGCAACAGTCATCACTAACCTCCTCTCCGCTATTCCCTACATCG GAACCGAAATGGTTCAATGAATTTGGGGTGGCTTCTCCGTAGATAAAGCAAC TCTTACTCGATTCTTCGCTTTCCACTTCCTACTTCCCTTTATCGTAGCAGCCC TAGTAATAGTCCACCTTCTTTTCCTGCACGAAACCGGATCAAACAACCCCAC AGGCATCCCATCAGACCCAGATATAATTCCATTCCACCCCTACTACACCATT AAAGACATCCTTGGCTTCCTAATCATACTAACAGCCCTATCCGCCCTAGTAC TATTCTCACCTGACCTACTAGGAGACCCAGACAATTACACCCCAG Stumira lilium (from Peru, CAI#01) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCCGCCCCATCAAGCCTCTCATCATGATGAAACTTCGGCTC TCTCTTAGGAGTGTGCTTAGGCGTGCAAATTTTAACAGGATTATTCCTAGCA ATGCACTACACATCCGACACAGCCACCGCATTTAACTCTGTAACACATATCT GCCGAGATGTAAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAG CATCCATATTCTTCATCTGCCTTTACCTGCATGTAGGTCGAGGCCTCTACTA CGGATCCTATACATACTCAGAAACATGAAACATCGGCATTCTCCTCCTCTTC GCCGTCATAGCCACAGCATTCATAGGCTACGTCCTTCCATGAGGGCAGATA TCCTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACA TTGGAACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAG CAACCCTCACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGC AGCTCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAAC CCCACAGGCATCCCATCAGACCCGGACATAATCCCATTCCACCCCTACTAC- ACCATCAAAGACATCCTCGGCTTCCTAATCATACTAACAGCCCTATCCGCCC TAGTACTATTCTCACCCGACCTACTAGGAGACCCAGACAATTACATCCCAG 267 Sturnira lilium serotinus (from Grenada, CAI#05) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAATAACTCACT CGTAGACCTCCCCGCTCCATCAAGCCTCTCATCATGATGAAACTTCGGTTCT CTTTTAGGAGTGTGCTTAGGCGTGCAAATTTTAACAGGATTATTCCTAGCAA TGCACTACACATCCGACACAGCCACCGCATTCAACTCTGTAACACATATCTG CCGAGATGTAAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAGC ATCCATATTCTTCATCTGCCTTTACCTGCATGTAGGCCGAGGCCTATACTAC GGATCCTATACATACTCAGAAACATGAAACATCGGCATTCTCCTCCTCTTCG CCGTCATAGCCACAGCATTCATAGGCTACGTCCTTCCATGAGGACAGATATC CTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACATC GGAACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAGCA ACCCTTACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAGCAG CTCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAACCC CACAGGCATCCCATCAGACCCGGACATAATTCCATTCCACCCCTACTAC— ACTATCAAAGACATCCTCGGCTTCCTAATCATACTAACAGCCCTATCCGCCC TAGTACTATTCTCACCCGACCTACTAGGGGACCCGGACAATTACATCCCAG Sturnira ludovici (f rom Ecuador, CAI#177) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATTATCAACAACTCACT CGTAGACCTACCTGCCCCATCAAGTCTCTCATCATGATGAAACTTTGGCTCT CTTTTAGGAGTCTGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAAT GCACTACACATCCGATACCGCTACCGCATTCAACTCTGTAACACATATCTGC CGAGATGTAAACTACGGCTGACTACTCCGATACCTCCACGCCAACGGAGCA TCCATATTCTTCATCTGCCTATACCTACACGTAGGTCGAGGCCTCTACTACG GATCTTACACATACTCAGAAACATGAAACATCGGCATCCTCCTCCTCTTTGC CGTTATAGCCACAGCATTCATGGGCTACGTCCTCCCATGAGGACAAATATCC TTCTGAGGAGCAACAGTCATTACCAACCTCCTCTCTGCCATCCCCTACATCG GAACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAGCAA CCCTCACCCGA I I I I I I GCCTTCCACTTCCTCCTCCCCTTTATCGTAACAGC CCTAGTAATAGTTCACCTTCTATTCCTACACGAAACCGGATCAAACAACCCT ACAGGCATCCCATCAGACTCAGACATAATCCCATTCCACCCCTATTAC— ACTATCAAAGACATTCTAGGCTTCCTAATCATACTAACAGTCCTATCCGCCCT AGTACTATTCTCACCCGACCTGCTAGGAGACCCAGACAACTACACCCCAG Sturnira ludovici (from Guatemala, CAI#214) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCTGCCCCATCAAGCCTCTCATCATGATGAAACTTCAGCTC TCTTTTAGGAGTGTGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAA TGCACTATACATCTGACACAGCCACCGCATTCAACTCTGTAACACATATCTG CCGAGATGTAAACTACGGCTGACTACTCCGATACCTTCACGCCAACGGGGC GTCTATATTCTTCATCTGCCTTTATCTACACGTAGGACGAGGCCTCTACTAC GGATCCTACACATACTCAGAAACATGAAACGTTGGCATCCTCCTCCTCTTCG CCGTTATAGCTACAGCATTCATAGGTTACGTCCTCCCATGAGGACAAATATC CTTCTGAGGGGCAACAGTCATTACCAACCTCCTCTCTGCCATCCCCTACATC GGAACCGAGTTAGTCCAATGAATCTGAGGCGGCTTCTCCGTAGACAAAGCA ACTCTCACCCGATTCTTCGCCTTCCACTTCCTCCTCCCTTTTATCGTAACAGC CCTAGTAATAGTCCACCTTCTATTCCTACACGAAACCGGATCAAACAACCCC ACAGGCATCCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAC— 268 ACTATCAAAGACATCCTGGGCTTCCTAATTATACTAACAGTCCTATCCGCCC TAGTATTATTCTCACCCGACCTGCTAGGAGACCCAGACAACTACACCCCAG Sturnira ludovici (from Costa Rica, CAI#36) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATTATCAACAACTCACT TGTAGACCTCCCCACCCCATCAAGCCTCTCATCATGATGAAACTTCGGCTCT CTTTTAGGAGTATGCTTAGGCGTACAAATTTTGACAGGATTATTCCTAGCAAT GCACTACACATCCGACACAGCCACCGCATTCAACTCTGTAACACATATCTGC CGAGATGTAAACTACGGCTGACTACTCCGATACCTTCACGCCAACGGGGCA TCCATATTCTTCATCTGCCTCTACCTACACGTAGGCCGAGGCCTCTACTACG GATCCTACACATACTCAGAAACATGAAACATCGGCATCCTCCTCCTCTTTGC CGTTATAGCCACAGCATTCATAGGCTACGTCCTCCCATGAGGACAAATATCC TTCTGAGGGGCAACAGTCATTACCAACCTCCTCTCTGCCATCCCCTACATCG GAACCGAATTAGTCCAATGAATCTGAGGCGGGTTCTCCGTAGACAAAGCAA CTCTCACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTATCGTAGCAGC CCTAGTAATAGTCCATCTGCTATTCTTACACGAAACTGGATCAAACAACCCC ACAGGCATTCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAC— ACTATCAAAGACATCCTGGGCTTCCTAATTATATTAACAACCCTATCCGCCCT AGTATTATTCTCACCCGACCTGCTAGGAGACCCAGACAACTACACCCCAG Sturnira luisi (from Panama, CAI#246) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCCGCTCCATCAAGCCTCTCATCATGATGAAACTTCGGTTC TCTCTTAGGAGTGTGCTTAGGCGTGCAAATTTTAACAGGATTATTCCTAGCA ATGCACTACACATCCGACACCGCCACCGCATTCAACTCTGTAACACATATCT GCCGAGATGTAAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAG CATCCATATTCTTCATCTGCCTTTACCTGCATGTAGGCCGAGGCCTCTACTA CGGATCCTATACATACTCAGAAACATGAAACATCGGCATTCTCCTCCTCTTC GCCGTCATAGCCACAGCATTCATAGGCTACGTCCTTCCATGAGGACAGATA TCCTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACA TTGGAACCGAACTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAG CAACCCTTACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTATCGTAGC AGCTCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAAC CCCACAGGCATCCCATCAGACCCGGACATAATTCCATTCCACCCCTACTAT-- -ACCATCAAAGACATCCTCGGCTTCCTAATCATACTAACAGCCCTATCCGCC CTAGTACTATTCTCACCCGACCTACTAGGAGACCCAGACAATTACATCCCAG Sturnira magna (from Ecuador, CAI#136) ATGACCAACATTCGTAAAACCCACCCCCTACTAAAAATTATCAACAACTCACT CGTAGACCTACCCGCTCCATCAAGCCTCTCATCCTGATGAAACTTTGGTTCC CTTTTAGGAGTATGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAAT GCACTACACATCCGATACAGCTACTGCATTCAACTCCGTAGCACATATCTGC CGAGATGTCAACTACGGCTGACTACTCCGATATCTCCATGCCAACGGAGCA TCCATATTCTTCATCTGCCTCTACATGCACGTAGGCCGAGGTCTCTACTACG GGTCCTATACATACTCAGAAACATGAAATATTGGCATCCTCCTTCTCTTCGC CGTTATGGCCACAGCATTCATAGGCTACGTCCTCCCATGAGGACAAATATCC TTCTGAGGAGCAACAGTCATCACTAACCTCCTCTCTGCCATCCCCTACATCG GAACCGAACTAGTCCAATGAATCTGGGGCGGCTTCTCTGTAGATAAGGCAA CTCTCACCCGATTCTTCGCCTTCCACTTCCTCCTTCCCTTTATCGTAACAGC CCTAGTAATAGTCCACCTTCTATTCCTACACGAAACCGGATCAAACAACCCC 269 ACAGGCATCCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAC- ACCATCAAAGATATCCTAGGCTTCCTAATTATATTAACAGCCCTATCTGCCCT AGTATTATTCTCACCCGACCTACTAGGAGACCCAGACAACTATACCCCAG Sturnira mordax (from Costa Rica, CAI#21 1) ATGACCAACATTCGTAAAACCC7CCCCCTACTAAAAATTATCAACAACTCACT CGTAGACCTACCCGCTCCATCAAGCCTCTCATCATGATGAAATTTTGGCTCT CTTTTAGGAGTATGCTTAGGTGTACAAATTTTGACAGGATTATTCCTAGCAAT GCACTACACATCCGACACAGCCACCGCATTCAACTCTGTAACACACATCTGC CGAGATGTAAACTACGGCTGACTACTCCGATACCTCCATGCCAACGGAGCA TCCATATTCTTCATCTGCCTCTACCTACACGTAGGCCGAGGCCTCTACTACG GATCCTACACATACTCAGAAACATGAAACATCGGCATCCTCCTTCTCTTTGC CGTTATAGCCACAGCATTCATGGGCTACGTCCTCCCATGAGGACAAATATCC TTCTGAGGAGCAACAGTCATTACCAACCTTCTCTCTGCTATCCCCTACATCG GAACCGAACTAGTCCAATGAATCTGAGGTGGCTTTTCCGTAGACAAAGCAA CTCTCACCCGATTCTTCGCCTTTCACTTCCTCCTTCCCTTTATCGTAGCAGC CCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACTGGATCAAACAACCCC ACAGGCATCCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAC— ACCATCAAAGACATCCTAGGCTTC?TAATTATGTTAACAGCCCTATCCGCC?T AGTACTATTCTCACCCGACCTACTAGGAGACCCAGACAACTACACCCCAG Sturnira nana (from Peru, CAI#240) ATGACCAACATTCGAAAAACTCACCCCCTCCTAAAAATTATCAACAACTCACT CGTAGACCTCCCCGCCCCATCAAGTCTCTCATCATGATGAAACTTCGGCTCT CTTTTAGGAGTCTGCCTAGGCGTACAAATTCTGACAGGATTATTCCTAGCAA TACACTACACATCCGACACAACCACCGCATTCAACTCTGTAACCCACATTTG CCGAGACGTAAACTACGGATGACTACTCCGATATCTCCATGCCAACGGAGC CTCCATATTCTTCATCTGCCTTTATTTACACGTAGGCCGAGGCCTATACTATG GATCCTACACATACTCAGAAACATGAAACATCGGCATCCTCCTCCTCTTTGC CGTCATAGCCACAGCATTCATGGGCTATGTACTTCCATGAGGACAAATATCC TTCTGAGGGGCAACAGTCATCACCAACCTCCTCTCTGCCATCCCCTACATTG GAACAGACCTAGTCCAGTGAATCTGAGGTGGCTTCTCCGTAGACAAAGCAA CCCTTACCCGATTCTTTGCCTTCCACTTCCTTCTCCCCTTCATTGTAACAGCC CTAGTAATAATCCACCTCCTATTCCTACACGAAACCGGATCAAACAACCCCA CAGGAATCCCATCAGACC Sturnira oporaphilum (from Peru, CAI#2) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATTATTAACAACTCACT CGTAGACCTCCCCGCCCCATCAAGCCTATCATCATGATGAAACTTCGGCTCT CTTTTAGGAGTGTGCTTAGGCGTACAAATTTTAACAGGATTATTCCTAGCAAT GCACTACACATCCGATACAGCCACCGCATTCAACTCTGTAACACATATCTGC CGAGATGTAAACTACGGCTGACTACTCCGATACCTCCACGCCAACGGAGCA TCCATA I I I I I CATCTGCCTATATCTACACGTAGGCCGAGGCCTCTACTACG GATCCTACACATATTCAGAAACATGAAACATTGGCATCCTCCTCCTCTTTGC CGTCATAGCCACAGCATTCATAGGCTACGTTCTCCCATGAGGACAAATATCC TTCTGAGGAGCAACAGTCATTACCAACCTCCTCTCTGCCATCCCCTACATCG GAACCGAACTAGTCCAATGAATCTGAGGTGGTTTCTCCGTAGACAAAGCAA CTCTCACCCGA I I I I I CGCCTTCCATTTCCTCCTCCCCTTTATCGTAGCGGC CCTAGTAATAGTCCACCTTCTATTCTTACACGAAACCGGATCAAACAACCCC ACGGGCATCCCATCAGACTCAGACATAATCCCATTCCACCCCTACTAC— 270 ACTATCAAAGACATCCTAGGCTTCCTAATTATACTAACAGTCTTATCCGCCCT AGTACTATTCTCACCCGACCTGCTAGGAGACCCAGATAACTACACCCCAG Sturnira thomasi (from Guadeloupe, CAI#229) ATGACCAACATTCGCAAAACCCACCCCCTACTAAAAATCATCAACAACTCAC TCGTAGACCTCCCCGCCCCATCAAGTCTCTCATCATGATGAAACTTCGGTTC TCTCTTAGGAGTGTGCTTGGGCGTGCAAATTTTAACAGGATTATTCCTAGCA ATGCACTACACATCCGACACAGCCACCGCATTCAACTCTGTAACACACATCT GCCGAGATGTAAACTACGGCTGACTGCTCCGATATCTCCATGCCAACGGAG CATCCATATTTTTCATCTGCCTTTACCTGCATGTAGGCCGAGGCCTCTACTA CGGATCCTATACATACTCAGAAACATGAAACATCGGCATTCTCCTCCTCTTC GCCGTCATAGCCACAGCATTCATAGGCTACGTCCTTCCATGAGGACAGATA TCCTTCTGAGGAGCAACAGTCATCACCAACCTCCTCTCCGCTATCCCCTACA TTGGAACCGAGCTAGTCCAATGAATCTGAGGTGGCTTCTCCGTAGACAAAG CAACCCTTACCCGATTCTTCGCCTTCCATTTCCTCCTTCCCTTTATCGTAGCA GCTCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGATCAAACAACC CCACAGGCATCCCATCAGACCCGGACATAATCCCATTCCACCCCTACTAC— ACCATCAAAGACATCCTAGGCTTCCTAATCATACTAACAGCCCTATCCGCCC TAGTACTATTCTCACCCGACCTACTAGGAGACCCAGACAATTACATTCCAG Sturnira tildae (from Ecuador, CAI#250) ATGACCAACATTCGCAAAACTCACCCCCTACTAAAAATTATCAACAACTCACT TGTAGACCTACCTACTCCATCAAGCCTCACATCATGATGAAACTTCGGCTCT CTTTTAGGAGTATGCTTAGGCGTACAAATTTTAACAGGATTGTTCCTAGCAAT GCACTACACATCCGATACAGCCACCGCATTCAACTCTGTAACACATATTTGC CGAGACGTAAACTACGGCTGACTACTCCGATACCTCCATGCCAACGGAGCA TCCATGTTCTTCATCTGCCTTTACCTACACGTAGGCCGAGGCCTCTACTACG GATCCTACACATATTCAGAAACATGAAATATCGGTATCCTTCTTCTCTTTGCC GTAATAGCCACAGCATTCATGGGCTACGTCCTTCCATGAGGGCAGATATCTT TCTGAGGAGCAACAGTCATCACCAACCTCCTCTCTGCCATCCCCTACATCG GAACTGAACTAGTCCAATGAATCTGAGGCGGCTTCTCCGTAGACAAGGCAA CTCTCACCCGATTCTTCGCCTTTCACTTCCTACTTCCCTTCATCGTAGCAGC CCTAGTAATAGTCCACCTTCTATTCCTGCACGAAACCGGGTCAAACAACCCC ACAGGCATCCCATCAGACCCAGACATAATCCCATTCCACCCCTACTAC— ACCATTAAAGACATCCTAGGCTTCCTAATCATGCTAACAGCCCTGTCAGCCC TAGTACTATTTTCACCCGACCTACTAGGAGACCCAGACAATTACACTCCAG REFERENCES Anderson, S., K. F. Koopman, and G. K. Creighton. 1982. Bats of Bolivia: An annotated checklist. American Museum Novitates 2750:1-24. Anthony, H. E. 1924. Preliminary report on Ecuadorean mammals. No. 6. American Museum Novitates 139:1-8. Arita, H.T. 1990. Morphology and ecological correlates in phyllostomid bats. Journal of Mammalogy 71:36-47. Arnason, U., K. Bodin, A. Gullberg, C. Ledge, and S. A. Mouchaty. 1995. Molecular view of pinniped relationships with particular emphasis on the true seals. Journal of Molecular Evolution 40:78-85. Avise, J. C. 1989. Gene trees and organismal histories: a phylogenetic approach to population biology. Evolution 43:1192-1208. Avise, J. C. 1994. Molecular markers, natural history and evolution. Chapman and Hall, New York. Baker, R. H. and J. K. Greer. 1962. Mammals of the Mexican State of Durango. Publications of The Museum, Biological Series: 25-154, Michigan State University, East Lansing. Baker, R. J. and H. H. Genoways. 1978. Zoogeography of Antillean bats. Pp. 53-97 in Zoogeography in the Caribbean (F. B. Gill, ed.). The 1975 Leidy Medal Symposium, Academy of Natural Sciences of Philadelphia, Special Publication 13:1-128. Baker, R. J., J. A. Groen, and R. D. Owen. 1984. Field key to Antillean bats. Occasional Papers, The Museum, Texas Tech University 94:1-18. Baker, R. J., V. A. Taddei, J. L. Hudgeons, and R. A. Van Den Bussche. 1994. Systematic relationships within Chiroderma (Chiroptera: Phyllostomidae) based on cytochrome b sequence variation. Journal of Mammalogy 75:321-327. Barone R. 1966. Anatomie comparee des mammiferes domestiques. Volume 1 (Osteologie), 1st edition. Laboratoire d'Anatomie, Ecole Nationale Veterinaire, Lyon. Baum, D. A. and K. L. Shaw. 1995. Genealogical perspectives on the species problem. Pp. 289-303 in Experimental and molecular approaches to plant 271 272 biosystematics (P. C. Hoch and A. G. Stephenson, eds.). Monographs in Botany from the Missouri Botanical Garden, vol. 53, St. Louis, Mo. Bogdanowicz, W., R. D. Csada, and M. B. Fenton. 1997. Structure of noseleaf, echolocation, and foraging behavior in the Phyllostomidae (Chiroptera). Journal of Mammalogy 78:942-953. Bremer, K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42:795-803. Bremer, K. 1994. Branch support and tree stability. Cladistics 1 0:295-304. Brosset, A. and G. Dubost. 1967. Chiropteres de la Guyane Francaise. Mammalia 31:583-594. Cabrera, A. 1958. Catalogo de los mamiferos de America del Sur. Revista del Museo Argentino de Ciencias Naturales "Bernardino Rivadavia," Ciencias Zoologicas, volumen 4:1-307. Cabrera Latorre, A. 1903. Sinopsis de los Quiropteros Chilenos. Extracto de la Revista de Historia Natural 7:278-308. Carter, C. H., H. H. Genoways, R. S. Loregnard, and R. J. Baker. 1981. Observations on bats from Trinidad, with a checklist of species occurring on the island. Occasional Papers, The Museum, Texas Tech University 72:1-27. Carter, D. C. and J. K. Jones, Jr. 1978. Bats from the Mexican state of Hidalgo. Occasional Papers, The Museum, Texas Tech University 54:1-12. Chase, M. W., D. E. Soltis, R. G. Olmstead, D. Morgan, D. H. Les, B. D. Mishler, M. R. Duvall, R. A. Price, H. G. Hills, Y.-L Qiu, K. A. Kron, J. H. Rettig, E. Conti, J. D. Palmer, J. R. Manhart, K. J. Sytsma, H. J. Michaels, W. J. Kress, K. G. Karol, W. D. Clark, M. Hedren, B. S. Gaut, R. K. Jansen, K.-J. Kim, C. F. Wimpee,. J. F. Smith, G. R. Furnier, S. H. Strauss, Q.-Y. Xiang, G. M. Plunkett, P. S. Soltis, S. M. Swensen, S. E. Williams, P. A. Gadek, C. J. Quinn, L. E. Eguiarte, E. Golenberg, G. H. Learn, Jr., S. W. Graham, S. C. H. Barrett, S. Dayanandan, and V. A. Albert. 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL Annals of the Missouri Botanical Garden 80:528-580. Chase, M. W., D. W. Stevenson, P. Wilkin, and P. J. Rudall. 1995. Monocot systematics: a combined analysis. Pp. 685-730 in Monocotyledons: systematics and evolution (P. J. Rudall, P. J. Cribb, D. F. Cutler, and C. J. Humpries, eds.). Royal Botanic Garden, Kew, England. Conroy, C. J. and J. A. Cook. 2000. Molecular systematics of a Holarctic rodent {Microtus: Muridae). Journal of Mammalogy 81:344-359. 273 Dalquest, W. W. 1953. Mammals of the Mexican state of San Luis Potest. Louisiana State University Press, Baton Rouge: 1-223. Davis, D. D. 1964. The giant panda, a morphological study of evolutionary mechanisms. Fieldiana, Zoology Memoirs : 1-339. Davis, W. B. 1980. New Sturnira (Chiroptera: Phyllostomidae) from Central and South America, with key to current recognized species. Occasional Papers, The Museum, Texas Tech University 70:1-15. Davis, W. B., D. C. Carter, and R. H. Pine. 1964. Noteworthy records of Mexican and Central American bats. Journal of Mammalogy 45:375-387. de la Torre, L. 1 952. An additional record of the bat, Sturnira ludovici, in Mexico. The Chicago Academy of Sciences, Natural History Miscellanea 105:1-2. de la Torre, L. 1959. A new species of bat of the genus Sturnira (Phyllostomidae) from the island of Trinidad, West Indies. Natural History Miscellanea, Chicago Academy of Sciences 166:1-6. de la Torre, L. 1961 . The evolution, variation, and systematics of the Neotropical bats of the genus Sturnira. Ph.D. dissertation, University of Illinois, Urbana. Ditchfield, A. D. 1996. Phylogeography of neotropical bats using mitochondrial DNA sequences. Ph.D. dissertation, University of California, Berkeley. Dobson, G. E. 1878. Catalogue of the Chiroptera in the collection of the British Museum. British Museum, London. Edwards, S. V., P. Arctander, and A. C. Wilson. 1991. Mitochondrial resolution of a deep branch in the genealogical tree for perching birds. Proceedings of the Royal Society of London, Series B 243:99-107. Elliot, D. G. 1904. The land and sea mammals of Middle America and the West Indies. Publications of the Field Columbian Museum - Zoological Series, IV (parts 1-2):1-439 & 441-850. Eriksson, T. 1998. AutoDecay version 4.01. (program distributed by author). Department of Botany, Stockholm University, Stockholm, Sweden. Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using bootstrap. Evolution 39:783-791. Felten, H. 1956. Quiropteros (Mammalia, Chiroptera) en El Salvador. Comunicaciones del Instituto Tropical de Investigaciones Cientificas, Universidad de El Salvador 5:153-170. 274 Freeman, P. W. 1981 . A multivariate study of the family Molossidae (Mammalia, Chiroptera): morphology, ecology, evolution. Fieldiana, Zoology, New Series III 7:1-173. Gardner, A. L. and J. O. O'Neill. 1969. The taxonomic status of Sturnira bidens (Chiroptera: Phyllostomidae) with notes on its karyotype and life history. Occasional Papers of the Museum of Zoology, Louisiana State University, Baton Rouge, Louisiana 38:1-8. Gardner, A. L. and J. O. O'Neill. 1971 . A new species of Sturnira (Chiroptera: Phyllostomidae) from Peru. Occasional Papers of the Museum of Zoology, Louisiana State University, Baton Rouge, Louisiana 42:1-7. Genoways, H. H. 1998. Two new subspecies of bats of the genus Sturnira from the Lesser Antilles, West Indies. Occasional Papers, The Museum, Texas Tech University 176:1-7. Genoways, H. H. and J. K. Jones, Jr. 1975. Additional records of the Stenodermine bat, Sturnira thomasi, from the Lesser Antillean island of Guadeloupe. Journal of Mammalogy 56:924-925. Geoffroy Saint-Hilaire, E. 1810. Sur les Phyllostomes et les especes de Megadermes, deux genres de la famille des Chauve-souris. Annales du Museum d'Histoire Naturelle (Paris) 15:157-198. Gervais, P. 1855. Cheiropteres sud-Americains. Pp. 25-88 in F. Castelnau (ed.). Animaux noveaux ou rares de I'Amerique du Sud, Paris. Goldman, E. A. 1917. New mammals from north and middle America. Proceedings of the Biological Society of Washington 30:107-1 16. Goldman, E. A. 1920. Mammals of Panama. Smithsonian Miscellaneous Collections No. 2498, 69:1-309. Goodwin, G. G. 1938. A new genus of bat from Costa Rica. American Museum Novitates 976:1-2. Goodwin, G. G. 1940. Three new bats from Honduras and the first record of Enchisthenes harti (Thomas) for North America. American Museum Novitates 1075:1-3. Goodwin, G. G. 1942. Mammals of Honduras. Bulletin of the American Museum of Natural History 79:107-195. Goodwin, G. G. 1946. Mammals of Costa Rica. Bulletin of the American Museum of Natural History 87:271-474. 275 Goodwin, G. G. 1953. Catalogue of the type specimens of recent mammals in the American Museum of Natural History. Bulletin of the American Museum of Natural History 102:207-412. Goodwin, G. G. and A. M. Greenhall. 1961. A review of the bats of Trinidad and Tobago: descriptions, rabies infection, and ecology. Bulletin of the American Museum of Natural History 122:195-299. Goodwin, G. G. and A. M. Greenhall. 1964. New records of bats from Trinidad and comments on the status of Molossus trinitatus Goodwin. American Museum Novitates 2195:1-23. Graham, S. W. and S. C. H. Barrett. 1995. Phylogenetic systematics of Pontederiales: Implications for breeding-system evolution. Pp. 415-441 in Monocotyledons: systematics and evolution (P. J. Rudall, P. J. Cribb, D. F. Cutler, and C. J. Humpries, eds.). Royal Botanic Garden, Kew. Graham, S. W., J. R. Kohn, B. R. Morton, J. E. Eckenwalder, and S. C. H. Barrett. 1 998. Phylogenetic congruence and discordance among morphological and three molecular data sets from Pontederiaceae. Systematic Biology 47:545- 567. Gray, J. E. 1842. Descriptions of some new genera and fifty unrecorded species of Mammalia. The Annals and Magazine of Natural History 10:255-257. Hatefi, Y. 1 985. The mitochondrial electron transport and oxydative phosphorylation system. Annual Review of Biochemistry 54:1015-1069. Hershkovitz, P. 1949. Mammals of Northern Colombia, Preliminary Report No. 5: Bats (Chiroptera). Proceedings of the United States National Museum 99:429- 454. Hershkovitz, P. 1958. A geographic classification of Neotropical mammals. Fieldiana: Zoology 36:579-620. Hillis, D. M., B. K. Mable, A. Larson, S. K. Davis, and E. A. Zimmer. 1996. Nucleic Acids IV: Sequencing and Cloning. Pp. 321-381 in Molecular Systematics (D. M. Hillis, C. Moritz, and B. K. Mable, eds.). 2nd ed. Sinauer Associates, Inc., Massachusetts. Huelsenbeck, J. P., J. J. Bull, and C. W. Cunningham. 1996. Combining data in phylogenetic analysis. Trends in Ecology and Evolution 1 1 : 152-1 58. Hutcheson, H. J., J. H. Oliver, M. A. Houck, and R. E. Strauss. 1995. Multivariate morphometric discrimination of nymphal and adult forms of the blacklegged tick (Acari: Ixodidae), a principal vector of the agent of lyme disease in Eastern North America. Journal of Medical Entomology 32:827-842. 276 Irwin, D. M., T. D. Kocher, and A. C. Wilson. 1991. Evolution of the cytochrome b gene of mammals. Journal of Molecular Evolution 32:128-144. ludica, C. A. 1994. Role of a bat community in the regeneration process of a forest after human disturbance in northwestern Argentina. M. A. Thesis, University of Florida, Gainesville. Janke, A., G. Feldmaier-Fuchs, W. K. Thomas, A. von Haeseler, and S. Paabo. 1994. The marsupial mitochondrial genome and the evolution of placental mammals. Genetics 137:243-256. Jones, J. K., Jr., J. Arroyo-Cabrales, and R. D. Owen. 1988. Revised checklist of bats of Mexico and Central America. Occasional Papers, The Museum, Texas Tech University 120:1-34. Jones, J. K., Jr. and D. C. Carter. 1976. Annotated checklist, with keys to subfamilies and genera. Pp. 7-38 in Biology of Bats of the New World Family Phyllostomatidae. Part I, No. 10 (R. J. Baker, J. Knox Jones, Jr., and D. C. Carter, eds.). Special Publications, The Museum, Texas Tech University, Lubbock. Jones, J. K., Jr. and R. D. Owen. 1986. Checklist and bibliography of Nicaraguan Chiroptera. Occasional Papers, The Museum, Texas Tech University 106:1-13. Jones, J. K., Jr. and C. J. Phillips. 1970. Comments on systematics and zoogeography of bats in the Lesser Antilles. Studies on the Fauna of Curacao and other Caribbean Islands 32:131-145. Jones, J. K., Jr. and C. J. Phillips. 1976. Bats of the genus Sturnira in the Lesser Antilles. Occasional Papers, The Museum, Texas Tech University 40:1- 16. Judd, W. S., C. S. Campbell, E. A. Kellogg, and P. F. Stevens. 1999. Plant systematics: A phylogenetic approach. Sinauer Associates, Inc., Sunderland, MA. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:111-120. Koopman, K. F. 1968. Taxonomic and distributional notes on Lesser Antillean Bats. American Museum Novitates 2333:1-13. Koopman, K. F. 1978. Zoogeography of Peruvian bats with special emphasis on the role of the Andes. American Museum Novitates 2651:1-33. 277 Koopman, K. F. 1993. Order Chiroptera. Pp. 137-241 in Mammal species of the world, a taxonomic and geographic reference (D. E. Wilson and D. M. Reeder, eds.). 2nd ed. Smithsonian Institution Press, Washington, D.C. Koopman, K. F. 1994. Chiroptera: Systematics. Handbook of Zoology, A Natural History of the Phyla of the Animal Kingdom, Volume VIII (Mammalia), Part 60, Walter de Gruyter, Inc., Berlin-New York. Kron, K. A. and W. S. Judd. 1997. Systematics of the Lyonia group (Andromedeae, Ericaceae) and the use of species as terminals in higher-level cladistic analyses. Systematic Botany 22:479-492. Kunz, T. H. and E. D. Pierson. 1994. Bats of the world: An introduction. Pp. 1- 46 in Walker's bats of the world (R. M. Nowak). The Johns Hopkins University Press, Baltimore and London. Legendre, S. 1984. Etude odontologique des representants actuels du groupe Tadarida (Chiroptera, Molossidae). Implications phylogeniques, systematiques et zoogeographiques. Revue Suisse de Zoologie 91 :399-442. Lim, B. K. and M. D. Engstrom. 1998. Phylogeny of Neotropical short-tailed fruit bats, Carollia spp.: Phylogenetic analysis of restriction site variation in mtDNA. Pp. 43-58 in Bats, Biology and Conservation (T. H. Kunz and P. A. Racey, eds.). Smithsonian Institution Press, Washington and London. Lledo, M. D., M. B. Crespo, K. M. Cameron, M. F. Fay, and M. W. Chase. 1998. Systematics of Plumbaginaceae based upon cladistic analysis of rbcL sequence data. Systematic Botany 23:21-29. Lukens, P. W. and W. B. Davis. 1957. Bats of the Mexican state of Guerrero. Journal of Mammalogy 38:1-14. Maddison, W. P. 1996. Molecular approaches and the growth of phylogenetic biology. Pp. 47-63 in Molecular Zoology: advances, strategies, and protocols (J. D. Ferraris and S. R. Palumbi, eds.). Wiley-Liss, New York. Maddison, W. P., M. J. Donoghue, and D. R. Maddison. 1984. Outgroup analysis and parsimony. Systematics Zoology 33:83-103. Maddison, W. P. and D. R. Maddison. 1999. MacClade: analysis of phylogeny and character evolution, Version 3.08a. Sinauer, Sunderland, MA. Mallet, J. 1995. A species definition for the modern synthesis. Trends in Ecology and Evolution 10:294-299. Manly, B. F. J. 1994. Multivariate statistical methods: A primer. 2nd. ed. Chapman and Hall/CRC, New York. . 278 Mares, M. A. and J. K. Braun. 2000. Graomys, the genus that ate South America: A reply to Steppan and Sullivan. Journal of Mammalogy 81 :271-276. Mauk, C. L, M. A. Houck, and R. D. Bradley. 1999. Morphometric analysis of seven species of pocket gophers (Geomys). Journal of Mammalogy 80:499-51 1 Mayr, E. and P. D. Ashlock. 1991. Principles of systematic zoology. 2nd. ed. McGraw-Hill, Inc., New York. McArthur A. G. and B. F. Koop. 1999. Partial 28S rDNA sequences and the antiquity of hydrothermal vent endemic gastropods. Molecular Phylogenetics and Evolution 13:255-274. McCarthy, T. J., W. B. Davis, J. E. Hill, J. K. Jones, Jr., and G. A. Cruz. 1993. Bat (Mammalia: Chiroptera) records, early collectors, and faunal lists for northern Central America. Annals of Carnegie Museum 62:191-228. McKenna, M. C. and S. K. Bell (with contributions from G. G. Simpson, R. H. Nichols, R. H. Tedford, K. F. Koopman, G. G. Musser, N. A. Neff, J. Shoshani, and D. M. McKenna). 1997. Classification of mammals above the species level. Columbia University Press, New York. McKnight, M. L. 1995. Mitochondrial DNA phylogeography of Perognathus amplus and Perognathus longimembris (Rodentia: Heteromyidae): a possible mammalian ring species. Evolution 49:816-826. McLellan, L. J. 1984. A morphometric analysis of Carollia (Chiroptera, Phyllostomidae). American Museum Novitates 2791:1-35. Meyer, A. 1994a. Molecular phylogenetic studies of fishes. Pp. 219-249 in Genetics and Evolution of Aquatic Organisms (A. R. Beaumont, ed.). Chapman and Hall, London. Meyer, A. 1994b. Shortcomings of the cytochrome b gene as a molecular marker. Trends in Ecology and Evolution 9:278-280. Miller, G. S., Jr. 1907. The families and genera of bats. Bulletin of the United States National Museum 79:1-282. Molinari, J. and P. J. Soriano. 1987. Sturnira bidens. Mammalian Species 276:1-4. Moritz, C. 1994. Defining "Evolutionary significant units" for conservation. Trends in Ecology and Evolution 9:373-375. 279 Myers, P. and R. M. Wetzel. 1983. Systematics and Zoogeography of the bats of the Chaco Boreal. Miscellaneous Publications, Museum of Zoology, University of Michigan 165:1-59. Nei, M. 1987. Molecular evolutionary genetics. Columbia University Press, New York. Nixon, K. C. and J. M. Carpenter. 1993. On outgroups. Cladistics 9:413-426. Nowak, R. M. and J. L. Paradise 1983. Walker's mammals of the world. The Johns Hopkins University Press, Baltimore, Maryland. Owen, R. D. 1987. Phylogenetic analyses of the bat subfamily Stenodermatinae (Mammalia: Chiroptera). Special Publications, The Museum, Texas Tech University 26:1-65. Pacheco, V., H. de Macedo, E. Vivar, C. Ascorra, R. Arana-Cardo, and S. Solari. 1995. Lista anotada de los mamiferos Peruanos. Occasional Papers in Conservation Biology No. 2, Conservation International, Washington, DC. Pacheco, V. and B. D. Patterson. 1991 . Phylogenetic relationships of the New World bat genus Sturnira (Chiroptera: Phyllostomidae). Bulletin of the American Museum of Natural History 206:101-121. Pacheco, V. and B. D. Patterson. 1992. Systematics and biogeographic analyses of four species of Sturnira (Chiroptera: Phyllostomidae), with emphasis on Peruvian forms. Memorias del Museo de Historia Natural, U.N.M.S.M. (Lima, Peru) 21:57-81. Page, R. D. M. 1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12:357-358. Palumbi, S. R. 1996. Nucleic Acids II: The polymerase chain reaction. Pp. 205- 247 in Molecular Systematics (D. M. Hillis, C. Moritz, and B. K. Mable, eds.). Sinauer Associates, Inc., Massachussetts. Pamilo, P. and M. Nei. 1988. Relationships between gene trees and species trees. Molecular Biology and Evolution 5:568-583. Patton, J. L, S. F., dos Reis, and M. N. F., da Silva. 1996. Relationships among didelphid marsupials based on sequence variation in the mitochondrial cytochrome b gene. Journal of Mammalian Evolution 3:3-29. Pedersen, S. O, H. H. Genoways, and P. W. Freeman. 1996. Notes on bats from Montserrat (Lesser Antilles) with comments concerning the effects of hurricane Hugo. Caribbean Journal of Science 32:206-213. 280 Peppers, L. L. and R. D. Bradley. 2000. Cryptic species in Sigmodon hispidus: evidence from DNA sequences. Journal of Mammalogy 81:332-343. Pirlot, P. and J. R. Leon. 1965. Chiropteres de Test du Venezuela. I. Region de Cumana et ile de Margarita. Mammalia 29:367-374. Pirlot, P. 1967. Nouvelle recolecte de chiropteres dans L'ouest du Venezuela. Mammalia 31:260-274. Pirlot, P. 1968. Chiropteres du Perou, specialement de haute-amazonie. Mammalia 32:87-96. Ralls, K. 1976. Mammals in which females are larger than males. The Quarterly Review of Biology 51:245-276. Ramirez-Pulido, J. A. Castro-Campillo, J. Arroyo-Cabrales, and F. A. Cervantes. 1996. Lista taxonomica de los mamiferos terrestres de Mexico. Occasional Papers, The Museum Texas Tech University 158:1-62. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 230:1350-1354. Saitou, N. and M. Nei. 1987. The neighbor-joining method: a new method for constructing phylogenetic trees. Molecular Biology and Evolution 4:406-425. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sanderson, M. J. and M. J. Donoghue. 1989. Patterns of variation in levels of homoplasy. Evolution 43: 1781-1795. Shamel, H. 1927. A new bat from Colombia. Proceedings of the Biological Society of Washington 40:129-130. Simmons, N. B. and J. H. Geisler. 1998. Phylogenetic relationships of Icaronycteris, Archaeonycteris, Hassianycteris, and Palaeochiropteryx to extant bat lineages, with comments on the evolution of echolocation and foraging strategies in Microchiroptera. Bulletin of the American Museum of Natural History 235:1-182. Smith, M. F. and J. L. Patton. 1993. The diversification of South American murid rodents: evidence from mitochondrial DNA sequence data for the Akodontine tribe. Biological Journal of the Linnean Society 50:149-177. 281 Soltis, D. E. and P. S. Soltis. 1998. Choosing an approach and an appropriate gene for phylogenetic analysis. Pp. 1-42 in Molecular Systematics of Plants II: DNA sequencing (D. E. Soltis, P. S. Soltis, and J. J. Doyle, eds.). Kluwer Academic Publishers, MA. Soltis, D. E., P. S. Soltis, M. E. Mort, M. W. Chase, V. Savolainen, S. B. Hoots, and C. M. Morton. 1998. Inferring complex phytogenies using parsimony: An empirical approach using three large DNA data sets for Angiosperms. Systematic Biology 47: 32-42. Starrett, A. and L. de la Torre. 1964. Notes on a collection of bats from Central America, with the third record for Cyttarops alecto Thomas. Zoologica, Scientific contributions of the New York Zoological Society 49:53-63. Steppan, S. and J. Sullivan. 2000. The emerging statistical perspective in systematics: a comment on Mares and Braun. Journal of Mammalogy 81:260- 270. Stevens, P. F. 1991. Character states, morphological variation, and phylogenetic analysis: A review. Systematic Botany 16:553-583. Sudman, P. D., L. J. Barkley, and M. S. Hafner. 1994. Familial affinity of Tomopeas ravus (Chiroptera) based on protein electrophoretic and cytochrome b sequence data. Journal of Mammalogy 75:365-377. Sullivan, J. 1996. Combining data with different distributions of among-site rate variation. Systematic Biology 45:375-380. Sullivan, J., K. E. Holsinger, and C. Simon. 1995. Among-site rate variation and phylogenetic analysis of 12S rRNA in Sigmodontine rodents. Molecular Biology and Evolution 12:988-1001. Swofford, D. L. 2000. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.0b4a. Sinauer Associates, Sunderland, MA. Tamsitt, J. R. and D. Valdivieso. 1963a. Notes on bats from Leticia, Amazonas, Colombia. Journal of Mammalogy 44:263. Tamsitt, J. R. and D. Valdivieso. 1963b. Records and observations on Colombian bats. Journal of Mammalogy 44:168-180. Tamsitt, J. R. and D. Valdivieso. 1986. Variacion morfometrica en el murcielago Sturnira magna (Chiroptera: Phyllostomidae). Caldasia 15:743-760. Thomas, O. 1915. A new genus of Phyllostome bats and a new Rhipidomys from Ecuador. Annals and Magazine of Natural History 8:310-312. . 282 Timm, R. M. and R. K. LaVal. 1998. A field key to the bats of Costa Rica. Occasional Publication Series. Center of Latin American Studies, The University of Kansas, Lawrence 22:1-30. Timm, R. M., D. E. Wilson, B. L. Clauson, R. K. La Val, and C. S. Vaughan. 1989. Mammals of the La Selva-Braulio Carrillo Complex, Costa Rica. North American Fauna 75:1-162. Tschudi, J. J. von. 1844. Untersuchungen iiber die Fauna Peruana. Therologie. Scheitlin und Zollikofer, St. Gallen, Switzerland. Valdivieso, D. 1964. La fauna quiroptera del Departamento de Cundinamarca, Colombia. Revista de Biologia Tropical, Universidad de Costa Rica 12:19-46. Van Den Bussche, R. A. and R. J. Baker. 1993. Molecular phylogenetics of the New World bat genus Phyllostomus based on cytochrome-b DNA sequence variation. Journal of Mammalogy 74:793-802. Van Den Bussche, R. A., R. J. Baker, H. A. Wichman, and M. J. Hamilton. 1993. Molecular phylogenetics of Stenodermatini bat genera: congruence of data from nuclear and mitochondrial DNA. Molecular Biology and Evolution 10:944-959. Van Den Bussche, R. A., J. L Hudgeons, and R. J. Baker. 1998. Phylogenetic accuracy, stability, and congruence: relationships within and among the New World bat genera Artibeus, Dermanura, and Koopmania. Pp. 59-71 in Bats, Biology and Conservation (T. H. Kunz and P. A. Racey, eds.). Smithsonian Institution Press, Washington and London. Villa-Ramirez, B. 1967. Los murcielagos de Mexico. Anales del Instituto de Biologia, Universidad Nacional Autonoma de Mexico, DF, Mexico. Wendel, J. F. and J. J. Doyle. 1998. Phylogenetic incongruence: window into genome history and molecular evolution. Pp. 265-296 in Molecular Systematics of Plants II: DNA sequencing (D. E. Soltis, P. S. Soltis, and J. J. Doyle, eds.). Kluwer Academic Publishers, Massachussetts. Wiens, J. J. 1998. Combining data sets with different phylogenetic histories. Systematic Biology 47:568-581 Wright, A. J., R. A. Van Den Bussche, B. K. Lim, M. D. Engstrom, and R. J. Baker. 1999. Systematics of the genera Carollia and Rhinophylla based on the cytochrome-b gene. Journal of Mammalogy 80:1202-1213. BIOGRAPHICAL SKETCH Carlos Alberto ludica was born in Capital Federal, Argentina, on February 25, 1959. During the first seven years of his life, he lived in the suburbs of Buenos Aires. He attended elementary and high school in Capital Federal. Carlos began working as assistant in the collection of vertebrates at the Museum of Natural History "Bernardino Rivadavia" at age 15. In 1977 he began to study ecology at the University of La Plata. Carlos devoted six years toward his degree of Licenciado in Ecology and Conservation of Natural Resources. While a student, he had a teaching assistantship in Principles in Botany and a field assistantship from WWF participating in field work on Pampas deer {Ozotocerus bezoarticus celet). He was called to do military service in 1983, spending one year in the middle of Patagonia, surrounded by glacial lakes, guanacos, and an endless steppe. After military service, he traveled across South America visiting Bolivia (from Santa Cruz to Lake Titicaca), Peru (Yungas, west coast, and Iquitos), and the Brazilian Amazon and its Atlantic coast (Belen to Rio Grande do Sul). A few days before he left Buenos Aires, Carlos met Maria Eugenia Fullana Jornet, now his wife. In 1985, he started a two-year general survey on a National Park in the Argentinean Yungas under the direction of Dr. J. Morello (director of National Parks) supported by a research fellowship from the National (Argentinean) Council of Scientific and Technical Research and later performed a study in 283 284 forest succession in the same area. From 1985 to 1988 Carlos conducted research, taught Biogeography as assistant professor, and was a scientific consultant for the Municipality of Buenos Aires. In 1988 Maria and Carlos moved to California where he met John Robinson and learned of the Tropical Conservation and Development Program at the University of Florida, which he entered in 1990. He obtained his masters degree in 1994 and immediately after graduation he was hired as Collection Manager at the mammal collection of the Florida Museum of Natural History. In 1995 Carlos entered the Department of Zoology, and under the guidance of John F. Eisenberg he worked for five years on a systematic revision of the genus Sturnira, a Neotropical fruit bat. During his years in Gainesville, he received several grants and awards and was the recipient of a Pew Scholarship, The McLaughlin Dissertation Fellowship, and the University of Florida's Presidential Recognition of Outstanding Student. At present, he has been hired as the Interim Assistant Curator of Mammals at the Florida Museum of Natural History, where he is planning to continue his studies in systematics and the biogeography of mammals. in opinion it conforms to I certify that I have read this study and that my acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. hri\F. Eisenberg, ChaW Katharine Ordway Professor of Ecosystem Conservation it to I in conforms I certify that have read this study and that my opinion acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Norris H. Williams Professor of Botany it I certify that I have read this study and that in my opinion conforms to acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Walter S. Judd ^ Professor of Botany that in my opinion it conforms to I and I certify that have read this study acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. Colin A. Chapman Associate Professor of Zoology that in my opinion it conforms to I this study and I certify that have read acceptable standards of scholarly presentation and is fully adequate, in scope and quality, as a dissertation for the degree of Doctor of Philosophy. ^(TWt^/ 'Brian W. Bowen Assistant Professor of Fisheries and Aquatic Sciences This dissertation was submitted to the Graduate Faculty of the Department of Zoology in the College of Liberal Arts and Sciences and to the Graduate School and was accepted as partial fulfillment of the requirements for the degree of Doctor of Philosophy. December 2000 Dean, Graduate School 10 UNIVERSITY OF FLORina ffllipi3 1262 08555 1850