INFORMATION TO USERS
This manuscript has been reproduced hx>m the microfilm master. UMI films the text directly fi’om the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter 6ce, while others may be fi-om any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing fi’om left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Information Company 300 North Zeeb Road, Ann Arbor MI 48106-1346 USA 313/761-4700 800/521-0600
CHARACTERIZATION, PURIFICATION, AND MOLECULAR CLONING OF
HYDROXYNITRILE LYASE FROM CASSAVA (MANIHOT ESCULENTA CRANTZ )
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the
Degree Doctor of Philosophy in the Graduate School of The
Ohio State University
By Wanda Lynn Broyles White, B.S.
*****
The Ohio State University
1996
Dissertation Committee:
Approved by;
Dr. Richard T. Sayre, Adviser
Dr. Michael Evans
Dr. Terrence Graham Adviser
Plant Biology Dept. UMI Number: 9710682
UMI Microform 9710682 Copyright 1997, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 ABSTRACT
Cassava {Manihot esculenta Crantz) is a staple food crop in Africa. The cyanogenic glycoside, linamarin, is stored in cassava cells and probably functions as an herbivore deterrent. When cassava roots are prepared for human consumption, linamarin and its degradation products, acetone cyanohydrin eind hydrogen cyanide, can remain in the food products. Exposure to these cyanogens has been linked to epidemics of neurological disorders in Africa. Acetone cyanohydrin is the main contributor to cyanide exposure from cassava consumption.
We purified hydroxynitrile lyase, which converts acetone cyanohydrin to acetone and hydrogen cyanide, from cassava leaf apoplast extracts and whole leaves. The enzyme was a homodimer of 29 kD subunits. The pH and temperature optima were 5.0 and 30°C, respectively. The enzyme displayed typical Michaelis-Menten kinetics. Activity was saturated by 20 mM acetone cyanohydrin and the Km was 0.925 mM.
Hydroxynitrile lyase maintained over 50 percent of its optimal activity at pH 4.0-5.5 and temperatures 4-45°C.
Also, the enzyme was not permanently inactivated by 24 hours of exposure to low pHs (4.0-6.0).
ii Anti-hydroxynitrile lyase antibodies were raised and used to localize the enzyme. Using FITC-labeled secondary antibodies ^ hydroxynitrile lyase was found in the cell walls of leaf epidermal, parenchyma, and mesophyll cells. Western blots demonstrated the presence of hydroxynitrile lyase in leaves and not stems or roots.
The gene encoding hydroxynitrile lyase was isolated from a cassava leaf cDNA library. The 1.1 kb cDNA clone encoded a
258 amino acid protein. The derived amino acid sequence had
78 percent identity to rubber tree (Hevea brasiliensis) hydroxynitrile lyase and 30 percent identity and 56 percent similarity to two pathogen induced response proteins from rice {Oryza sativa). Southern blot analysis supported the presence of one copy of the hydroxynitrile lyase gene in the cassava genome. Little expression of the hydroxynitrile lyase gene (1.3 kb mRNA) was found in cassava stems and roots.
Ill ACKNOWLEDGMENTS
I would like to thank the members of my committee, Mike
Evans, Terrence Graham, and Luther Waters, and my adviser,
Richard Sayre for their efforts in the successful completion of my project.
Ron Hutchison, Diana Arias, Stuart Ruffle, and meiny other members of the lab helped me along the way with experiments. I hope I have given as much help back to the lab as I have received. Dr. Graham and his group, Ming-Ching
Hsieh, especially, helped me use the HPLC and taught me plant pathology techniques. I would like to thank Drs. Sack,
Coplin, Davis, McDonald, and Yang for the use of equipment.
Thanks also to their students who helped me use it; Yakang
Lin, Greg Bell, Shalu Mittal, and Matt Geisler.
Finally I would also like to thank those who prepared me for my work here at OSU. I thank the faculty of Rhodes
College, especially members of the Biology Department, for teaching me invaluable lessons about science and, more importantly, personal growth. I thank my family for their support throughout the years and their sacrifices for my education. I thank my husband. Trey, for his constant compeuiionship and encouragement.
iv VITA
May 11, 1969...... Bom-Johns on City, Tennessee
1991...... B.S. Biology, Rhodes College
1991-present...... Graduate Teaching Associate, The Ohio State University
PUBLICATIONS
White, W.L.B., and R.T. Sayre (1993) Peurtial purification and characterization of hydroxynitrile lyase from cassava. In: Roca, W. and Thro, A., eds. Proceedings of the first international scientific meeting of the Cassava Biotechnology Network, Cartegena, Colombia, 25-28 August 1992. Cali, Colombia: Centro International de Agriculture Tropical, 379-383.
White, W.L.B., McMahon, J.M., and R.T. Sayre (1994) Regulation of cyanogènesis in cassava. Acta Hortlculturae 375: 69-78.
McMcihon, J.M., White, W.L.B., and R.T. Sayre (1995) Cyanogenesis in cassava. Journal of Experimental Botany 288: 731-741.
White, W.L.B., and R.T. Sayre (1995) The characterization of hydroxynitrile lyase for the production of safe food products from cassava (Manihot esculenta Crantz). In: D.L. Gustine and H.E. Flores, eds. Phytochemicals and Health. Proceedings of the Tenth Annual Penn State Symposium in Plant Physiology, May 18-20, 1995. (American Society of Plant Physiologists, Rockville, Maryland) pp. 303-4.
FIELDS OF STUDY
Major Field: Plant Biology TABLE OF CONTENTS Page
Abstract...... 11
Acknowledgments...... Iv
Vita...... V
List of Tables...... Ix
List of Figures...... x
List of Abbreviations...... xll
Chapters : 1. Introduction...... 1
1.1 General Information about Cassava...... 1 1.2 Cyanogenesis In Cassava...... 5 1.3 The Role of Cyanogenesis...... 12 1.4 Cyanogenesis and Human Consumption...... 15 1.5 The Goals of This Research Project...... 21
2. Purification and Characterization of Hydroxy- nltrlle Lyase from Cassava...... 23
2.1 Introduction...... 23 2.2 Methods...... 25 2.2.1 Assay for Hydroxynitrile Lyase Activity...... 25 2.2.2 Purification of Hydroxynitrile Lyase from Apoplast Extracts...... 27 2.2.3 Purification of Hydroxynitrile Lyase from Whole Leaves...... 29 2.2.4 Determination of Native Molecular Weight...... 30 2.3 Results...... 30 2.3.1 Spontaneous Degradation of Acetone Cyanohydrin Versus Enzymatic Breakdown...... 30 2.3.2 Purification of Hydroxynitrile Lyase from Leaf Apoplast Extracts.. 31
VI 2.3.3 Characterization of Hydroxynitrile Lyase: Stability and Optimization of Activity...... 36 2.3.4 Purification of Hydroxynitrile Lyase from Whole Leaf Extracts 40 2.3.5 Determination of Native Molecular Weight...... 40 2.3.6 Determination of Kinetic Properties 45 2.4 Discussion...... 47
Immunolocalization of Hydroxynitrile Lyase...... 51 3.1 Introduction...... 51 3.2 Methods...... 53 3.2.1 Western Blot...... 53 3.2.2 Fluorescent Immunolocalization of Hydroxynitrile Lyase in Leaves 54 3.3 ^^esults...... 55 3.3.1 Localization and Quantitation of Hydroxynitrile Lyase in Cassava Organs...... 55 3.3.2 Cellular Localization of Hydroxy nitrile Lyase in Cassava Leaves.... 55 3.4 Discussion...... 57
Cloning of the Hydroxynitrile Lyase cDNA...... 60 4.1 Introduction...... 60 4.2 Methods...... 62 4.2.1 Screening the cDNA Library...... 62 4.2.2 DNA Sequencing and Sequence Analysis...... 67 4.2.3 DNA Isolation and Southern Blot.... 68 4.3 Results...... 68 4.3.1 Hydroxynitrile Lyase cDNA and Derived Amino Acid Sequence...... 69 4.3.2 Southern Blot...... 71 4.4 Discussion...... 73
Expression of Hydroxynitrile Lyase...... 76 5.1 Introduction...... 76 5.2 Methods...... 77 5.2.1 RNA Isolation and Northern Blot.... 77 5.2.2 Preparation and Application of Phytophthora parasitica and Cell Wall Glucan Elicitor...... 78 5.3 Results...... 81 5.3.1 Localization of Hydroxynitrile Lyase Expression in Cassava Orgeins. 81 5.3.2 Expression of Hydroxynitrile Lyase in Infected Roots...... 81 5.4 Discussion...... 83
VI1 6. Summeury...... 84
List of References...... 87
vrxa. LIST OF TABLES
Table Page
1.1 Cyanide consumption and its effects on human health...... 16
1.2 Cyanogen levels in cassava food products...... 18
2.1 Comparison of hydroxynitrile lyases from several plants...... 24
2.2 Purification of hydroxynitrile lyase from apoplast extracts...... 34
2.3 Purification of hydroxynitrile lyase from whole leaf extracts...... 41
2.4 Comparison of cassava hydroxynitrile lyase purifi cation procedures using whole leaf tissue...... 43
4.1 Predicted amino acid composition of hydroxynitrile lyase...... 70
IX LIST OF FIGURES
Figure Page
1.1 Cassava...... 2
1.2 Map of cassava cultivation...... 4
1.3 Cyanide release during ethylene production...... 6
1.4 Cyanogenic glycosides...... 8
1.5 Linamarin synthesis...... 9
1.6 Linamarin degradation...... 11
1.7 Cyanide detoxification in plants...... 13
1.8 Cyanide detoxification in humans...... 17
2.1 Diagram of apoplast protein extraction procedure.. 28
2.2 Spontaneous degradation of acetone cyeinohydrin as a function of pH and temperature...... 32
2.3 Spontaneous versus enzymatic breakdown of acetone cyanohydrin at pH 6.0...... 33
2.4 SDS-PAGE of hydroxynitrile lyase purification steps from apoplast protein extracts...... 35
2.5 Diagram of protein profile eluted from Sephacryl S-200 column during purification of hydroxynitrile lyase...... 37
2.6 Hydroxynitrile lyase pH optimum...... 38
2.7 Hydroxynitrile lyase temperature optimum...... 39
2.8 SDS-PAGE of hydroxynitrile lyase purification steps from whole leaf protein extracts...... 42
X 2.9 Determination of native molecular weight of hydroxynitrile lyase...... 44
2.10 Michaelis-Menten Plot...... 46
2.11 Lineweaver-Burk Plot...... 48
3.1 Quantitative immunoblot of hydroxynitrile lyase in cassava leaf, stem, root rind, and root parenchyma 56
3.2 Immunolocalization of hydroxynitrile lyase in cassava leaves using fluorescently tagged anti bodies ...... 58
4.1 DNA. and derived amino acid sequence of hydroxy nitrile lyase cDNA clone...... 63
4.2 Conversion of phage genome containing hydroxy nitrile lyase cDNA to plasmid for sequencing..... 66
4.3 Comparison of hydroxynitrile lyase cDNA clone to other clones of cassava and rubber tree hydroxy nitrile lyases...... 72
4.4 Southern blot of cassava genomic DNA probed with the hydroxynitrile lyase cDNA clone...... 74
5.1 Northern blot of total RNA from cassava leaf, stem, and root probed with the hydroxynitrile lyase cDNA clone...... 82
XI ABBREVIATIONS
ATP, adenosine triphosphate; BCIP, 5-bromo-4-chloro-3-indolyl phosphate; BSA, bovine serum albumin; DEPC, diethyl pyrocarbonate; DNA, deoxyribonucleic acid; DTT, dithiothreitol; FITC, fluorescein isothiocyanate; HCN, hydrogen cyanide; HPLC, high performance liquid chromatography; IPTG, isopropyl p-D-thiogalactopyranoside;
LB, Luria broth; MOPS, morpholinopropane sulfonic acid; MS,
Murashige and Skoog; NBT, nitro blue tétrazolium; PVP, polyvinyl pyrrolidone; RNA, ribonucleic acid; SDS, sodium dodecyl sulfate; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; SM, suspension medium;
SSC, sodium chloride and sodium citrate buffer; TBS, tris buffered saline; Tween-20, monolaurate polyoxyethylene sorbitan; X-gal, 5-bromo-4-chloro-3-indolyl-p-D- galactopyranos ide.
XIX CHAPTER 1
INTRODUCTION
1.1 General Information About Cassava
Cassava {Manihot esculenta Crantz, previously M. utilissima and M. palmata) is a member of the Euphorbiaceae family (Nartey, 1969; Osuntokun, 1981). Unlike most plant or crop species, cassava is a cultigen meaning that it is unknown in the wild except for instances of escape from cultivation (Cooke and Coursey, 1981). It was probably domesticated from several (3 or more) naturally occurring
Manihot species in Mexico where the progenitor specimens have been found (Norman et al., 1995). In the late 16th century, cassava was taken to west Africa emd then tremsported across
Africa and into India. Although cassava has been cultivated at least 2,500 years, its use has increased greatly during the last century (Cooke and Coursey, 1981; Norman et al.,
1995).
Cassava is a perennial shrub with lobed leaves and grows
1 to 5 meters high (Figure 1.1). Each plant produces 5 to 20 large storage roots. Cassava was bred to produce large, starchy roots and less branching stems. In part because Figure 1.1. A diagram of cassava {Manihot esculenta Crantz) showing its storage roots which are an important food crop in many African countries. cassava only flowers at branched points along its stems, cassava flowering is limited. Not only does cassava have few flowers, but viable seed production is very low, meiking vegetative propagation of cassava necessary (Norman et al.,
1995).
Cassava is now grown in tropical regions all over the world (Figure 1.2) (Henry and Gottret, 1996). It grows best in hot, wet tropics but can survive in tropical regions which have dry seasons. Cassava can also tolerate poor soils.
Cassava roots are associated with mycorrhizae to a large extent and are tolerant of low levels of calcium, nitrogen, potassium, and phosphorous and high levels of aluminium and manganese (Normaui et al., 1995). Cassava is also tolerant of low pH or acid soils and drought (Norman et al., 1995). It uses drought avoidance techniques, such as dropping its leaves, to survive periods of drought (Norman et al., 1995).
Compared to other crops, cassava production is very energy efficient. After initial planting of stem cuttings and weeding, cassava requires little attention until harvest.
Also, hcucvesting can occur over a long period of time since the roots are stable while in the soil. Depending on varietal differences, cassava can be harvested between 6 and
11 months (short-season) or between 1 and 6 years after initial planting (long-season) (Norman et al., 1995).
Humans mainly use cassava for food or animal feed.
Cassava can also be used in the production of industrial o
Figure 1.2. A map of major (black) and minor (grey) cassava producing regions of the world. alcohol, textiles, adhesives, paper, and starch derivatives such as high fructose syrup (Centro Intemacional de
Agriculture Tropical, 1996; The Thai Tapioca Development
Institute, 1996). In many African countries, cassava can provide the major source of calories (e.g. 1,112 calories/day in Zaire) with an average per capita consumption of 1.06 kg/day (Centro Intemacional de Agriculture Tropical, 1996).
It is estimated that 500 million people currently rely on cassava as a subsistence crop (Centro Intemacional de
Agriculture Tropical, 1996). In m r a l African areas, cassava production is a communal activity and long-season cassava is usually planted to be available whenever needed. In the more populated areas of Africa and in industrialized countries such as Brazil, cassava is grown by individuals for market sale and is more often short-season cassava (Norman et al.,
1995).
1.2 Cyanogenesis in Cassava
Small amounts of cyanide are produced by plants as a by product of ethylene synthesis (Figure 1.3). However, large amounts of cyanide can also be released from damaged pleint tissues of at least 2,500 species (Conn, 1994). This process is called cyanogenesis. Most cyanogenic plants store so called "bound" cyanide in the form of cyanogenic glycosides
(some also use cyanogenic lipids). When tissues are damaged, enzymes break down the stored compound to release the C H oO H C H oO H I HCOH HCOH NH ,+ IO2)
CH2=CH2 + COg + HCN + 2H 2O + ACC Oxidase coo- m Ascorbate 1-Aminocyclopropane- Ethylene Dehydroascorbate 1-carboxylie acid (ACC)
Figure 1.3. Ethylene production in higher plants. Cyanide is a by-product. cyanide. In plants, amino acids are the precursors for cyanogenic glycoside synthesis. Linamarin eind its glucoside linustatin, probably the two most common of over 60 cyanogenic glycosides, are synthesized from valine (Figure
1.4). Other cyanogenic glycosides are synthesized from isoleucine (lotaustralin), tyrosine (dhurrin), and phenylalanine (prunasin) (Fig. 1.4) (Narstedt, 1985). The synthesis pathways of linamarin in cassava, and dhurrin in sorghum ( Sorghum bicolor L . ) have been studied and show a large amount of similarity (Koch et al., 1992; Halkier et al., 1991). The first committed step is the hydroxylation of the a-amino group of the amino acid (Figure 1.5). This reaction is catalyzed by a cytochrome P450 (Sibbesen et al.,
1994). The N-hydroxy amino acid is further oxidized until an oxime is formed followed by decarboxylation. The oxime is then converted to a nitrile. A second hydroxylation, of the original amino acid's a-carbon or the adjacent carbon of the side chain, forms the cyanohydrin (Halkier et al., 1991).
The cyanohydrin is glycosylated to form the cyanogenic glycoside (Mederacke et al., 1996). The synthesis steps leading to the hydroxynitrile occur in a membrane enzyme complex. These reactions exhibit channeling of the substrates and can be performed in vitro using microsomal fractions
(Halkier et al., 1991; Koch et al., 1992).
The release of cyanide from cyanogenic glycosides requires only two steps: the hydrolysis of the glycoside(s) glucose-O HOOC - CH - NHg glucose-0^ ^C=N glucose-O^ ^C=N A - HgC CHg HgC CHg HgC CHg
Valine Linamarin Linustatln
HOOC- C H - NHo glucose-0^ ^C=N I CH / \ HgC CH2CHg HgC CH2CHg
Isoleucine Lotaustralin
HOOC - CH - NHp giucose-0^ ^C=N I CH / H H \ OH OH Tyrosine Dtiurrin
HOOC - CH - NH2 giucose-0, C=N CH / H
Ptienylalanine Pmnasin
Figure 1.4. Some cyanogenic glycosides (right) and their amino acid precursors (left). CHgNOg c
HgC \ h 3 1 -Nltro-2-methyl-propane
-00Ç .H ■00Ç .H ■00Ç .H V /O- Og + NAD PH " HgC \ n g HgC \ n g HgC \ h 3 HgC \ h 3 Acetone cyanofiydrin 2-Methylpropionltrll(i (Z)-2-Methyl-propanal oxime (E)-2-Methyl-propanal oxime UDPQ->| glucose-0^y = N C HgC \ n g Linamarin Figure 1.5. The pathway for linamarin synthesis in cassava (Koch et al., 1992). and the release of cyanide from the hydroxynitrile. In the case of the glycosides, the first step is catalyzed by a p- glucosidase. These p-glucosidases are generally specific for their substrates (Poulton, 1990). In cassava, the p- glucosidase linamarase removes the glucose from linamarin producing acetone cyanohydrin (Figure 1.6). The second step for cyanide release is catalyzed by a hydroxynitrile lyase which forms an aldehyde or ketone and hydrogen cyanide (HCN). In cassava, hydroxynitrile lyase converts acetone cyanohydrin to acetone and HCN. Hydroxynitriles are typically unsteüDle under high pH or temperatures and can, therefore, also break down spontaneously (Poulton, 1990). In cassava, linamarin is most likely stored in the vacuole (McMahon et al., 1995). Linamarase is stored in the cell wall and possibly in laticifers (Mkpong et al., 1990; Pancoro and Hughes, 1992). Therefore, cyanogenesis only occurs after tissue damage. It is only then that the cyanogenic glycoside and its degrading enzymes come in contact with each other (Poulton, 1990). Cyanide interferes with respiration. It binds to the heme iron of cytochrcxae c oxidase within the mitochondrion and halts electron flow (Stryer, 1988). This process is sometimes referred to as "cellular suffocation" as it produces the same effect as a lack of oxygen. Plants producing cyanide apparently have two different mechanisms to protect against the toxic effects of cyanide. 10 glucose-0^ ^C=N HO^ ^C=N Hydroxynitrile lyase O or II C LInamarase Glucose spontaneous breakdown # \ ► /\ HCN HgC ^CHg H3G/ v CH, H3C CH3 Unamarin Acetone cyanohydrin Acetone Hydrogen cyanide Figure 1.6. The cyanogenesis pathway in cassava. Linamarin is broken down by linamarase producing glucose and acetone cyanohydrin. Acetone cyanohydrin can be degraded by hydroxynitrile lyase or spontaneously decompose to produce acetone and HCN. First, the mitochondrion of plants can tolerate a higher concentration (up to 1 mM) of cyanide than other eukaryotes (10 nM) due to the activity of an alternate oxidase which restores electron flow (Yip and Yang, 1988; Lance et al., 1985). Second, enzymes are present which use cyanide as a substrate, p-cyanoalanine synthase converts cysteine and HCN to p-cycinoalanine and hydrogen sulfide (Figure 1.7). The P- cyanoalanine is then hydrated to asparagine. Utilizing this pathway allows plants to retain nitrogen which would otherwise be lost via volatilization of HCN. All plants examined thus far, including cassava, have p-cyanoalanine synthase activity (Miller and Conn, 1980). 1.3 The Role of Cyanogenesis For many reasons, cyanogenesis has been assumed to be an herbivory deterrent. Cyanogenic plants only release cyanide after tissue damage such as that performed by herbivores. Also, cyanogenic glycosides are typically located in organs essential for survival (e.g. seeds, flowers, young leaves) (Narstedt, 1985). Feeding deterrent studies using pests of cyanogenic plants support the use of cyanogenic glycosides as herbivory deterrents. The Mexican beam beetle {Epilachna varivestis), a pest of linamairin and lotaustralin producing plants Phaseolus lunatus and P. vulgaris, was toleraint of 0.1 percent (w/v) (approximately 4 mM) cyanogenic glucoside in a glucose solution, but would not ingest 1 percent (w/v) 12 NH' H2S + HCN HoO HoO + + CONH. COOH I CHoSH CHoCN CHo ► CH2 I P-cyanoline I P-cyanoline Asparaginase I CHNH2 synthase CHNH2 hydrolase CHNHp CHNHo w I I ^ I ^ COOH COOH COOH COOH cysteine P-cyanoalanine asparagine aspartate Figure 1.7. Plants detoxify cyanide by converting it to p-cyanoalanine. p-cyanoalanine synthase has been found in every plant which has been surveyed. (approximately 40 mM) solutions without sugars. Also, the beetles are more devastating to the P. vulgaris crop which produces 4-fold less cyanogenic glucosides than P. lunatus (Narstedt, 1985). The cassava herbivore Zonocerus variegatus can be a devastating pest to cassava grown in west Africa; however, it feeds on cassava as a last resort when all other suitable vegetation has died during the dry season (Bemays et al., 1977). In feeding experiments, the early instars would not eat healthy cassava leaves even if they were the only food offered. They would eat the unhealthy leaves which had much slower cyanide release. Adults which were more tolerant to the cassava leaves, lost weight when fed only healthy leaves. In field trials, the insects ate leaves in increasing order of cyanide potential, beginning with unhealthy leaves, then eating older leaves and then younger leaves (Bemays et al., 1977). The cassava burrowing bug (Cyrtomenus bergi) is a sucking insect which feeds on cassava roots. Belloti and Arias (1993) found that the first and second instars, which have short stylets, feed on the root rind (which has a higher concentration of cyanogenic glycosides than the deeper parenchyma tissue) euid have 56 and 84 percent mortality if fed low cyanide and high cyanide cassava, respectively. In the same study, a field trial in which low, intermediate, and high cyanide cultivars were planted in a random block demonstrated a preference for cultivars based on lower cyanide content. The low cyanide 14 plants had feeding damage on 46 percent of their roots, while the intermediate and high cyanide cultivars had only 12.5 and 4.2 percent damage, respectively. 1.4 Cyanogenesis and Human Consumption In humans, cyanide can cause several health problems including death. For an adult, consumption of 50-100 mg or 2 mmol HCN within 24 hours is lethal (Table 1.1) (Rosling, 1993a; Rosling et al., 1993b). Lower levels cause a variety of other symptoms, such as vomiting and nausea, weakness and headache, and impaired vision (Essers et al., 1992; Osuntokun, 1981). Long term exposure to cyanide Ccui cause neurological disorders such as loss of sight or hearing and paralysis (Osuntokun, 1981). Approximately 10 mg of HCN can be sequestered by met-hemoglobin (Rosling et al., 1993b). Humans remove most non-bound HCN from their bodies by converting it to SCN which is excreted in the urine (Figure 1.8) (Osuntokun, 1981). However, SCN competitively inhibits iodine metabolism in the thyroid and can cause goiter (Cooke and Coursey, 1981; Rosling et al., 1993b). The levels of cyanogens in cassava food products can be hazardous. Flour made from high-cyanide cassava can contain more than one lethal dose of cyanide equivalents per kilogram dry weight (Table 1.2). Death is infrequent, however, because not all the cyanogens are completely degraded in the body. The three cyanogens found in cassava flour occur in 15 Symptom Subject Cyanogen Reference Consumption Death Healthy adult 2 mmol HCN within Rosling (1993a); 24 hours or 50-60 Cooke and Coursey mg HCN (1993) Symptomleas Healthy adult 10 mg HCN in 24 Rosling et al. Exposure hours (1993b) Acute Intoxication Vomiting African family Dizziness members consuming = 1 mmol HCN in Mlingi (1992) Nausea bitter cassava one dose Palpitation flour (27 mg HCN) Weakness Diarrhea a\ Headache Impaired Vision Konzo Africans consuming 0.5-1 mmol HCN/day Tylleskar et al. Rapid and bitter cassava for several weeks (1992) Irreversible flour (14-27 mg) Paralysis Tropical Ataxic Neuropathy Elderly Africans Moderate levels Osuntokun (1981) Slowly Developed consuming cassava (10-14 mg HCN/day) Paralysis for several years for several years Table 1.1. Cyanide exposure and its effects on human health. Rhodanese CN" + 82803-^ ------► SCN- + Figure 1.8. Humans detoxify the majority of cyanide by the enzyme rhodanese which produces thiocyanate. Thiocyanate is excreted in the urine. 17 Cyanide Content Processing (mg CN equivalents/ Reference kg dry weight) Short-cut processing of bitter cassava 12-124 Tylleskar flour immediately (1992) after preparation Collected bitter cassava flour from 32 Tylleskar African homes (1992) Costa Rican market cassava flour 15.1 Essers (1994) Costa Rican market cassava flour with fungus Neurospora 0.6 Essers (1994) sitophila Ghana market cassava 22.7 Essers (1994) flour Ghana market cassava flour with fungus Neurospora 2.7 Essers (1994) sitophila Chinyanya bitter Mlingi et al. cassava flour 144 (1992) Makopa from bitter Mlingi et al. cassava flour 133 (1992) Table 1.2. Cyanogen levels in cassava flour prepared by different methods. The type of cassava roots used (bitter or sweet) is given if known. 18 different concentrations and have different toxicities. HCN, which is volatile and easily removed from cassava material by soaking, is highly toxic but only very small amounts of HCN remain in food products (Nambisan et al., 1985; Tylleskar et al., 1992). Linamarin, which is only partially degraded by humans (less than 50 percent at most), does remain in poorly processed cassava flour (Nambisan et al., 1985; Tylleskar et al., 1992). Acetone cyanohydrin remains in poorly processed cassava flour, and it is as toxic as HCN due to its instability at body temperature cind at blood pH (Tylleskar et al., 1992). The levels of total cyanogens and of each individual cyanogen differ according to starting material (high or low cyanide cassava, environmental conditions, age of the root, etc.) and the type of processing (Teible 1.2 ) (Tylleskar et al., 1992; Nambisan et al., 1985; Kojima et al., 1983; Essers et al., 1994; Mlingi et al., 1992). In one study, the cyanogen content of cassava flour prepared from high cyanide cultivars was studied using traditional and short-cut methods. Both procedures required approximately 7 days but the short-cut method was much less labor intensive. The traditionally prepsured cassava flour (prepared by soaking roots 70 hours followed by crushing and drying in balls) contained 0-10 mg cyanide equivalents of linamarin and HCN per kg dry weight and 0-25 mg cyanide equivalents of acetone cyanohydrin per kg dry weight. In short-cut processed cassava flour (prepared by soaking 30 hours and dried as 19 whole roots ), the amounts of linamarin and HCN remained almost the same, but the amount of acetone cyanohydrin increased to 10-100 mg cyanide equivalents per kg dry weight (Tylleskar et al., 1992). Therefore, acetone cyanohydrin can be the major contributor to cyanide exposure from cassava flour. In Africa, where most of the health concerns caused by cassava consumption occur, many individuals subsist on cassava. In four African countries the disease konzo has become epidemic during drought years (1-3.8 people per 1000) (Essers et al., 1992). Konzo is an irreversible paralysis in both legs brought about by exposure to high but non-lethal doses of cyanide. Konzo patients have a 15-fold increase in urine SCN concentrations compared to unaffected African individuals (Tylleskar et al., 1992) which strongly supports cyanide exposure as the causal agent. Another disease, tropical ataxic neuropathy, can be common, affecting 8 percent of a Nigerian village population (Osuntokun, 1981). Tropical ataxic neuropathy is a common term for the gradual development of many symptoms which can be reversible such as, weakness, impaired vision, deafness, thinning of the legs, paralysis, impaired coordination, lack of normal reflexes, dementia, euphoria, phobic anxiety, and schizophrenic-like psychosis (Osuntokun, 1981). These symptoms have been linked with the consumption of cyanide-containing cassava food products and mainly occur in the elderly. The epidemics 20 occur towards the end of the dry season when other food products are limited and protein intake is low. Also linking tropical ataxic neuropathy symptoms to cyanide exposure was the discovery of demyelination of the peripheral nerves in tropical ateixic neuropathy patients. In the areas where tropical neuropathy and konzo of these epidemics occur, high-cyanide cultivars of cassava are preferred since they are also long-season cultivars which allow haucvesting over a much longer period of time. Using a short-cut procedure or a previously used procedure on a new cassava cultivar with higher cyanide levels accounts for most of the epidemics (Tylleskar et al., 1992; Osuntokun, 1981). Short-cut procedures become necessary during drought when there is nothing else to eat. During these times 95-99 percent of all meals can be cassava-based (Tylleskar et al., 1992). Cassava roots also contain higher levels of linamarin in drought conditions further increasing the risk of cyanide exposure (Osuntokun, 1981). 1.5 The Goals of This Research Project The goal of this project was to elucidate the cyanogenesis pathway in cassava. We chose the enzyme hydroxynitrile lyase which had not been previously characterized. In order to understand why cyanogenesis is incomplete during root processing, the characterization. 21 localization, and expression of hydroxynitrile lyase must be determined. While performing the above research we hoped to find a potentially successful method of genetically engineering cassava for the production of low cyanogen food products. The dispersal of such a transformant throughout Africa could be performed by the International Institute of Tropical Agriculture which currently disperses cassava to farmers. Since cassava is a subsistence crop, we had to develop a method which would maintain cassava's resistance to pests, drought, and poor soil. It is our hope that eventually diseases due to cyanide exposure from cassava could be drastically reduced by consumption of cassava food products from plants which can more effectively convert cyanogens into volatile HCN. 22 CHAPTER 2 PURIFICATION AND CHARACTERIZATION OF HZDROXZNITRILE LZASE FROM CASSAVA 2 .1 Introduction Hydroxynitrile lyases convert hydroxynitriles to HCN and the corresponding carbonyl. They are divided into two groups, those containing a flavin group (occurring in members of the Rosaceae family) and those not containing a flavin group. Hydroxynitrile lyases from both groups have been isolated and characterized (Table 2.1). The flavin- containing hydroxynitrile lyases have molecular weights of 50,000 - 60,000, are monomers, and occur mainly in seeds. They are abundant in plant tissues, often requiring less than 15-fold purification, and may act as storage proteins (Wu and Poulton, 1991; Xu et al., 1986; Yemm and Poulton, 1986). Non flavin containing hydroxynitrile lyases are less similar to each other than the flavin containing hydroxynitrile lyases, only sharing a pH optimum near 5.5 and isoelectric points from 4-5 (Xu et al., 1988; Kuroki and Conn, 1989; Wajant and Forster, 1996; Wajant and Mundry, 1993). 23 Species Subunit Native pH pi Glycosylated Cloned References size enzyme optimum (JcDa) (kDa) Flavin Prunus lyonii 50 59, 5.5 93 4.75 yes no Xu et al., 1986 monomer HM Yemm and Poulton, Prunus 57-59 55.6, 6-7 0.17 4.6 yes yes 1986; serotina 5 forms monomer mM Cheng and Poulton, 1993 Non-flavin N3 vt. Wajant and Fdrster, Hevea 30 100-105, 5.3-5.7 115 no yes 1996; brasiliensis tri- or mM Hasslacher et al., tetramer 1996 Linum 42 82, 5.5 2.5 4.5- no no Xu et al., 1988 usitatissimum homodimer mM 4.8 95-105, Sorghum a=22 2a 2P yes yes Wajant and Mundry, bicolor P=33 hetero- 1993 tetramer Wajant et al., 1994 Xlmenla americana 36.5 38, 5.5 280 3.9 yes no Kuroki and Conn, monomer HM 1989 Table 2.1. Comparison of hydroxynitrile lyases characterized in several plants. The relative level of hydroxynitrile lyase to linamarase can greatly affect the rate of cyanogenesis. Hevea brasiliensis leaves have a linamarase to hydroxynitrile lyase ratio of 1:2-3.7, however, Selmar et al. (1989) found that a ratio of 1:5 significantly increased the rate of cyanogenesis. The same may also be true for cassava roots where cyanogenesis is often not completed even after days of processing. An increase in hydroxynitrile lyase may degrade more acetone cyanohydrin, the major cyanogen contributing to cyanide exposure in humans, producing a safer food product. In 1992, when the research presented below began, there was no published evidence for the existence of hydroxynitrile lyase in cassava. We investigated whether cassava had a hydroxynitrile lyase. If the enzyme was sufficient to drive the complete conversion of acetone cyanohydrin to cyanide and active under the conditions present during root processing, increasing the hydroxynitrile lyase activity in roots may produce safer food products with decreased processing. This method would create safer food products without removing the cyanogenic glycosides which probably protect cassava from herbivores. 2.2 Methods 2.2.1 Assay for Hydroxynitrile Lyase Activity Hydroxynitrile lyase assays for the determination of pH and temperature optima and assays for spontaneous 25 decomposition of acetone cyanohydrin were performed using 1 ml reactions with 10.95 jiM acetone cyanohydrin and 50 mM sodium phosphate, pH 4.5, at room temperature (unless stated otherwise). After incubation for 15 or 30 minutes in capped tubes, HCN concentration was determined using the Spectroquant 14800 cyanide detection kit (EM Science). In the assay, cyanide binds to the nitrogen of pyridine, forming 1-cyanopyridium which spontaneously degrades to form glutacone dialdehyde and cyanamide. The glutacone dialdehyde condenses with 2 molecules of 1 ,3-dimethyl barbituric acid producing a lavender colored compound. The color change was measured at 585 nm. Potassium cyanide was used to make the standard curve for cyanide concentration. Spontaneous rates of acetone cyanohydrin breakdown were always subtracted from the enzyme catalyzed reaction rates in parallel assays lacking enzyme. All other hydroxynitrile lyase assays were performed in 50 mM sodium phosphate, pH 5.0 and 28 mM acetone cyanohydrin at room temperature (unless stated otherwise). After 7.5 or 15 minutes, a portion of the reaction mixture was added to 50 mM sodium phosphate, pH 4.0 and the HCN concentration measured as above. 26 2.2.2 Purification of Hydroxynitrile Lyase from Apoplast Extracts A method for apoplast protein extraction from cassava leaves was developed from modifying the procedures of Griffith et al. (1992) and Terry and Bonner (1980). Cassava leaves were washed with 50 percent ethanol for approximately 3 minutes to partially remove the leaves' waxy coating. The leaves were then washed in water three times and placed in a glass tray. Leaves were cut with razor blades into strips approximately 1 cm wide. The cuts were perpendicular to the leaf midrib. The strips were washed three times in water and then placed in 10 mM sodium phosphate, pH 7.0. Vacuum infiltration was carried out at room temperature in a vacuum chamber for 30 minutes. Apoplast extracts were collected by centrifuging (1,200 x g for 30 minutes at 4®C) rolled cassava leaves in 20 ml syringe barrels inside 50 ml tubes (Figure 2.1). On average the recovery was 19 {ig of apoplast protein per gram fresh weight of leaf. Extracts were pooled and concentrated to 10-25 percent of the original volume using Centricon 10 concentrators (10 kD molecular weight cut off) before application to the Sephacryl S-200 column (Pharmacia; Upsala, Sweden). The column dimensions were 2.5 x 40 cm. The column was run in 100 mM sodium phosphate, pH 7.0, and 200 mM NaCl at a flow rate of 1.5 mls/min. Fractions containing hydroxynitrile lyase activity were pooled and run over a Con A sepharose column to remove glycosylated proteins. 27 Whole leaves washed in 50% ethanol and rinsed in water i Leaves cut into approximately 1 cm strips, perpendicular i to the midrib under water 1 Strips washed with water 3 times and then put in I 10 mM sodium phosphate buffer, pH 7.0 i Leaves vacuum infiltrated for 30 minutes i Leaves layered and rolled into cylinders approximately 1.25 cm i Rolls centrifuged in 20 ml syringe tubes at 1,200 x g for 30 minutes \r i Apoplast extract collected in 50 ml tube Figure 2.1. Diagram of the apoplast protein extraction procedure. 28 Hydroxynitrile lyase did not bind to the Con A sepharose column (Pharmacia). The Con A column (approximately 1 ml) was equilibrated with 100 mM sodium phosphate, pH 7.0. Protein was run into the column and left to bind for 5 minutes. The unbound proteins were then collected by elution using equilibration buffer. The eluent, containing the unbound proteins, was adjusted to approximately 10 mM sodium phosphate, pH 5.6, with monobasic sodium phosphate and water. The protein solution was then loaded onto a pre-packed, 5 ml hydroxyapatite column (Biorad; Richmond, California). Pure hydroxynitrile lyase was eluted from the column using a 10- 500 mM sodium phosphate, pH 5.6, gradient. Linamarase was purified as a single peak from the Sephacryl S-200 column. Protein concentrations were determined by the method of Bradford (1976) using a BSA stemdard. Estimation of the pure hydroxynitrile lyase fraction was performed by densitometry of Coomassie stained gels due to the small quantity of protein available. SDS-PAGE was performed on precast 10-15 percent gradient gels using the Phastgel system (Pharmacia). 2.2.3 Purification of Hydroxynitrile Lyase from Whole Leaves Whole cassava leaves were cut into small pieces with scissors and ground at 4°C using a Coming blender in 100 mM sodium phosphate, pH 4.0, 500 mM NaCl, 3 mM DTT, 1 % (w/v) polyvinyl pyrrolidone for 1 minute on low speed. Ten mis of 29 buffer was used per gram fresh weight of leaf. The solution was filtered through Miracloth and centrifuged at 25,000 x g at 4°C for 10 minutes. The supernatant was brought to 0.05 % (v/v) Tween-20 and 40 % (w/v) saturation with saturated ammonium sulfate. The solution sat on ice for at least three hours before centrifugation at 25,000 x g at 4°C for 30 minutes. The supernatant was dialyzed versus 10 mM sodium phosphate, pH 5.6, 50 mM NaCl, 3 mM DTT, and 0.05 % (v/v) Tween-20 at 4°C for at least 24 hours. 2.2.4 Determination of Native Molecular Weight Hydroxynitrile lyase and linamarase from whole leaf protein extracts were loaded onto the calibrated Sephacryl S- 200 column in 100 mM sodium phosphate, pH 5.6, and 200 mM NaCl. The column was calibrated with ribonuclease A (13,700), chymotrypsinogen (25,000), ovalbumin (43,000), albumin (67,000), and Blue Dextran 2000 (Pharmacia). Proteins were eluted with 100 mM sodium phosphate, pH 7.0, and 200 mM NaCl at a flow rate of 1.5 mis/minute. The elution profile was monitored at 280 nm. 2 . 3 Results 2.3.1 Spontaneous Degradation of Acetone Cyanohydrin Versus Enzymatic Breakdown Since acetone cyanohydrin was found to be the major cyanogen remaining in poorly processed cassava flour, we 30 investigated its stability as a function of temperature emd pH. The spontaneous decomposition of acetone cyanohydrin was measured at pHs 4.0, 5.0, and 6.0 and temperatures ranging between 25-65%. Acetone cyanohydrin was highly unstable at pH 6.0 and temperatures above 35*C (Figure 2.2). At 25% and pH 6.0, over 50 percent of the acetone cyanohydrin had degraded after only 15 minutes. Acetone cyanohydrin was stable, however, at pH 4.0 and temperatures up to 35%. In order to determine the usefulness of increasing cassava hydroxynitrile lyase activity in roots, we compared the hydroxynitrile lyase activity of leaf crude extract to spontaneous degradation at pH 6.0 and room temperature. After 30 minutes, the crude extract had broken down three times as much acetone cyanohydrin as had broken down spontaneously (Figure 2.3). 2.3.2 Purification of Hydroxynitrile Lyase from Leaf Apoplast Extracts Apoplast extract was found to have an 8-fold higher hydroxynitrile lyase specific activity than whole leaf extracts (0.28 mmol HCN/mg protein/h versus 2.4 mmol HCN/mg protein/h). We developed a leaf apoplast protein extraction procedure which consistently produced non-chlorophyll containing protein extracts. Hydroxynitrile lyase with the highest published specific activity was purified (Table 2.2, Figure 2.4). The final specific activity was more than four 31 c 100 pH 6.0 in 40 pH 5.0 20 pH 4.0 L e 25 35 45 55 65 Temperature (®C) Figure 2.2. Spontaneous degradation of acetone cyanohydrin as a function of pH and temperature. Reactions were performed with 11 pM acetone cyanohydrin in 50 mM sodium phosphate buffer of the appropriate pH. After 15 minutes, the 1 ml reaction mixture was added to 50 mM sodium phosphate, pH 4.0, and assayed for cyanide. Each point represents the average of 2 to 3 reactions. 32 120 § 100- o (0 0 oc 80 - o Crude Extract c 60- 2 A Boiled Crude Extract g 40- o O 2 0 - pH 6.0 0 20 40 60 80 100 Time (min) Figure 2.3. Spontaneous versus enzymatic breakdown of acetone cyanohydrin. Hydroxynitrile lyase (10 p.g leaf crude protein extract) increased the rate of cyanogenesis even at pH 6.0 and room temperature compared to spontaneous breakdown. Reactions were performed with 11 pM acetone cyanohydrin in pH 5.0, 50 mM sodium phosphate buffer. After 30 minutes, 0.75 ml of the reaction volume was added to 50 mM sodium phosphate buffer, pH 4.5, and assayed for cyanide. 33 Fraction Total Total Specific Purification Protein Activity Activity Fold mg mmol CN/h mmol CN/mg protein/h Apoplast extract 1.580 3.8 2.4 1 Sephacryl S-200 0.553 3.7 6.7 2.8 Con A Sepharose 0.102 1.3 13 5.5 Hydroxyapatite 0.035 0.85 24 10 Table 2.2. Purification table of hydroxynitrile lyase from apoplast extracts. 34 A B c D E F Figure 2.4. SDS-PAGE of hydroxynitrile lyase purification steps. (A) protein standards; (B) 3 pg of whole leaf crude extract; (C) 0.25 |ig of apoplast extract; (D) 2.1 |ig of Sephacryl S-200 fraction; (E) 1 pg of Con A Sepharose fraction; and (F) 0.8 pg of purified hydroxynitrile lyase from the hydroxyapatite column fraction. The upper arrow points to linamarase (65 kD), the lower arrow to hydroxynitrile lyase (29 kD). SDS-PAGE was performed on SDS- Phast System (Pharmacia). 35 times that reported by Hughes et al. (1994) and Wajant et al. (1995) (24 mmol HCN/mg protein/h versus 2.2 and 5.5 mmol HCN/mg protein/h). Hydroxynitrile lyase made up 10 percent of the leaf apoplast protein based on the relative specific activities of the crude (2.4 mmol HCN/mg protein/h) and purified enzyme (24 mmol HCN/mg protein/h). Linamarase was also present in the apoplast extract (Figure 2.4) and could be purified as one peak off the Sephacryl S-200 column (Figure 2.5). 2.3.3 Characterisation of Hydroxynitrile Lyase: Stability and Optimization of Activity It was important to determine if hydroxynitrile lyase would be active and stable in the conditions present during root processing, namely low pH. We measured the enzyme's remaining activity after 24 h incubation at pHs 4.0-7.0. There was no change in activity. The activity of hydroxynitrile lyase over pH range of 3.5-6.0 was determined. Optimal activity was at pH 5.0, but at pH 4.0, the enzyme retained 50 percent of its optimal activity (Figure 2.6). The optimal temperature for hydroxynitrile lyase activity was 30°C, but over 50 percent of activity was observed at temperatures between 4 and 50®C (Figure 2.7). 36 Linamarase Hydroxynitrile ‘280 Lyase 5 10 15 20 25 Fraction Number Figure 2.5. Diagram of Sephacryl S-200 elution profile Linamarase eluted as a pure peak. 37 110 100 - >> 90- > u < 80- c o u 70- o o. 60- 50- 3 4 5 6 7 pH Figure 2.6. Hydroxynitrile lyase activity as a function of pH. The optimum was between 5.0 and 5.5. Reactions were performed in 50 itiM sodium phosphate of the appropriate pH, 11 nM acetone cyanohydrin for 30 minutes at room temperature. Reaction solution (0.75 ml) was added to 50 mM sodium phosphate, pH 4.5, and assayed for cyanide. 38 110 100 - 90- 2 o < 80- c « 70- wu O Q. 60- 50- 0 10 20 30 40 50 60 Temperature (°C) Figure 2.7. Hydroxynitrile lyase activity as a function of temperature. The optimum was 30®C. Reactions were performed in 50 mM sodium phosphate, pH 4.5, 11 pM acetone cyanohydrin. After 30 minutes, 1 ml of reaction solution was added to 50 mM sodium phosphate buffer, pH 4.5, and assayed for cyanide. 39 2.3.4 Purification of Hydroxynitrile Lyase from Whole Leaf Extracts Hydroxynitrile lyase was purified to apparent homogeneity from whole leaves (Table 2.3, Figure 2.8). The additions of high salt (500 mM NaCl), 1 % (w/v) PVP, and 0.05 % (v/v) Tween-20 were essential to recover active enzyme. The use of pH 4.0 sodium phosphate as the extraction buffer denatured most other proteins, but left low pH-stable hydroxynitrile lyase soluble. Other low pH-stable proteins, such as linamarase, were removed by precipitation with 40 percent saturated ammonium sulfate. Hydroxynitrile lyase was left in the supernatant. Not only is this by far the easiest method for attaining purified hydroxynitrile lyase, this procedure yields hydroxynitrile lyase which is twice as active as hydroxynitrile lyase purified by the previously published methods of Hughes et al.(1994) and Wajant et al.(1995) (Table 2.4). 2.3.5 Determination of Native Molecular Weight Hydroxynitrile lyase eluted from the calibrated Sephacryl S-200 column at a volume of 123 mis. This volume represents a native molecular weight of 50.1 kD (Figure 2.9). Since the molecular weight of hydroxynitrile lyase on SDS- PAGE is 29 kD, the native molecular weight represents a dimer. Linamarase eluted at a volume of 96.8 mis. This 40 Total Total Specific Activity Fraction Protein Activity (mmol CN/mg protein/h) (mg) (mmol CN/h) Crude Extract 5.31 3.24 0.61 Ammonium 0.947 10.9 11.5 Sulfate Table 2.3. Purification table of hydroxynitrile lyase from whole leaf extracts. 41 Hydroxynitrile lyase Figure 2.8. SDS-PAGE of hydroxynitrile lyase purification from whole leaf protein extract. Five fag of purified hydroxynitrile lyase was loaded onto the gel. 42 Specific Purification Subunit Native Activity K,. (mM) Method Size Size (mmol CN/mg (kD) (kD) protein/h) Hughes et al., 1994 28.5 92 2.2 119 (trimer) Wajant et al., 1995 30 124 5.5 --- (tetramer) White 29 50.1 11.5 0.925 (dimer) Table 2.4. Comparison of three cassava hydroxynitrile lyase purification procedures from whole leaf extracts. 43 0.8 * HNL 0.6 3 0.4 ■ Standards 0.2 A Linamarase 4.5 5 5.5 log MW Figure 2.9. Determination of hydroxynitrile lyase's native molecular weight by elution from a standardized Sephacryl S- 200 column. Standards were ribonuclease A (13.7 kD), chymotrypsinogen A (25 kD), ovalbumin (43 kD), and bovine serum albumin (67 kD) . Hydroxynitrile lyase and linamarase eluted at 50.1 kD and 138 kD, respectively. 44 represents a molecular weight of 138 kD, a dimer of the 65 kD subunit (Mkpong et al., 1990). The cassava hydroxynitrile lyase native molecular weights reported by Wajant et al. (1995) and Hughes et al. (1994) are 124 and 92 kD, respectively (Table 2.4). These represent tetramer and trimer sizes of the 28.5 kD subunit, respectively. All three determinations support the unpublished results of Carvalho (1981), who detected different quaternary structures as a function of protein and salt concentration. It is not surprising that the native molecular weight using our procedure is the lowest of those reported since we used low protein concentrations euid high salt concentrations, both of which were reported to decrease polymerization (Carvalho, 1981). A homodimer quaternary structure has also been found in the rubber tree hydroxynitrile lyase which has amino acid homology to cassava hydroxynitrile lyase (see below) (Hasslâcher et al., 1996). 2.3.6 Determination of Kinetic Properties Hydroxynitrile lyase assays were performed with different concentrations of acetone cyanohydrin but the same amount of purified hydroxynitrile lyase. The results are shown in the Michaelis-Menten plot (Figure 2.10). Maximum activity was reached at an acetone cyanohydrin concentration of less than 30 mM. The curve remained flat at higher acetone cyanohydrin concentrations, displaying typical 45 500 4 0 0 300 200 100 0 20 40 60 80 120100 Acetone Cyanohydrin (mM) Figure 2.10. Michaelis-Menten plot of hydroxynitrile lyase activity as a function of acetone cyanohydrin concentration, Hydroxynitrile lyase was saturated near 20 mM actone cyanohydrin. Reactions were performed in 50 mM sodium phosphate, pH 5.0, at room temperature. After 7.5 minutes, 10 |Lil was transferred to 20 mis sodium phosphate, pH 4.0, and assayed for cyanide. Each point represents the average of two reactions. 46 Michaelis-Menten kinetics. The Lineweaver-Burk plot (Figure 2.11) was linear representing a Km of 0.925 mM. These results are contrary to those of Hughes et al. (1994). They indicated that hydroxynitrile lyase did not have standcird Michaelis-Menten kinetics eind did not saturate even at 300 mM acetone cyanohydrin, resulting in a Km of 119 mM (Table 2.4). They made the argument that linamarin levels in leaves may be as high as 0.5 mmol/g dry weight and, therefore, a Km of 119 mM is justified, but linamarin is not the substrate of hydroxynitrile lyase. The levels of acetone cyanohydrin are limited by the activity of linamarase and will always be lower than the initial cyanogenic glycoside level. Also, linamarase has a Km near 1 mM (Mkpong et al., 1990), almost identical to our Km value for hydroxynitrile lyase. 2.4 Discussion We purified hydroxynitrile lyase from cassava leaves, maintaining a high specific activity using a simpler 2-step purification procedure. The use of a non-ionic detergent, high salt, PVP, and reductant were necessary to purify active hydroxynitrile lyase from whole leaves. The differences between our determination of hydroxynitrile lyase kinetics and those of Hughes et al. (1994) and Wajant et al. (1995) were probably not due to assay procedure even though there are some differences. We all used the same method of cyanide 47 4.5 - 3.5 IC a H 2.5 i €b > rl 0.5 1 -0.8 -0.6 -0.4 -0.2 0 0.2 0.4 0.6 0.8 1/S (niM Acetone Cyanohydrin) Figure 2.11. Li.ueweaver-Burk plot of hydroxynitrile lyase assays shown in Figure 2.10. The Km value was 925 pM. The R“ value for the line fit was 0.96. 48 determination, however, they used 10 mM acetone cyanohydrin in the reaction while we used 28 mM. As we have shown, the enzyme is not saturated in 10 mM acetone cyanohydrin (see above). Also, Wajant et al. (1995) used pH 5.6 in their reactions. This pH is higher than the enzyme's optimum pH and increases the spontaneous rate of acetone cyanohydrin breakdown which can cause lower activity values. These two differences can not explain the lack of saturation of the enzyme isolated by Hughes et al. (1994) even at 300 mM acetone cyanohydrin. The specific activity of the enzyme purified by Wajant et al. (1995), however, may actually be higher than reported. We characterized the stability and activity of hydroxynitrile lyase in order to determine if it would be active at the conditions present during rural African cassava root processing. Cassava roots ferment quickly becoming acidic in probably less than 24 hours (Tylleskar et al., 1992). The roots sure typically processed at outdoor temperatures which could range from 20-35°C. Hydroxynitrile lyase maintained 50 percent of its optimal activity at pH 4.0 and was not permeuiently inactivated even after 24 hours at pHs 4.0-6.0. Also, it was active over a broad range of temperatures, maintaining over 50 percent of its optimal activity from 4-45“C. These results supported the potential use of increasing hydroxynitrile lyase activity in roots in order to produce safer food products. 49 The almost 10-fold increase in activity of apoplast extracts over whole leaf extracts supports the localization of hydroxynitrile lyase to the apoplast. Hydroxynitrile lyase could not be present in equal amounts in both compairtments or enrichment of activity would not have occurred. Also, since hydroxynitrile lyase only required 10- fold purification from apoplast extracts, it is not only present there but a major component of that space. This compartmentalization of hydroxynitrile lyase in cassava leaves is important for the prevention of cyanogènes is when tissue damage has not occurred. The cyauiogenic glycoside, linamarin, and linamarase are also compartmentalized in cassava leaves (see below). 50 CHAPTER 3 IMMUHOLOCALIZATION OF HZOROXZNITRILE LYASE 3.1 Introduction In order to prevent toxic levels of HCN release in cyanogenic plant tissues, the cyanogenic glycoside(s) are compartmentalized away from the degrading enzymes. In some cyanogenic plants, such as rubber tree, the separation of substrate and enzymes is at a subcelluleir level. Endosperm cells contain linamarin and hydroxynitrile lyase in their cytoplasm, while the glucosidase is located in the apoplast (Poulton, 1990). For others the separation is at a tissue level. In Sorghum bicolor leaves, the cyanogenic glycoside dhurrin is located in vacuoles of epidermal cells. The glucosidase and hydroxynitrile lyase are mainly found in the cytoplasm and plastids of mesophyll cells (Wajant et al., 1994; Poulton, 1990). Since HCN is released only from damaged cyanogenic plants, it is assumed that all the plants use compartmentalization to prevent HCN release. However, aside from the above examples, there are no more plant systems where the cellular and tissue localization of both 51 the degrading enzymes and cyanogenic glycoside have been determined. Localization of the cyanogènesis pathway components differs from plant organ to plant organ. In sorghum, hydroxynitrile lyase is present in leaves and not stems or roots (Wajant et al., 1994). The roots of sorghum do not contain dhurrin and are also incapable of dhurrin synthesis (Halkier and Moller, 1989). In cassava leaves, linamarase has been localized to cell walls (Mkpong et al., 1990), and we found that the enzyme could be purified from cassava leaf apoplast extracts (see above). In addition, Pancoro and Hughes (1992) demonstrated that linamarase is present in laticifers. Linamarin has been localized to the vacuoles of cassava leaves (McMahon and Sayre, 1995). While the tissue localization of linamarase has not been determined in leaves, it is present in the root rind of cassava roots along with its substrate. Both substrate and enzyme decrease in concentration towards the inner root (Kojima et al., 1983). Much less is known about the localization of hydroxynitrile lyase. Using western blot and immunolocalization with fluorescently labeled secondary antibodies, we determined the cellular, tissue (in leaves), and organ specific localization of hydroxynitrile lyase in cassava. 52 3 .2 Methods 3.2.1 Western Blot Cassava leaf, stem, root rind, and root parenchyma tissues were frozen with liquid nitrogen and ground with a mortar and pestle in 100 mM sodium phosphate, pH 7.0, 500 mM NaCl. The solutions were filtered through Miracloth and centrifuged at 100,000 x g for 1 h at 4“C. Supernatants were stored at -20°C. SDS-PAGE and western transfer were performed according to Harlow and Lane (1988) using a semi-dry blotter. Protein samples were loaded onto 12 percent polyacrylamide gels with 6 percent stacking gels (Harlow and Lane, 1988). Protein was transferred to Immobilon-P (Millipore) membrane using a semi-dry blotter at 20 V for 1-2 hours. Western blots were washed in TBS (20 mM Tris-HCl, 500 mM NaCl, pH 7.5) and blocked using 3 % (w/v) gelatin in TBS for 30 minutes. The blots were then washed with 0.5 % (v/v) Tween-20 in TBS and incubated overnight with the primary antibody (1:5,000 dilution) in 1 % (w/v) gelatin, 0.5 % (v/v) Tween-20 in TBS. After washing with 0.5 % (v/v) Tween-20 in TBS, blots were incubated in a 1:3,000 dilution of the secondary antibody, goat anti-mouse IgG cilkaline phosphatase conjugate (Promega) for 1 hour. Hydroxynitrile lyase bands were visualized by adding alkaline phosphate substrate solution, 0.15 mg/ml BCIP, 0.3 mg/ml NBT, 1 mM magnesium chloride, 0.1 M carbonate buffer, pH 9.8. Polyclonal antibodies were raised versus 53 partially purified apoplast hydroxynitrile lyase by the Ohio State University Antibody Center. The hydroxynitrile lyase concentration of the hydroxynitrile lyase standard protein solution was determined using densitometry with BSA standards. 3.2.2 Fluorescent Immunolocalization of Hydroxynitrile Lyase in Leaves Vibratome sections (approximately 100 microns) of cassava leaf were washed in 20 mM Tris, pH 7.5, 500 mM NaCl (TBS) and blocked with 0.5 % (w/v) BSA in TBS for 30 minutes. After washing in TBS, sections were incubated in 1 ml of a 1:100 dilution of hydroxynitrile lyase polyclonal antibodies in 0.05 % (v/v) Tween-20, 1 % (w/v) gelatin in TBS for 1 h. The sections were washed twice for approximately 30 minutes each time with 1 ml TBS and then incubated in the dark with 1 ml of a 1:30 dilution of goat anti-rabbit IgG fluorescein conjugate (Calbiochem) in TBS with 0.5 % (w/v) BSA. After 1 h, sections were washed overnight in TBS to remove unbound antibodies and the sections were mounted onto slides using Mowiol 4-88 (Osbom cind Weber, 1992). Slides were stored at 4®C in the dark until photographed using a ZEISS axiovert 100 microscope. Polyclonal antibodies were raised against purified hydroxynitrile lyase (apparent homogeneity on SDS- PAGE) by the Ohio State University Antibody Center. 54 3.3 Results 3.3.1 Localization and Quantitation of Hydroxynitrile Lyase in Cassava Organs Western blots of cassava leaf, stem, root rind, and root parenchyma total protein support the presence of hydroxynitrile lyase only in the leaves (Figure 3.1). Approximately 4 to 9 percent of the leaf total soluble protein was hydroxynitrile lyase. The level of staining in the leaf lane (L) was between the standard hydroxynitrile lyase amounts present in lanes 5 and 6 (Figure 3.1). The amounts of hydroxynitrile lyase in lanes 5 (1.34 pg) and 6 (2.68 pg) correspond to 4 and 9 percent of the total leaf protein (30 pg), respectively. Stem, root rind, and root parenchyma contained no visible hydroxynitrile lyase. Since the lowest amount of hydroxynitrile lyase standard loaded (Lane 1, Figure 3.1) was 0.084 [xg and it produced ein easily visible band, the most hydroxynitrile lyase which could be present in the stem, root rind, and root parenchyma was less than 0.3 percent of the total protein. 3.3.2 Cellular Localization of Hydroxynitrile Lyase in Cassava Leaves Cassava leaf sections incubated in antibodies raised against hydroxynitrile lyase followed by anti-rabbit IgG conjugated to FITC revealed the cellular location of hydroxynitrile lyase. Hydroxynitrile lyase was found in the 55 L s RR RP 1 2 3 5 6 Figure 3.1. Quantitative immunoblot of hydroxynitrile lyase in cassava leaf (L), stem (S), root rind (RR), and root parenchyma (RP) . Each tissue lane contains 30 ^ig of protein extract. Lanes 1-6 contain known amounts of hydroxynitrile lyase (0.084, 0. 168, 0.336, 0.672, 1.34, and 2.68 \ig, respectively). Hydroxynitrile lyase was not present in detectible levels in stems, root rind, or root parenchyma (much less than 0.3 percent of total protein). 56 cell walls of all cell types, including the parenchyma, mesophyll, and epidermis (Figure 3.2). Control sections did not have FITC staining. Only the red autofluorescence of the chloroplasts was visible. 3.4 Discussion In keeping with the theory that cyanogenic glycosides and their degrading enzymes are compartmentalized, we found that cassava hydroxynitrile lyase is located in the apoplast away from linamarin and its precursor, acetone cyanohydrin, which are located in the vacuole. Hydroxynitrile lyase was present in mesophyll, parenchyma, and epidermal cell walls. Linamcirase has a similar pattern of localization in cassava leaves (Mkpong, unpublished results). The organ specific localization of cassava hydroxynitrile lyase is identical to that found in sorghum and linen {Linum usitatissimum) (Wajant et al., 1994b). The enzymes were only present in leaves and not stems or roots. In sorghum, the whole cyanogènes is pathway is absent from roots, but in cassava roots, linamarin and linamarase are both present (though at much reduced levels compared to leaves). Since cyanogenesis probably mainly functions as an herbivory deterrent, the localization of the pathway in leaves is not surprising. The incomplete pathway is not unique in that some cyanogenic plants contain no hydroxynitrile lyase at all. White clover contains linameirin 57 en 00 B Figure 3.2. Immunolocalization of hydroxynitrile lyase in cassava leaf vibratome sections. (A) control section treated with 1:100 dilution of pre-immune serum; (B) section treated with 1:100 dilution of immune serum. The control section had no FITC labeling, only autofluorescence of chlorophyll (red) in the mesophyll cells (M). The experimental section had labeling in apoplasts throughout the section, including parenchyma (P), epidermal (E), and mesophyll (M) cells. and linamarase ^ but no hydroxynitrile lyase activity has been found, even in leaves (Hughes et al., 1994). Due to the instability of cyanohydrins some plants or organs may rely only on spontaneous decomposition of the cyanohydrin instead of producing a hydroxynitrile lyase. The absence of hydroxynitrile lyase in cassava roots further supports the efficacy of introducing hydroxynitrile lyase into roots in transgenic plants to facilitate cyanogenesis during processing. If it had been present in amounts comparable to linamarase, then the assumption would have to have been that it could not maintain activity under processing conditions. 59 CHAPTER 4 CLONING OF THE CONA FOR CASSAVA HYDROXYNITRILE LYASE 4.1 Introduction Genes encoding several hydroxynitrile lyases have been cloned recently. These include those of sorghum (Wajant et al., 1994), black cherry (Prunus serotina)(Cheng and Poulton, 1993), rubber tree (Hasslâcher et al., 1996), euid cassava (Hughes et al., 1994). Consistent with its protein cofactor requirement, the flavin-containing black cherry hydroxynitrile lyase had a consensus sequence for FAD-binding near the N-terminus (Cheng and Poulton, 1993). The sorghum clone was homologous to different areas of several serine carboxypeptidases (Wajant et al., 1994). In areas 100-150 bp in length, the sorghum hydroxynitrile lyase had 25-58 percent identity with 11 serine carboxypeptidases. Like most serine carboxypeptidases, two cysteine linked subunits make up the heterotetrameric protein. Also, anti sorghum hydroxynitrile lyase antibodies reacted with serine carboxypeptidase II from wheat. A putative aspartate, histidine, serine catalytic triad was found. In addition. Southern analysis demonstrated a lack of introns in the 60 genomic gene. Since a series of adenines (similar to a poly-A tail) was found in the genomic clone, the evolution of the gene from a reverse transcriptional event is supported. The rubber tree cDNA clone (Hasslacher et al., 1996) had a derived amino acid sequence 35 percent identical to two rice pathogen induced proteins which have a lipase consensus sequence. The rubber tree clone also had putative lipase, serine-carboxypeptidase, and aldehyde dehydrogenase catalytic sequences. When the rubber tree hydroxynitrile lyase cysteine®! was replaced with a serine and expressed in E.coli and yeast, the enzyme lost activity compared to hydroxynitrile lyase expressed without replacement. Also, inhibitors of sulfhydryl groups completely inhibited the enzyme. These results support the role of cysteine®! in the active site of rubber tree hydroxynitrile lyase. Previously, the dissimilar characteristics of the non flavin hydroxynitrile lyases supported independent evolution of each species' enzyme, however, the nucleotide and amino acid sequences of rubber tree and cassava have a high degree of similarity (78 percent amino acid identity) (Hasslacher et al., 1996). Both species are members of the Euphorbiaceae. This supports the evolution of hydroxynitrile lyase from a common eincestor in this group of plants. The proteins are also serologically similar. Antibodies raised to either cassava or rubber tree hydroxynitrile lyase react with both enzymes on western blots (Wajant et al., 1996). 61 Although the cDNA clone of cassava had already been published, we had to isolate a hydroxynitrile lyase clone and sequence it for use in cassava transformation studies. We found that the published sequence had several errors and report here our results and a comparison of the two sequences. We also determined the copy number within the cassava genome and surveyed for the presence of introns. 4. 2 Methods 4.2.1 Screening the cDNA Library A cassava leaf Lambda ZAP cDNA library was screened using a 30-mer oligo corresponding to the N-terminal coding end of hydroxynitrile lyase (Hughes et al., 1994) according to the methods of Ausubel et al. (1994)(Figure 4.1). The phage containing the cDNA library were used to transfect E. coli BB4 cells. Phage (12 ^1) was diluted with 38 pil SM (5.8 g NaCl, 2 g MgS0 4 *7H2 0 , 50 mis 1 M Tris-Cl, pH 7.5, 0.01 % (w/v) gelatin to 1 liter with water) and incubated with 500 (il of BB4 E. coli cells [grown overnight in LB liquid media with 0.2 % (w/v) maltose and 10 mM MgS0 4 ] for 20 minutes at 37°C. Seven mis of 0.7 % (w/v) top agarose (at 45-55°C) was added and the solution was plated onto LB plates. Plaque formation occurred after 4 to 6 hours of incubation at 37°C. After plaques of approximately 0.5-1 mm formed, the plates were stored at 4®C for at least one hour. Afterwaurds, nitrocellulose filters were laid on the plates for 5-10 62 1 TTTTTTTTTTTGA 14 AGAAATGGAGTGATAACTTACATTAATC\CAGAAAATACAACAGACACACaCGA'rTCTAAAAGAGTTAGArATCATTTCGflAA 97 ATG GTA ACT GCA CAT TTT GTT CTG ATT CAT ACC ATT TGC CAT GGT GCA TGG ATT TGG CAT AAG 1 Me: vai zh r ala his phe vai leu ile his thr ile cys his gly ala trp lie trp his iys 160 CTC AAA CCA GCC CTT GAG AGA GCT GGC CAC AAA GTC ACTGCA CTG GAC ATG GCA GCC AGT GGC 22 leu lys pro ala leu glu arg ala gly his iys vai thr ala leu asp tret ala ala ser gly 223 ATT GAC CCA AC-G CAA ATT GAG CAG ATT AAT TCA TTT GAT GAA TAC TCT GAA CCC TTA TTG ACT 43 Lie asp pro arg gin Lie glu gin ile asn ser phe asp glu tyr ser glu pro leu leu thr 286 TTG GAG AAA CCT CAA GGG GAA AAG GTC ATC ATT GTT GGT GAG AGC TCT GCA GGG CTC 64 phe leu glu lys leu pro gin gly glu lys vai ile lie vai gly glu ser cys ala gly leu 349 AAT ATT GCT ATT GCT GCT GAT AGA TAC GTT GAC AAA ATT GCA GCT GGT GTT TTC CAC AAT TCC 85 asn lie ala lie ala ala asp arg tyr vai asp lys ile ala ala gly vai phe his asn ser 412 TTA TTG CCA GAC ACC GTT CAT AGC CCA TCT TAC ACT GTGGAA AAG CTT TTG GAG TCG TTT CCT 106 leu leu pro asp vai his ser pro ser tyr thr vai glu lys leu leu glu ser phe pro 475 GAC TGG AGA GACACA GAG TAT TTT ACG TTC ACT AAT ATC ACT GGA GAG ACA ATT ACA ACA ATG 127 asp z rp arg asp thr glu tyr phe thr phe thr asn ile thr gly glu thr lie thr thr met 538 AAG CTG GGC TTC GTA CTT CTG AGG GAA AAT TTA TTT ACC AAA TGC ACT GAT GGG GAA TAT GAA 146 lys leu gly phe vai leu leu arg glu asn leu phe thr iys cys thr asp gly glu tyr glu 601 CTG GCA AAA ATG GTA ATGAGG AAG GGA TCA CTG TTT CAA AAT GTT TTG GCT CAG AGA CCG Ai\G 169 leu ala lys net vai arg lys gly ser leu phe gin asn vai leu ala gin arg pro lys 664 :TC ACT GAA AAA GGT TAC GGA TCA ATT AAG AAA GTT TAT ATT TGG ACC GAT CAA GAC AAA ATA 190 phe zhz glu lys gly tyr gly ser lie lys lys vai tyr ile trp thr asp gin asp lys lie 727 TTT TTA CCA GAC TTT CAA CGC TGG CAA ATA GCA AAC TAC AAA CCA GAC AAG GTT TAT CAG GTT ::i phe leu pro asp phe gin arg trp gin ile ala asn tyr lys pro asp lys vai tyr gin vai "90 CAA GGT GGA GAT CAT AAG CTC CAG CTT ACA AAA ACT GAG GAG GTA GCT CAT ATT CTC CAA SAG 232 gin Gly gly asp his lys leu gin leu thr lys thr glu glu vai ala his lie leu gin glu 653 GTG GCT GATGCATAT GCT TGA AGC TTT TAG CTC CTA TTA AGT TAA CCT GGG TGC AGT TAT AAA 253 vai ala asp ala tyr ala stop 916 rAATCTCACATTTTCATGTGAGAATTARATTGCACTAAAATAAAGTTTGAGTTTTTTTTTCrrTAAATATGGGAGAGTTCCAC 999 GTTGGTGTCTCTTCATTTOlTaAGATGTGTGTATTTAAGGGAATGTTATCCCTATTATGTAATCTTTAAATTAAATAAATAAA 1082 TATCTTATTAAC-TGAGTAAAAAAAAAAAAAAJWAAAA Figure 4.1. DNA and derived amino acid sequence of the hydroxynitrile lyase cDNA clone. The six 30-mer oligonucleotides within the sequence are represented by underlines (primer was complemetary to DNA sequence shown) or Overline (primer was identical to sequence shown). The bold line represents the oligonucleotide used to screen the cDNA library. 63 minutes to bind the phage DNA. The filters were dried and then laid on a series of 3MM Whatman filter papers saturated with 0.2 M NaOH, 1.5 M NaCl; 0.4 M Tris-HCl, pH 7.6, 2X SSC (300 mM NaCl, 30 mM sodium citrate, pH 7.0); euid 2X SSC, respectively. The nitrocellulose filters were laid DNA-side up on the soaked filter papers for 1-2 minutes. The nitrocellulose filters were dried overnight at 42®C and stored at room temperature until use. Filters were washed to remove bacterial debris in 3X SSC, 0.1 % (w/v) SDS (3 room temperature washes) followed by a 1.5-14 h wash in the same solution at 65®C. The filters were then prehybridized for 1 h at 37®C in 100 mis prehybridization solution [6X SSC, 5X Denhardt's solution, 0.05 % (w/v) sodium pyrophosphate, 100 (xg sheared calf thymus DNA/ml, 0.5 % SDS]. The filters (10- 20) were sealed in a bag with 32p_iabeled oligonucleotide and 20 mis of hybridization buffer [6X SSC, IX Denhardt's solution, 100 pg sheared calf thymus DNA/ml, 0.05 % (w/v) sodium pyrophosphate]. Denhardt's solution (lOOX) had a 2 % (w/v) of Ficoll, PVP, and BSA. Filters hybridized at 47®C overnight in a shaking water bath. After three 15-minute washes at room temperature in 6X SSC and 0.05 % (w/v) sodium pyrophosphate, the filters were moved to a 65®C water bath for a final 30-minute wash in the same solution. Filters were then taped to a support, covered with Saran Wrap, and exposed to X-ray film to identify positive clones. Positive plaques were collected and stored in SM until used to 64 transfect in a secondary or tertieury screen (Ausubel et al., 1994). The 32p-end-labeling reaction had 190 ng N-terminus oligonucleotide (see Figure 4.2), 5 [xl (8.3 pmol,6000 Ci/mmol. Amers ham ), 2.5 )xl lOX kinase buffer (supplied with enzyme), and 2 ul (20 U) T4 polynucleotide kinase (Gibco BRL). Water was added to give a final volume of 25 [xl. The reaction was performed at 37®C for 1.5-4 h. To remove unbound ATP, the DNA was ethanol precipitated and centrifuged at 13,000 X g for 30 minutes at 4°C. The supernatant was discarded. The pellet was dried down in the speed vacuum and 100 ul of water was added back. In order to quantify the activity of the labeled oligo, 1 ul was counted by liquid scintillation counter. After three successive screens, five independently positive clones were converted from linear to plasmid DNA (packaged in phagemid) with the aid of f1 helper phage and E. coli XL1-Blue (Figure 4.2). Phage containing the positive clones (100 ul), f1 helper phage (1 ul of 1-9 x 10^ plaque forming units), and E. coli XL1-Blue cells (100 ul of overnight culture in LB liquid medium) were incubated at 37°C for 15 minutes with 100 ul of 10 mM MgCl2 , 10 mM CaCl2 . Afterwards, 50 mis of NZC media was added and incubation continued with vigorous shaking from 4.75-8 h when lysis (clearing with debris) occurred (Ausubel et a., 1994). The phagemid was collected by adding a few drops of chloroform 65 C£. T3cDNA T7 Amp*^ Lac Z Lambda Zap with cDNA Insert Lac Z \T7 Amp' cDNA Lac Z T3 pBluescript SK(-) with cDNA insert Figure 4.2. Diagrams of linear phage DNA (above) and the resulting excised plasmid. Locations of the T3 and T7 primers for DNA sequencing, the cimp^ gene for ampicillin resistance, and the interrupted lac Z gene are shown. 66 (to kill remaining bacteria) and centrifuging to remove the debris (11,400 x g for 20 minutes). Supernatants containing phagemid were stored at 4®C. The plasmids were then moved into E. coli XL 1-Blue by transfection with the phagemid. Phagemid (10 p,l undiluted stock) and E. coli XL 1-Blue cells (200 ^il overnight growth in LB liquid medium) were incubated for 15 minutes at 37®C. Transfected cells were selected on LB plates with ampicillin (50 ng/ml). Cells were then screened again for the plasmid containing the cDNA insert by blue/white screening. Cells were selected for white colony formation on LB plates containing 4 mg/ml X-gal and 25 nmol IPTG. If there were no insert in the lac Z gene, a blue color would have been formed from hydrolysis of X-gal (Figure 4.2). 4.2.2 DNA Sequencing and Sequence Analysis Hydroxynitrile lyase clones 2-1 and 2-2 were sequenced using the PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit (Perkin Elmer) with 8 different 30-mer oligonucleotide primers (Figures 4.1 and 4.2). Unbound fluorescent nucleotides were removed from the labeled DNA using Centrisep spin columns (Princeton Separations, Inc.). The full length cDNA sequence was analyzed using the PC Gene program (Intelligenetics). The nucleotide and amino acid sequences were sent to BLAST for homology comparisons (NIH, www.ncbi.nlm.nih.gov/blast). Sequences with expectation 67 thresholds above 10 were viewed for sequence hcxnology. Derived amino acid sequences were analyzed using the Prosite program (www.ebi.ac.uk/searches/prosite_input.html) which can locate over 1000 amino acid consensus sequences for transport, function, etc. 4.2.3 DNA Isolation and Southern Blot DNA was extracted from cassava leaf material according to Dellaporta et al. (1983). Southern blots were performed according to Maniatis et al. (1982). DNA was digested with Bam HI, Hind III, and Eco RI using 1 U/pg DNA. A 1 % (w/v) agarose gel with 10 fig DNA of each digestion run per well was denatured in 1.5 M NaCl, 0.5 N NaOH for 1 hour followed by washing briefly in water. The gel was then soaked in 1 M Tris-Cl pH 8.0 plus 1.5 M NaCl for 1 h. Southern transfer onto Duralon-UV (Stratagene) was set up with lOX SSC and continued 16-24 h (Maniatis et al., 1982). The nylon membrane was baked for 2 hours at 80®C. Prehybridization was performed at 47“C in buffer (6X SSC, 5X Denhardt's, 5 fiM EDTA, 100 fig/ml sheared calf thymus DNA, 1 mg/ml SDS) for at least 2 hours. ^2p_j^adiolabeled cDNA clone (25 ng of the longest clone) was prepared using the Radprime DNA labeling system using the manufacturer's instructions (Gibco BRL). Sixteen pmol [a-32p]dCTP (3000 Ci/mmol, Amersham) was used per reaction. After addition of the labeled probe, the blot hybridized at 47°C overnight. The 68 blot was washed twice in 2X SSC, 0.1 % (w/v) SDS for a total of fifteen minutes at room temperature. The buffer was changed to O.IX SSC, 0.1 % (w/v) SDS and washing continued at 55®C for 2 hours with one change of buffer. After washing, the blot was exposed to X-ray film or a phosphor imager screen for visualization. 4.3 Results 4.3.1 Hydroxynitrile Lyase cONA and Derived Amino Acid Sequence The longest of the two cDNA clones was sequenced in both directions, at least twice. The cDNA clone was 1118 bp long and encoded a 258 amino acid protein having a predicted molecular weight of 29,371 (Figure 4.1, Table 4.1). DNA sequence analysis indicated that both clones had the same derived amino acid sequence. The nucleotide sequence was nearly identical to the cassava hydroxynitrile lyase sequence of Hughes et al. (1994) but less similar to the rubber tree hydroxynitrile lyase gene (Hasslacher et al., 1996). Significemtly, the derived amino acid sequence reported here differed from that of Hughes et al. (1994) by 13 amino acids. Eleven of the amino acid differences occurred in an area where the two nucleotide sequences differ due to a frame shift. After base 519, the Hughes et al. (1994) sequence has a guanidine inserted, and at base 553, the cytosine is missing. Within this region, however, our sequence maintains 69 Amino Number Percent Acid of Total Polar ASN 7 2.71 GLN 12 4.65 CYS 3 1.16 SER 10 3.88 THR 19 7.36 TYR 10 3.88 Non-polar ALA 20 7.75 LEU 24 9.30 GLY 15 5.81 VAL 17 6.59 ILE 8 6.98 MET 5 1.94 PHE 13 5.04 PRO 10 3.88 TRP 5 1.94 Charged ARG 8 3.10 LYS 20 7.75 HIS 9 3.49 ASP 15 5.81 GLU 18 6.98 Table 4.1. The derived amino acid composition of hydroxynitrile lyase. 70 amino acid similarity with the rubber tree sequence while the Hughes sequence does not (Figure 4.3). Of the 13 amino acids of our sequence which are not identical to the Hughes sequence (amino acids 49, 142-149, 151-153, and 198), eight are identical to the rubber tree amino acid sequence. None of those thirteen amino acids in Hughes sequence are identical to the rubber tree sequence. The 13 amino acids in our sequence were mainly uncharged (11 uncharged: 2 charged) while the Hughes sequence had more charged amino acids (8 uncharged: 5 charged). The amino acid sequence also showed similarity to the pathogen induced response proteins pir 7a and pir 7b of rice (Reimann et al., 1995). The sequences are 30 percent identical emd 50 percent similar to cassava hydroxynitrile lyase. In the first 62 amino acids, the sequences are 55 percent identical and 79 percent similar. The pir proteins have a lipase amino acid active site sequence which is not present in the hydroxynitrile lyase sequence. The PROSITE search found no significant similarity for hydroxynitrile lyase to over 1000 amino acid patterns for targeting, function, post translational modification, etc. 4.3.2 Southern Blot The enzymes Bam HI, Eco RI, and Hind III were chosen to digest the cassava genomic DNA. The cassava hydroxynitrile lyase cDNA clone did not contain Bam HI or Eco RI restriction 71 Amino Acid Number 49___ 142-153______^ Manihot esculenta ^ arg gly asp asn tyr asn asn glu ala ___ leu arg ile arg Manihot esculenta ^ gly glu thr ile thr thr met lys leu ___ phe vai leu ile Hevea brasiliensis ^ gly lys glu ile thr gly leu lys leu phe thr leu ile ^ Hughes et al., 1994 ^ White Hasslacher et al., 1996 NJ Figure 4.3. Comparison of two hydroxynitrile lyase clones from cassava and one from rubber tree. Of the thirteen different amino acids between the two cassava clones, eight of the amino acids in our sequence are identical to the rubber tree amino acids (shown in bold). None of the Hughes et al. (1994) amino acids are identical to the rubber tree sequence. sites. The cDNA contained 2 Hind III restriction sites which should produce 3 fragments per genomic copy of the hydroxynitrile lyase gene, including one fragment near 400 bp. Genomic DNA cut with Bam HI or Eco RI had only one fragment which annealed to the cDNA clone ( Figure 4.4). Genomic DNA cut with Hind III had three fragments which annealed to the cDNA probe, however, the fragment sizes were not expected (Figure 4.4). A 400 bp fragment was expected. The fragment may have been present but undetected. Also, the Hind III digestion may have been incomplete. Since the Eco RI lane has only one 7 kb fragment, the most copies of hydroxynitrile lyase which could be present is six. If there were more than one copy, however, there would probably be several more fragments which bound the probe in the Hind III lane. If more than one copy is present, the copies are clustered together and are not more than six in number. 4.4 Discussion We isolated and sequenced a cDNA clone which we feel represents the true cDNA sequence due to our rigorous sequencing procedure. Hughes et al. (1994) do not report the number of oligos used for sequencing or state that they sequenced in both directions. We used eight 30-mer oligos and sequenced in both directions. Also, we sequenced a second clone in one direction. This clone had the same derived amino acid sequence as our first clone. Since our 73 H B E Figure 4.4. Southern blot of cassava genomic DNA probed with hydroxynitrile lyase cDNA clone. Ten fig of Hind III (H), Bam HI (B), and Eco RI (E) digested genomic DNA was loaded per lane. 74 hydroxynitrile lyase cDNA sequences had greater similarity to the rubber tree hydroxynitrile lyase than that of Hughes et al. (1994), we are confident that our sequence is correct and the differences between the two cassava hydroxynitrile lyase clones is due to human error. The 1118 bp clone encoded a 258 amino acid sequence with a molecular weight of 29,371 which is consistent with the SDS-PAGE determined molecular weight of 29,000. Southern blot probed with 32_p labeled clone supported the existence of one copy of hydroxynitrile lyase in the cassava genome. The isolation of the hydroxynitrile lyase cDNA from cassava was necessary for the future transformation of cassava. Our goal is to express hydroxynitrile lyase in the roots of cassava in order to produce safer food products. 75 CHAPTER 5 EXPRESSION OF HYDROXYNITRILE LYASE 5.1 Introduction To further investigate the localization of hydroxynitrile lyase in cassava organs, we quantitated its expression in leaves, stems, and roots. The only previous study of hydroxynitrile lyase expression in different organs was performed in sorghum where hydroxynitrile lyase mRNA was detected only in leaves, not stems or roots (Wajant et al., 1994). As mentioned above, the hydroxynitrile lyase amino acid sequence was homologous to two pathogen induced genes in rice. The rice pir 7b gene is induced during pathogen attack by Pseudomonas syringae pv. syringae (Reimann et al., 1995). Unlike other pir genes, it was not induced by other pathovars of P. syringae or chemical inducers, suggesting that pir 7b is specific for P. syringae pv. syringae infection. Although cyanogènesis has been attributed to defense against herbivores and pathogens, there has never been a study monitoring the mRNA levels of any cyanogenic glycoside synthesizing or degrading enzyme during pathogen or herbivore 76 attack. Phytophthora parasitica, a fungal cassava root pathogen (Florida Department of Agronomy), was used to determine if the hydroxynitrile lyase expression in roots increased during pathogen attack. P. parasitica is closely related to P. sojae, a pathogen of soybean. During a P. sojae attack on soybeans, a glucan elicitor from the P. sojae cell walls is released which increases the production of glyceollin, a phytoalexin, in soybean (Graham and Graham, 1996). We tested the ability of both P. parasitica infection and the cell wall glucan elicitor to induce hydroxynitrile lyase in cassava roots. 5.2 Methods 5.2.1 RHA Isolation and Northern Blot Total RNA was extracted from leaves, stems, and roots of sterile plants grown in liquid MS media supported by the LifeRaft system (Gibco BRL) (Lin et al., 1995) using Trizol Reagent (Gibco BRL). Due to low RNA yields using the regular Trizol protocol, the manufacturer's modifications for proteoglycan and polysaccharide contamination were followed. The growth of plants in liquid medium was necessary for successful extraction of root RNA. The conditions for plant growth were as in Arias-Garzon and Sayre (1993). RNase-free solutions and equipment were prepared using 0.05 percent (v/v) DEPC water and RNaseZap ( Invitrogen ). Denaturing RNA (2.2 M formaldehyde) gels were performed according to Farrell 77 (1993). RNA samples were dissolved in IX MOPS buffer, 2.2 M formaldehyde, 50 % (v/v) formamide at 55®C for 15 minutes before loading. RNA was transferred onto Duralon-UV (Stratagene) for 16-24 h before baking at 80®C for 2 h. The ^2p_iabeled hydroxynitrile lyase cDNA clone probe was prepared as for Southern blot ( see Chapter 4 ). Prehybridization and hybridization were performed at 47®C in 5X SSPE, 0.01 % (w/v) sheared calf thymus DNA, 1 % (w/v) SDS and lOX Denhardt's solution. Blots were washed at room temperature in 2X SSPE, 0.1 % SDS followed by 2 hours in O.IX SSPE, 0.1 % (w/v) SDS at 55°C. Radioactively labeled bands were quantified using a phosphorimager and Imagequant (Molecular Dynamics). 5.2.2 Preparation and Application of Phytopbtbera parasitica and Cell Wall Glucan Elicitor Phytophthera parasitica was provided by Fritz Schmittenner (Department of Plant Pathology, Ohio State University). It was subcultured on 0.5X lima bean media (Graham et al., 1990). After a petri dish was covered with mycelial growth (approximately 7 days), approximately 1 inch of the plate was cut into small sections and the material was pushed through an 18 gauge syringe needle to produce small pieces of mycelia in agar. Cassava roots rested on absorbent paper covered with the mycelial preparation for infection to occur. Infection of roots by P. parasitica caused maceration 78 (water soaking) within 48 hours after inoculation. This symptom corresponds to a compatible response. After inoculation proceeded 24 and 48 hours, experimental and control roots were harvested and frozen at -80°C until total RNA was extracted. Sane root material from each group was used for HPLC analysis as described below. Sterile water was applied to the absorbent paper as needed. Phytophthora sojae cell walls were provided by Dr. Terrence Graham (Department of Plant Pathology, Ohio State University). Cell walls were digested with lyticase (P-1,3- glucanase. Sigma) in 10 mM Tris, pH 7.5 at 1 unit per jig of cell wall. Digestions were at room temperature for 6 hours. Digested cell walls were tested for elicitor activity using soybean cotyledons. Eight-day-old soybean cotyledons were shallowly cut across one side. Digested cell wall and controls were applied to the cut surfaces of the cotyledons, 30 pil per cotyledon, 10 cotyledons per treatment. Lyticase in 10 mM Tris buffer, water, and undigested cell walls were used as controls. After 24 hours, the cotyledons were scored for pterocarpan production, a visible red pigment which is a precursor of the phytoalexin glyceollin, on a scale of 0 to 6 . Zero meant no red color on the cut cotyledon surfaces and 6 meant a dark, blood-like color on surfaces (Dr. Terrence Graham, Department of Plant Pathology, Ohio State University, personal communication). After 48 hours, each cotyledon was punctured with a number 1 cork borer through the application 79 area. The plugs were divided into the SI tissue (the approximately 1 mm next to the application surface) and the 82 tissue (all remaining tissue) using razor blades. Tissues were stored at -20®C until ground with 400 ul 80 % ethanol. The samples were centrifuged for 10 min at 13,000 x g at room temperature before 20 jil was loaded onto the HPLC column. Compounds were run over a Lichrosorb RP-18 hydrophobic column (250 X 4.6 mm. Alltech) for 29 minutes using a 100 percent acetonitrile to 100 percent water gradient at 1.5 mis/min. The amounts of glyceollin, daidzein conjugates, and genistein conjugates were determined by comparing peak sizes at 240 nm to those of standards. Compounds were identified based on retention time (minutes). After determining that the digested elicitor produced a response similar to cell walls digested with the soybean native enzyme (i.e. increased glyceollin production), it was applied to cassava roots. Roots were cut from sterile plants and grown in 20 mis MS liquid media with 15 j,ig/ml elicitor or control buffer. After 24 and 72 hours roots were harvested and frozen at -80°C until total RNA was extracted. The 24 and 72 hour control roots and the 24 and 72 hour experimental roots were pooled for RNA extraction. Some roots were removed from all samples for HPLC analysis. Northern blots were performed as described above. 80 5.3 RESULTS 5.3.1 Localization of Hydroxynitrile Lyase Expression in Cassava Radiolabeled hydroxynitrile lyase cDNA. clone (1.1 kb) hybridized to a 1.3 kb mRNA band on northern blots (Figure 5.1). This size is approximately 500 bases larger than the coding region and 200 bases larger than the cDNA clone. The transcript was found mainly in cassava leaves, although detectable amounts from stems and roots were seen on some blots. The amounts found in stems and roots were at most 2 and 6 percent of the leaf expression, respectively. 5.3.2 Hydroxynitrile Lyase Expression in Roots Infected with P. parasitica or Elicited with Cell Wall Glucan Northern blots of total RNA (30 jig/lane) from glucan elicited and P. parasitica infected cassava roots probed with ^^P-labeled cDNA clone gave no evidence of hydroxynitrile lyase induction (data not shown). Hydroxynitrile lyase mRNA was not detectable in glucan elicited or infected control or experimental lanes, but was detected in lanes containing RNA from healthy (unmanipulated) plants. RNA from control and experimental glucan elicited and infected roots was degraded. On a 1 percent agarose gel, there were no bands as in RNA extracted from unmanipulated plants. The 260/280 nm absorbance ratios for the samples were 1.3-1.4. The ratio 81 1.3 kb Figure 5.1. Northern blot of total RNA extracted from cassava leaf (L, 50.6 (ig), stem (S, 50.4 (ig) , and root (R, 34 pg) probed with hydroxynitrile lyase cDNA clone. The message was approximately 1.3 kb. The expression, standardized based on amounts of RNA loaded, in stems and roots was 2 percent and 6 percent of that in leaves, respectively. 82 from healthy root RNA is usually 1.8-1.9. Since the RNA was not suitable for detection of hydroxynitrile lyase expressionr no conclusions can be made concerning hydroxynitrile lyase induction. In future, stem induction would be easier to study since high quality RNA is easier to obtain. Also, a non-fungal pathogen may be used since many fungi contain cyanide hydratase which detoxifies HCN (Osbourn, 1996). 5.4 Discussion Northern blots demonstrated the existence of hydroxynitrile lyase mRNA only in the leaves. Expression of the 1.3 kb message was minimal in roots and stems. The mRNA size was similar to that of the rubber tree hydroxynitrile lyase, further supporting their similarity and common ancestry. The low levels of hydroxynitrile lyase mRNA found in cassava roots indicate that hydroxynitrile lyase probably does not accumulate to high levels in roots. This result is important for our plans to transform cassava by increasing hydroxynitrile lyase in the roots. Replacing the hydroxynitrile lyase promoter with one which is constitutively expressed should increase hydroxynitrile lyase activity in roots. 83 CHAPTER 6 SUMMARY Tke. hydroxynitrile lyase cDNA clone from cassava was isolated for the transformation of cassava. It is our hope to express hydroxynitrile lyase in the roots of cassava in order to produce safer food products. The presence of hydroxynitrile lyase in root cell walls should increase the degradation of acetone cyanohydrin during root processing. From our characterization of hydroxynitrile lyase, we can predict that it will be active at the low pHs and temperatures present during processing. Cassava was regenerated successfully by Stamp and Henshaw (1982), and recently two transformation procedures have been described (Li et al., 1996; Schôpke et al., 1996). Both methods use Agrobacterium-mediated transfer of a TDNA to the cassava tissues. These studies have made genetic engineering of cassava possible, and efforts to improve cassava's resistance to African cassava mosaic virus and starch quality have begun. Diana Arias (Department of Plant Biology, Ohio State University) is presently using a modification of the two 84 transformation procedures to express hydroxynitrile lyase in cassava roots. She has inserted our hydroxynitrile lyase clone in a TDNA behind a double 358 promoter. The promoter should express hydroxynitrile lyase in all tissues, including roots. This strategy should not interfere with other necessary or useful pathways in cassava. Since hydroxynitrile lyase should be localized to the apoplast, no HCN should be released until tissue damage. Transport of cyanogenic glycosides in cassava should not be affected by increased hydroxynitrile lyase in the apoplast. Linamarin is probably glycosylated to form linustatin which is then transported to other areas of the plant (Selmar, 1994). Linustatin can not be degraded by the linamarase or hydroxynitrile lyase present in the cell wall; therefore, no HCN should be released. Protection from herbivores which are deterred by cyanogenic glycosides could actually increase due to the predicted increased rate of HCN release. There is a possibility of increased susceptibility to pathogens which are sensitive to scopoletin. HCN interferes with scopoletin synthesis (Osbourn, 1996). Due to its volatility emd the presence of p-cyanoalanine synthase, HCN should only be present temporarily after tissue damage. The synthesis of scopoletin would only be affected during that period of time and may not significantly decrease the pool of scopoletin available for protection. 85 After cassava transformants with hydroxynitrile lyase expression in roots are found, field trials will be performed to determine the usefulness of this strategy. An increased rate of HCN production during root processing should lead to a decrease in the cyanogen content of cassava food products. For African rural communities, that could mean a decrease in neurological disorders caused by cyanide exposure. 86 LIST OF REFERENCES Arias-Garzon, D. I., and Sayre, R. T. (1993). Tissue specific inhibition of transient gene expression in cassava {Manihot esculenta Crantz). Plant Science 93, 121-130. Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J., Struhl, K., Albright, L., Coen, D., Varki, A., and Janssen, K, eds (1994) Current Protocols in Molecular Biology, volume I. (USA: John Wiley & Sons, Inc.). Bradford, M. (1976) A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. Belloti, A. and Arias, B. (1993) The possible role of HCN on the biology and feeding behavior of the cassava burrowing bug {Cyrtomenus bergi Froeschner). In: Roca, W. and Thro, A., eds. Proceedings of the first international scientific meeting of the Cassava Biotechnology Network, Cartegena, Colombia, 25-28 August 1992. Cali, Colombia: Centro Intemacional de Agriculture Tropical, 406-409. Bemays, E., Chapman, E., Leather, A., and McCaffery, W. (1977) The relationship of Zonocerus variegatus (L.) (Acridoidea: Pyrgomorphidae) with cassava (Manihot esculenta). Bull. ent. Res. 67, 391-404. Carvalho, J. (1981) Studies on the aliphatic ketone cyanohydrin hydroxynitrile lyase from Manihot esculenta Crantz. Ph.D. Thesis, University of California, Davis, California, USA. Centro Intemacional de Agriculture Tropical (1996) Cassava: the latest facts about an ancient crop. (CIAT, Cali, Columbia). 87 Cheng, I-P., and Poulton, J. (1993) Cloning of cDNA of Prunus serotlna (R)-(+)-mandelonitrile lyase and identification of a putative FAD-binding site. Plant Cell Physiol. 34(7),1139-1143. Conn, E. (1994) Cyanogènesis-a personal perspective. Acta Horticulturae 375, 31-43. Cooke, R., and Coursey, D. (1981) Cassava: A major cyanide- containing food crop. In B. Vennesland, E. Conn, C. Knowles, J. Westley, and F. Wissing (Eds.), Cyanide in Biology, (pp. 93-114). London: Academic Press. Dellaporta, S. L., Wood, J., and Hicks, J. B. (1983). A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1, 19-21. Essers, A., Alsen, P., and Rosling, H. (1992) Insufficient processing of cassava induced acute intoxications and the paralytic disease konzo in a rural area of Mozambique. Ecology of Food and Nutrition 27, 17-27. Essers, A., Witjes, C., Schurink, E., and Nout, M. (1994) Role of fungi in cyanogens removal during solid substrate fermentation of cassava. Biotechnology Letters 16, 755-758. Farrell, Jr., R. (1993) RNA Methodologies : A Laboratory Guide for Isolation and Characterization. (San Diego: Academic Press). Florida Department of Agronomy (1984) Index of Plant Diseases in Florida, Bulletin 11. Graham, T., eind Graham, M. (1996) Signaling in soybean phenylpropenoid responses. Plant Physiology 110, 1123- 1133. Greiham, T., Kim, J., and Graham, M. (1990) Role of constitutive isoflavone conjugates in the accumulation of glyceollin in soybean infected with Phytophthora megasperma. Molecular Plant-microbe Interactions 3, 157- 166. Griffith, M., Ala, P., Yeing, D., Hon, W-C., and Moffatt, B. (1992) Antifreeze protein produced endogenously in winter rye leaves. Plant Physiology 100, 593-596. Harlow, E. and Lane, D. (1988) Antibodies : A Laboratory Manual. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory). 88 Halkier, B., Lykkesfeldt, J., and Holier, B. (1991) 2-Nitxo- 3-(p-hydroxyphenyl)propionate and aci-l-nitro-2-(p- hydroxyphenyl)ethane, two intermediates in the biosynthesis of the cyanogenic glucoside dhurrin in Sorghim bicolor (L.) Moench. Proc. Natl. Acad. Soi. USA 88, 487-491. Hasslâcher, M., Schall, M., Hayn, M., Griengl, H., Kohlwein, S., and Schwab, H. (1996) Molecular cloning of the full-length cDNA of (S)-hydroxynitrile lyase from Hevea brasiliensis. Journal of Biological Chemistry 271, 5884-5891. Henry, G., and Gottret, V. (1996) Global cassava trends: reassessing the crop's future. (Cali, Colombia: Centro Intemacional de Agriculture Tropical ). Hughes, J., Carvalho, F., and Hughes, M. (1994) Purification, characterization, and cloning of a- hydroxynitrile lyase from cassava (Manihot esculenta Crantz). Archives of Biochemistry and Biophysics 311, 496-502. Koch, B., Nielsen, V., Halkier, B., Olsen, C., cind Holler, B. (1992) The biosynthesis of cyanogenic glucosides in seedlings of cassava (Manihot esculenta Crantz). Archives of Biochemistry and Biophysics 292, 141-150. Kojima, M., Iwatsuki, N., Data, E., Villegas, C., and Uritani, I. (1983) Changes of cyanide content and linamarase activity in wounded cassava roots. Plant Physiology 72, 186-189. Kuroki, G., and Conn, E. (1989) Heuidelonitrile lyase from Ximenia americana L. : Stereospecificity and lack of flavin prosthetic group. Proceedings of the National Academy of Science USA 86, 6978-6981. Lance, C., Chauveau, H., and Dizengremel, P. (1985) The cyanide-resistant pathway. In: Douce, R., and Day, D., eds. Encyclopedia of plant physiology, volume 18 (Springer-Verlag, Berlin) 202-247. Li, H-Q., Sautter, C., Potrykus, I., and Puonti-Kaerlas, J. (1996) Genetic transformation of cassava (Manihot esculenta Crantz). Nature Biotechnology 14, 736-740. Lin, J., Fike, R., and Assad-Garcia, N. (1995). Improved regeneration of plant tissues: a novel medium format and membrane-based liquid culture system. Focus 17, 95- 97. 89 McMahon, J., White, W., and Sayre, R. (1995) Cyanogènes is in cassava (Manihot esculenta Crantz). Journal of Experimental Botany 46, 731-741. Maniatis, T., Fritsch, E. P., and Sambrook, J., eds (1982). Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor, NY: Cold Spring Heirbor Laboratory). Mederacke, H., Biehl, B., and Selmar, D. (1996) Characterization of two cyano glucosyltransferases from cassava leaves. Phytochemistry 42, 1517-1522. Miller, J., and Conn, E. (1980) Metabolism of hydrogen cyeinide by higher plants. Plant Physiology 65, 1199- 1202. Mkpong, 0., Yan, H., Chism, G., and Sayre, R. (1990) Purification, characterization and localization of linamarase in cassava. Plant Physiology 93, 176-181. Mlingi, N., Poulter, N., and Rosling, H. (1992) An outbreak of acute intoxications from consumption of insufficiently processed cassava in Tanzania. Nutrition Research 12, 677-687. Nambisan, B., and Sundaresan, S. (1985) Effect of processing on the cyanoglucoside content of cassava. J. Sci. Food Agric. 36, 1197-1203. Narstedt, A. (1985) Cyanogenic compounds as protecting agents for organisms. Plant Systematics and Evolution 150, 35-47. Nartey, F. (1969) Studies on cassava, Manihot utilissima. II. Biosynthesis of asparagine- ^C from ^^C-labeled hydrogen cyanide and its relations with cyanogènesis. Physiologia Plantarum 22, 1085-1096. Norman, M., Pearson, C., and Searle, P. (1995) The ecology of tropical food crops, 2nd ed. (Cambridge University Press, Great Britain). Osbom, M . , and Weber, K. (1992) Immunofluorescence cuid immunocytochemical procedures with affinity purified antibodies : tubulin-containing structures. In: Methods in Cell Biology 24, 97-132. Osbourn, A. (1996) Preformed antimicrobial compounds and plcint defense against fungal attack. The Plant Cell 8, 1821-1831. 90 Osuntokun, B. (1981) Cassava diet, chronic cyanide intoxication and neuropathy in the Nigerian Africans. Wld. Rev. Nutr. Diet. 36, 141-173. Pancoro, A., and Hughes, M. (1992) In-situ localization of cyanogenic P-glucosidase (linamarase) gene expression in leaves of cassava {Manihot esculenta Crantz) using non-isotopic riboprobes. The Plcuit Journal 2, 821-827. Poulton, J. (1990) Cyanogènesis in plants. Plant Physiology 94, 401-405. Reimann, C., Hofmann, C., Mauch, F., and Dudler, R. (1995) Characterization of a rice gene induced by Pseudomonas syringe pv. syringe: requirement for the bacterial lemA gene function. Physiological and Molecular Plant Pathology 46, 71-81. Rosling, H. (1993a) Cyanide exposure from linseed. Lancet 341, 177. Rosling, H., Mlingi, N., Tylleskar, T., and Banea, M. (1993b) Causal mechanisms behind human diseases induced by cyanide exposure from cassava. In: Roca, W. and Thro, A., eds. Proceedings of the first international scientific meeting of the Cassava Biotechnology Network, Ceirtegena, Colombia, 25-28 August 1992. Cali, Colombia: Centro Intemacional de Agriculture Tropical, 366-375. Schopke, C., Taylor, N., Cârcamo, R., Konan, N. Marmey, P., Henshaw, G., Beachy, R., Fauquet, C. (1996) Regeneration of transgenic cassava plants {Manihot esculenta Crantz) from microbombarded embryogénie suspension cultures. Nature Biotechnology 14, 731-735. Selmar, D., Lieberei, R., Biehl, B., and Conn, E. (1989) a- Hydroxynitrile lyase in Hevea brasiliensis and its significance for rapid cyanogènesis. Physiologia Plantarum 75, 97-101. Selmar, D. (1994) Translocation of cyanogenic glucosides in cassava. Acta Horticulturae 375, 61-67. Sibbesen, O., Koch, B., Halkier, B., and Mcller, B. (1994) Isolation of the heme-thiolate enzyme cytochrome P-450tyr, which catalyzes the committed step in the biosynthesis of the cyanogenic glucoside dhurrin in Sorghum bicolor (L.) Moench. Proc. Natl. Acad. Sci. USA 91, 9740-9744. 91 stamp,J. and Henshaw, G. (1982) Somatic embryogenesis in cassava. Z. Pflanzenphysiol. Bd. 105, 183-187. Stryer, L. (1988) Biochemistry, 3rd. ed. (W.H. Freeman and Company, New York) pp. 405-413. Terry, M., and Bonner, B. (1980) An examination of centrifugation as a method of extracting extracellular solution from peas, and its use for the study of indoleacetic acid-induced growth. Plant Physiology 66, 321-325. Thai Tapioca Development Institute, The (1996) Thai tapioca (Department of Commerce, Royal Thai Government, Thailcuid). Tylleskar, T., Cooke, R., Banea, M., Poulter, N., Bikangi, N., and Rosling, H. (1992) Cassava cyanogens and konzo, an upper motoneuron disease found in Africa. Lancet 339, 208-211. Wajant, H. and Forster, S. (1996) Purification and characterization of hydroxynitrile lyase from Hevea brasiliensis. Plant Science 115, 25-31. Wajant, H., Forster, S., Bottinger, H., Effenberger, F., and Pfizenmaier, K. (1995) Acetone cyanohydrin lyase from Manihot esculenta (cassava) is serologically distinct from other hydroxynitrile lyases. Plcint Science 108, 1- 11. Wajant, H. and Mundry, K-W. (1993) Hydroxynitrile lyase from Sorghum bicolori a glycoprotein heterodimer. Plant Science 89, 127-133. Wajant, H., Mundry, K-W., and Pfizenmaier, K. (1994a) Molecular cloning of hydroxynitrile lyase from Sorghum bicolor (L.) Homologies to serine carboxypeptidases. Plant Molecular Biology 26, 735-746. Wajant, H., Riedel, D., Bent, S., and Mundry, K-W. (1994b) Immunocytological localization of hydroxynitrile lyases from Sorghum bicolor L. emd Linum usitatissimum L. Plant Science 103, 145-154. Wu, H-C. and Poulton, J. (1991) Immunocytochemical localization of mandelonitrile lyase in mature black cherry {Prunus serotina Ehrh.) seeds. Plant Phys. 96, 1329-1337. 92 Xu, L-L., Singh, B., and Conn, E. (1986) Purification and characterization of mandelonitrile lyase from Prunus lyonii. Archives of Biochemistry and Biophysics 250, 322-328. Xu, L-L., Singh, B., and Conn, E. (1988) Purification and characterization of acetone cyanohydrin lyase from Linum usitatissimum. Archives of Biochemistry and Biophysics 263, 256-263. Yemm, R. and Poulton, J. (1986) Isolation and characterization of mandelonitrile lyase from mature black cherry {Prunus serotina) seeds. Archives of Biochemistry and Biophysics 247, 440-445. Yip, W-K. and Yang, S. (1988) Cyanide metabolism in relation to ethylene production in plant tissues. Plant Physiology 88, 473-476. 93