DOCSLIB.ORG

Depletion of Phosphatidylinositol 4-Phosphate at the Golgi Translocates K-Ras to Mitochondria Taylor E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Depletion of Phosphatidylinositol 4-Phosphate at the Golgi Translocates K-Ras to Mitochondria Taylor E © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs231886. doi:10.1242/jcs.231886 RESEARCH ARTICLE Depletion of phosphatidylinositol 4-phosphate at the Golgi translocates K-Ras to mitochondria Taylor E. Miller1, Karen M. Henkels1, Mary Huddleston2, Richard Salisbury2, Saber M. Hussain2, Atsuo T. Sasaki3 and Kwang-Jin Cho1,* ABSTRACT CAAX endopeptidase 1 (RCE1) then removes the AAX tripeptide, Ras proteins are small GTPases localized to the plasma membrane followed by the methylation of the now C-terminal prenylated Cys (PM), which regulate cellular proliferation, apoptosis and differentiation. by isoprenylcysteine carboxyl methyltransferase (ICMT) (Clarke After a series of post-translational modifications, H-Ras and N-Ras et al., 1988; Gutierrez et al., 1989). N-Ras, H-Ras and K-Ras4A, the traffic to the PM from the Golgi via the classical exocytic pathway, alternative K-Ras splicing variant, are further modified with the but the exact mechanism of K-Ras trafficking to the PM from the ER is addition of palmitic acids on one or two other Cys residues located not fully characterized. ATP5G1 (also known as ATP5MC1) is one in the HVR (Hancock et al., 1989), allowing Ras to interact with and localize to the PM. K-Ras4B (hereafter, K-Ras) is unique in that it of the three proteins that comprise subunit c of the F0 complex of the mitochondrial ATP synthase. In this study, we show that has a single farnesyl chain preceded by a polybasic domain of six overexpression of the mitochondrial targeting sequence of ATP5G1 Lys residues (Hancock et al., 1990). The strong positive charge of perturbs glucose metabolism, inhibits oncogenic K-Ras signaling, and this polybasic domain allows K-Ras to interact with anionic redistributes phosphatidylserine (PtdSer) to mitochondria and other phospholipids in the PM through electrostatic interaction. Depletion endomembranes, resulting in K-Ras translocation to mitochondria. of phosphatidylserine (PtdSer) from the inner PM leaflet or acute 2+ Also, it depletes phosphatidylinositol 4-phosphate (PI4P) at the Golgi. neutralization of PM electrostatic potential by Ca influx results in Glucose supplementation restores PtdSer and K-Ras PM localization rapid dissociation of K-Ras from the PM (Cho et al., 2016, 2012; – and PI4P at the Golgi. We further show that inhibition of the Golgi- Yeung et al., 2008). Furthermore, K-Ras PM interaction can be localized PI4-kinases (PI4Ks) translocates K-Ras, and PtdSer to regulated through K-Ras phosphorylation, with phosphorylation at mitochondria and endomembranes, respectively. We conclude that residue Ser181 by protein kinase C or protein kinase G causing PI4P at the Golgi regulates the PM localization of PtdSer and K-Ras. mislocalization of K-Ras from the PM to endomembranes, including mitochondria (Bivona et al., 2006; Cho et al., 2016). This article has an associated First Person interview with the first author Both H-Ras and N-Ras are palmitoylated at the Golgi by a of the paper. palmitoylacyltransferase (Swarthout et al., 2005), where they are trafficked to the PM through the classical secretory pathway KEY WORDS: K-Ras, Phosphatidylserine, Phosphatidylinositol (Apolloni et al., 2000; Choy et al., 1999). H-Ras and N-Ras proteins 4-phosphate, Phosphatidylinositol 4-kinase, Golgi, Mitochondria undergo a cycle of palmitoylation and depalmitoylation, which allows them to cycle between endomembrane and PM (Lin and INTRODUCTION Conibear, 2015; Rocks et al., 2010, 2005). While the mechanism for Ras proteins are small GTPases that operate like molecular switches K-Ras trafficking from the ER to the PM is not fully elucidated, for cell proliferation, migration and apoptosis (Hancock, 2003). previous studies have implicated microtubules and possibly The three ubiquitously expressed Ras isoforms in mammalian mitochondria as having a role (Chen et al., 2000; Thissen et al., cells, K-Ras, N-Ras and H-Ras, are highly homologous in sequence 1997; Wang and Deschenes, 2006). K-Ras PM maintenance except for the C-terminal 20 amino acid residues, called the requires the chaperone protein phosphodiesterase δ (PDEδ, also hypervariable region (HVR). Post-translational modifications occur known as PDE6D). Cytosolic PDEδ binds K-Ras endocytosed from at the HVR and are important for Ras trafficking to and interacting the PM and releases K-Ras to perinuclear membranes in an Arl2- with the plasma membrane (PM), where the Ras family activates dependent manner. K-Ras then electrostatically interacts with the its downstream effectors (Hancock et al., 1989, 1990). Newly recycling endosome (RE) and returns to the PM (Chandra et al., synthesized Ras proteins are prenylated by farnesyltransferase 2012; Schmick et al., 2014). (FTase), which allows Ras to attach to the cytosolic leaflet of the ER Mitochondrial ATP synthase is a multimeric protein consisting of (Gutierrez et al., 1989; Hancock et al., 1989). RAS converting two linked complexes, F0 and F1 (Jonckheere et al., 2012). Each ATP synthase molecule is anchored to the inner mitochondrial membrane through the F0 complex, with the catalytic F1 core 1Department of Biochemistry and Molecular Biology, Boonshoft School of Medicine, Wright State University, OH 45435, USA. 2Human Signatures Branch, extending out into the mitochondrial matrix (Jonckheere et al., Human-Centered ISR Division, Airman Systems Directorate, 711 Human 2012). Protons from the intermembrane space funnel through the Performance Wing, Air Force Research Laboratory, Wright Patterson Air Force proton channel of the F complex, which causes the c-subunit Base, OH 45433, USA. 3Division of Hematology and Oncology, Department of 0 Internal Medicine, University of Cincinnati, Cincinnati, OH 45267, USA. oligomer ring to rotate. This rotation confers conformational changes to the structure of F1 that results in the conversion of *Author for correspondence ([email protected]) ADP+Pi to ATP (Boyer, 2000). In mammals, subunit c is encoded K.-J.C., 0000-0002-2234-9292 by three different genes (ATP5MC1, ATP5MC2, ATP5MC3) yielding three protein isoforms, which differ only in their Received 13 March 2019; Accepted 12 July 2019 mitochondrial targeting peptide sequences (Dyer et al., 1989; Journal of Cell Science 1 RESEARCH ARTICLE Journal of Cell Science (2019) 132, jcs231886. doi:10.1242/jcs.231886 Dyer and Walker, 1993; Yan et al., 1994). The mitochondrial whereas the PM localization of K-Ras4AG12V (Cho et al., 2015; targeting sequence of one of these isoforms, ATP5G1 (also known Tsai et al., 2015), and the PM and Golgi localization of mGFP–H- as ATP5MC1), is used as a mitochondrial marker (Guy et al., 2002; RasG12V (Roy et al., 2005) were not perturbed (Fig. 1B). K-Ras Vives-Bauza et al., 2010). In this study, we discovered that translocates to mitochondria through PKC-mediated K-Ras overexpression of the mitochondrial targeting sequence of ATP5G1 phosphorylation at Ser181 (Bivona et al., 2006). To test whether translocates K-Ras and PtdSer to mitochondria and endomembranes, K-Ras translocation to mitochondria in cells overexpressing respectively, by mechanisms regulating phosphatidylinositol ATP5G1(1–67) is through phosphorylation of Ser181, we 4-phosphate (PI4P) contents at the Golgi. generated MDCK cells stably co-expressing ATP5G1(1–67)–RFP and a mGFP–K-RasG12V S181A mutant (Bivona et al., 2006; Cho RESULTS et al., 2016). Confocal microscopy shows that K-RasG12V S181A Overexpression of ATP5G1(1–67) translocates K-Ras to is co-localized with ATP5G1(1–67)–RFP, suggesting ATP5G1(1– mitochondria 67)-mediated K-RasG12V translocation to mitochondria is Recently, we identified several classes of compounds that independent of K-Ras phosphorylation. Taken together, Fig. 1 mislocalize K-Ras from the PM to endomembranes (Cho et al., shows that ATP5G1(1–67) overexpression translocates K-Ras from 2016; Cho et al., 2012; Salim et al., 2014a,b, 2015; Tan et al., 2018; the PM to mitochondria through its HVR in an isoform-specific van der Hoeven et al., 2013, 2017). In yeast, deletion of class C VPS manner and it is independent of K-Ras phosphorylation. genes results in mitochondrial defects and an accumulation of Ras2 on mitochondrial membranes (Wang and Deschenes, 2006). ATP5G1(1–67) overexpression perturbs cellular In mammalian cells, K-Ras translocates to mitochondria through phosphatidylserine distribution PKC-mediated phosphorylation at Ser181, inducing Bcl-XL During apoptosis, cardiolipin translocates to the outer mitochondrial (also known as BCL2L1)-dependent apoptosis (Bivona et al., membrane, which changes mitochondrial surface charge and recruits 2006). These studies suggest that mitochondria are involved in proteins with positively charged amino acid residues, including K-Ras K-Ras trafficking and signaling once K-Ras is mislocalized from (Heitetal.,2011).TotestwhetherATP5G1(1–67)-mediated K-Ras the PM. To characterize whether the identified compounds translocation to mitochondria is due to apoptosis, cell lysates of translocate K-Ras to mitochondria, MDCK cells stably expressing MDCK cells stably co-expressing ATP5G1(1–67)–RFP with mGFP– a monomeric GFP (mGFP)-tagged K-RasG12V were infected with K-RasG12V or mGFP–H-RasG12V were immunoblotted to measure lentivirus expressing a mitochondrial marker, RFP-tagged ATP5G1 cleaved caspase-3 and caspase-8 levels. Caspase cleavage is an early (amino acid residues 1–67). ATP5G1 is mitochondrial F0 complex apoptosis event, before phosphatidylserine (PtdSer) externalization subunit C1 in ATP synthase,
Load more

Recommended publications
  • Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG207674 Pi4k2a (BC022127) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Pi4k2a (BC022127) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Pi4k2a Synonyms: MGC37783, Pi4k2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 ORF Nucleotide >MG207674 representing BC022127 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGAGACGAGCCCGCTAGTGTCCCCCGAGCGGGCCCAACCCCCGGAGTACACCTTCCCGTCGGGCT CCGGAGCTCACTTTCCGCAAGTACCGGGGGGCGCGGTCCGCGTGGCGGCGGCGGCCGGCTCCGGCCCGTC ACCGCCGTGCTCGCCCGGCCACGACCGGGAGCGGCAGCCCCTGCTGGACCGGGCCCGGGGCGCGGCGGCG CAGGGCCAGACCCACACGGTGGCGGTGCAGGCCCAGGCCCTGGCCGCCCAGGCGGCCGTGGCGGCGCACG CCGTTCAGACCCACCGCGAGCGGAACGACTTCCCGGAGGACCCCGAGTTCGAGGTGGTGGTGCGGCAGGC CGAGGTTGCCATCGAGTGCAGCATCTATCCCGAGCGCATCTACCAGGGCTCCAGTGGAAGCTACTTCGTC AAGGACTCTCAGGGGAGAATCGTTGCTGTCTTCAAACCCAAGAATGAAGAGCCATATGGGCACCTTAACC CTAAGTGGACCAAGTGGCTGCAGAAGCTATGCTGCCCCTGCTGCTTCGGCCGAGACTGCCTTGTTCTCAA CCAGGGCTATCTCTCAGAGGCAGGGGCTAGCCTGGTGGACCAAAAACTGGAACTCAACATTGTACCACGT
    [Show full text]
  • Mouse Models for Hereditary Spastic Paraplegia Uncover a Role Of
    University of Dundee Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation Khundadze, Mukhran; Ribaudo, Federico; Hussain, Adeela; Stahlberg, Henry; Brocke- Ahmadinejad, Nahal; Franzka, Patricia Published in: Autophagy DOI: 10.1080/15548627.2021.1891848 Publication date: 2021 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Khundadze, M., Ribaudo, F., Hussain, A., Stahlberg, H., Brocke-Ahmadinejad, N., Franzka, P., Varga, R-E., Zarkovic, M., Pungsrinont, T., Kokal, M., Ganley, I. G., Beetz, C., Sylvester, M., & Hübner, C. A. (2021). Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation. Autophagy. https://doi.org/10.1080/15548627.2021.1891848 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches
    [Show full text]
  • Convergent Evolution in the Mechanisms of ACBD3 Recruitment to Picornavirus Replication Sites
    RESEARCH ARTICLE Convergent evolution in the mechanisms of ACBD3 recruitment to picornavirus replication sites 1 2 3 1 Vladimira Horova , Heyrhyoung LyooID , Bartosz Ro życkiID , Dominika Chalupska , 1 1 2¤ Miroslav Smola , Jana Humpolickova , Jeroen R. P. M. StratingID , Frank J. M. van 2 1 1 Kuppeveld *, Evzen Boura *, Martin KlimaID * 1 Institute of Organic Chemistry and Biochemistry, Czech Academy of Sciences, Prague, Czech Republic, 2 Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands, 3 Institute of Physics, Polish a1111111111 Academy of Sciences, Warsaw, Poland a1111111111 a1111111111 ¤ Current address: Viroclinics Biosciences, Rotterdam, The Netherlands a1111111111 * [email protected] (FJMvK); [email protected] (EB); [email protected] (MK) a1111111111 Abstract Enteroviruses, members of the family of picornaviruses, are the most common viral infec- OPEN ACCESS tious agents in humans causing a broad spectrum of diseases ranging from mild respiratory Citation: Horova V, Lyoo H, RoÂżycki B, Chalupska illnesses to life-threatening infections. To efficiently replicate within the host cell, enterovi- D, Smola M, Humpolickova J, et al. (2019) Convergent evolution in the mechanisms of ACBD3 ruses hijack several host factors, such as ACBD3. ACBD3 facilitates replication of various recruitment to picornavirus replication sites. PLoS enterovirus species, however, structural determinants of ACBD3 recruitment to the viral rep- Pathog 15(8): e1007962. https://doi.org/10.1371/ lication sites are poorly understood. Here, we present a structural characterization of the journal.ppat.1007962 interaction between ACBD3 and the non-structural 3A proteins of four representative Editor: George A. Belov, University of Maryland, enteroviruses (poliovirus, enterovirus A71, enterovirus D68, and rhinovirus B14).
    [Show full text]
  • Download Tool
    by Submitted in partial satisfaction of the requirements for degree of in in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________ Chair ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Adolfo Cuesta ii Acknowledgements For me, completing a doctoral dissertation was a huge undertaking that was only possible with the support of many people along the way. First, I would like to thank my PhD advisor, Jack Taunton. He always gave me the space to pursue my own ideas and interests, while providing thoughtful guidance. Nearly every aspect of this project required a technique that was completely new to me. He trusted that I was up to the challenge, supported me throughout, helped me find outside resources when necessary. I remain impressed with his voracious appetite for the literature, and ability to recall some of the most subtle, yet most important details in a paper. Most of all, I am thankful that Jack has always been so generous with his time, both in person, and remotely. I’ve enjoyed our many conversations and hope that they will continue. I’d also like to thank my thesis committee, Kevan Shokat and David Agard for their valuable support, insight, and encouragement throughout this project. My lab mates in the Taunton lab made this such a pleasant experience, even on the days when things weren’t working well. I worked very closely with Tangpo Yang on the mass spectrometry aspects of this project. Xiaobo Wan taught me almost everything I know about protein crystallography. Thank you as well to Geoff Smith, Jordan Carelli, Pat Sharp, Yazmin Carassco, Keely Oltion, Nicole Wenzell, Haoyuan Wang, Steve Sethofer, and Shyam Krishnan, Shawn Ouyang and Qian Zhao.
    [Show full text]
  • Loss of Phosphatidylinositol 4-Kinase 2 Activity Causes Late Onset
    Loss of phosphatidylinositol 4-kinase 2␣ activity causes late onset degeneration of spinal cord axons J. Paul Simonsa,b,1,2, Raya Al-Shawia,b,2, Shane Minoguea,b, Mark G. Waugha, Claudia Wiedemanna,3, Stylianos Evangeloua, Andrzej Loescha, Talvinder S. Sihrac, Rosalind Kingd, Thomas T. Warnerd, and J. Justin Hsuana,b,1 aDivision of Medicine, bRoyal Free Centre for Biomedical Science, and dDivision of Neuroscience, University College London Medical School, University College London, Rowland Hill Street, London NW3 2PF, United Kingdom; and cDepartment of Pharmacology, University College London, Gower Street, London WC1E 6BT, United Kingdom Edited by Lewis C. Cantley, Harvard Institutes of Medicine, Boston, MA, and approved May 28, 2009 (received for review March 18, 2009) Phosphoinositide (PI) lipids are intracellular membrane signaling RNA interference in cultured mammalian cells established intermediates and effectors produced by localized PI kinase and requirements in Wnt signaling (10), vesicle export from the phosphatase activities. Although many signaling roles of PI kinases trans-Golgi network (TGN) (11, 12), and endosomal trafficking have been identified in cultured cell lines, transgenic animal (13, 14). Nonetheless, the physiological or pathophysiological studies have produced unexpected insight into the in vivo func- importance in mammals is unknown as no transgenic phenotype tions of specific PI 3- and 5-kinases, but no mammalian PI 4-kinase or disease has been associated with the PI4K2a gene. (PI4K) knockout has previously been reported. Prior studies using We now describe the generation and characterization of mice cultured cells implicated the PI4K2␣ isozyme in diverse functions, lacking PI4K2␣ kinase activity. These mice develop late-onset including receptor signaling, ion channel regulation, endosomal neurological features that resemble human hereditary spastic trafficking, and regulated secretion.
    [Show full text]
  • Global Phosphoproteomic Profiling Reveals Perturbed Signaling in a Mouse Model of Dilated Cardiomyopathy
    Global phosphoproteomic profiling reveals perturbed signaling in a mouse model of dilated cardiomyopathy Uros Kuzmanova,b,1, Hongbo Guoa,1, Diana Buchsbaumc, Jake Cosmec, Cynthia Abbasic, Ruth Isserlina, Parveen Sharmac, Anthony O. Gramolinib,c,2, and Andrew Emilia,2 aDonnelly Centre for Cellular and Biomolecular Research, University of Toronto, Toronto, ON, Canada M5S 3E1; bTed Rogers Centre for Heart Research, University of Toronto, Toronto, ON, Canada M5G 1M1; and cDepartment of Physiology, University of Toronto, Toronto, ON, Canada M5S 3E1 Edited by Christine E. Seidman, Howard Hughes Medical Institute, Harvard Medical School, Boston, MA, and approved August 30, 2016 (received for review April 27, 2016) + + Phospholamban (PLN) plays a central role in Ca2 homeostasis in kinase A (PKA) or Ca2 /calmodulin-dependent protein kinase II cardiac myocytes through regulation of the sarco(endo)plasmic re- (CaMKII) (3). ticulum Ca2+-ATPase 2A (SERCA2A) Ca2+ pump. An inherited mu- Proteomic analyses have revealed changes in the abundance tation converting arginine residue 9 in PLN to cysteine (R9C) results of other effector proteins in diverse biochemical pathways in in dilated cardiomyopathy (DCM) in humans and transgenic mice, DCM. Notably, shotgun proteomic analysis of membrane pro- but the downstream signaling defects leading to decompensation tein expression dynamics in heart microsomes isolated from mice and heart failure are poorly understood. Here we used precision overexpressing a superinhibitory (I40A) mutant of PLN revealed mass spectrometry to study the global phosphorylation dynamics changes in G protein-coupled receptor-mediated pathways leading of 1,887 cardiac phosphoproteins in early affected heart tissue in a to activation of protein kinase C (PKC) (4).
    [Show full text]
  • Structural Insights and in Vitro Reconstitution of Membrane
    www.nature.com/scientificreports OPEN Structural insights and in vitro reconstitution of membrane targeting and activation of human Received: 18 December 2015 Accepted: 10 March 2016 PI4KB by the ACBD3 protein Published: 24 March 2016 Martin Klima1, Dániel J. Tóth2, Rozalie Hexnerova1, Adriana Baumlova1, Dominika Chalupska1, Jan Tykvart1, Lenka Rezabkova3, Nivedita Sengupta2, Petr Man4,5, Anna Dubankova1, Jana Humpolickova1, Radim Nencka1, Vaclav Veverka1,*, Tamas Balla2,* & Evzen Boura1 Phosphatidylinositol 4-kinase beta (PI4KB) is one of four human PI4K enzymes that generate phosphatidylinositol 4-phosphate (PI4P), a minor but essential regulatory lipid found in all eukaryotic cells. To convert their lipid substrates, PI4Ks must be recruited to the correct membrane compartment. PI4KB is critical for the maintenance of the Golgi and trans Golgi network (TGN) PI4P pools, however, the actual targeting mechanism of PI4KB to the Golgi and TGN membranes is unknown. Here, we present an NMR structure of the complex of PI4KB and its interacting partner, Golgi adaptor protein acyl-coenzyme A binding domain containing protein 3 (ACBD3). We show that ACBD3 is capable of recruiting PI4KB to membranes both in vitro and in vivo, and that membrane recruitment of PI4KB by ACBD3 increases its enzymatic activity and that the ACBD3:PI4KB complex formation is essential for proper function of the Golgi. Phosphatidylinositol 4-kinase beta (PI4KB, also known as PI4K IIIβ ) is a soluble cytosolic protein yet its function is to phosphorylate membrane lipids. It is one of four human PI4K enzymes that phosphorylate phosphatidy- linositol (PI) to generate phosphatidylinositol 4-phosphate (PI4P)1,2. PI4P is an essential lipid found in various membrane compartments including the Golgi and trans-Golgi network (TGN), the plasma membrane and the endocytic compartments.
    [Show full text]
  • Functional Dependency Analysis Identifies Potential Druggable
    cancers Article Functional Dependency Analysis Identifies Potential Druggable Targets in Acute Myeloid Leukemia 1, 1, 2 3 Yujia Zhou y , Gregory P. Takacs y , Jatinder K. Lamba , Christopher Vulpe and Christopher R. Cogle 1,* 1 Division of Hematology and Oncology, Department of Medicine, College of Medicine, University of Florida, Gainesville, FL 32610-0278, USA; yzhou1996@ufl.edu (Y.Z.); gtakacs@ufl.edu (G.P.T.) 2 Department of Pharmacotherapy and Translational Research, College of Pharmacy, University of Florida, Gainesville, FL 32610-0278, USA; [email protected]fl.edu 3 Department of Physiological Sciences, College of Veterinary Medicine, University of Florida, Gainesville, FL 32610-0278, USA; cvulpe@ufl.edu * Correspondence: [email protected]fl.edu; Tel.: +1-(352)-273-7493; Fax: +1-(352)-273-5006 Authors contributed equally. y Received: 3 November 2020; Accepted: 7 December 2020; Published: 10 December 2020 Simple Summary: New drugs are needed for treating acute myeloid leukemia (AML). We analyzed data from genome-edited leukemia cells to identify druggable targets. These targets were necessary for AML cell survival and had favorable binding sites for drug development. Two lists of genes are provided for target validation, drug discovery, and drug development. The deKO list contains gene-targets with existing compounds in development. The disKO list contains gene-targets without existing compounds yet and represent novel targets for drug discovery. Abstract: Refractory disease is a major challenge in treating patients with acute myeloid leukemia (AML). Whereas the armamentarium has expanded in the past few years for treating AML, long-term survival outcomes have yet to be proven. To further expand the arsenal for treating AML, we searched for druggable gene targets in AML by analyzing screening data from a lentiviral-based genome-wide pooled CRISPR-Cas9 library and gene knockout (KO) dependency scores in 15 AML cell lines (HEL, MV411, OCIAML2, THP1, NOMO1, EOL1, KASUMI1, NB4, OCIAML3, MOLM13, TF1, U937, F36P, AML193, P31FUJ).
    [Show full text]
  • Axon-Specific Mitochondrial Pathology in SPG11 Alpha Motor
    fnins-15-680572 July 12, 2021 Time: 16:24 # 1 ORIGINAL RESEARCH published: 07 July 2021 doi: 10.3389/fnins.2021.680572 Axon-Specific Mitochondrial Pathology in SPG11 Alpha Motor Neurons Fabian Güner1, Tatyana Pozner1, Florian Krach1, Iryna Prots1, Sandra Loskarn1, Ursula Schlötzer-Schrehardt2, Jürgen Winkler3,4, Beate Winner1,4 and Martin Regensburger1,3,4* 1 Department of Stem Cell Biology, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany, 2 Department of Ophthalmology, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany, 3 Department of Molecular Neurology, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany, 4 Center for Rare Diseases Erlangen, University Hospital Erlangen, Erlangen, Germany Pathogenic variants in SPG11 are the most frequent cause of autosomal recessive complicated hereditary spastic paraplegia (HSP). In addition to spastic paraplegia caused by corticospinal degeneration, most patients are significantly affected by Edited by: progressive weakness and muscle wasting due to alpha motor neuron (MN) Juan Antonio Navarro Langa, Institute of Health Research degeneration. Mitochondria play a crucial role in neuronal health, and mitochondrial (INCLIVA), Spain deficits were reported in other types of HSPs. To investigate whether mitochondrial Reviewed by: pathology is present in SPG11, we differentiated MNs from induced pluripotent stem Stefan Hauser, German Center cells derived from SPG11 patients and controls. MN derived from human embryonic for Neurodegeneratives, Helmholtz stem cells and an isogenic SPG11 knockout line were also included in the study. Association of German Research Morphological analysis of mitochondria in the MN soma versus neurites revealed Centers (HZ), Germany Alejandra Rojas Alvarez, specific alterations of mitochondrial morphology within SPG11 neurites, but not within Pontificia Universidad Católica the soma.
    [Show full text]
  • Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
    BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases.
    [Show full text]
  • PI4K2A, Active (SRP5063)
    PI4K2A, active, GST tagged, human PRECISIOÒ Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5063 Storage Temperature –70 °C Synonyms: DKFZp761G1923, PI4KII, PIK42A, Figure 1. RP11-548K23.6 SDS-PAGE Gel of Typical Lot 70–95% (densitometry) Product Description PI4K2A or phosphatidylinositol 4-kinase type 2 alpha is involved in the formation of phosphatidyl- inositolpolyphosphates (PtdInsPs), which are centrally involved in many biologic processes ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4K2A phosphorylates PtdIns at the D-4 position, which is an essential step in the biosynthesis of PtdInsPs. PI4K2A is a novel regulator of tumor growth by its action on angiogenesis and HIF-1alpha regulation. PI4K2A generates PtdIns4P-rich domains within the Golgi, which regulate targeting of clathrin adaptor AP-1 complexes.1 PI4K2A is also Figure 2. required for Wnt to regulate LRP6 phosphorylation.2 Specific Activity of Typical Lot 81-109 nmole/min/mg Recombinant full-length human PI4K2A was co-expressed by baculovirus in Sf9 insect cells using an N-terminal GST tag. The PI4K2Agene accession number is NM_018425. Recombinant protein stored in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM glutathione, 0.1 mM EDTA, 0.25 mM DTT, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ~79 kDa Purity: 70–95% (SDS-PAGE, see Figure 1) Specific Activity: 81–109 nmole/min/mg (see Figure 2) Procedure Preparation Instructions Precautions and Disclaimer Kinase Assay Buffer – 25 mM MOPS, pH 7.2, 12.5 mM This product is for R&D use only, not for drug, glycerol 2-phosphate, 25 mM MgCl2, 5 mM EGTA, and household, or other uses.
    [Show full text]
  • The Transcriptome of Pig Spermatozoa, and Its Role in Fertility
    International Journal of Molecular Sciences Article The Transcriptome of Pig Spermatozoa, and Its Role in Fertility Manuel Alvarez-Rodriguez 1,* , Cristina Martinez 1, Dominic Wright 2, Isabel Barranco 3, Jordi Roca 4 and Heriberto Rodriguez-Martinez 1 1 Department of Biomedical & Clinical Sciences (BKV), BKH/Obstetrics & Gynaecology, Faculty of Medicine and Health Sciences, Linköping University, SE-58185 Linköping, Sweden; [email protected] (C.M.); [email protected] (H.R.-M.) 2 Department of Physics, Chemistry and Biology, Faculty of Science and Engineering, Linköping University, SE-58183 Linköping, Sweden; [email protected] 3 Biotechnology of Animal and Human Reproduction (TechnoSperm), Department of Biology, Institute of Food and Agricultural Technology, University of Girona, 17003 Girona, Spain; [email protected] 4 Department of Medicine and Animal Surgery, Faculty of Veterinary Medicine, International Campus for Higher Education and Research “Campus Mare Nostrum”, University of Murcia, 30100 Murcia, Spain; [email protected] * Correspondence: [email protected]; Tel.: +46-(0)729427883 Received: 6 February 2020; Accepted: 24 February 2020; Published: 25 February 2020 Abstract: In the study presented here we identified transcriptomic markers for fertility in the cargo of pig ejaculated spermatozoa using porcine-specific micro-arrays (GeneChip® miRNA 4.0 and GeneChip® Porcine Gene 1.0 ST). We report (i) the relative abundance of the ssc-miR-1285, miR-16, miR-4332, miR-92a, miR-671-5p, miR-4334-5p, miR-425-5p, miR-191, miR-92b-5p and miR-15b miRNAs, and (ii) the presence of 347 up-regulated and 174 down-regulated RNA transcripts in high-fertility breeding boars, based on differences of farrowing rate (FS) and litter size (LS), relative to low-fertility boars in the (Artificial Insemination) AI program.
    [Show full text]