DOCSLIB.ORG

Source, Fate and Function of Early Glial Cells Expressing Nkx2.1 in Mouse Embryonic Brains

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Source, Fate and Function of Early Glial Cells Expressing Nkx2.1 in Mouse Embryonic Brains Unicentre CH-1015 Lausanne http://serval.unil.ch Year : 2012 SOURCE, FATE AND FUNCTION OF EARLY GLIAL CELLS EXPRESSING NKX2.1 IN MOUSE EMBRYONIC BRAINS VALLOTON Delphine VALLOTON Delphine, 2012, SOURCE, FATE AND FUNCTION OF EARLY GLIAL CELLS EXPRESSING NKX2.1 IN MOUSE EMBRYONIC BRAINS Originally published at : Thesis, University of Lausanne Posted at the University of Lausanne Open Archive. http://serval.unil.ch Droits d’auteur L'Université de Lausanne attire expressément l'attention des utilisateurs sur le fait que tous les documents publiés dans l'Archive SERVAL sont protégés par le droit d'auteur, conformément à la loi fédérale sur le droit d'auteur et les droits voisins (LDA). A ce titre, il est indispensable d'obtenir le consentement préalable de l'auteur et/ou de l’éditeur avant toute utilisation d'une oeuvre ou d'une partie d'une oeuvre ne relevant pas d'une utilisation à des fins personnelles au sens de la LDA (art. 19, al. 1 lettre a). A défaut, tout contrevenant s'expose aux sanctions prévues par cette loi. Nous déclinons toute responsabilité en la matière. Copyright The University of Lausanne expressly draws the attention of users to the fact that all documents published in the SERVAL Archive are protected by copyright in accordance with federal law on copyright and similar rights (LDA). Accordingly it is indispensable to obtain prior consent from the author and/or publisher before any use of a work or part of a work for purposes other than personal use within the meaning of LDA (art. 19, para. 1 letter a). Failure to do so will expose offenders to the sanctions laid down by this law. We accept no liability in this respect. Département de Biologie Cellulaire et Morphologie SOURCE, FATE AND FUNCTION OF EARLY GLIAL CELLS EXPRESSING NKX2.1 IN MOUSE EMBRYONIC BRAINS Thèse de doctorat en Neurosciences présentée à la Faculté de Biologie et de Médecine de l’Université de Lausanne par Delphine VALLOTON Biologiste diplômée de l’Université de Lausanne, Suisse Jury Prof. Philippe Maeder, Président Dr. Cécile Lebrand, Directrice Prof. Jean-Pierre Hornung, Co-directeur Dr. Sonia Garel, Experte Prof. Alexandre Dayer, Expert Lausanne 2012 Programme doctoral interuniversitaire en Neurosciences des Universités de Lausanne et Genève 1 2 ACKNOWLEDGMENTS The first person I would like to thank a lot is of course my thesis director Cécile, who accepted to take me in her lab 5 years ago, for performing my master work first, what led then to these exciting thesis studies with a lot of sudden revivals. So, thank you, Cécile, for giving me such a great opportunity to achieve my PhD in your team. Thank you also for sharing the so many skills you possess in “Science”, for your dynamism, for your enthousiasm and tenacity, and all the time and energy you have given to offer me a favorable and prosperous thesis environment. Thanks for your availability, for the understanding you have shown and for the support you have given to me when I had doubts. Finally, thank you for this unforgettable and emotionally rich adventure. I would like also to thank Jean-Pierre Hornung for his dedicated support and for kindly welcoming me and for sharing his lab space and equipment since the very beginning of my master until the very last moments of my PhD studies. Many thanks also for sharing your scientific knowledge and for your wise advices on many aspects of our research. Thank you also to all the members of my master, half-thesis and thesis jury who kindly accepted to review my work many times through the last years. Thanks for the time you have offered and that you offer again, and for your scientific remarks. Then, I would like to thank a few teams: The Lebrand’s team in which I am proud to be the second studient and maybe unfortunately… the last to end its thesis studies, and in which I feel like I had the chance to be guided by two pionnering axo… members. Ladies first, so thanks to Christiane for her kindness and who has taken care of our psychological and unmaterial concerns with gentleness, for her technical and unmeasurable help in molecular biology; to Carine for all the working hours that you made so nice to go through, for all the fun, for all the laugh we had inside and out of the lab and for your endless creativity that just started to emerge in our first Christmas costumes and for giving me so often the account of your advantures; to Shilpi for her enormous investment and quick acclimatization in the work of the lab and for her brilliant to visionnary skills and knowledge in science, but also for many gales of laughter and for our good indian and greek food sessions. And then the guys, so thanks to Sebastien and Mathieu who both gave me the impulse to choose the Lebrand’s team, to Belkacem who shared also with us nearly one year of its life in the lab and also many beers and parties outside of the lab. The Hornung’s team Thank you Dominique for your kindness, for your availability, for teaching me also a piece of your expertise in histology and thanks also for the nice chats during the long hours of dissection, cutting or mounting the brain slices. Then thanks to all the past and present members of the lab, so thank you Natacha, Peggy, Mary-Aude, Christine, Lionel, Alessandro, Julien and Alex and for all the fun we had and thank you everyone for making this journey enjoyable. I would like also to give a special big Thanks to both teams together, for your presence and your support at all the dance shows and Christmas choreography I gave during the last five years since I think they were around 9! Thanks also to all the members of the DBCM, 3 Fanny, Alain and all the members of the animal facility for taking care of our mice, Alex Sandoval and Yannick for informatical help, Eric for the printing of the posters and manuscript, Rudolf for its precious help in statistics and the secretariat team. I would like also to thank some other people and teams that brought help in many ways So thanks to: Jean-Luc Martin and Hubert Fiumelli who gave me the opportunity to start in their team for my pre-master work during which I already learned a lot, and a special thank to Hubert who taught us and set up the equipment for the In Utero electroporation. Jean-Yves Chatton and the CIF team for teaching me THE confocal microscopy, Christophe Lamy for helping me to give practicals in confocal microscopy and for sharing his knowledge in live imaging. Yvan Arsenijevic for the neurosphere’s technique. Sonia Bolea, Sonia Garel, Alexandre Dayer, Denis Jabaudon, Victor Borrell, Gord Fishell, Oscar Marin, for their encouragements, advises and support. Then I would like to thank more intimately some colleagues: To all guys of the coffee and apero corner, thank you for your kindness, availability, happiness and humanity and for everything you have done to make the work place more warm, funny, lively and welcoming. Thank you Jannick, Nieves, Nicole, Marie, Guylène, Saska, Sanda, Maria, Francine, Shilpi, the Romanette’s, Dimitri, Guy, Charles, Denis, Gilles, Alessandro, Hadi, David, Evrim… To Peter Clarke and all the Christmas party staff: The dancers and acrobats: Shilpi, Saska, Nicole, Franceline, Marie, Guylène, Christine, Tugce, Nieves, Jannick, Maria, Francine, Carine, Sanda, Valeria, Michel, Alex, Dimitri, Guy, Donald. Two rock bands: A great thank to Michel Kielar our spiritual guide and musical leader, to Matthieu for the equipment and the drums, to Christophe for the guitar bass, to Mathieu and Dutch for the folk guitar and vocals and to Lily for the outstanding vocal performance. Finally, I would like to thank my friends and family who largely contribute to this adventure. Thank you, my Friends of Ever, Marylaure, Simone and Sonia for the years of friendship. Thank you for being here at any time. Thank you, my dancing friends and teachers, Jean-Philippe, Marion, Héloïse, Baronne, Alice, Gwendolyn, Marinaz, Daniela, and so many others… Thank you, my friends from le gymnase du soir, Carine, Aurore, Amanny, Stephane, Sophie and Manu. Thank you, my new friends, Lily, Laurent, Damien, Alex and Dutch. Thank you, my parents and my brother, for taking care of me since ever. Thank you, my new family. And finally, Thank You, Mathieu, to have taken me as your Padawan in science, but more importantly to protect me, to support me, to daily share your feelings and emotions with me, and to share a big piece of life with me. 4 ABSTRACT Source, fate and function of early glial cells expressing Nkx2.1 in mouse embryonic brains Delphine Valloton Department of Cellular Biology and Morphology The brain tissue is made of neuronal and glial cells generated in the germinal layer bordering the ventricles. These cells divide, differentiate and migrate following specific pathways. The specification of GABAergic interneurons and glutamatergic neurons has been broadly studied but little is known about the origin, the fate and the function of early glial cells in the embryonic telencephalon. It has been commonly accepted since long that the glial cells and more particularly the astrocytes were generated after neurogenesis from the dorsal telencephalon. However, our work shows that, unlike what was previously thought, numerous glial cells (astroglia and polydendrocytes) are generated during neurogenesis in the early embryonic stages from E14.5 to E16.5, and originate from the ventral Nkx2.1-expressing precursors instead. NK2 homeobox 1 (Nkx2.1) is a member of the NK2 family of homeodomain- containing transcription factors.
Load more

Recommended publications
  • The Transcription Factor Pou3f1 Promotes Neural Fate Commitment
    RESEARCH ARTICLE elifesciences.org The transcription factor Pou3f1 promotes neural fate commitment via activation of neural lineage genes and inhibition of external signaling pathways Qingqing Zhu1,2†, Lu Song1†, Guangdun Peng1, Na Sun3, Jun Chen1, Ting Zhang1, Nengyin Sheng1, Wei Tang1, Cheng Qian1, Yunbo Qiao1, Ke Tang4, Jing-Dong Jackie Han3, Jinsong Li1, Naihe Jing1* 1State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 2Department of Neurosurgery, West China Hospital, Sichuan University, Sichuan, China; 3Key Laboratory of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 4Institute of Life Science, Nanchang University, Nanchang, Jiangxi, China Abstract The neural fate commitment of pluripotent stem cells requires the repression of extrinsic inhibitory signals and the activation of intrinsic positive transcription factors. However, how these two events are integrated to ensure appropriate neural conversion remains unclear. In this study, we showed that Pou3f1 is essential for the neural differentiation of mouse embryonic stem cells (ESCs), specifically during the transition from epiblast stem cells (EpiSCs) to neural progenitor cells (NPCs). Chimeric analysis showed that Pou3f1 knockdown leads to a markedly decreased *For correspondence: njing@ incorporation of ESCs in the neuroectoderm. By contrast, Pou3f1-overexpressing ESC derivatives sibcb.ac.cn preferentially contribute to the neuroectoderm. Genome-wide ChIP-seq and RNA-seq analyses †These authors contributed indicated that Pou3f1 is an upstream activator of neural lineage genes, and also is a repressor of equally to this work BMP and Wnt signaling.
    [Show full text]
  • Specific Functions of the Wnt Signaling System in Gene Regulatory Networks
    Specific functions of the Wnt signaling system in PNAS PLUS gene regulatory networks throughout the early sea urchin embryo Miao Cui, Natnaree Siriwon1, Enhu Li2, Eric H. Davidson3, and Isabelle S. Peter3 Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA 91125 Contributed by Eric H. Davidson, October 9, 2014 (sent for review September 12, 2014; reviewed by Robert D. Burke and Randall T. Moon) Wnt signaling affects cell-fate specification processes throughout Fig. 1A. Cells located at the vegetal pole will become skeleto- embryonic development. Here we take advantage of the well-studied genic mesodermal cells. These cells are surrounded by the veg2 gene regulatory networks (GRNs) that control pregastrular sea urchin cell lineage. This lineage consists of veg2 mesodermal cells, lo- embryogenesis to reveal the gene regulatory functions of the entire cated adjacent to skeletogenic cells and giving rise to all other Wnt-signaling system. Five wnt genes, three frizzled genes, two se- mesodermal cell fates such as esophageal muscle cells, blasto- creted frizzled-related protein 1 genes, and two Dickkopf genes are coelar cells, and pigment cells, and of veg2 endoderm cells, expressed in dynamic spatial patterns in the pregastrular embryo of which will form the foregut and parts of the midgut. At a further Strongylocentrotus purpuratus. We present a comprehensive analysis distance from the vegetal pole, but still within the vegetal half of of these genes in each embryonic domain. Total functions of the the embryo, is the veg1 lineage, consisting of veg1 endoderm, Wnt-signaling system in regulatory gene expression throughout the located adjacent to veg2 endoderm and giving rise to the other embryo were studied by use of the Porcupine inhibitor C59, which parts of the midgut and the hindgut, and of veg1 ectoderm, the interferes with zygotic Wnt ligand secretion.
    [Show full text]
  • Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Rb-Mediated Neuronal Differentiation Through Cell-Cycle–Independent Regulation of E2f3a
    PLoS BIOLOGY Rb-Mediated Neuronal Differentiation through Cell-Cycle–Independent Regulation of E2f3a Danian Chen1,2,3, Rene Opavsky4,5,6, Marek Pacal1,2,3, Naoyuki Tanimoto7, Pamela Wenzel4,5,6, Mathias W. Seeliger7, Gustavo Leone4,5,6, Rod Bremner1,2,3* 1 Genetics and Development Division, Toronto Western Research Institute, University Health Network, University of Toronto, Ontario, Canada, 2 Department of Ophthalmology and Visual Science, University of Toronto, Ontario, Canada, 3 Department of Laboratory Medicine and Pathobiology, University of Toronto, Ontario, Canada, 4 Human Cancer Genetics Program, Department of Molecular Virology, Immunology and Medical Genetics, Ohio State University, Columbus, Ohio, United States of America, 5 Department of Molecular Genetics, Ohio State University, Columbus, Ohio, United States of America, 6 Comprehensive Cancer Center, Ohio State University, Columbus, Ohio, United States of America, 7 Ocular Neurodegeneration Research Group, Centre for Ophthalmology, Institute for Ophthalmic Research, University of Tuebingen, Germany It has long been known that loss of the retinoblastoma protein (Rb) perturbs neural differentiation, but the underlying mechanism has never been solved. Rb absence impairs cell cycle exit and triggers death of some neurons, so differentiation defects may well be indirect. Indeed, we show that abnormalities in both differentiation and light- evoked electrophysiological responses in Rb-deficient retinal cells are rescued when ectopic division and apoptosis are blocked specifically by deleting E2f transcription factor (E2f) 1. However, comprehensive cell-type analysis of the rescued double-null retina exposed cell-cycle–independent differentiation defects specifically in starburst amacrine cells (SACs), cholinergic interneurons critical in direction selectivity and developmentally important rhythmic bursts. Typically, Rb is thought to block division by repressing E2fs, but to promote differentiation by potentiating tissue- specific factors.
    [Show full text]
  • Age-Driven Developmental Drift in the Pathogenesis of Idiopathic Pulmonary Fibrosis
    BACK TO BASICS INTERSTITIAL LUNG DISEASES | Age-driven developmental drift in the pathogenesis of idiopathic pulmonary fibrosis Moisés Selman1, Carlos López-Otín2 and Annie Pardo3 Affiliations: 1Instituto Nacional de Enfermedades Respiratorias Ismael Cosío Villegas, Mexico city, Mexico. 2Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Instituto Universitario de Oncología, Universidad de Oviedo, Oviedo, Spain. 3Facultad de Ciencias, Universidad Nacional Autónoma de México, Mexico city, Mexico. Correspondence: Moisés Selman, Instituto Nacional de Enfermedades Respiratorias, Tlalpan 4502, CP 14080, México DF, México. E-mail: [email protected] ABSTRACT Idiopathic pulmonary fibrosis (IPF) is a progressive and usually lethal disease of unknown aetiology. A growing body of evidence supports that IPF represents an epithelial-driven process characterised by aberrant epithelial cell behaviour, fibroblast/myofibroblast activation and excessive accumulation of extracellular matrix with the subsequent destruction of the lung architecture. The mechanisms involved in the abnormal hyper-activation of the epithelium are unclear, but we propose that recapitulation of pathways and processes critical to embryological development associated with a tissue specific age-related stochastic epigenetic drift may be implicated. These pathways may also contribute to the distinctive behaviour of IPF fibroblasts. Genomic and epigenomic studies have revealed that wingless/ Int, sonic hedgehog and other developmental signalling pathways are reactivated and deregulated in IPF. Moreover, some of these pathways cross-talk with transforming growth factor-β activating a profibrotic feedback loop. The expression pattern of microRNAs is also dysregulated in IPF and exhibits a similar expression profile to embryonic lungs. In addition, senescence, a process usually associated with ageing, which occurs early in alveolar epithelial cells of IPF lungs, likely represents a conserved programmed developmental mechanism.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]