DOCSLIB.ORG

Intraspecific Phylogeny of Anopheles (Kerteszia) Neivai Howard, Dyar

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Intraspecific Phylogeny of Anopheles (Kerteszia) Neivai Howard, Dyar Infection, Genetics and Evolution 67 (2019) 183–190 Contents lists available at ScienceDirect Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid Research paper Intraspecific phylogeny of Anopheles (Kerteszia) neivai Howard, Dyar & Knab T 1913, based on mitochondrial and nuclear ribosomal genes ⁎ Andrés López-Rubioa, ,1, Juan David Suaza-Vascoa,1, Sergio Solarib,1, Lina Gutiérez-Builesc,1, Charles Portera,1, Sandra I. Uribea,1 a Universidad Nacional de Colombia – Medellín, Facultad de Ciencias – Escuela de Biociencias, Grupo de Investigación en Sistemática Molecular, Carrera 65 59A-110, Medellín 050034, Colombia b Instituto de Biología, Grupo de Mastozoología, Universidad de Antioquia, Calle 70 52-21, Medellín, Colombia c Escuela de Ciencias de la Salud, Facultad de Medicina, Grupo de Biología de Sistemas, Universidad Pontificia Bolivariana, Calle 78B 72A-109, Medellín, Colombia ARTICLE INFO ABSTRACT Keywords: Three mitochondrial regions and a fragment of a large nuclear ribosomal subunit was used to study the evo- Malaria lutionary patterns of An. neivai, a mosquito inhabiting mangroves and tropical forest in the lowland and coastal COI areas of the Yucatan Peninsula through the Pacific Ecuadorian coast. This species exhibits epidemiological Cytb importance regarding Malaria transmission in natural ecosystems, particularly in rural areas of the Pacific D2 Colombian coast. The results based on phylogenetic networks and Bayesian inference showed no robust evidence Cryptic species supporting the existence of previously suggested cryptic species. Diversification patterns in geographically widespread species such as this one, are complex and therefore could impact malaria control strategies. Further studies focused on behavior, morphology, and phylogenomics will improve the understanding of the evolu- tionary patterns within An. neivai and its role as a disease vector. 1. Introduction difficulty of proper taxonomic assignment and appropriate control ac- tivities (Bickford et al., 2007; Collins and Paskewitz, 1996; Rosa-Freitas Anopheles (Kerteszia) neivai Howard Dyar & Knab, 1913 (Diptera: et al., 1998). Moreover, the vectorial capacity for transmission of Culicidae) is widely distributed from the Yucatan Peninsula in Mexico Plasmodium spp. may vary across different cryptic species of Anopheles through the northern pacific coast in Ecuador, inhabiting lowland tro- and therefore a robust taxonomic assessment of the genus is critical for pical forests and mangroves in coastal areas (Forattini, 2002; Knight malaria control efforts (Stevenson and Norris, 2017). and Stone, 1977; Zavortink, 1973). Epidemiological evidence indicates Studying the evolutionary patterns in suspected cryptic species can An. neivai serves as a vector for malaria in the Colombian Pacific Coast help to identify recently diverged species within a species complex in several localities such as Charambirá, Santa Bárbara–Iscuandé, and (Bourke et al., 2013). Nowadays, molecular markers are widely used to Buenaventura (Escovar et al., 2013; Murillo et al., 1988; Olano et al., examine evolutionary patterns and to reconstruct phylogenies in ano- 1997). pheline mosquitoes at several systematic scales, including intraspecific Despite the reports of primary vectors for this area such as An. phylogenies (Moreno et al., 2013; Wilkerson et al., 2005). The purpose darlingi, and An. albimanus (Montoya-Lerma et al., 2011), the available of constructing a multilocus phylogeny is to merge all available data epidemiological data from An. neivai and other secondary culicid vec- sources in order to provide a more robust assessment of species limits. tors suggest these species of mosquitoes should be considered as im- Several strategies for analyzing multilocus datasets exist including portant vectors for disease within their local range (Sinka et al., 2010). matrix concatenation, total evidence, and more recently used, a species In this context, and for malaria-control purposes, a precise taxonomical tree (Igea et al., 2015; Schlick-Steiner et al., 2010; Yeates et al., 2011). identification and knowledge of the vector species is essential (Higa Regarding tropical anophelines, multilocus phylogenies improved et al., 2010; Müller et al., 2013). There are several sections within the the understanding of the evolutionary patterns in An. triannulatus, a Anopheles genus where cryptic species –two or more distinct species vector of malaria in Brazil, with epidemiological importance in Peru classified as a single species– are recognized, thus contributing tothe and Venezuela. Phylogenetic analyses using mitochondrial COI, nuclear ⁎ Corresponding author. E-mail address: [email protected] (A. López-Rubio). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.meegid.2018.10.013 Received 9 July 2018; Received in revised form 10 October 2018; Accepted 20 October 2018 Available online 03 November 2018 1567-1348/ © 2018 Elsevier B.V. All rights reserved. A. López-Rubio et al. Infection, Genetics and Evolution 67 (2019) 183–190 Table 1 Collection Information for sampled localities. Country Location Species (sample number) Latitude Longitude Altitude (masla) Brazil Capanema (CAP) Anopheles marajoara (1) 1°11' 45.62” S 47°9' 41.50” W 31 Colombia Sierra Nevada de Santa Marta (MAG) An. pholidotus (1) 11° 5' 48.0” N 74° 4' 33.8” W 1689 Acandí (ACA) An. neivai (2) 8° 34' 39.81” N 77° 23' 56.31” W 200 Bahía Solano (BAH) An. neivai (6) 6° 21' 40.81” N 77° 21' 23.89” W 32 Nuquí (NUQ) An. neivai (8) 5° 41' 24.1” N 77° 15' 16.7” W 26 Litoral de San Juan (LIT) An. neivai (5) 4° 16' 14.1” N 77° 29' 34.3” W 8 Panama Portobelo (POR) An. neivai (6) 9° 29' 59.4” N 79° 41' 30.96” W 16 Guatemala Puerto Barrios (PUE) An. neivai (4) 15° 40' 23.34” N 88° 41' 27.96” W 912 Chiquimula (CHI) An. neivai (4) 14° 50' 48.60” N 89° 40' 36” W 1743 a Meters above sea level. Fig. 1. Collection map for specimens in Colombia, Panama and Guatemala. ITS2 and White DNA sequences revealed two major and well-differ- In the present study, the evolutionary patterns of An. neivai in three entiated groups corresponding to specimens collected from the Amazon mitochondrial regions and a ribosomal gene fragment were explored to and Andean regions (Moreno et al., 2013). In addition, the use of three determine the presence of possible cryptic species, using total-evidence circadian clock genes and three encoding ribosomal proteins in An. and taxonomic congruence approaches. cruzii, considered as a secondary malaria vector at the Brazilian Atlantic forest, showed the existence of sibling or incipient species (Rona et al., 2. Materials and methods 2012). In all these studies, the use of multilocus phylogenies were used to identify the smallest diagnosable cluster of individuals, according to Specimens of An. neivai were collected from seven locations in South the phylogenetic species concept (De Queiroz, 1998). and Central America (Table 1), including the type locality at Portobelo An. neivai, within the subgenus Kerteszia, is proposed as a species (Panama) (Fig. 1). Adult specimens were collected with Shannon and complex based on morphological, behavioral, and genetic data in- CDC traps, while immatures (larvae and pupa) were collected in bro- cluding spot scale color and pattern variations in the R4+5 vein meliads and reared under laboratory conditions to collect exuviae as a (Montoya-Lerma et al., 1987), biting activity, and variability in the source of morphological evidence and species confirmation. Morpho- DNA COI barcoding region (Linton, 2009). In particular, the available logical identifications were based on the taxonomic keys for adultand DNA barcode genetic data suggested at least three different genetic immature specimens from (Escovar et al., 2012; González and Carrejo, groups for specimens distributed across Guatemala, Colombia, Vene- 2009). In addition, other species from Kerteszia (An. pholidotus) were zuela and Ecuador (Ahumada et al., 2016; Suaza et al., 2009). However, included along with specimens from Nyssorhynchus (An. braziliensis and the evolutionary patterns in An. neivai, including topotypic specimens An. marajoara), as this taxon is the recognized sister group of Kerteszia have not been explored. (Harbach, 2013, 2007; Sallum et al., 2002). All voucher specimens were 184 A. López-Rubio et al. Infection, Genetics and Evolution 67 (2019) 183–190 Table 2 Primer sequence and thermal profile used for PCR and cycle sequencing experiments. Molecular region/ primers PCR annealing temperature/time COI (Kumar et al., 2007)/Kum07-F (GGATTTGGAAAT-GATTAGTTCCTT) Kum07-R (AAAAATTTTAATTCCAGTTGGAACAGC) 48–51 °C/ 60s ND4 (Gorrochotegui-Escalante et al., 2000)/ND4+ (GTDYATTTATGATTRCCTAA) ND4- (CTTCGDCTTCCWADWCGTTC) 48 °C/36s Cytb–TRNASer–IG1–ND1 (Ready et al., 1997)/CB3FC (CAYATTCAACCWGAATGATA) NINFR GGTAYWTTGCCTCGAWTTCGWTATGA) 47 °C/30s D1–D2 (Porter and Collins, 1996)/ CP12 (GTGGATCCAGTCGTGTTGCTTGATAGTGCAG) CP15 (GTGAATTCTTGGTCCGTGTTTCAAGACGGG) 62 °C/34.8s deposited at the Francisco Luís Gallego Entomological Museum primers described in Table 2 with the following conditions: 0.5 μL (MEFLG), National University of Colombia, Medellín. Field permit for [10 mM] of primer, 2 μL of purified PCR product, 4.5 μL molecular collecting trips were authorized under decree 1376, June 27th 2013, grade H20, 2 μL ABI® 5× sequencing buffer, 0.5 μL Applied Biosystems Ministerio de Medio Ambiente, República de Colombia, collecting BigDye Terminator® V1.1 (Waltham, USA). The thermal conditions
Load more

Recommended publications
  • MOSQUITO STUDIES (Diptera, Culicidae)
    MOSQUITO STUDIES (Diptera, Culicidae) XXIX. A REVIEW OF THE SUBGENUS KERTESZIA OF ANOPHELES ’ Thomas J. Zavortink2 INTRODUCIION’ Kerteszia is a small, Neotropical subgenusof Anopheles. Although severalspecies of *this subgenusare important, even primary, vectors of human malariasand other speciesare suspectedvectors, Kerteszia is appallingly poorly known systematically. Becauseof the dearth of specimensavailable for study, the present paper can be little more than a preliminary review laying the groundwork for a future, more com- prehensivestudy. Only 1146 specimens,97 males, 64 male genitalia, 538 females, 294 larvae and 153 pupae, were examined during this study; included were 155 individual rearings (100 larval, 28 pupal and 27 incomplete). Most of the adultsstudied, including the reared ones, are in very poor condition, either broken, denuded,shriveled, fungused, decomposedor imbedded in adhesive,and are not of researchquality. Many of the skinsof the immature stagesare poorly preservedor poorly mounted and almost all whole larvae examined died during the attempt to rear them and are rotted, mis- shapen and discolored.Only the Colombian and Panamanianpopulations of neivai and the Trinidadian populationsof bellator and homunculus are representedby even modest seriesof adultsand immatures,and only 2 of thesepopulations, the Panama- nian neivai and the Trinidadian beZZator,are topotypic or nearly so. Classical,comparative morphological taxonomic procedureswere used. Many of the conclusionsreached must be consideredas tentative only, for in most cases neither the quantity nor quality of material availablefor study is adequatefor test- ing the hypothesesabout the number of speciesand their diagnosticcharacters that are summarized in the keys. The descriptionsare basedon a few individualsfrom, if possible,one population, as indicated under the species;the organization, termi- nology and abbreviationsused in the descriptionsfollow Belkin (1962) in large part.
    [Show full text]
  • Identification Keys to the Anopheles Mosquitoes of South America
    Sallum et al. Parasites Vectors (2020) 13:583 https://doi.org/10.1186/s13071-020-04298-6 Parasites & Vectors RESEARCH Open Access Identifcation keys to the Anopheles mosquitoes of South America (Diptera: Culicidae). I. Introduction Maria Anice Mureb Sallum1*, Ranulfo González Obando2, Nancy Carrejo2 and Richard C. Wilkerson3,4,5 Abstract Background: The worldwide genus Anopheles Meigen, 1918 is the only genus containing species evolved as vectors of human and simian malaria. Morbidity and mortality caused by Plasmodium Marchiafava & Celli, 1885 is tremendous, which has made these parasites and their vectors the objects of intense research aimed at mosquito identifcation, malaria control and elimination. DNA tools make the identifcation of Anopheles species both easier and more difcult. Easier in that putative species can nearly always be separated based on DNA data; more difcult in that attaching a scientifc name to a species is often problematic because morphological characters are often difcult to interpret or even see; and DNA technology might not be available and afordable. Added to this are the many species that are either not yet recognized or are similar to, or identical with, named species. The frst step in solving Anopheles identi- fcation problem is to attach a morphology-based formal or informal name to a specimen. These names are hypoth- eses to be tested with further morphological observations and/or DNA evidence. The overarching objective is to be able to communicate about a given species under study. In South America, morphological identifcation which is the frst step in the above process is often difcult because of lack of taxonomic expertise and/or inadequate identifca- tion keys, written for local fauna, containing the most consequential species, or obviously, do not include species described subsequent to key publication.
    [Show full text]
  • Subgenus Anopheles Meigen
    Mosquito Taxonomic Inventory (www.mosquito-taxonomic-inventory.info/) Updated 12 June 2014 − Ralph Harbach (Note: Cited references are listed at the end of the classification.) Subgenus Cellia Theobald Cellia Series (Christophers, 1924a) argenteolobatus (Gough) brumpti Hamon & Rickenbach cristipalpis Service murphyi Gillies & de Meillon pharoensis Theobald swahilicus Gillies Squamosus Group (Grjebine, 1966) cydippis de Meillon squamosus Theobald Myzomyia Series (Christophers, 1924a) apoci Marsh azaniae Bailly-Choumara barberellus Evans bervoetsi D’Haenans brunnipes (Theobald) domicola Edwards dthali Patton erythraeus Corradetti ethiopicus Gillies & Coetzee flavicosta Edwards fontinalis Gillies & de Meillon gabonensis Rahola, Makanga & Paupy, 2014 majidi Young & Majid moucheti Evans schwetzi Evans tchekedii de Meillon & Leeson walravensi Edwards Demeilloni Group (Gillies & de Meillon, 1968) carteri Evans & de Meillon demeilloni Evans freetownensis Evans garnhami Edwards keniensis Evans lloreti Gil Collado sergentii (Theobald) subspecies macmahoni Evans subspecies sergentii (Theobald) Funestus Group (Garros et al., 2005b) jeyporiensis James Aconitus Subgroup (Chen et al., 2003) aconitus Dönitz filipinae Manalang mangyanus (Banks) pampanai Büttiker & Beales varuna Iyengar Culicifacies Subgroup (Garros et al., 2005b) culicifacies Giles (species A, B, C, D and E) (Kar et al., 1999) Funestus Subgroup (Garros et al., 2005b) aruni Sobti confusus Evans & Leeson funestus Giles funestus-like species (Spillings et al., 2009) longipalpis (Theobald)
    [Show full text]
  • Anthropophilic Biting Behaviour of Anopheles (Kerteszia) Neivai
    Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 108(8): 1057-1064, December 2013 1057 Anthropophilic biting behaviour of Anopheles (Kerteszia) neivai Howard, Dyar & Knab associated with Fishermen’s activities in a malaria-endemic area in the Colombian Pacific Jesús Eduardo Escovar1,2/+, Ranulfo González3, Martha Lucía Quiñones1 1Department of Public Health, Universidad Nacional de Colombia, Bogota, Colombia 2Department of Basic Sciences, Universidad de La Salle, Bogota, Colombia 3Faculty of Natural and Exact Sciences, Universidad del Valle, Cali, Colombia On the southwest Pacific Coast of Colombia, a field study was initiated to determine the human-vector association between Anopheles (Kerteszia) neivai and fishermen, including their nearby houses. Mosquitoes were collected over 24-h periods from mangrove swamps, marshlands and fishing vessels in three locations, as well as in and around the houses of fishermen. A total of 6,382 mosquitoes were collected. An. neivai was most abundant in mangroves and fishing canoes (90.8%), while Anopheles albimanus was found indoors (82%) and outdoors (73%). One An. neivai and one An. albimanus collected during fishing activities in canoes were positive for Plasmodium vivax, whereas one female An. neivai collected in a mangrove was positive for P. vivax. In the mangroves and fishing canoes, An. neivai demonstrated biting activity throughout the day, peaking between 06:00 pm-07:00 pm and there were two minor peaks at dusk and dawn. These peaks coincided with fishing activities in the marshlands and mangroves, a situation that places the fishermen at risk of contracting malaria when they are performing their daily activities. It is recommended that protective measures be implemented to reduce the risk that fishermen will contract malaria.
    [Show full text]
  • Quantifying Seasonal and Diel Variation in Anopheline and Culex Human Biting Rates in Southern Ecuador
    bioRxiv preprint doi: https://doi.org/10.1101/192773; this version posted September 22, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Quantifying Seasonal and Diel Variation in Anopheline and Culex Human Biting Rates in Southern Ecuador Sadie J. Ryan a,b,c,d*, Catherine A. Lippi a,b*, Philipp H. Boersch-Supan a,e, Naveed Heydari c, Mercy Silva f, Jefferson Adrian c, Leonardo F. Noblecilla g, Efraín B. Ayala h, Mayling D. Encalada i, David A. Larsen j, Jesse T. Krisher k, Lyndsay Krisher l,m, Lauren Fregosi a,j, Anna M. Stewart-Ibarra c a Emerging Pathogens Institute, University of Florida, Gainesville, FL, USA b Department of Geography, University of Florida, Gainesville, FL, USA c Center for Global Health and Translational Science and Department of Medicine, State University of New York Upstate Medical University, Syracuse, NY, USA d College of Agriculture, Engineering, and Science, University of KwaZulu-Natal, Durban, South Africa e Department of Integrative Biology, University of South Florida, Tampa, FL, USA f Ministerio de Salud Pública, Laboratorio Clínico Hospital Teófilo Dávila, Machala, Ecuador g Ministerio de Salud Pública, Lab. Entomologia CZ7, Machala, Ecuador h Facultad de Medicina, Universidad Técnica de Machala, Machala, Ecuador i Ministerio de Salud Pública, Dirección Nacional de Vigilancia Epidemiológica, Av. República de El Salvador 36-64 y Suecia, Quito, 170515, Ecuador j Department of Public Health, Food Studies, and Nutrition, Syracuse University, Syracuse, NY, USA k Division of Nutritional Sciences, Cornell University, Ithaca, NY, USA l Center for Health, Work & Environment, Department of Environmental and Occupational Health, Colorado School of Public Health, University of Colorado Denver, Aurora, CO m Colorado Consortium on Climate Change and Human Health, University of Colorado Denver, Aurora, CO bioRxiv preprint doi: https://doi.org/10.1101/192773; this version posted September 22, 2017.
    [Show full text]
  • Species in Anophezes
    Mosquito Systematics Vol. 9(l) 1977 1 The Place of Morphological * Studies in the Investigation of AnopheZes Species Complexes \ G. B. White British Museum (Natural History) London SW7 5BD England Page Summary ____________________~~~-~~--~---~~~-~~-~~--------~~~~~~---------- ----- 1 Preamble __----_--______--___~~-~------------------------~~~~----~~--~~~~~~-~~ 2 Background ____---_____-_______~-~----~~~~~--------~~~~~~~-------~~~~-~------- 2 Species in AnopheZes ---_--___-----______~-~-----~~~~~~~~~~~~~--~~~~~~~~~~~~-~ 5 Systematics of the Anophelinae -----------------_-------~---~-~~~~~---~------- 6 Morphological characters in Anopheles ------_------_______~~~~~~~~~~~~~~~~~~~~~ 7 Detection of species complexes ---_--_-__------____~~~~~~~~-~-~~~~~~~~~~~----- 8 Morphological comparisons of AnopheZes species: past, present and potential. a. Adults and general--------------- ---------------------------~~~~~~~~~--~- 9 b. Larvae and pupae -__-_------_-___-_-----------~~~~~-~~-~~-~-~~~~~~~~~~-~-- 11 c. Eggs ------_------------------~ ____-__-_-_-_-_-_---~-~----~-~~~~-~~~-~---- 13 Concluding discussion --___-__----__-_-__-----_---__-__--_------_--___-_------~4 Acknowledgments ------______________I___________________~~~~~~~~~~~~~~~~~~~~~~ 15 References ------_--------_-----~-----~-- -------------_----------~-~~--~------ 16 Summary High standards of comparative morphological work on AnopheZes were attained early in the 20th Century. The genus now has 401 recognized species and subspecies, about half of which exist as close-knit clusters of similar
    [Show full text]
  • Part II, Geographic Distribution And
    Mosquito Systematics Vol. 17(4) 1985 279 MOSQUITOESOF ARGENTINA Part II, GeographicDistribution and Bibliography (Diptera, Culicidae) Carl J, Mitchell* and RichardF, Darsie, Jr,** TABLE OF CONTENTS Page INTRODUCTION 280 ACKNOWLEDGMENTS 281 GEOGRAPHIC DISTRIBUTION OF THE MOSQUITOES OF ARGENTINA 287 BIBLIOGRAPHY OF THE MOSQUITOES OF ARGENTINA 336 INDEX FOR PARTS I AND II 357 ABSTRACT Distributional data are presented for 208 species occurring in Argentina, 2 species for which records apparently are based on misidentifications, and 1 species that no longer is found there. Data are organized by province or, in the case of Tierra de1 Fuego, by national territory. The relationship of the mosquito fauna of Misiones Province to that of Brazil is documented, and attention is drawn to the depauperate mosquito fauna of the Patagonian Region of Argentina. Literature citations or collection records, or both, are given to document the occurrence of each species in a particular province or territory. A'comprehensive bibliography is provided. *Chief and **Research Entomologist, Vector Virology Laboratory, Division of Vector-borne Viral Diseases, Center for Infectious Diseases, Centers for Disease Control, Public Health Service, U. S. Department of Health and Human Services, P. 0. Box 2087, Fort Collins, Colorado 80522. **Present address: International Center for Public Health Research, University of South Carolina, P. 0. Box 699, McClellanville, South Carolina 29458. 280 INTRODUCTION Epizootics of equine encephalitis have swept through the Argentine Pampa at irregular intervals with devastating results (Sabattini et al. 1985). Attempts to clarify vector relationships of the responsible viruses have been hampered by the lack of appropriate identification keys to the female mosquitoes and the lack of a ready source of information concerning species composition and distribution in the affected areas.
    [Show full text]
  • ISSUE 58, April, 2017
    FLY TIMES ISSUE 58, April, 2017 Stephen D. Gaimari, editor Plant Pest Diagnostics Branch California Department of Food & Agriculture 3294 Meadowview Road Sacramento, California 95832, USA Tel: (916) 262-1131 FAX: (916) 262-1190 Email: [email protected] Welcome to the latest issue of Fly Times! As usual, I thank everyone for sending in such interesting articles. I hope you all enjoy reading it as much as I enjoyed putting it together. Please let me encourage all of you to consider contributing articles that may be of interest to the Diptera community for the next issue. Fly Times offers a great forum to report on your research activities and to make requests for taxa being studied, as well as to report interesting observations about flies, to discuss new and improved methods, to advertise opportunities for dipterists, to report on or announce meetings relevant to the community, etc., with all the associated digital images you wish to provide. This is also a great place to report on your interesting (and hopefully fruitful) collecting activities! Really anything fly-related is considered. And of course, thanks very much to Chris Borkent for again assembling the list of Diptera citations since the last Fly Times! The electronic version of the Fly Times continues to be hosted on the North American Dipterists Society website at http://www.nadsdiptera.org/News/FlyTimes/Flyhome.htm. For this issue, I want to again thank all the contributors for sending me such great articles! Feel free to share your opinions or provide ideas on how to improve the newsletter.
    [Show full text]
  • Arthropod-Borne Viruses Arthropod-Borne • Rebekah C
    Arthropod-Borne Viruses • Rebekah C. Kading, Aaron C Brault Beckham David and J. Arthropod-Borne Viruses The Outbreak Edition Edited by Rebekah C. Kading, Aaron C Brault and J. David Beckham Printed Edition of the Special Issue Published in Tropical Medicine and Infectious Disease www.mdpi.com/journal/tropicalmed Arthropod-Borne Viruses Arthropod-Borne Viruses: The Outbreak Edition Editors Rebekah C. Kading Aaron C Brault J. David Beckham MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade • Manchester • Tokyo • Cluj • Tianjin Editors Rebekah C. Kading Aaron C Brault Colorado State University Centers for Disease Control and Prevention USA USA J. David Beckham University of Colorado School of Medicine USA Editorial Office MDPI St. Alban-Anlage 66 4052 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal Tropical Medicine and Infectious Disease (ISSN 2414-6366) (available at: https://www.mdpi.com/ journal/tropicalmed/special issues/Arthropod Borne Viruses). For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Article Number, Page Range. ISBN 978-3-03943-348-3 (Hbk) ISBN 978-3-03943-349-0 (PDF) c 2020 by the authors. Articles in this book are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications. The book as a whole is distributed by MDPI under the terms and conditions of the Creative Commons license CC BY-NC-ND.
    [Show full text]
  • Reinert Anopheline Eggs
    European Mosquito Bulletin 28 (2010), 103-142 Journal of the European Mosquito Control Association ISSN 1460-6127; w.w.w.e-m-b.org First published online 20 July 2010 List of anopheline species with published illustrations and/or descriptions of eggs (Diptera: Culicidae: Anophelinae) John F. Reinert Center for Medical, Agricultural and Veterinary Entomology (CMAVE), United States Department of Agriculture, Agricultural Research Service, 1600/1700 SW 23rd Drive, Gainesville, Florida 32608-1067, and collaborator Walter Reed Biosystematics Unit, National Museum of Natural History, Smithsonian Institution, Washington, D.C. (e-mail: [email protected]) Abstract Species of the mosquito subfamily Anophelinae with published illustrations and/or morphol- ogical descriptions of the egg stage are listed with their literature citations. Species of the subfamily have the egg stage better known than those in most tribes of family Culicidae. Key words: Diptera, Culicidae, Anophelinae, Anopheles, Bironella, Brugella, Chagasia, Cellia, Kerteszia, Lophopodomyia, Nyssorhynchus, Stethomyia, mosquito, eggs Introduction A listing of species with published illustrations and/or descriptions of eggs in the mosquito subfamily Anophelinae is provided below and includes literature citations. Many of the publications include descriptive information in addition to the illustrations of the egg, however, some descriptions are very brief. Descriptive information on eggs sometimes is included in keys. The identification of anopheline species, subspecies, varieties, races, synonyms, etc. utilized in the cited literature is reported in the following list. Qu & Zhu (2008) provided recent information on several species that had been synonymized or resurrected from synonymy. The latest listing of currently valid species and generic-level taxa reported in the Mosquito Taxonomic Inventory (http://mosquito-taxonomic-inventory.info, accessed 30 June 2010) was utilized.
    [Show full text]
  • Kerteszia) Cruzii(DIPTERA: CULICIDAE
    Rev. Inst. Med. Trop. Sao Paulo 56(5):403-409, September-October, 2014 doi: 10.1590/S0036-46652014000500006 Anopheles (Kerteszia) cruzii (DIPTERA: CULICIDAE) IN PERIDOMICILIARY AREA DURING ASYMPTOMATIC MALARIA TRANSMISSION IN THE ATLANTIC FOREST: MOLECULAR IDENTIFICATION OF BLOOD-MEAL SOURCES INDICATES HUMANS AS PRIMARY INTERMEDIATE HOSTS Karin KIRCHGATTER(1), Rosa Maria TUBAKI(2), Rosely dos Santos MALAFRONTE(3,4), Isabel Cristina ALVES(5), Giselle Fernandes Maciel de Castro LIMA(1), Lilian de Oliveira GUIMARÃES(1), Robson de Almeida ZAMPAULO(2) & Gerhard WUNDERLICH(6) SUMMARY Anopheles (Kerteszia) cruzii has been implicated as the primary vector of human and simian malarias out of the Brazilian Amazon and specifically in the Atlantic Forest regions. The presence of asymptomatic human cases, parasite-positive wild monkeys and the similarity between the parasites infecting them support the discussion whether these infections can be considered as a zoonosis. Although many aspects of the biology of An. cruzii have already been addressed, studies conducted during outbreaks of malaria transmission, aiming at the analysis of blood feeding and infectivity, are missing in the Atlantic Forest. This study was conducted in the location of Palestina, Juquitiba, where annually the majority of autochthonous human cases are notified in the Atlantic Forest of the state of São Paulo. Peridomiciliary sites were selected for collection of mosquitoes in a perimeter of up to 100 m around the residences of human malaria cases. The mosquitoes were analyzed with the purpose of molecular identification of blood-meal sources and to examine the prevalence of Plasmodium. A total of 13,441 females of An. (Ker.) cruzii were collected.
    [Show full text]
  • Zika and Dengue Viruses Infecting Wild-Caught Mosquitoes in an Environmental Protection Area in Brazil
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.17.879643; this version posted December 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Zika and dengue viruses infecting wild-caught mosquitoes in an environmental 2 protection area in Brazil 3 4 Karolina Morales Barrio-Nuevo1, Antônio Ralph Medeiros-Sousa1, Walter Ceretti-Junior1, Aristides 5 Fernandes1, Iray Maria Rocco2, Mariana Sequetin Cunha2, Adriana Luchs3, Luis Filipe Mucci4, 6 Renato Pereira de Souza2, Mauro Toledo Marrelli1,* 7 8 1Epidemiology Department, School of Public Health, University of São Paulo, Brazil 9 10 2Vector-borne Disease Laboratory, Virology Center, Adolfo Lutz Institute, São Paulo, Brazil 11 12 3Enteric Disease Laboratory, Virology Center, Adolfo Lutz Institute, São Paulo, Brazil 13 14 4Superintendency for the Control of Endemic Diseases, State Health Secretariat, São Paulo, Brazil. 15 16 *Corresponding author 17 E-mail: [email protected] 18 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.17.879643; this version posted December 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 19 Abstract 20 Species of the genus Flavivirus are widespread in Brazil and are a major public health concern. 21 The city of São Paulo is in a highly urbanized area with some green spaces which are used for 22 recreation and where potential vertebrate hosts and mosquito vectors of these arboviruses can be 23 found, a scenario that can contribute to the transmission of flaviviruses to humans.
    [Show full text]