UNIVERSITY of CALIFORNIA, SAN DIEGO the Role of ELMO1 in The

UNIVERSITY OF CALIFORNIA, SAN DIEGO

The Role of ELMO1 in the Pathogenesis of Infections with Gram-Negative

Bacteria

A thesis submitted in partial satisfaction of the requirements for the degree Master of Science

Biology

Courtney Lynn Tindle

Committee in charge:

Professor Peter Ernst, Chair Professor Stephen Hedrick, Co-Chair Professor Soumita Das Professor Eric Schmelz

2016

The thesis of Courtney Lynn Tindle is approved, and it is acceptable In quality and form for publication on microfilm and electronically

Co-Chair

Chair

University of California, San Diego

2016

iii

Dedication

I dedicate this thesis to my mom, dad, husband and son for their support and

encouragement.

Table of Contents

Signature Page……………………………………………………………………….iii

Dedication……………………………………………………………………………..iv

Table of Contents……………………………………………………………………..v

List of Figures………………………………………………………..……………….vi

Acknowledgments…………………………………………………………………...vii

Abstract of the Thesis………………………………………………………………viii

I. Introduction………………………………………………………………………….1

II. Materials and Methods……………………………………………………………8

III. Results……………………………………………………………………………13

IV. Discussion………………………………………………………………………..23

V. References………………………………………………………………………..28

List of Figures

Figure 1: The BAI1/ ELMO1-Mediated Engulfment pathway…………………….4

Figure 2: The ELMO1-dependent LC3BII Accumulation after Rapamycin Treatment...………………………..………………………………………………...17

Figure 3: The ELMO1-dependent LC3BII Accumulation after Salmonella Infection…………...……………………………………………………………..…..18

Figure 4: The Delayed Clearance of Salmonella in ELMO1-depleted Cells…………………………………………………………………………….…….19

Figure 5: The Late Endosomal Marker Rab9 interacts with ELMO1……………………………………………………………………...………..20

Figure 6: The Regulation of Cathepsin B following Salmonella Infection….....20

Figure 7: The ELMO1-dependent SPI2 Gene Induction………………………..21

Acknowledgements

I would like to thank Dr. Ernst for allowing me to work in his lab, and for serving as my chair of the thesis committee. He gave me insightful instruction on how to organize my thoughts and present them to others.

Secondly, I would like to thank Dr. Das for working closely with me through my experimental procedures, and for helping me to improve my work by giving me constructive criticism.

I am thankful for the previous work of Dr. Sarkar that laid the ground work for my thesis project and made experimental planning smoother.

Also, I would like to thank Dr. Hedrick and Dr. Schmelz for serving on my thesis committee, and offering helpful advice to improve my experimental designs.

I want to thank members from the Das and Ernst’s labs for aiding in my experiments. I would like to thank Amber Ablack and Cornelis Den Hartog from the Crowe lab for their assistance and the GI Division for shared equipment.

The Results, in part are being prepared for submission for publication of the material. Sarkar, Arup; Tindle, Courtney; Pranadinata, Rama; Ernst, Peter;

Das, Soumita. “ELMO1 regulates autophagic induction and bacterial clearance during Salmonella infection”

Last, but not least, I would like to thank my family for being supportive during my studies, eminently when I had to work long days and on weekends.

vii

Abstract of the Thesis

The Role of ELMO1 in the Pathogenesis of Infections with Gram-Negative

Bacteria

Courtney Lynn Tindle

Masters of Science in Biology

University of California, San Diego 2016

Professor Peter Ernst, Chair Professor Stephen Hedrick, Co-Chair The clearance of enteric bacteria by phagocytes plays an essential role in the host response of infection. Previously, we have reported that BAI1 (Brain

Angiogenesis Inhibitor 1) binds bacterial Lipopolysaccharide (LPS) and facilitates engulfment of Gram-negative bacteria by activating ELMO1 (Engulfment and cell motility protein 1). Using Salmonella as a model organism, we hypothesized that

viii

ELMO1 regulates bacterial clearance, activates autophagy and modulates the endosomal lysosomal pathway. The data from Salmonella infection in J774 murine macrophages with depleted ELMO1 expression, by genetic modification, suggest that ELMO1 is important for LC3BII accumulation. There was a compounded decrease in LC3BII accumulation when ELMO1 and ATG-5 were simultaneously inhibited. These observations suggest that ELMO1 is upstream of ATG-5 and important for its function. The effect of ULK-1 depleted macrophages on LC3BII accumulation was insignificant when compared to control macrophages.

Therefore, it appears that Salmonella is cleared mostly by LC3-associated phagocytosis in an ELMO1-dependent manner. ELMO1-depleted macrophages showed delayed bacterial clearance post infection. ELMO1 was found to interact with the late endosomal protein Rab9, which is involved in lysosome biogenesis and cellular trafficking. The accumulation of the lysosomal enzyme cathepsin B varried in a time-dependent manner and decreased in ELMO1-depleted macrophages compared to control macrophages 12 h post infection. The expression of genes associated with the Salmonella Pathogenicity Island-2 (SPI-

2), important for bacterial survival inside macrophages, decreased in ELMO1- depleted macrophages compared to control macrophages at 6 hours post infection. The understanding of the host response to enteric infections is important because they persistently reoccur.

Introduction

Relevant Background

Food and waterborne infections are a major global health problem.

According to the estimates of the World Health Organization, 4-6 million people die of enteric infections each year1. Within the United States, food and waterborne infections are responsible for millions of illness incedents, thousands of deaths and substantial economic loss associated with food recall. One of the most common causes of these foodborne illnesses is Salmonella which can contaminate frequently encountered food items such as vegetables, poultry and eggs1.

Most people can clear Salmonella, but young children and people with suppressed immune systems experience reoccurring instances of Salmonella infection. After ingestion of Salmonella, genes are expressed within the

Salmonella pathogenicity island-1 that are necessary to invade and cross the intestinal epithelial layer2,3. Once Salmonella crosses this barrier, it is engulfed by phagocytes such as macrophages. Therefore, the interactions between

Salmonella and macrophages is a crucial aspect of the host response to investigate and understand.

The Pathogenesis of Salmonella

One of the main roles of intestinal macrophages is to survey and clear bacteria from the lamina propria, the area next to the basal surface of the intestines4. When macrophages engulf Salmonella, the bacteria become enclosed in a membrane bound compartment called a phagosome. The acidic

3 environment of the phagosome inside macrophages activates Salmonella pathogenicity island-2 gene expression5. Acidic pH is required for the functional assembly of the type III secretion system encoded by the Salmonella pathogenicity island-2.

The type 3 secretion system effector proteins that are encoded by these genes cause morphological changes to the phagosome, ultimately forming the

Salmonella-containing vacuole that protects Salmonella from the degradation system of macrophages6. The integrity of the Salmonella-containing vacuole is maintained by the Salmonella pathogenicity island-2 effector protein SifA, allowing survival of the bacteria inside macrophages7. However, the underlying mechanism by which the bacteria avoid the host clearance mechanism is not well understood.

The aim of this thesis is to understand the host-bacterial interface that regulates bacterial clearance.

The Engulfment Pathway

Bacteria interact with host cells via multiple pattern recognition receptors

(PRRs) which recognize microbial products or pathogen-associated molecular patterns (PAMPs). Previous work from our lab identified BAI1 (Brain Angiogenesis

Inhibitor 1) as a new pattern recognition receptor that preferentially binds Gram- negative bacterial Lipopolysaccharide (LPS)8,9. Unlike TLR4 (Toll like receptor 4) which binds the lipid A region of LPS, BAI1 recognizes the core oligosaccharide.

The binding of Gram-negative bacteria on the BAI1 receptor recruits the cytosolic protein ELMO1 (engulfment and cell motility protein 1)8,9.

Figure 1: The BAI1 / ELMO1-Mediated Engulfment Pathway: Previously, we have shown that BAI1 binds the LPS of Gram-negative enteric bacteria and apoptotic cells8,9. The C terminus of BAI1 interacts with cytosolic ELMO1 that facilitates bacterial internalization. ELMO1 activates Rac1 following infection that triggers actin rearrangement and the uptake of the bacteria. The schematic is a modified version from Ravichandran et al10. ELMO1 interacts with Dock180 and together they act as a guanine exchange factor for Rac1. Once Rac1 is activated, it rearranges the actin cytoskeleton of the macrophage to allow engulfment of Gram-negative bacteria such as Salmonella (Figure 1)8,9. Previously, ELMO1 has been shown in the engulfment and clearance of apoptotic cells11. Recently, our lab showed that

ELMO1 is involved in bacterial internalization and the generation of inflammatory responses12. Together, these observations led to the hypothesis that ELMO1 regulates the bacterial clearance pathway post engulfment.

Clearance Mechanisms

Among various bacterial clearance machineries in phagocytes, conventional autophagy is one of the mechanisms that host cells employ to degrade invading bacteria13. Autophagy is a process that cells have developed over time, allowing them to recycle damaged proteins and organelles in times of

5 nutrient deprivation. Interestingly, the autophagy pathway has evolved the ability to degrade invading pathogens that have escaped into the cytosol of a cell14. Anti- bacterial autophagy can also be triggered by the formation of diacylglycerol at the plasma membrane, triggered by membrane disturbances from invading

Salmonella15. Many TLRs also prime the cytosol to recognize bacteria for degradation by the autophagy pathway, including TLR 2-7 and TLR916.

Microtubule associated Light Chain 3 (LC3) is a surrogate marker of autophagy. Among three forms of mammalian LC3, the major form, LC3B, is cleaved immediately adjacent to the carboxy-terminus to generate LCB-I; which is further lipidated to LC3B-II following ubiquitination. The active, lower molecular weight form of LC3, LC3B-II, is the form used as marker of autophagy. It was recently found that the clearance of dead cells in macrophages led to the accumulation of lipidated LC3BII and absence of unlipidated LC3BI18. A form of autophagy known as conventional autophagy, is characterized by the formation of a double membrane vacuole, the autophagosome, which is embeded with the

LC3BII protein17. The formation of the autophagosome starts with the pre-initiation complex which is activated by the dissociation of the autophagy protein ULK-1.

The preinitiation complex can be chemically activated upon addition of Rapamycin which binds to mTOR (mechanistic target of Rapamycin) and dissociates from the pre-initiation complex. Then the pre-initiation complex interacts with the isolation membrane, recruiting Beclin-1 and class-III phosphatidyl inositol 3-kinase (PI3K).

The product of this complex is phosphatidyl inositol 3-phosphate (PI3P), and

6 ubiquitin like conjugated systems I and II (Ub-I and Ub-II) are successively recruited. Ub-I and Ub-II bind phosphatidyl ethanolamine to light chain associated protein 1 (LC3BI), forming light chain associated protein II at the autophagosome

(LC3BII)19. One of the proteins important for forming Ub-1 is ATG-5, a protein important to our studies.

In contrast, LC3-associated phagocytosis (LAP) is a form of autophagy in which pathogens are engulfed into a single membrane vacuole that is embedded with the LC3BII protein and degrades bacteria more quickly than conventional autophagy17. LAP borrows some of the conventional autophagy machinery including the ubiquitin-like conjugation systems that utilize ATG-5 to recruit LC3BII to the membrane, however, LAP is independent of the ULK-1 protein18. LAP is believed to be an important pathway through which macrophages clear pathogens, and autophagy may be a back-up method in case pathogens such as Salmonella escape LAP14. Studies have shown that specific TLRs activate either LAP or autophagy pathways, but little investigation has been done for other receptors. In collaboration with Sarkar et al, a main focus of my thesis work is to interrogate whether the enteric pathogen Salmonella is cleared significantly by conventional autophagy in an ELMO1-dependent manner, a pathway downstream of the BAI1 receptor.

After bacteria are trapped in a membrane bound vesicle embedded with the

LC3BII protein, they can be degraded by fusion with the lysosome. Lysosomal enzymes such as cathepsin B, a cysteine endopeptidase, are transported from the

7 trans-Golgi network to the late endosome where they degrade bacteria or other pathogens when the late endosome fuses with the lysosome20. Also, cathepsin B was found to be important in cell signaling, IL-1β production and vesicle transport of TNF-α to the plasma membrane of macrophages21. The fusion of the endosome with the lysosome can only occur upon acidification of the late endosome. It has been suggested previously that acidification of the Salmonella-containing vacuole increases expression of genes within the Salmonella pathogenicity island-25. The effectors from the Salmonella pathogenicity island-2 inhibit bacterial killing inside macrophages and enhance survival of bacteria22. Therefore, in my proposal, the potential role of ELMO1 is tested in bacterial survival/clearance and the accumulation of lysosomal enzyme cathepsin B.

In the constant battle for survival between host and pathogen, Salmonella can modify the clearance pathways of the host by utilizing effectors from

Salmonella pathogenicity island-2. The Salmonella pathogenicity island-2 consists of a 25 kb locus important for replication and virulence within macrophages23. The genes within the Salmonella pathogenicity island-2 are regulated by two major components that are encoded by the SpiR and SsrB genes. SsrB can bind to all

Salmonella pathogenicity island 2 promoters including those in the SpiR region24.

In order to determine the participation of ELMO1 in Salmonella pathogenicity island-2 gene expression, we performed qRT-PCR on control and ELMO1- depleted macrophages following infection.

Materials and Methods

Cell lines and bacterial culture:

The murine macrophage cell line J774 (American Type Culture Collection

(ATCC), Manassas, VA, USA), control shRNA, and ELMO1-depleted shRNA J774 cells (a kind gift from Dr. Ravichandran, University of Virginia) were used as phagocytes. ELMO1-depleted shRNA cells were generated as reported previously12. Cells were maintained in high-glucose-containing DMEM (Life

Technologies, Carlsbad) supplemented with 10% fetal bovine serum (Life

Technologies), 2 mM penicillin-streptomycin (Sigma) and 0.5μg/ml puromycin

(Sigma). HEK-293 (ATCC) cells were used for some assays and were also maintained in high-glucose containing DMEM (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies), 2 mM penicillin-streptomycin

(Sigma). A wild type strain of Salmonella enterica serovar Typhimurium (SL1344) was used for infections. For this, a single colony was selected from LB agar plates, inoculated in LB broth and cultured for 6-8 h on a shaking platform to allow aeration. Finally, the culture was allowed to grow in a static oxygen limiting condition overnight. The ratio between bacteria and phagocytes was maintained at 10:1 for all experiments.

ATG-5 and ULK-1 Suppression:

ATG-5 and ULK-1 expression were suppressed with mouse ATG-5 and

ULK-1 siRNA (On Target Plus siRNA from Dharmacon, GE Life sciences). Control and ELMO1 shRNA J774 cells were plated on 6 well plates, transfected with 80

10 nM siRNA in 2 ml OptiMEM media using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) according to the supplier’s protocol.

Immunopulldown:

Human embryonic kidney 293 (HEK) cells were transfected with control vector or with BAI1 and FLAG-tagged ELMO1. Cells were uninfected or infected with Salmonella. Each condition was lysed and incubated with anti-FLAG agarose beads and separated by SDS-page.

Antibodies and other reagents:

Rabbit monoclonal antibody (mAb) to LC3B (1:1000, Cell Signaling

Technologies) was used for detecting LC3B accumulation by Western blotting.

Rabbit mAb Rab9 (1:1000, Cell Signaling Technologies), mouse pAb cathespsin

D (1:1000, Novus Biologicals), Rabbit mAB cathepsin B (1:1000, Cell Signaling technologies) and monoclonal Anti-FLAG (1:1000, Sigma) were used for Western blotting. Rapamycin and bafilomycin (100 nM) were procured from Sigma.

Western Blotting:

Control and ELMO1 shRNA cells were lysed in cold RIPA buffer (50 mM

Tris-HCl, 150 mM sodium chloride, 1mM EDTA, 0.25% sodium-deoxycholate, 1%

NP40) with freshly added protease inhibitor cocktail (Sigma). Equal amounts of proteins were loaded on each lane of the SDS-PAGE and transferred onto a nitrocellulose membrane (Bio-Rad). Membranes were blocked using 5% non-fat dry milk (Lab Scientific Inc.) in Tris Buffer Saline containing 0.05% Tween -20

(TBST) for 1h at room temperature. Membranes were then incubated with the appropriate primary antibody (ratio mentioned above) in 5% BSA containing TBST overnight at 4oC. Membranes were then washed and incubated with appropriate secondary antibody (1:4000, Cell Signaling Technologies) for 1h at room temperature in blocking buffer (5% non-fat dry milk in TBS containing 0.05%

Tween-20).

Bacterial Clearance by Plating Assay:

Control and ELMO1 shRNA cells were seeded into each well of a 24 well plate with 5x105 cells/well, 16h prior to infection. Cells were infected with SL 1344 at a moi (multiplicity of infection) of 10 for 30 min. Extracellular bacteria were killed with gentamicin treatment at a final concentration of 250 µg/ml for 90 min at 37◦ C followed by low gentamicin (25 µg/ml) for the rest of the time period. At 1 h, 3 h, 6 h, 12 h, and 24 h time points, cells in each well were washed twice with PBS and lysed in 1% Triton X 100 in PBS for 15 min at 37 ◦ C. Cell lysates were serially diluted from 10-1 to 10-6 and plated on LB agar plates and kept at 37◦ C overnight.

The colony forming units (CFUs) were counted the next day. The graph was plotted for bacterial clearance and survival for the indicated time after normalizing the CFU with the CFU of bacteria at 30 min of infection.

RNA Preparation, Quantitative Real Time-Reverse Transcriptase Chain

Reaction:

RNA was isolated from control and ELMO1 shRNA cells following infection with Salmonella for the respective time periods using the RNAzol Kit (Zymo

12 research). RNA was reverse transcribed with the RT-PCR Kit from Quanta

Biosciences. Quantitative RT-PCR was performed using buffers containing SYBR green (Biotool), and the forward and reverse primers of Salmonella pathogenicity island-2 genes sseA and sscB. The sequence of the primers was as follows: sseA

Forward: TTCTTCATAACCTATTTCCACAAGG, sseA Reverse: TGTTTCAGTCGTACTTCAAGTTGTTT; sscB Forward:

CGTTTATGCCAGTGGTTACG, sscB Reverse: ATCACCAGCCAACTAAAATCG; dnaK forward: TCACCGTACCGGCTTACTTT, dnaK Reverse:

CGTTGATGATACGTTTAACTTCCA. Ct values were calculated25 and normalized to the bacterial gene dnaK.

Statistical analysis:

Results are expressed as the mean ± SD. Results were compared using two-tailed

Student's t test and considered significant if p values were < 0.05.

III.

Results

After engulfing the target, phagocytes induce autophagy to clear the target/pathogen18,26. To test the involvement of ELMO1 in the autophagy pathway, we induced autophagy by treating control and ELMO1-depleted macrophages with

Rapamycin, a well-known inducer of autophagy17. We measured LC3BII

(discussed in the Introduction) as the marker of autophagy by Western blot. As shown in Figure 2, there was a decrease in accumulation of LC3BII in ELMO1- depleted macrophages when compared to control macrophages after Rapamycin treatment. This was true for all Rapamycin concentrations and time points used.

Interestingly, autophagy induction appeared more prominent with 200 nM treatment of Rapamycin for 20 h in control macrophages. This datum suggested that ELMO1 is involved in autophagy and that LC3BII accumulation is ELMO1- dependent in macrophages.

Previous literature showed that, ULK-1 and ATG-5 are required for LC3BII accumulation in autophagy, whereas LC3-associated phagocytosis recruits LC3BII to the phagosome independent of ULK-118. To test the effect of ELMO1 on autophagy, Control and ELMO1 shRNA macrophages were infected with

Salmonella, following down regulation of the autophagy proteins ATG-5 and ULK-

1. The accumulation of LC3BII was measured by Western blot. After Salmonella infection, there was a downregulation of LC3BII in ELMO1-depleted macrophages, but not in the control macrophages when transfected with control siRNA. In the

ATG-5 knockdown macrophages, there was a downregulation of LC3BII in both control and ELMO1-depleted macrophages, but the downregulation was

15 compounded in those that were ELMO1-depleted. The ULK-1 knockdown macrophages had comparable LC3BII levels to the control macrophages. These data indicate that LC3BII generates independently of ULK-1 following ELMO1- mediated Salmonella engulfment and the possible involvement of LC3-associated phagocytosis.

To evaluate whether ELMO1 is involved in bacterial degredation, the clearance of Salmonella by control and ELMO1 shRNA cells was measured by a plating assay (Figure 4). At the initial time point, we observed a lower bacterial count in ELMO1-depleted cells because ELMO1 is important for internalization of

Gram-negative bacteria8,9. Despite the attenuated internalization of Salmonella, the bacterial number was higher in ELMO1 shRNA cells starting from the 6 h time point, and the delayed clearance of bacteria by ELMO1-depleted macrophages continued at the 12 and 24 h time points. The delayed clearance of Salmonella in

ELMO1-depleted macrophages suggests that ELMO1 is involved not only in engulfment, but also in the clearance pathway.

To address the involvement of ELMO1 in the endocytic pathway, an immunoprecipitation assay was performed in collaboration with Pranadinata et al for ELMO1 and the late endosomal protein Rab 9. HEK 293 cells were transfected with control vector or BAI1 and FLAG-tagged ELMO1. Cell lysate was prepared and used for a pulldown assay with anti-FLAG agarose beads followed by an immunoblot with Rab9. The immunoblot in Figure 5 shows the interaction of

ELMO1 with Rab9. Late endosome protein Rab9, is involved in the retrograde

16 transport of mannose-6-phosphate receptors from the late endosome to the trans-

Golgi network20. Therefore, ELMO1 may be involved in the late endosomal pathway.

Since ELMO1 interacts with the late endosome protein Rab9, lysosomal enzyme cathepsin B was quantified in control and ELMO1-depleted macrophages by Western blot and Densitometry, as seen in Figure 6. ELMO1-depleted cells had more cathepsin B than control shRNA cells following infection at 3 hours. This is consistent with the accumulation of fewer bacteria in ELMO1-depleted cells up to

3 h post infection in our bacterial clearance data in Figure 4. At the 6 hour time point, the presence of cathepsin B was comparable in control and ELMO1- depleted macrophages. After 6 hours of infection, the cathepsin B level was higher in control cells. The decreased accumulation of cathepsin B in ELMO1-depleted cells correlates with our bacterial clearance data, shown in Figure 4, where there was delayed clearance in ELMO1-depleted macrophages after 6 hours post infection. The lower amount of cathepsin B in ELMO1-depleted macrophages after

6 hours of infection may be due to an interruption in the endosomal/ lysosomal pathway since ELMO1 interacts with Rab 9.

A previous report suggested that phagosome acidification during fusion with lysosomes and activation of lysosomal enzymes induces the expression of

Salmonella pathogenicity island-2 genes, responsible for bacterial survival inside the macrophage27. Due to the difference of cathepsin B accumulation in control and ELMO1-depleted macrophages, the gene expression of Salmonella

17 pathogenicity island-2 effectors; sseA and sscB were measured. The expression of these genes were at a low level until 6 hours post infection. At 6 hours of

Salmonella infection, there was a significant upregulation of sseA and sscB genes in control macrophages, but not in ELMO1-depleted macrophages. This correlates with control macrophages having more cathepsin B (Figure 6) after 6 hours of infection.

The Results, in part are being prepared for submission for publication of the material. Sarkar, Arup; Tindle, Courtney; Pranadinata, Rama; Ernst, Peter;

Das, Soumita. “ELMO1 regulates autophagic induction and bacterial clearance during Salmonella infection”

Figure 2: The ELMO1-dependent LC3BII Accumulation after Rapamycin Treatment: To determine if ELMO1 augments LC3BII accumulation after inducing autophagy, control and ELMO1 shRNA J774 macrophages were untreated or treated with Rapamycin (Rapa) at indicated concentrations and time points. Macrophages were then lysed, separated by SDS- PAGE and probed for the 14 KDa protein LC3BII, (Cell Signaling 1:1000) by Western blot. The bottom panel, GAPDH, was the loading control. The LC3BII accumulation was quantified using densitometry and normalized with the respective loading control (represented by numbers above the LC3BII bands). There was a decrease in LC3BII levels in ELMO1-depleted macrophages. Therefore, ELMO1 appears to be important for

LC3BII accumulation in autophagy. This data is representative of 3 separate experiments.

Figure 3: The ELMO1-dependent LC3BII Accumulation after Salmonella Infection: To understand the role of ELMO1 in the autophagy pathway, Control and ELMO1 shRNA J774 macrophages were transfected with Control, ATG-5 or ULK-1 siRNA and infected with Salmonella. Macrophages were lysed and separated by SDS-PAGE. The top panel was probed for the LC3BII (14 kDa) protein by Western blot, and the bottom panel, GAPDH, was the loading control. Protein accumulation was quantified by densitometry and normalized with the loading control. The LC3BII blot is representative of three separate experiments. After infection, there was less LC3BII accumulation in ELMO1-depleted macrophages, and this decrease was compounded with the ATG-5 knockdown. There was not a significant effect of ULK-1 in LC3BII accumulation because the knockdown of ULK-1 was comparable to Control siRNA. Thus, we speculate that ELMO1 has a functional relationship with ATG-5.

Figure 4: The Delayed Clearance of Salmonella in ELMO1-depleted Cells: To test if ELMO1 is involved in clearing bacteria, Control and ELMO1 shRNA cells (J774) were plated and then infected with Salmonella for 30 minutes. The extracellular bacteria were killed by treatment with gentamicin. Post treatment, the Control and ELMO1-depleted cells were lysed at different time points and plated so that the number of internalized bacteria could be determined. The number of bacteria in the initial 30-minute time point was used to normalize each successive time point and signifies the clearance/survival and replication of Salmonella. There was delayed clearance in ELMO1-depleted cells, indicating the importance of ELMO1 in bacterial clearance. A representative graph was selected from three independent experiments.

Figure 5: The Late Endosomal Marker Rab9 Interacts with ELMO1: We probed whether ELMO1 interacts with Rab9 by transfecting HEK-293 cells with control vector or with FLAG-tagged ELMO1. Cells were lysed and incubated with anti-Flag agarose beads and were immunoprecipitated with anti-FLAG conjugated agarose beads (Sigma). The top panel was probed with Rab9 (23 KDa, Cell Signaling 1:1000) and the bottom panel with α-Flag, the control to test the pulldown. The blot showed that ELMO1 interacts with RAb9, indicating that ELMO1 may be important for endosomal signaling.

Figure 6: The Regulation of Cathepsin B following Salmonella Infection: Since there was delayed clearance in ELMO1-depleted cells and ELMO1 interacts with Rab9, we wanted to know if ELMO1 has an influence on lysosomal enzyme accumulation. The cell lysates from control and ELMO1 shRNA cells, after indicated time of infection, were loaded on SDS-PAGE and immunoblotted with cathepsin B (42 KDa, Cell Signaling 1:1000) antibody by Western blot. Equal loading was checked by blotting with the loading control β-actin. Each band was quantified using Densitometry and normalized with the loading control. Initially, there was a higher accumulation of cathepsin B protein in ELMO1-depleted macrophages. After 12 h of infection, there was less cathepsin B in ELMO1-

21 depleted cells compared to control cells. The decrease in cathepsin B at later time points may be due to the interruption of its retrograde transport from the trans- Golgi because ELMO1 interacts with Rab9. The blot is a representative blot from three independent experiments.

Figure 7: The ELMO1-dependent SPI2 Gene Induction: We tested if there was a change in Salmonella pathogenicity-island 2 gene expression in ELMO1- depleted cells, compared to control cells, because there were differences in cathepsin B expression. RT-PCR of Salmonella infected control shRNA(Control) and ELMO1 shRNA (ELMO1) macrophages was used to measure the gene expression of sseA (top panel) or sscB (bottom panel). There was an increase in gene expression for both genes in control macrpohages at 6 h of infection. The induction of gene expression may be due to a higher acidity and more host

22 enzymes in control macrophages. The sseA and sscB gene expression is representative of two separate experiments.

IV.

Discussion

Clearance of Salmonella by LAP

Since LC3BII accumulates in the autophagy and LC3-associated phagocytosis clearance pathways, it can be used as a marker for the clearance of bacteria13. The depletion of ELMO1 in macrophages decreased the amount of

LC3IIB present after infection with Salmonella, suggesting that ELMO1 aids not only in internalization, but also in the clearance of Salmonella. Consistent with recent literature, knockdown of ATG-5 results in a decrease of LC3BII in control and ELMO1-depleted macrophages. This supports that ATG-5 is important for

LC3BII recruitment in autophagy and LC3-associated phagocytosis17. A novel observation was the greater decrease of LC3BII protein in ATG-5 knockdown

ELMO1-depleted macrophages when compared to control macrophages, suggesting that there is a functional interaction between ELMO1 and ATG-5. The effect of ATG-5 knocdown macrophages on Salmonella clearance needs to be studied in the future to better understand the importance of ATG-5 in autophagy pathways. There was not a significant effect on LC3BII accumulation in ULK-1 knockdown macrophages compared to the control macrophages, implying that

Salmonella is cleared mostly by LC3-associated phagocytosis. This is concurrent with the observation that LC3BII accumulation at the phagosome is independent of ULK-1 in the clearance of dead cells18.

ELMO1 Is Involved in Bacterial Clearance

When the clearance of Salmonella in control and ELMO1-depleted macrophages was probed, fewer colony forming units appeared in ELMO1-

25 depleted cells in the first 6 hours of infection. This observation is most likely due to less internalization of bacteria because ELMO1 aids in internalization8,9,12.

Interestingly, after the 6 h time point, ELMO1-depleted macrophages had more colony forming units than control macrophages. Bacterial replication is a factor that has to be considered for this observation, but it is unlikely that bacterial replication alone is the reason for more colony forming units because control macrophages would also have bacterial replication. Therefore, the data indicated that ELMO1 plays a role in degrading bacteria in addition to internalization.

ELMO1 Regulates the Endosome/ lysosome Pathway

Previously, our lab found that ELMO1 interacts with SPI2 effector SifA.

Interestingly, SifA interacts with late endosomal protein Rab928. We further investigated the interaction of endosomal proteins with ELMO1. In collaboration with Pranadinata et al, we found that ELMO1 interacts with Rab9, a protein associated with the late endosome, suggesting that ELMO1 may modulate the endosomal pathway to clear Gram-negative bacteria. Rab9 facilitates the retrograde transport of mannose-6-phosphate receptors to the trans-Golgi network, allowing newly synthesized lysosomal enzymes to be transported to the lysosome with recycled mannose-6-phosphate receptors20. It is possible that

ELMO1 affects retrograde transport of mannose-6-phosphate receptors, confirming why we observed lower levels of the lysosomal enzyme cathepsin B in

ELMO1-depleted macrophages after 6 hours of infection.

It has been reported recently that inhibition of cathepsin B decreased

Chlamydia muridarum clearance in RAW macrophages29. This finding concurs with our data that there was less accumulation of cathepsin B and delayed

Salmonella clearance after 6 hours of infection. Soon-Duck et al showed that depleting bone-marrow derived macrophages of cathepsin B and challenging them with LPS, resulted in less TNF-α secretion than control mice21. As mentioned previously, it was speculated that cathepsin B transports TNF-α to the plasma membrane in the cytosol. Since ELMO1-depleted macrophages secrete less TNF-

α, due to less bacterial internalization, less cathepsin B may be needed for TNF-α transport12. In the future, an activity assay for cathepsin B will be performed to give insight on the time-dependent changes in cathepsin B activity.

Induction of Salmonella Pathogenicity-Island 2 Genes in Macrophages

The host and pathogen are in a constant battle to survive as they are continually working against one another. Salmonella injects type III secretion effectors into its host to manipulate its clearance pathways to facilitate self survival.

We tested whether there was a change in Salmonella pathogenicity-island 2 bacterial gene expression in ELMO1-depleted macrophages, compared to control macrophages, at different times of infection. We observed an upregulation in the

Salmonella pathogenicity-island 2 bacterial gene expression of sseA and sscB in control macrophages at 6 hours of infection. This may be due to a lower pH and more lysosomal enzymes like cathepsin B in control macrophages as acidification has been found to induce bacterial gene expression27. SseA is believed to be a

27 promoter of a chaperone/ effector operon30. Similarly, sscB is a chaperone for a secretion protein and is responsible for Salmonella induced filament production.

The upregulation of virulent Salmonella effectors may have been evolutionary selected for to help Salmonella survive inside of its host. The expression of more effectors from Salmonella pathogenicity-island 2 will need to be measured to insure that this is a reoccurring trend.

Together, our results indicated a role for ELMO1 in the induction of LC3BII accumulation and bacterial clearance, possibly by modulating late endosomal processing. The association of ELMO1 with late endosomal signaling may be a target for controlling the intracellular survival of enteric bacteria. This is important because bacteria, such as Salmonella, are not completely cleared by elderly patients, small children, and people with compromised immune systems. The increased understanding of the clearance pathway of Salmonella as a model organism for enteric infection is crucial for decreasing the occurrence of bacterial disease.

References

1 Surveillance for foodborne disease outbreaks--United States, 2009-2010. MMWR Morb Mortal Wkly Rep 62(3), 41-47 (2013).

2 Bakowski, M. A., Braun, V. & Brumell, J. H. Salmonella-containing vacuoles: directing traffic and nesting to grow. Traffic 9, 2022-2031, doi:10.1111/j.1600-0854.2008.00827.x (2008).

3 Broz, P., Ohlson, M. B. & Monack, D. M. Innate immune response to Salmonella typhimurium, a model enteric pathogen. Gut Microbes 3, 62-70, doi:10.4161/gmic.19141 (2012).

4 Gross, M., Salame, T. M. & Jung, S. Guardians of the Gut - Murine Intestinal Macrophages and Dendritic Cells. Front Immunol 6, 254, doi:10.3389/fimmu.2015.00254 (2015).

5 Rappl, C., Deiwick, J. & Hensel, M. Acidic pH is required for the functional assembly of the type III secretion system encoded by Salmonella pathogenicity island 2. FEMS Microbiol Lett 226, 363-372 (2003).

6 LaRock, D. L., Chaudhary, A. & Miller, S. I. Salmonellae interactions with host processes. Nat Rev Microbiol 13, 191-205, doi:10.1038/nrmicro3420 (2015).

7 McGourty, K., Thurston, T. L., Matthews, S. A., Pinaud, L., Mota, L. J., % Holden, D. W. Salmonella inhibits retrograde trafficking of mannose-6- phosphate receptors and lysosome function. Science 338, 963-967, doi:10.1126/science.1227037 (2012).

8 Das, S., Owen K. A., Ly K. T., Park D., Black S. G., Wilson J. M., Sifri C. D., Ravichandran K. S., Ernst P. B., Casanova J. E. Brain angiogenesis inhibitor 1 (BAI1) is a pattern recognition receptor that mediates macrophage binding and engulfment of Gram-negative bacteria. Proc Natl Acad Sci U S A 108, 2136-2141, doi:10.1073/pnas.1014775108 (2011).

9 Das, S., Sarkar, A., Ryan, K. A., Fox, S., Berger, A. H., Juncadella, I. J., Bimczok, D., Smythies, L. E., Harris, P. R., Ravichandran, K. S., Crowe, S. E., Smith, P. D., Ernst, P. B. Brain angiogenesis inhibitor 1 is expressed by gastric phagocytes during infection with Helicobacter pylori and mediates the recognition and engulfment of human apoptotic gastric epithelial cells. FASEB J 28, 2214-2224, doi:10.1096/fj.13-243238 (2014).

10 Ravichandran, K. S. & Lorenz, U. Engulfment of apoptotic cells: signals for a good meal. Nat Rev Immunol 7, 964-974, doi:10.1038/nri2214 (2007).

11 Gumienny, T. L., Brugnera, E., Tosello-Trampont, A. C., Kinchen, J. M., Haney, L. B., Nishiwaki, K., Walk, S. F., Nemergut, M. E., Macara, I. G., Francis, R., Schedl, T., Qin, Y., Van Aelst, L., Hengartner, M. O., Ravichandran, K. S. CED-12/ELMO, a novel member of the CrkII/Dock180/Rac pathway, is required for phagocytosis and cell migration. Cell 107, 27-41 (2001).

12 Das, S. Sarkar, A., Choudhury, S. S., Owen, K. A., Castillo, V., Fox, S., Eckmann, L., Elliott, M. R., Casanova, J. E., Ernst, P. B. ELMO1 has an essential role in the internalization of Typhimurium into enteric macrophages that impacts disease outcome. Cell Mol Gastroenterol Hepatol 1, 311-324, doi:10.1016/j.jcmgh.2015.02.003 (2015).

13 Mostowy, S. Autophagy and bacterial clearance: a not so clear picture. Cell Microbiol 15, 395-402, doi:10.1111/cmi.12063 (2013).

14 Levine, B. Eating oneself and uninvited guests: autophagy-related pathways in cellular defense. Cell 120, 159-162, doi:10.1016/j.cell.2005.01.005 (2005).

15 Shahnazari, S. Yen, W. L., Birmingham, C. L., Shiu, J., Namolovan, A., Zheng, Y. T., Nakayama, K., Klionsky, D. J., Brumell, J. H. A diacylglycerol- dependent signaling pathway contributes to regulation of antibacterial autophagy. Cell Host Microbe 8, 137-146, doi:10.1016/j.chom.2010.07.002 (2010).

16 Delgado, M. A., Elmaoued, R. A., Davis, A. S., Kyei, G. & Deretic, V. Toll- like receptors control autophagy. EMBO J 27, 1110-1121, doi:10.1038/emboj.2008.31 (2008).

17 Mehta, P., Henault, J., Kolbeck, R. & Sanjuan, M. A. Noncanonical autophagy: one small step for LC3, one giant leap for immunity. Curr Opin Immunol 26, 69-75, doi:10.1016/j.coi.2013.10.012 (2014).

18 Martinez, J. Almendinger, J., Oberst, A., Ness, R., Dillon, C. P., Fitzgerald, P., Hengartner, M. O., Green, D. R. Microtubule-associated protein 1 light chain 3 alpha (LC3)-associated phagocytosis is required for the efficient clearance of dead cells. Proc Natl Acad Sci U S A 108, 17396-17401, doi:10.1073/pnas.1113421108 (2011).

19 Mizushima, N., Yoshimori, T. & Ohsumi, Y. The role of Atg proteins in autophagosome formation. Annu Rev Cell Dev Biol 27, 107-132, doi:10.1146/annurev-cellbio-092910-154005 (2011).

20 Riederer, M. A., Soldati, T., Shapiro, A. D., Lin, J. & Pfeffer, S. R. Lysosome biogenesis requires Rab9 function and receptor recycling from endosomes to the trans-Golgi network. J Cell Biol 125, 573-582 (1994).

21 Ha, S. D., Martins, A., Khazaie, K., Han, J., Chan, B. M., Kim, S. O. Cathepsin B is involved in the trafficking of TNF-alpha-containing vesicles to the plasma membrane in macrophages. J Immunol 181, 690-697 (2008).

22 Cirillo, D. M., Valdivia, R. H., Monack, D. M. & Falkow, S. Macrophage- dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survival. Mol Microbiol 30, 175- 188 (1998). 23 Ochman, H., Soncini, F. C., Solomon, F. & Groisman, E. A. Identification of a pathogenicity island required for Salmonella survival in host cells. Proc Natl Acad Sci U S A 93, 7800-7804 (1996).

24 Walthers, D., Carroll, R. K., Navarre, W. W., Libby, S. J., Fang, F. C., Kenney, L. J. The response regulator SsrB activates expression of diverse Salmonella pathogenicity island 2 promoters and counters silencing by the nucleoid-associated protein H-NS. Mol Microbiol 65, 477-493, doi:10.1111/j.1365-2958.2007.05800.x (2007).

25 Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408, doi:10.1006/meth.2001.1262 (2001).

26 Yu, H. B., Croxen, M. A., Marchiando A. M., Ferreira R. B., Cadwell K., Foster L. J. & Finlay B. B. Autophagy facilitates Salmonella replication in HeLa cells. MBio 5, e00865-00814, doi:10.1128/mBio.00865-14 (2014).

27 Arpaia, N., Godec, J., Lau, L., Sivick, S. E., McLaughlin, L. M., Jones, M. B., Dracheva, T., Perterson, S. N. & Monack, D. M. TLR signaling is required for Salmonella typhimurium virulence. Cell 144, 675-688, doi:10.1016/j.cell.2011.01.031 (2011).

28 Jackson, L. K., Nawabi, P., Hentea, C., Roark, E. A. & Haldar, K. The Salmonella virulence protein SifA is a G protein antagonist. Proc Natl Acad Sci U S A 105, 14141-14146, doi:10.1073/pnas.0801872105 (2008).

29 Rajaram, K. & Nelson, D. E. Chlamydia muridarum infection of macrophages elicits bactericidal nitric oxide production via reactive oxygen species and cathepsin B. Infect Immun 83, 3164-3175, doi:10.1128/IAI.00382-15 (2015).

30 Osborne, S. E. & Coombes, B. K. Transcriptional priming of Salmonella Pathogenicity Island-2 precedes cellular invasion. PLoS One 6, e21648, doi:10.1371/journal.pone.0021648 (2011).