Oncogene (2007) 26, 1477–1483 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc SHORT COMMUNICATION Regulation of localization and transcription by the HECT domain E3 ligase WWP1

A Laine and Z Ronai

Signal Transduction Program, The Burnham Institute for Medical Research, La Jolla, CA, USA

As a key cellular regulatory p53 is subject to tight 2003; Doran et al., 2004; Shmueli and Oren, 2005; regulation by several E3 ligases. Here, we demonstrate the Harris and Levine, 2005). Common to these ligases is role of HECT domain E3 ligase, WWP1, in regulating p53 their role in limiting p53 stability and activity. In localization and activity. WWP1 associates withp53 and searching for protein ligases with different effects on p53 induces p53 ubiquitylation. Unlike other E3 ligases, activity, we identified the HECT domain E3 ligase WWP1 increases p53 stability; inhibition of WWP1 WWP1, whose interaction with p53 increases its stability expression or expression of a ligase-mutant form results while reducing its transcriptional activity. in decreased p53 expression. WWP1-mediated stabilization WW domain-containing protein 1 (WWP1) was first of p53 is associated withincreased accumulation of p53 in identified as a novelprotein based on its WW modules– cytoplasm witha concomitant decrease in its transcrip- a 35–40 amino-acid (aa) region exhibiting high affinity tional activities. WWP1 effects are independent of Mdm2 towards the PY motif, a proline-rich sequence followed as they are seen in cells lacking Mdm2 expression. by a tyrosine residue (Verdecia et al., 2003). WWP1 Whereas WWP1 limits p53 activity, p53 reduces expres- shares a characteristic domain organization with the E3 sion of WWP1, pointing to a possible feedback loop ligases Nedd4 and Smurfs, which consists of a C2 mechanism. Taken together, these findings identify the first domain, 2–4 WW domains, and a HECT domain instance of a ligase that causes stabilization of (Kasanov et al., 2001). Although WWP1 has been p53 while inactivating its transcriptional activities. shown to function as an E3 , only few Oncogene (2007) 26, 1477–1483. doi:10.1038/sj.onc.1209924; substrates have been identified. Among these are published online 21 August 2006 Kru¨ ppel-like factors (Conkright et al., 2001; Zhang et al., 2004; Chen et al., 2005) and Smad7 (Moren et al., Keywords: p53; WWP1; ubiquitin; HECHT; E3 ligases; 2005), which have been shown to be regulated by transcription WWP1. Additionally, it has been reported that WWP1 is essentialfor embryonic development in Caenorhabdi- tis elegans (Huang et al., 2000). WWP1 is a member of the Nedd4 family of E3 ligases, The tumor-suppressor protein p53 is a primary coordi- which includes Nedd4, Itch and WWP2 (Sudol and nator of cellular responses to a wide range of stresses Hunter, 2000; Ingham et al., 2004). Members of the (Oren, 2003). After genotoxic stress, p53 is rapidly Nedd4 family have been shown to be involved in activated and either promotes cell growth arrest or regulating cellular signaling and protein sorting (Galinier apoptosis, depending on the type, strength and duration et al., 2002). Nedd4 was initially found to regulate cell of the stimulus (reviewed by Oren (2003), Sengupta and surface stability of the epithelial sodium channel (ENaC) Harris (2005) and Poyurovsky and Prives (2006)). Under (Staub et al., 1996). Itch has been shown to be regulated normalgrowth conditions, however, the levelofp53 by JNK and to play a role in TNF signaling (Chang expression and activity is kept under tight control, et al., 2006). Additionally, Itch has been shown to preventing its activity under nonwarranted conditions. interact with, ubiquitinate, and degrade p73 (Rossi et al., Such tight regulation is for the most part mediated by 2005). WWP2 has been shown to regulate the stability of limiting p53 stability by one of several ubiquitin ligases, the Oct-4 transcription factor, a master regulator including Mdm2, ARF-BP1, Pirh1 and the component affecting the fate of pluripotent embryonic stem cells of the signalosome, Cop9, which efficiently targets p53 (Xu et al., 2004). WWP1, WWP2 and Itch have been to ubiquitylation and proteasome-dependent degrada- implicated in vascular protein sorting, which is exploited tion (Haupt et al., 1997; Kubbutat et al., 1997; Ashcroft by enveloped viruses (Martin-Serrano et al., 2005). and Vousden, 1999; Brooks and Gu, 2003; Leng et al., Earlier studies have implicated the role of the proline- rich domain of p53 in its activities (Walker and Levine, Correspondence: Professor Z Ronai, SignalTransduction Program, 1996; Zhu et al., 2000). For example, the phosphoryla- The Burnham Institute for Medical Research, La Jolla, CA, 92037, tion of Thr81 within this domain has been shown to be USA. E-mail: [email protected] important in recruitment of the prolyl isomerase Pin1 Received 15 March 2006; revised 13 July 2006; accepted 14 July 2006; (Zacchi et al., 2002), which contributes to p53 stability published online 21 August 2006 and activity following stress. In searching for E3 ligases Regulation of p53 localization and transcription A Laine and Z Ronai 1478 that may associate with the proline-rich domains domain (aa 97–116), p53Dp7, still efficiently bound to (Bedford et al., 2000; Verdecia et al., 2000), we have WWP1. This observation suggests that the conforma- compared different members of the four WW-domains tion of p53, generated in the presence of the proline-rich for their association with p53. Among those, WWP1 domain, is important for efficient association with exhibited the strongest association (see data below). To WWP1. As WWP1 is part of a family of HECT-E3 map the region on p53 required for interaction with ligases that contain a C-terminal HECT domain and WWP1, we performed a GST-pull down assay. Surpris- N-terminalWW domains, we next determined whether ingly, WWP1 associated, not with the proline-rich other members of the Nedd4 family can also associate region (1–100) but rather with the DNA-binding region with p53. GST-pull down assay using full-length p53 of p53 (100–295) (Figure 1a). However, the proline-rich and the four members of the Nedd4 family revealed that region was required for efficient interaction in vivo, WWP1 displayed the strongest association. WWP2 because a mutant of p53 that lacks this region (aa showed weaker association whereas Nedd4 and Itch 68–91), p53D6, showed a weaker association with WWP1 showed no association (Figure 1c). These data suggest in a co-immunoprecipitation assay (Figure 1b). Another that WWP1 is the primary Nedd4 family member that mutant which lacks a region downstream of the proline associates with p53 and that both the DNA-binding and

∆ a b p53 p7 ---+ ∆ p53 p6 - - + - p53wt ---+ Flag-WWP1 ++++

IB : Flag IP : his 10% InputGST-p53GST-p53 FL GST-p53 1-100GST-p53 100-295GST-p53 295-393 100-393 IB : his 35S-WWP1 Autorad

kDa IB : Flag 100 IP : Flag 73 IB : his 54 Coomassie

48 IB : Flag WCE 35 IB : his 12 34 5 1234

c 35S-Nedd4 + ++ 35S-Itch +++ 35S-WWP2 + ++ + 35S-WWP1 +++ kDa 130 100 Autorad 72

10% Input

Coomassie

GST GST-p53 FL Figure 1 WWP1 associates with p53. (a) In vitro GST pull down between 35S-radiolabeled WWP1 and either full-length p53 or different fragments of p53. Top panelis autoradiograph of bound WWP1 and lowerpanelis coomassie stain of GST . (b) In vivo association. In p53À/À/Mdm2À/À MEFs either his-tagged wild-type p53 or p53D6 (deleted of aa 68-91) or p53D7 (deleted of aa 97–116) was co-transfected with Flag-WWP1. Proteins were precipitated using either anti-his or anti-flag antibodies and samples separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). Western blot was performed to detect the respective proteins. (c) In vitro GST pull down between GST-p53 and other HECT E3 ligases. GST or GST-p53 full-length was incubated with 35S-radiolabeled WWP1, WWP2, Itch or Nedd4. Top panel is autoradiograph of bound E3 ligases and lower panel is coomassie stain of GST proteins.

Oncogene Regulation of p53 localization and transcription A Laine and Z Ronai 1479 the proline-rich domains of p53 are required for this possible role of Mdm2, p53À/À/Mdm2À/À mouse embryo association. fibroblasts (DKO MEFs) were used. Coexpression of As WWP1 is an E3 ligase, we next determined the WWP1 with p53 in the DKO MEFs increased p53 possible role of WWP1 in p53 stability. To exclude the steady-state levels (Figure 2a). A ligase-dead mutant of

a b

MG132 Flag-WWP1mut - --++ Flag-WWP1mut - - - - - 1.0 Flag-WWP1wt ++- -- Flag-WWP1wt - --0.1 1.0 2.0 p53wt - + +++ p53wt -+++++ IB : p53 IB : p53 IB : Flag IB : Flag IB : GFP IB : GFP 123456 12345

c d

MG132 Time 0 1230123 Flag-WWP1mut - - 1.0 2.02.0 Flag-WWP1wt ----++++ Flag-WWP1wt ----1.0 p53wt ++++++++ IB : p53 Autorad

IB : Flag IB : Flag IB : hdm2 IB : GFP IB : GFP 12345678 12345

e f NT pS-controlpS-WWP-99

IB : WWP1 pS-controlpS-WWP-98pS-WWP-2663 pS-controlpS-WWP-98pS-WWP-2663 p53wt +++ Flag-WWP1wt +++ IB : p53 IB : Flag IB : p53 IB : GFP IB : GFP 123 12 3 IB : p21

IB : β-actin 123 Figure 2 Effect of WWP1 on p53. (a) WWP1 increases p53 protein levels. In p53À/À/Mdm2À/À MEFs, p53 was co-transfected with either wild-type or mutant WWP1. At 24 h after transfection, some cells were treated with 40 mM of MG132 for 4 h before harvesting. Proteins were separated by SDS–PAGE and analysed by Western blot. The band corresponding to p53 is indicated by the arrow. (b) WWP1 acts in a dose-dependent manner. In p53À/À/Mdm2À/À MEFs, increasing amounts of WWP1 (mg, indicated in figure) were co-transfected with a constant amount of p53. At 24 h after transfection, cells were harvested and proteins were separated by SDS– PAGE and analysed by Western blot. (c) WWP1 increases levels of endogenous p53. U2OS cells were transfected with either wild-type or mutant WWP1 (mg indicated). At 24 h after transfection, some cells were treated with 40 mM of MG132 for 4 h before harvesting. Proteins were separated by SDS–PAGE and analysed by Western blot. (d) WWP1 increases the half-life of p53. In p53À/À/Mdm2À/À MEFs, p53 was co-transfected with Flag-WWP1. At24 h after transfection, cells were incubated with 35S-methionine for 1 h and incubated with excess unlabeled methionine for the indicated time periods (in h). Cells were harvested and lysates immunoprecipitated using anti-p53 antibody. The immunoprecipitates were separated by SDS–PAGE and then exposed to film. A fraction of the lysates was used to determine expression of Flag-WWP1 and GFP as a control of transfection efficiency. (e) Knockdown of exogenous WWP1 decreases p53 stability. In p53À/À/Mdm2À/À MEFs, p53 was co-transfected with the shRNA pSuper plasmid containing either the control sequence or two different sequences directed against WWP1. At 48 h after transfection, cells were harvested and protein levels determined. In the right panel, the efficiency of the shRNA was determined by co-transfecting the pSuper plasmids with Flag-WWP1 in p53À/À/Mdm2À/À MEFs. (f) Knockdown of endogenous WWP1 decreases p53 stability. In LOX-IMVI melanoma cells, p53 was co-transfected with the shRNA pSuper plasmid containing either the control sequence or a sequence directed against WWP1 (AAGAACTGGTTCGGAACAGCA). At 48 h after transfection, cells were harvested and protein levels determined. WWP1 is indicated by an arrow.

Oncogene Regulation of p53 localization and transcription A Laine and Z Ronai 1480 WWP1 (C883A; where the catalytic cysteine residue is To determine a possible mechanism that may explain mutated to arginine) failed to stabilize p53. In fact, p53 these observations, we monitored localization of p53 stability was remarkably reduced upon expression of after WWP1 expression. The primary localization of p53 mutant WWP1, suggesting that it serves as an efficient within the nucleus turned out to be cytosolic upon dominant negative (Figure 2a). Consistent with this expression of wild-type WWP1 (Figure 3d). Mutant conclusion is the observation that the effect of the WWP1 was unable to facilitate cytosolic localization of WWP1 mutant could be attenuated upon addition of p53. These findings suggest that WWP1 promotes the proteasome inhibitor MG132, suggesting that the nuclear export of p53. This conclusion is supported by WWP1 mutant increases p53 degradation (Figure 2a). the observation that treatment with the nuclear-export These data suggest that stabilization of p53 by WWP1 inhibitor Leptomycin B attenuated WWP1’s ability to requires its E3 ligase activity. WWP1 stabilized p53 in a cause redistribution of p53. Consistent with these dose-dependent manner in the DKO MEFs (Figure 2b), findings is the observation that WWP1 elicited a similar suggesting an MDM2-independent effect on p53 stabi- effect on Smad7. Wild-type, but not mutant WWP1, lity. Furthermore, WWP1 also affected endogenous p53 causes export of Smad7 from the nucleus to the cytosol steady-state levels; in U2OS cells, wild-type WWP1 led (Moren et al., 2005). Taken together, these findings to an increase in p53 levels, whereas the ligase mutant suggest that increase in p53 levels after WWP1 expres- WWP1 decreased p53 levels (Figure 2c). Again, protea- sion is associated with its export to the cytosol, which some inhibitors could attenuate the effect of mutant results in decreased p53 transcriptional activities. This WWP1 on p53 and the levels of hdm2 were unaffected is further supported by the finding that knockdown by expression of WWP1. To determine whether WWP1 of WWP1 leads to an increase in the levels of mediates increase in p53 levels post-transcriptionally, we p21 expression, a marker for increased p53 activity performed a cycloheximide chase analysis in DKO (Figure 2f). MEFs. p53 alone had a half-life of approximately Interestingly, increased expression of p53 in DKO 1.5 h. Upon coexpression with WWP1, the half-life of MEFs decreased WWP1 levels (Figure 4a). This effect p53 increased to more than 3 h (Figure 2d). These data could not be blocked by addition of MG132, suggesting suggest that WWP1 increases p53 levels by prolonging that the p53-mediated decrease in WWP1 is not its half-life. We next sought to determine whether proteasome-dependent. This effect was substantiated in WWP1 is required for p53 stability. Using shRNAi cells that express p53 or lack such expression. p53À/À against WWP1, we observed that knocking down MEFs exhibited higher WWP1 levels that were reduced exogenously expressed WWP1 led to a corresponding upon reconstitution with p53 (Figure 4b). As MG132 decrease in p53 levels (Figure 2e). Furthermore, similar could not block p53’s effect on WWP1, we tested the results were obtained using endogenous proteins; knock- possibility that p53 affects WWP1 transcriptionally. down of endogenous WWP1 lead to a decrease in p53 To this end, levels of WWP1 transcripts were followed levels (Figure 2f). These results are consistent with the in p53 þ / þ and p53À/À MEFs under normalgrowth effects observed with mutant WWP1: in both cases, conditions and after exposure to UV-irradiation or attenuating WWP1 activity, either by mutation or g-irradiation. UV-irradiation decreased transcript levels knockdown, decreased p53 stability. in p53 þ / þ cells. This effect was time dependent and not To address the possible mechanism of WWP1’s effect seen within the first 4 h in p53À/À cells (Figure 4c). This on p53 stability, we determined WWP1’s effect on p53 time frame corresponded to activation of p53, as was ubiquitylation. Expression of WWP1 in DKO MEFs assessed by monitoring p53 target genes p21 and revealed that wild-type WWP1 facilitated p53 ubiquity- survivin. In fact, WWP1 showed similar changes to lation, whereas the ligase mutant could not ubiquitinate those seen with survivin, which is known to be p53 (Figure 3a). The level of ubiquitylation of p53 by transcriptionally repressed by p53 (Hoffman et al., WWP1 was modest compared to that of p53 by Mdm2. 2002; Wang et al., 2004). Similar results were obtained Of note, however, whereas expression of WWP1 when treating p53 þ / þ or p53À/À MEFs with g-irradiation increased steady-state levels of p53, Mdm2 decreased (Figure 4d). These results suggest a possible feedback them (compare lanes 2 and 5 in Figure 3a). WWP1’s mechanism between p53 and WWP1. ability to facilitate ubiquitylation of p53 was confirmed Our findings point to the role of WWP1 in inactiva- by performing an in vitro ubiquitylation assay tion of p53 transcriptionalactivities under nonstressed (Figure 3b). In this assay, WWP1 promoted ubiquityla- conditions. At this point we cannot exclude the tion of p53 to a degree similar to that seen with Mdm2; possibility that localization of p53 to the cytosol by in both cases, in addition to polyubiquitylation, a clear WWP1 does not serve an as yet undisclosed function of monoubiquitinated form of p53 was seen. p53 within the cytosol, which is expected in light of its Given WWP1’s effect on ubiquitylation-dependent increased stability. Given that WWP1 (along with other stabilization of p53, we next explored its effect on p53 members of this ligase family) has been implicated in transcriptionalactivity using a luciferase construct vacuolar protein sorting (Martin-Serrano et al., 2005), it driven by the p21-promoter. Expression of wild-type would be of interest to explore possible role of WWP1- WWP1 led to a dose-dependent decrease in p21 modified p53 in this process. WWP1-modified p53 is transactivation by p53, whereas the mutant WWP1 expected to carry a noncanonicalubiquitin chain, given had no effect (Figure 3c). This result was surprising in that such ubiquitylation results in its stabilization rather light of our finding that WWP1 increases p53 stability. than degradation. Upon stress, inactivation of WWP1 is

Oncogene Regulation of p53 localization and transcription A Laine and Z Ronai 1481

Figure 3 WWP1 ubiquitinates and affects p53’s activity and localization. (a) In vivo ubiquitylation of p53 by WWP1. In p53À/À/ Mdm2À/À MEFs, wild-type or mutant WWP1 was co-transfected with p53 and his-tagged ubiquitin. At 48 h after transfection, cells were harvested using guanidium hydrochloride and then Ni-NTA beads were used to pull down his-ubiquitin conjugated proteins. Proteins were separated by SDS–PAGE and then Western blot was performed using a mixture of monoclonal p53 antibodies. An aliquot of the cell lysate was used for Western blot analysis of the various expressed proteins. Hdm2 was used as a positive control for p53 ubiquitylation. Monoubiquitinated p53 is indicated with an arrow. (b) In vitro ubiquitylation of p53 by WWP1. In vitro transcribed and translated 35S-radiolabeled p53 was incubated with unlabeled in vitro transcribed and translated wild-type or mutant WWP1, E6 and E6AP, or Mdm2. All reactants were transcribed using the T7 promoter (pcDNA3). Recombinant E1, Ubch5c and ubiquitin were added. The reaction mixture was incubated at 371C for 90 min and separated by SDS–PAGE and exposed to film. (c)WWP1 expression decreases p53 transcriptionalactivity. p53À/À/Mdm2À/À MEFs were transfected with pGL3-p21 luciferase plasmid with p53 and/or WWP1 wild-type or mutant (mg indicated). The level of transcriptional activation was monitored by determining luciferase activity and normalizing to internal control b-galactosidase activity. (d) WWP1 causes cytoplasmic localization of p53. In p53À/À/ Mdm2À/À MEFs, the indicated constructs were transfected. At 24 h after transfection, some cells were treated with leptomycin B (2 mM) for 4 h before fixation. After fixing, cells were permeabilized and stained for p53 (using polyclonal antibody FL-393) and WWP1 (using monoclonal anti-Flag antibody). Nuclei were counterstained with DAPI and images taken through a confocal microscope. expected to enable a complete activation of p53. The activities. The role of WWP1 in mediating increased inverse correlation between WWP1 and p53 is expected expression but decreased activity of the tumor- to persist in cells that harbor functional p53 but not in suppressor p53 represents a previously unrecognized those where p53 is mutated or deleted. Consistent with regulatory mode. The effect of WWP1 is independent this hypothesis is the observation that tumor cells with of Mdm2 but nevertheless resembles changes after inactive p53 exhibit elevated levels of WWP1 expression monoubiquitylation of p53 by low levels of Mdm2 (http://symatlas.gnf.org). (Li et al., 2003). Overall, our current findings highlight a previously un- One would expect that WWP1 activity occurs described mechanism for regulation of p53 transcriptional primarily under conditions in which Mdm2 is not active

Oncogene Regulation of p53 localization and transcription A Laine and Z Ronai 1482 a b

MG132 p53wt - 0.1 0.5 1.0 2.0 1.0 Flag-WWP1wt + +++ ++ p53wt - + IB : Flag IB : WWP1

IB : p53 IB : p53

IB : GFP IB : GFP 12 123456

+/+ -/- +/+ -/- p53 p53 c p53 p53 d 0248 0248 UV 0 2 4 8 0 2 4 8 IR

WWP1 WWP1

p21 p21

Survivin Survivin

GAPDH GAPDH

1234 567 8 1234 5678 Figure 4 p53 regulates WWP1 levels. (a) p53 reduces expression of WWP1. In p53À/À/Mdm2À/À MEFs, increasing levels of p53 (mg indicated) were transfected with a constant amount of Flag-WWP1. At 24 h after transfection, some cells were treated with 40 mM of MG132 for 4 h before harvesting. Proteins were separated by SDS–PAGE and analysed by Western blot. (b) p53 decreases expression of endogenous WWP1. In p53À/À MEFs, p53 was expressed. At 36 h after transfection, cells were harvested and protein levels analysed by Western blot. (c) p53 decreases WWP1 mRNA following UV treatment. Either p53 þ / þ or p53À/À MEFs were exposed to 30 J/m2 of UV irradiation. Cells were harvested and mRNA extracted at the indicated time points (in h). mRNA was used for semiquantitative reverse transcription–polymerase chain reaction (RT–PCR) using 32P-dCTP. Levels of WWP1, p21, Survivin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA were assessed. (d) p53 decreases WWP1 mRNA following IR treatment. Either p53 þ / þ or p53À/À MEFs were exposed to 8 Gy of g-irradiation. Cells were harvested and mRNA extracted at the indicated time points (in h). mRNA was used for semiquantitative RT–PCR using 24 cycles. Levels of WWP1, p21, Survivin and GAPDH mRNA were assessed by staining gels with ethidium bromide.

or available; it is also plausible that elevated WWP1 Acknowledgements expression as seen in human tumors may override the We thank Marius Sudoland Tony Hunter for providing us with effect of Mdm2, thereby attenuating p53 activities. WWP1 reagents, Stephen Jones for p53/Mdm2 DKO cells, and Further studies will be required to address such ZQ Pan, J Manfredi and M O’Connell for advice. A Laine relationships as well as the mechanism underlying p53 performed these studies as part of his work for the MD/PhD nuclear export by WWP1 and the function of p53 in the program at Mount Sinai Schoolof Medicine, New York, NY. cytosolunder nonstressed. Support by NCI grant CA78419 to ZR is gratefully acknowledged.

References

Ashcroft M, Vousden KH. (1999). Regulation of p53 stability. Chang L, Kamata H, Solinas G, Luo JL, Maeda S, Oncogene 18: 7637–7643. Venuprasad K, Liu YC, Karin M. (2006). The E3 ubiquitin Bedford MT, Sarbassova D, Xu J, Elder P, Yaffe MB. (2000). ligase itch couples JNK activation to TNFalpha-induced cell A novelpro-Arg motif recognized by WW domains. J Biol death by inducing c-FLIP(L) turnover. Cell 124: 601–613. Chem 275: 10359–10369. Chen C, Sun X, Guo P, Dong XY, Sethi P, Cheng X et al. Brooks CL, Gu W. (2003). Ubiquitination, phosphorylation (2005). Human Kruppel-like factor 5 is a target of the E3 and acetylation: the molecular basis for p53 regulation. Curr ubiquitin ligase WWP1 for proteolysis in epithelial cells. Opin Cell Biol 15: 164–171. J Biol Chem 280: 41553–41561.

Oncogene Regulation of p53 localization and transcription A Laine and Z Ronai 1483 Conkright MD, Wani MA, LingrelJB. (2001). Lung Kruppel- Oren M. (2003). Decision making by p53: life, death and like factor contains an autoinhibitory domain that regulates cancer. Cell Death and Diff 10: 431–442. its transcriptionalactivation by binding WWP1, an E3 Poyurovsky MV, Prives C. (2006). Unleashing the power of ubiquitin ligase. J Biol Chem 276: 29299–29306. p53: lessons from mice and men. Genes Dev 15: 125–131. Doran D, Wertz I, Shimizu H, Arnott D, Frantz GD, Dowd P Rossi M, De Laurenzi V, Munarriz E, Green DR, Liu YC, et al. (2004). The ubiquitin ligase COP1 is a critical negative Vousden KH et al. (2005). The ubiquitin-protein ligase Itch regulator of p53. Nature 429: 86–92. regulates p73 stability. EMBO J 24: 836–848. Galinier R, Gout E, Lortat-Jacob H, Wood J, Chroboczek J. Sengupta S, Harris CC. (2005). p53: traffic cop at the (2002). Adenovirus protein involved in virus internali- crossroads of DNA repair and recombination. Nature Rev zation recruits ubiquitin-protein ligases. Biochemistry 41: Mol Cell Biol 6: 44–55. 14299–14305. Shmueli A, Oren M. (2005). Life, death, and ubiquitin: taming Harris SL, Levine AJ. (2005). The p53 pathway: positive and the mule. Cell 121: 963–965. negative feedback loops. Oncogene 24: 2899–2908. Sudol M, Hunter T. (2000). NeW wrinkles for an old domain. Haupt Y, Maya R, Kazaz A, Oren M. (1997). Mdm2 promotes Cell 103: 1001–1004. the rapid degradation of p53. Nature 387: 296–299. Staub O, Dho S, Henry P, Correa J, Ishikawa T, McGlade J Hoffman WH, Biade S, Zilfou JT, Chen J, Murphy M. (2002). et al. (1996). WW domains of Nedd4 bind to the proline-rich Transcriptionalrepression of the anti-apoptotic survivin PY motifs in the epithelial Na+ channel deleted in Liddle’s gene by wild type p53. J Biol Chem 277: 3247–3257. syndrome. EMBO J 15: 2371–2380. Huang K, Johnson KD, Petcherski AG, Vandergon T, Verdecia MA, Bowman ME, Lu KP, Hunter T, NoelJP. Mosser EA, Copeland NG et al. (2000). A HECT domain (2000). Structuralbasis for phosphoserine-prolinerecogni- ubiquitin ligase closely related to the mammalian protein tion by group IV WW domains. Nat Struct Biol 7: 639–643. WWP1 is essentialfor Caenorhabditis elegansembryo- Verdecia MA, Verdecia MA, Joazeiro CA, Wells NJ, genesis. Gene 252: 137–145. Ferrer JL, Bowman ME et al. (2003). Conformational Ingham RJ, Gish G, Pawson T. (2004). The Nedd4 family of flexibility underlies ubiquitin ligation mediated by the E3 ubiquitin ligases: functional diversity within a common WWP1 HECT domain E3 ligase. Mol Cell 11: 249–259. modular architecture. Oncogene 23: 1972–1984. Walker KK, Levine AJ. (1996). Identification of a novel p53 Kasanov J, Pirozzi G, Uveges AJ, Kay BK. (2001). Charac- functionaldomain that is necessary for efficient growth terizing Class I WW domains defines key specificity suppression. Proc Natl Acad Sci USA 93: 15335–15340. determinants and generates mutant domains with novel Wang Z, Fukuda S, Pelus LM. (2004). Survivin regulates specificities. Chem Biol 8: 231–241. the p53 tumor suppressor gene family. Oncogene 23: Kubbutat MH, Jones SN, Vousden KH. (1997). Regulation of 8146–8153. p53 stability by Mdm2. Nature 387: 299–303. Xu HM, Liao B, Zhang QJ, Wang BB, Li H, Zhong XM et al. Leng RP, Lin Y, Ma W, Wu H, Lemmers B, Chung S et al. (2004). Wwp2, an E3 ubiquitin ligase that targets transcrip- (2003). Pirh2, a p53-induced ubiquitin-protein ligase, tion factor Oct-4 for ubiquitination. J Biol Chem 279: promotes p53 degradation. Cell 112: 779–791. 23495–23503. Li M, Brooks CL, Wu-Baer F, Chen D, Baer R, Gu W. (2003). Zacchi P, Gostissa M, Uchida T, Salvagno C, Avolio F, Mono- versus polyubiquitination: differential control of p53 Volinia S et al. (2002). The prolyl isomerase Pin1 reveals a fate by Mdm2. Science 302: 1972–1975. mechanism to controlp53 functions after genotoxic insults. Martin-Serrano J, Eastman SW, Chung W, Bieniasz PD. Nature 419: 853–857. (2005). HECT ubiquitin ligases link viral and cellular PPXY Zhang X, Srinivasan SV, LingrelJB. (2004). WWP1- motifs to the vacuolar protein-sorting pathway. J Cell Biol dependent ubiquitination and degradation of the lung 168: 89–101. Kruppel-like factor, KLF2. Biochem Biophys Res Commun Moren A, Imamura T, Miyazono K, Heldin CH, Moustakas A. 316: 139–148. (2005). Degradation of the tumor suppressor Smad4 by WW Zhu J, Zhang S, Jiang J, Chen X. (2000). Definition of the p53 and HECT domain ubiquitin ligases. J Biol Chem 280: functionaldomains necessary for inducing apoptosis. J Biol 22115–22123. Chem 275: 39927–39934.

Oncogene