This is the accepted version of the following article:
Snežana Radenković, Ljiljana Šašić Zorić, Mihajla Djan, Dragana Obreht Vidaković, Jelena Ačanski, Gunilla Ståhls, Nevena Veličković, Zlata Markov, Theodora Petanidou, Nataša Kočiš Tubić, Ante Vujić (2018) Cryptic speciation in the Merodon luteomaculatus complex (Diptera: Syrphidae) from the eastern Mediterranean. Journal of Zoological Systematics and Evolutionary Research, 56(2): 170-191., which has been published in final form at [https://doi.org/10.1111/jzs.12193]. This article may be used for non-commercial purposes in accordance with the Wiley Self-Archiving Policy [https://authorservices.wiley.com/author-resources/Journal-Authors/licensing-open-access/open- access/self-archiving.html]. Journal of Zoological Systematics and Evolutionary Research
Cryptic speciation in the Merodon luteomaculatus complex (Diptera: Syrphidae) from the Eastern Mediterranean
Journal:For Journal Review of Zoological Systematics Only and Evolutionary Research Manuscript ID JZS.201700031.R3
Wiley Manuscript type: Original Article
Date Submitted by the Author: n/a
Complete List of Authors: Radenkovic, Snezana; Faculty of Sciences, Department of Biology and Ecology Šašić Zorić, Ljiljana; University of Novi Sad, BioSense Institute Djan, Mihajla; Faculty of Sciences, Department of Biology and Ecology Obreht Vidaković, Dragana; University of British Columbia, Department of Forest and Conservation Sciences Ačanski, Jelena; University of Novi Sad, BioSense Institute Ståhls, Gunilla; Finnish Museum of Natural History, Zoology unit Veličković, Nevena; Faculty of Sciences, Department of Biology and Ecology Markov, Zlata; Faculty of Sciences, Department of Biology and Ecology Petanidou, Theodora; University of the Aegean, Department of Geography Kočiš Tubić, Nataša; Faculty of Sciences, Department of Biology and Ecology Vujić, Ante; Faculty of Sciences, Department of Biology and Ecology
The Balkan Peninsula and Aegean region, hoverflies, DNA sequence data, Keywords: palaeogeography, wing and male genitalia geometric morphometry
The Merodon aureus group is characterized by high endemism and the presence of morphologically cryptic species. Within one of its sub groups, M. bessarabicus , seven species and four more species complexes have been described to date. One of these complexes, the M. luteomaculatus , comprises new taxa that are the subject of the present study. Its members have allopatric ranges restricted to the Balkan Peninsula and Aegean islands. This complex exhibits morphological variability that could not be characterized using a traditional morphological approach. Thus, we used Abstract: integrative taxonomy with independent character sets (molecular, geometric morphometric, distributional) to delimit species boundaries. Data on three molecular markers ( COI , 28S rRNA , ISSR), geometric morphometry of the wing and male genitalia, together with distributional data, enabled recognition of six cryptic species within the complex: M. andriotes sp. n., M. euri sp. n., M. erymanthius sp. n., M. luteomaculatus sp. n., M. naxius sp. n. and M. peloponnesius sp. n. We discuss the possible influence of Aegean palaeogeographic history on the speciation of this complex.
Page 1 of 84 Journal of Zoological Systematics and Evolutionary Research
For Review Only Journal of Zoological Systematics and Evolutionary Research Page 2 of 84
1 Cryptic speciation in the Merodon luteomaculatus complex (Diptera: Syrphidae) from 2 the Eastern Mediterranean
3 Runing title: Merodon luteomaculatus complex
4 Snežana Radenković 1, Ljiljana Šašić Zorić 2,* , Mihajla Djan 1, Dragana Obreht Vidaković 3, 5 Jelena Ačanski 2, Gunilla Ståhls 4, Nevena Veličković 1, Zlata Markov 1, Theodora Petanidou 5, 6 Nataša Kočiš Tubić 1, Ante Vujić 1
7 1 Department of Biology and Ecology, Faculty of Sciences, University of Novi Sad, Trg 8 Dositeja ObradovićaFor 2, 21000 Review Novi Sad, Serbia. Only Phone: +381214852656, Fax: 9 +38121450620
10 2 BioSense Institute Research Institute for Information Technologies in Biosystems, 11 University of Novi Sad, Dr Zorana Đinđića 1, 21000 Novi Sad, Serbia. Phone: +38121485 12 2137
13 3 Department of Forest and Conservation Sciences, University of British Columbia, #3027 – 14 2424 Main Mall, Vancouver, BC, V6T 1Z4. Phone: 604822 2507, Fax: 6048229102
15 4 Zoology Unit, Finnish Museum of Natural History, PO Box 17, 00014 University of 16 Helsinki, Finland. Phone: +3585031828824
17 5 Laboratory of Biogeography and Ecology, Department of Geography, University of the 18 Aegean, Mytilene, Greece. Phone: +302251036406, Fax: +30251036423.
19
20 *Corresponding author: [email protected]
21
22
23 Key words: The Balkan Peninsula and Aegean region, hoverflies, DNA sequence data, 24 palaeogeography, wing and male genitalia geometric morphometry.
1
Page 3 of 84 Journal of Zoological Systematics and Evolutionary Research
25 Abstract
26 The Merodon aureus group is characterized by high endemism and the presence of 27 morphologically cryptic species. Within one of its sub groups, M. bessarabicus , seven 28 species and four more species complexes have been described to date. One of these 29 complexes, the M. luteomaculatus , comprises new taxa that are the subject of the present 30 study. Its members have allopatric ranges restricted to the Balkan Peninsula and Aegean 31 islands. This complex exhibits morphological variability that could not be characterized using 32 a traditional morphological approach. Thus, we used integrative taxonomy with independent 33 character sets (molecular,For geometric morphometric,Review Only distributional) to delimit species 34 boundaries. Data on three molecular markers ( COI , 28S rRNA , ISSR), geometric 35 morphometry of the wing and male genitalia, together with distributional data, enabled 36 recognition of six cryptic species within the complex: M. andriotes sp. n., M. euri sp. n., M. 37 erymanthius sp. n., M. luteomaculatus sp. n., M. naxius sp. n. and M. peloponnesius sp. n. We 38 discuss the possible influence of Aegean palaeogeographic history on the speciation of this 39 complex.
2
Journal of Zoological Systematics and Evolutionary Research Page 4 of 84
40 Introduction
41 The hoverfly genus Merodon Meigen, 1803 comprises more than 160 species distributed over 42 Palaearctic and Ethiopian regions (Ståhls et al., 2009; Vujić et al., 2012). The most 43 comprehensive taxonomic study of this genus is that of Hurkmans (1993) who revised 61 44 Palaearctic species. During the last 15 years, multiple authors have significantly contributed 45 to clarifying the taxonomy and distribution of the taxa of this speciose genus, focussing on 46 particular species groups on the Iberian, Balkan and Anatolian Peninsulas (e.g. Marcos 47 García, Vujić & Mengual, 2007; Ståhls et al., 2009; Popov, 2010; Radenković et al., 2011; 48 Vujić, Marcos García,For Sarıbıyık Review & Ricarte, 2011; Vu Onlyjić et al., 2012; Vujić, Radenković, 49 Likov, Trifunov & Nikolić, 2013a; Popović et al., 2015; Vujić et al., 2015; Ačanski et al., 50 2016; Šašić et al., 2016; Veselić, Vujić & Radenković, 2017). It became the most species rich 51 hoverfly genus in Europe (121 spp.) after the appearance of recent publications with newly 52 described species (Ačanski et al., 2016; Šašić et al., 2016; Veselić et al., 2017). This 53 phytophagous genus is especially widespread in the Mediterranean Basin, a region with a 54 high diversity of geophytes. Although the immature stages of only five species have been 55 described to date, and observational data on the host plants of larvae exist for only 15 species 56 (Andrić et al., 2014), it seems that the underground storage organs of geophytes are general 57 hosts for all Merodon species.
58 The taxonomy of one species group, named aureus , is especially challenging due to the 59 absence of distinct diagnostic characters like specific structure of genitalia or hind legs in 60 males. The shape of the male genitalia in this group is simple and very similar in all species 61 of the group. Its members can be easily recognized by their small size, rounded abdomen, and 62 the presence of a spike on the metatrochanter of males (Radenković et al., 2011; Šašić et al., 63 2016; Veselić et al., 2017). This group is characterized by high endemism (e.g. on the Iberian 64 Peninsula more than 70% of species from the aureus group are endemic to the region) and the 65 presence of morphologically cryptic species. Šašić et al. (2016) defined five sub groups: M. 66 aureus Fabricius, 1805, M. bessarabicus Paramonov, 1924, M. chalybeus Wiedemann in 67 Meigen, 1822, M. cinereus (Fabricius, 1794) and M. dobrogensis Bradescu, 1982, in addition 68 to two species with independent positions, i.e. M. caerulescens Loew, 1869 and M. 69 unguicornis Strobl in Czerny & Strobl, 1909. Šašić et al. (2016) particularly focussed on 70 species delimitation within the atratus complex of the M. cinereus subgroup. Later, Veselić et
3
Page 5 of 84 Journal of Zoological Systematics and Evolutionary Research
71 al. (2017) reviewed the M. bessarabicus sub group that is characterized by predominantly 72 pale tibiae and tarsi, and typically dark tergites. Authors distinguished seven species and 73 highlighted the presence of four additional species complexes the members of which could 74 not be differentiated by a traditional morphological taxonomic approach. One of these four 75 complexes is the M. luteomaculatus , which comprises new taxa that are the subject of the 76 present study.
77 Integrative taxonomy that uses several different, independent character sets (morphological, 78 molecular, ecological, etc.) has proven to be useful for cryptic species discovery and 79 delimitation of species boundaries in hoverflies, including the genus Merodon . The 80 mitochondrial cytochromeFor c oxidaseReview I ( COI ) gene is theOnly most frequently applied marker in 81 such studies because it is highly informative in elucidating relationships at the species level 82 (e.g. Mengual, Ståhls, Vujić & Marcos García, 2006; Ståhls et al., 2009; Marcos García , 83 Vujić, Ricarte & Ståhls, 2011; Radenković et al., 2011; Grković, Vujić, Radenković, Chroni 84 & Petanidou, 2015; Popović et al., 2015; Ačanski et al., 2016; Šašić et al., 2016; Chroni, 85 Djan, Vidaković, Petanidou & Vujić, 2017). However, there are cases when morphologically 86 differentiated species can share the same COI haplotypes (Mengual et al., 2006; Ståhls et al., 87 2009, Haarto & Ståhls, 2014), so it is recommended to employ multiple data sources, such as 88 morphological and ecological data, and molecular genetic evidence from more than one 89 genetic locus. The nuclear 28S rRNA gene is also used as an additional source of information 90 to resolve taxonomic uncertainties (Mengual et al., 2006; Kočiš et al., in prep.), although it is 91 usually applied at the genus level. Inter Simple Sequence Repeats (ISSR) have been used to 92 discern closely related insect species (Kehlmaier and Assmann, 2010) and for assessments of 93 population level genetic polymorphism (Ståhls et al., 2016). In addition to molecular data, 94 geometric morphometry has been successfully used in cryptic species delimitation due to its 95 considerable discriminatory and statistical power in revealing minor but stable morphological 96 variation, often undetectable to the naked eye (Nedeljković et al., 2013; 2015; Vujić et al., 97 2013b; Šašić et al., 2016).
98 This newly discovered eastern Mediterranean species complex, is distributed in both the 99 Balkan Peninsula and Aegean islands. This region is characterized by a rich geological 100 history during Plio Pleistocene and represents an excellent study area for the distributional 101 patterns and evolution of species. The mountains of the Balkan Peninsula were glaciated on
4
Journal of Zoological Systematics and Evolutionary Research Page 6 of 84
102 several occasions (Messerli, 1967). The striking contrast in the extent and thickness of ice 103 cover during the Pleistocene cold stages has greatly influenced the geomorphology and 104 biological evolution of the Balkans (Hughes, Woodward, Van Calsteren, Thomas & 105 Adamson, 2010). Some of the largest glaciers in the Balkans were formed in Albania and 106 Montenegro, especially in the inland mountains of Prokletije and Durmitor (Milivojević, 107 Menković & Ćalić, 2008; Djurović, 2009). The most extensive glaciation of Mount Orjen 108 occurred during the mid Pleistocene (c. 480 430 ka). Later, there were several more, less 109 extensive glaciations (190 130 ka; 110 11.7 ka) (Hughes et al., 2010). Simaiakis & Mylonas 110 (2008) and Thanou, Giokas & Kornilios (2014) presented the palaeogeography of the Aegean 111 region, which is For important Review to understand the distri Onlybution patterns of the Merodon 112 luteomaculatus complex. Here, we summarize the main events. In the late and middle 113 Miocene (23 – 12 Mya), the Aegean region was part of a united landmass called Aegaeis 114 (Ägäis), and the geological history leading to fragmentation of this landmass has impacted 115 the distributions of many organisms. The most important palaeohistorical event that happened 116 in the Aegean archipelago was the formation of the Mid Aegean trench, which occurred ca. 117 12 Mya and contributed to the separation of Crete from the southeastern Aegean islands and 118 the Anatolian Peninsula. The Mid Aegean trench is a sea barrier that led to the disjunction of 119 western and eastern Aegean islands. During the upper Miocene (12 – 5 Mya), the 120 palaeogeography of the south Aegean Archipelago changed completely (Simaiakis & 121 Mylonas, 2008). Marine expansion and continental compartmentalization took place during 122 the Pliocene (5 – 2 Mya). The southern Cyclades separated from the northern Cyclades (with 123 these latter remaining connected to the mainland) about 3.5 Mya (Anastasakis & Dermitzakis, 124 1990). During the Pleistocene, a wide sea barrier existed between the Cyclades islands, Crete 125 and the Dodecanese islands (Dermitzakis, 1990). The Peloponnesian region was connected to 126 the mainland until the end of the Miocene (5.3 Mya) but, by the beginning of the Pliocene 127 (3.5 Mya), it was disconnected by a wide sea barrier (Dermitzakis, 1990). From then on, 128 climatic oscillations and resulting sea level fluctuations led to repeated 129 connection/disconnection cycles (Perissoratis & Conispoliatis, 2003).
130 A vast array of papers have dealt with the biogeographical patterns of different animal groups 131 in the region (Mylonas, 1982; Trichas & Legakis, 1987; Anastasakis and Dermitzakis, 1990; 132 Sfenthourakis, 1996; Sfenthourakis & Giokas, 1998; Foufopoulos & Ives, 1999; 133 Sfenthourakis, Giokas & Mylonas, 1999; Welter Schultes & Williams, 1999; Dennis, 5
Page 7 of 84 Journal of Zoological Systematics and Evolutionary Research
134 Shreeve, Olivier & Coutsis, 2000; Stathi & Mylonas, 2001; Chatzaki, Thaler & Mylonas, 135 2002; Fattorini, 2002; Chatzimanolis, Trichas, Giokas & Mylonas, 2003; Parmakelis, Spanos, 136 Papagiannakis, Louis & Mylonas, 2003; Perissoratis & Conispoliatis, 2003; Poulakakis et al., 137 2003; Chatzaki, Lymberakis, Markakis & Mylonas, 2005; Simaiakis & Mylonas, 2008; Vujić 138 et al., 2016), and molecular data were often used to assess phylogeography of species in the 139 Aegean Archipelago (Douris, Rodakis, Giokas, Mylonas & Lecanidou, 1995; Beerli, Hotz & 140 Uzzell, 1996; Gantenbein, Kropf, Largiader & Scholl, 2000; Weisrock, Macey, Ugurtas, 141 Larson & Papenfuss, 2001; Gantenbein & Largiadèr, 2002; Kasapidis, Magoulas, Mylonas & 142 Zouros, 2005; Parmakelis et al., 2005; 2006a; Parmakelis, Stathi, Spanos, Louis & Mylonas, 143 2006b; Poulakakis,For Lymberakis, Review Tsigenopoulos, Magou Onlylas & Mylonas, 2005a; Poulakakis et 144 al., 2005b; Poulakakis, Lymberakis, Valakos, Zouros & Mylonas, 2005c). Ståhls et al. (2016) 145 recently studied the phylogeographic patterns of selected Merodon species in the Eastern 146 Mediterranean. They concluded that both current and past geographic barriers have 147 influences on the dispersal and evolution of Merodon . According to their results, current 148 inter island distance was particularly important in explaining the replacement of 149 mitochondrial COI barcode haplotypes, whereas the Mid Aegean Trench was a strong ancient 150 barrier that drove differences in haplotype richness and distributions.
151 The M. luteomaculatus species complex exhibits morphological variability that could not be 152 characterized using a traditional morphological approach. Thus, the present study was 153 designed with the aim of delimiting species borders within the complex using an integrative 154 taxonomic approach. We also discuss the most plausible scenario of speciation for this 155 complex based on the region’s well studied palaeogeography.
156
157 Material and methods
158 Study area
159 The Balkan Peninsula is an area of south eastern Europe surrounded by water on three sides: 160 the Adriatic Sea to the west; the Ionian, Aegean and Marmara seas to the south; and the Black 161 Sea to the east. Most of the Peninsula is occupied by the massive Dinaric, Balkan, 162 Carpathian, Pindus, Rila, Pirin and Rhodopes mountain ranges. 6
Journal of Zoological Systematics and Evolutionary Research Page 8 of 84
163 Additionally, an area of special interest for our study is the Aegean Archipelago; a group of 164 islands in the Aegean Sea with mainland Greece to the west and north. The area is 165 characterized by high levels of diversity and endemism (Strid, 1997; Sfenthourakis & 166 Legakis, 2001) and a complex palaeogeographical history (Anastasakis & Dermitzakis, 1990; 167 Perissoratis & Conispoliatis, 2003).
168
169 Studied material
170 In total, 181 MerodonFor specimens Review belonging to the M. luteomaculatusOnly complex were collected 171 in Greece, Serbia, Bosnia and Herzegovina, Bulgaria and Montenegro. Of these, 66 172 specimens were collected in the continental area of Greece, 69 on the Peloponnese Peninsula, 173 17 on the Greek islands of Andros (14) and Naxos (3), 22 in Montenegro (19 on Orjen 174 Mountain, 2 on Durmitor Mountain, and 1 in the Bay of Kotor), 4 from Pčinja in Serbia, 1 in 175 Bosnia and Herzegovina, and 2 in Bulgaria. Specimen sampling was done with an 176 entomological net and over the course of a 30 year period (22.viii.1984 to 10.x.2014), except 177 for a single record from 1911 (for details see Appendix 1 and type material listed for each 178 species in the Appendix 2). The following acronyms of museums and entomological 179 collections containing studied material are used in the text: BMNH, Natural History Museum, 180 London, UK; FSUNS, Department of Biology and Ecology, Faculty of Sciences, University 181 of Novi Sad, Serbia; MAegean, The Melissotheque of the Aegean, University of the Aegean, 182 Mytilene, Greece; MZH, Zoological Museum, Finnish Museum of Natural History, Helsinki, 183 Finland; RMNH, Naturalis Biodiversity Center, Leiden, The Netherlands; SAR, Zemaljski 184 Muzej Sarajevo, Bosnia and Herzegovina; C.C. coll., Claus Claussen Collection; J.S. coll., 185 John Smit collection, The Netherlands; M.S. coll., Martin Speight collection, Ireland.
186 A distribution map was created in GenGIS v.2.4.1. Elevation data for each specimen were 187 generated from detailed locality information on the basis of the WorldClim dataset (Hijmans, 188 Cameron, Parra, Jones & Jarvis, 2005).
189
190 Taxonomic study
7
Page 9 of 84 Journal of Zoological Systematics and Evolutionary Research
191 The characters used in the descriptions and drawings employ the terminology for 192 morphological characters established by Thompson (1999) and those relating to male 193 genitalia follow Marcos García et al. (2007).
194 The male genitalia were extracted from dry specimens previously relaxed in a humid 195 chamber, then cleared by boiling in warm 10% potassium hydroxide (KOH) for 3 – 5 min. 196 Acetic acid was used to neutralize the KOH over 5 seconds. Genitalia were stored in 197 microvials containing glycerol. Specimen measurements were taken in dorsal view with a 198 micrometer and are presented as ranges. Body length was measured from the lunule to the 199 end of the abdomen,For and wing Review length from the base ofOnly the tegula to the wing apex. Photos 200 were made with a Leica DFC320 camera connected to a personal computer. After imaging, 201 CombineZ software (Hadley, 2006) was used to create composite images of in focus areas to 202 provide extended depth of field.
203
204 Molecular procedures
205 Total genomic DNA was extracted from mid and hind legs of 83 hoverfly specimens 206 representing all studied species and localities of the Aegean archipelago and Balkan 207 Peninsula (samples are indicated in Appendix 1) using the SDS extraction protocol (Chen, 208 Rangasamy, Tan, Wang & Siegfried, 2010). Genomic DNA vouchers are conserved at the 209 Faculty of Sciences, Department of Biology and Ecology, University of Novi Sad (FSUNS).
210 The 3’ end of the mitochondrial COI gene was amplified using the forward primer C1 J 2183 211 (5’ CAACATTTATTTTGATTTTTTGG 3’) (alias JERRY) and the reverse primer TL2 N 212 3014 (5’ TCCAATGCACTAATCTGCCATATTA 3’) (alias PAT) (Simon et al., 1994). The 213 Folmer or ‘barcoding’ fragment (the 5’ end of the COI gene) was amplified using the LCO 214 (5’ GCTCAACAAATCATAAAGATATTGG 3’) and HCO (5’ 215 TAAACTTCAGGGTGACCAAAAAATCA 3’) primer pair (Folmer, Black, Hoeh, Lutz & 216 Vrijenhoek, 1994). The primer pair F2 (5 AGAGAGAGTTCAAGAGTACGTG 3’) and 3DR 217 (5’ TAGTTCACCATCTTTCGGGTC 3’) was used to amplify the D2 3 expansion segment 218 of the 28S rRNA gene (Belshaw, Lopez Vaamonde, Degerli & Quicke, 2001). Polymerase 219 chain reactions (PCR) were carried out in 25 l reaction volumes. The reaction mixture
8
Journal of Zoological Systematics and Evolutionary Research Page 10 of 84
220 contained 1x reaction buffer (Thermo Scientific, Vilnius, Lithuania), 2.5 mM MgCl 2, 0.1 mM 221 of each nucleotide, 1.25 U Taq polymerase (Thermo Scientific, Vilnius, Lithuania), 5 pmol of 222 each primer, and approximately 50 ng of template DNA. PCR amplifications were performed 223 using the following conditions: 95°C for 2 min; 29 cycles of 94°C for 30 s each, 49°C (for 3’ 224 COI ) and 50°C (for 5’ COI and D2 3 region of 28S rRNA ) for 30 s; 72°C for 2 min; with the 225 final extension at 72°C for 8 min. The PCR products were purified using Exonuclease I and 226 Shrimp Alkaline Phosphatase enzymes (Thermo Scientific, Vilnius, Lithuania) according to 227 the manufacturer’s instructions. Sequencing was done in the forward direction using the 228 BigDye Terminator v.3.1 cycle sequencing kit (Thermo Scientific, Vilnius, Lithuania) on an 229 ABI3730xl GeneticFor Analyzer Review (Applied Biosystems) inOnly the Sequencing Laboratory of the 230 Finnish Institute for Molecular Medicine, Helsinki, Finland.
231 A non anchored repeated tetra nucleotide primer, (GACA) 4, was used for PCR amplification 232 of Inter Simple Sequence Repeats (ISSR). PCR amplification was carried out in 25 µl
233 reaction volumes. The PCR master mix contained 1x reaction buffer (Thermo Scientific,
234 Vilnius, Lithuania), 2.5 mM MgCl 2, 0.1 mM of each nucleotide, 1.25 U Taq polymerase 235 (Thermo Scientific, Vilnius, Lithuania), 5 pmol of primer and approximately 50 ng of 236 template DNA. Amplification was performed according to following conditions: initial 237 denaturation of 5 min at 94°C, followed by 26 cycles of 60 s at 94°C, 60 s at 52°C, 3 min at 238 72°C, and a final elongation of 10 min at 72°C, as described in Kehlmaier & Assmann 239 (2010). Genomic fingerprints were obtained by electrophoresis of 5 l of PCR products on a 240 6% non denaturing polyacrylamide (PAA) gel. Fragment sizes were estimated based on a 241 Gene Ruler DNA ladder mix (Thermo Scientific, Vilnius, Lithuania), which is designed to 242 size and approximately quantify a wide range of double stranded DNA fragments.
243
244 Molecular genetic data analyses
245 The COI and 28S sequences were edited for base calling errors and aligned using the Clustal 246 W (Thompson, Higgins & Gibson, 1994) algorithm implemented in BioEdit 7.0.9.0. (Hall, 247 1999), and trimmed to final length by eye (see Table S4 and S5). Sequences of 3’ and 5’ 248 fragments of the COI gene were concatenated for molecular analyses. DNA polymorphism 249 for the concatenated COI matrix was estimated using DnaSP version 5 (Librado & Rozas, 9
Page 11 of 84 Journal of Zoological Systematics and Evolutionary Research
250 2009). Arlequin 3.5.1.3. (Excoffier & Lischer, 2010) was used for analysis of molecular 251 variance (AMOVA) and pairwise species divergence comparisons. A median joining network 252 of 28S genotypes was constructed by NETWORK 5 (Bandelt, Forster & Röhl, 1999) using 253 manually aligned 28S sequences. Maximum Parsimony (MP) and Maximum Likelihood 254 (ML) phylogenetic trees were constructed based on the COI matrix. Archimicrodon sp. 255 (subfamily Microdontinae) was used to root the phylogenetic trees and additional outgroups 256 were Eumerus amoenus Loew, 1848 and Merodon albifasciatus Macquart, 1842 (both 257 Eristalinae), and Xanthogramma citrofasciatum (de Geer, 1776) (Syrphinae). Parsimony 258 analysis was performed in NONA (Goloboff, 1999) spawned with the aid of Winclada 259 (Nixon, 2002) usingFor the heuristic Review search algorithm withOnly 1,000 random addition replicates 260 (mult*1,000), holding 100 trees per round (hold/100), maxtrees set to 100,000 and applying 261 tree bisection reconnection (TBR) branch swapping. The ML tree was constructed using 262 RAxML 8.2.8 (Stamatakis, 2014) using the CIPRES Science Gateway web portal (Miller, 263 Pfeiffer & Schwartz, 2010) under the general time reversible (GTR) evolutionary model with 264 a gamma distribution (GTRGAMMA) (Rodríguez, Oliver, Marín & Medina, 1990). Nodal 265 support was estimated using non parametric bootstrapping with 1,000 replicates for both MP 266 and ML trees. Putative species limits were explored with Automatic Barcode Gap Discovery 267 (ABGD) (Puillandre, Lambert, Brouillet & Achaz, 2012) using default settings and and a 268 Kimura two parameters model for pairwise distance calculation (Kimura, 1980). The ABGD 269 program uses a range of prior intraspecific divergences to infer from the data a model based 270 one sided confidence limit for intraspecific divergence and then detects the barcode gap as 271 the first significant gap beyond this limit to partition the data (Puillandre et al., 2012).
272 For ISSR allele/loci scoring, only bands that could be scored consistently among individuals 273 were used. It was assumed that each amplified band represented a distinct locus. The 274 fragments (bands) were scored as present = 1 and absent = 0. This information generated a 275 binary matrix used for analyses. The software FreeTree (Pavlicek, Hrda & Flegr, 1999) and 276 Treeview (Page, 1996) were used to construct Unweighted Pair Group Method with 277 Arithmetic mean (UPGMA) dendrograms based on the Nei & Li (1979) coefficient of genetic 278 distances. AMOVA analysis was conducted in Arlequin. Genetic structure within the M. 279 luteomaculatus complex was assessed using the software STRUCTURE ver. 2.3.4. 280 (Pritchard, Stephens & Donnelly, 2000; Falush, Stephens & Pritchard, 2007). Genotype 281 classes were considered to consist of haploid alleles (Oliveira, Venturini, Rossi & 10
Journal of Zoological Systematics and Evolutionary Research Page 12 of 84
282 Hastenreiter, 2010; Pinheiro et al., 2012). We applied the admixture ancestry model with 283 correlated allele frequencies. We ran five replicates for each K ranging from 1 to 10. The 284 analyses were done with a burn in length of 20,000, followed by 200,000 Markov Chain 285 Monte Carlo (MCMC) iterations. The K methods of Evanno, Regnaut & Goudet (2005) 286 were used to select the most probable number of genetic clusters (K). The CLUMPAK 287 software (Kopelman, Mayzel, Jakobsson, Rosenberg & Mayrose, 2015) was used for 288 graphical presentation of STRUCTURE results.
289
290 Geometric morphometricFor analysis Review Only
291 As part of our integrative approach, two quantitative traits were used to identify species of the 292 M. luteomaculatus complex: the wing and the posterior surstyle lobe of male genitalia 293 (hereinafter referred to as the surstylus). Two different geometric morphometric analyses 294 were employed: landmark based analysis of the wing and outline contours of the surstylus.
295 High resolution wing and surstylus images were captured using a Leica MZ16 296 stereomicroscope attached to a Leica DFC320 video camera and connected to a personal 297 computer. Landmarks and semi landmarks were drawn on every picture using the TpsDig 298 2.05 software (Rohlf, 2006).
299 First, the amount of shape variation among specimens, without a priori defined groups, was 300 explored using principal component analysis (PCA). Analysis of variance (ANOVA) 301 conducted on principal components (PC) was used to confirm that the observed variations 302 were linked to shape differences among species. Canonical variates analysis (CVA) and 303 discriminant function analysis (DA) were used to test the significance of differences in wing 304 and surstylus shape and to produce a distance matrix for graphical presentation of these 305 differences. The phenetic relationships among taxa were determined by UPGMA analysis 306 based on squared Mahalanobis distances computed from the DA applied to wing and 307 surstylus variables. MorphoJ v2.0 was used to visualize thin plate spline deformations 308 (Klingenberg, 2011). To assess whether the morphological variations were associated with 309 geographical distance, a two tailed Mantel test (Mantel, 1967) with 10,000 permutations was 310 conducted in PaSSaGe (Rosenberg & Anderson, 2011). Geographic distance was calculated 11
Page 13 of 84 Journal of Zoological Systematics and Evolutionary Research
311 as the minimum distance between two species using QGIS (Quantum GIS Development 312 Team, 2016). All statistical analyses were calculated using Statistica for Windows (StatSoft, 313 2015: version 12).
314
315 Wing morphometry
316 Variations in wing size and shape were assessed amongst 94 specimens of the M. 317 luteomaculatus complex (Appendix 1) using a landmark based, geometric morphometric 318 method (Bookstein,For 1991). M . naxiusReview sp. n. was excluded Only from analysis due to an insufficient 319 number of specimens. Due to our limited sample size, males and females were analysed 320 together. Samples were grouped and analysed according to their genetic identification, and 321 given tentative names based on their origins for sample distinction. The right wing of each 322 studied specimen was removed from the body and mounted in Hoyer’s Medium between a 323 microscope slide and a coverslip. Wings have been archived and labelled using unique codes 324 saved in FSUNS database with other data relevant to the specimens. Eleven homologous 325 landmarks that could be reliably identified and were representative of wing shape were 326 chosen (Fig. 1). Generalized least squares Procrustes superimposition was first applied on the 327 landmark data to remove non shape variations in location, scale and orientation, and to 328 superimpose the objects in a common coordinate system (Rohlf & Slice, 1990; Zelditch, 329 Swiderski, Sheets & Fink, 2004). For the wing shape analysis between taxa, partial warp 330 scores were calculated using CoordGen 7.14 and CVAgen 7.14a, which are elements of the 331 IMP software package (Sheets, 2012).
332 Figure 1.
333 Surstylus morphometry
334 Shape analysis of the right posterior surstyle lobe (Fig. 2a: pl) of male genitalia was carried 335 out on 40 specimens of the M. luteomaculatus complex using a semi landmark geometric 336 morphometric approach (Appendix 1). M. naxius sp. n. was again excluded from analysis due 337 to an insufficient number of specimens. The surstylus was removed using a scalpel and 338 placed on its lateral side in glycerol on a microscopic slide, with a coverslip placed on the top
12
Journal of Zoological Systematics and Evolutionary Research Page 14 of 84
339 of the surstylus to immobilize it. Due to a lack of homologous anatomical loci, 20 semi 340 landmarks were digitized (from the membranous part of the epandrium to the end of the 341 surstylus) using the option ‘resample curve by length’ in the TpsDig 2.05 software (Rohlf, 342 2006). All surstyli were digitized twice to reduce measurement error. The software CoordGen 343 7.14 with an integrated Semiland module was used for semi landmark superimposition using 344 a distance minimizing protocol that minimized shape differences due to the arbitrary nature 345 of semi landmark positions along the curve (Bookstein, 1997; Zelditch et al., 2004).
346 Figure 2
347 Results For Review Only
348 Merodon luteomaculatus complex of species
349 Morphological analyses
350 The Merodon luteomaculatus complex belongs to the aureus group of species characterized 351 by: small size (8 13.3 mm), rounded abdomen (Fig. 3, Fig. 21 in Appendix 2), a distinct spike 352 on the metatrochanter of males (see Fig. 20a: t in Appendix 2), and the very similar, simple 353 structure of the male genitalia with an undeveloped anterior surstyle lobe of the epandrium 354 and a sickle shaped hypandrium that has a reduced lateral sclerite of the aedeagus (Fig. 2) 355 (Vujić et al., 2007).
356 Based on the key for identification of taxa of the Merodon aureus group ( sensu stricto ) in 357 Europe (Šašić et al., 2016), members of the Merodon luteomaculatus complex are part of the 358 Merodon bessarabicus sub group because of their predominantly pale tibia and tarsi (see Fig. 359 20 in Appendix 2), but differ in having yellow spots on tergites 2 and 3 (see Fig. 21 in 360 Appendix 2).
361 Analysis of all available material revealed variability in specimen size, colour of the antennae 362 and tarsi, colour of the pilosity on the eyes and tergites, as well as the presence of 363 microtrichose bands on the tergites. Because of overlapping character states, clear separation 364 among specimens was not always achievable. Also, though small differences in the shape of 365 male genitalia were observed, it was not possible to characterize them by classical 366 morphological study. 13
Page 15 of 84 Journal of Zoological Systematics and Evolutionary Research
367 Descriptions of M. luteomaculatus sp. n. and diagnostic characters for all species from the 368 complex are presented in the Appendix 2.
369 Figure 3.
370 Molecular evidence
371 A combined set of 83 COI sequences with total length 1271 base pairs (bp) (672 bp 3’ COI 372 and 599 bp 5’ COI ) and 154 observed polymorphic sites was analysed using MP and ML 373 methods. MP analysis resulted in 18 equally parsimonious trees of 640 steps (Consistency 374 Index = 74%, RetentionFor Index Review= 88%) (Fig. 4). Both MPOnly and ML trees resolved five clusters 375 (with slightly differing topologies), with species being delimited as follows: M. 376 luteomaculatus sp. n. + M. euri sp. n., M. peloponnesius sp. n., M. erymanthius sp. n., M. 377 andriotes sp. n., and M. naxius sp. n. (Fig. 4 and 5). The bootstrap support value for the M. 378 erymanthius sp. n. lineage was low for both the MP and ML trees, but remaining species 379 clusters were well supported for both trees.
380 Figure 4.
381 Figure 5.
382 In order to confirm species separation within the M. luteomaculatus complex, we explored 383 the presence of barcoding gaps within the COI dataset (combined 3’ and 5’ COI sequences). 384 ABGD was run with a prior maximum divergence of intraspecific diversity, i.e. species 385 divergence from 0.001 to 0.1. The number of groups for the recursive partition was one with 386 a prior divergence of 0.0359; two with prior divergences of 0.0215, 0.0129, 0.0077 and 387 0.0046; four for 0.0028; five for 0.0017; and eight for 0.001. The primary partition was in 388 concordance with the recursive for all prior divergence values up to 0.0017 (for which the 389 primary partition was four groups and in the recursive partition it was five groups). 390 Partitioning into five groups is in agreement with our phylogenetic analyses. Thus, the 391 ABGD confirms the presence of at least five species within the M. luteomaculatus species 392 complex: M. luteomaculatus sp. n. + M. euri sp. n., M. peloponnesius sp. n., M. erymanthius 393 sp. n., M. andriotes sp. n. and M. naxius sp. n.
394 The combined COI dataset comprised 45 haplotypes (Table S1). All of the COI sequences 14
Journal of Zoological Systematics and Evolutionary Research Page 16 of 84
395 were species specific and no haplotypes were shared between different species. Estimated 396 haplotype diversity (Hd) was 0.959, nucleotide diversity (Pi) was 0.01743, and the average 397 number of nucleotide differences (k) was 22.158 for the total dataset. AMOVA revealed a 398 high percentage of inter group variability (92.09%), which supports species level divergence 399 (p < 0.0001). Pairwise Фst values between all species were significant (p < 0.05). 400 Uncorrected pairwise sequence divergence (p) values for the combined COI dataset between 401 M. naxius sp. n. and all other taxa were between 9 and 9.3%. For all other species 402 comparisons, p distances were lower (see Table 1).
403 Table 1. For Review Only
404 We were generated 79 sequences of the D2 3 region of 28S rRNA with a total length of 581 405 bp. The 28S sequences revealed three genotypes, with genotype I corresponding to M. 406 erymanthius sp. n., genotype II corresponding to M. euri sp. n., M. peloponnesius sp. n., M. 407 andriotes sp. n. and M. naxius sp. n., and genotype III corresponding to M. luteomaculatus 408 sp. n. Genotype I and III differ by three mutational steps from genotype II, respectively (Fig. 409 6, Table S2).
410 Figure 6.
411 Produced COI and 28S sequences are available in GenBank under the accession numbers 412 KY946816 KY946977 .
413 ISSR profiles were generated for 31 specimens belonging to six species of the M. 414 luteomaculatus complex (five specimens were randomly chosen for each species, except for 415 M. euri sp. n. (8 specimens) and M. naxius sp. n. (3 specimens)). The generated ISSR 416 polymorphic bands (putative loci) ranged in size from 210 to 2,500 bp (Figure S1) and 21 417 scorable bands were detected. AMOVA revealed a high level of interspecies variability 418 (86.24%), with an overall Fst value of 0.86236 indicating significant differentiation (p < 419 0.05) among species. Within species variability was 13.76%.
420 Figure 7.
421 UPGMA cluster analysis based on the Nei Li genetic distance coefficient for the band 422 scoring data showed five clusters corresponding to M. euri sp. n., M. luteomaculatus sp. n., 15
Page 17 of 84 Journal of Zoological Systematics and Evolutionary Research
423 M. erymanthius sp. n., M. naxius sp. n., and M. peloponnesius sp. n. + M. andriotes sp. n. 424 (Fig. 7). Merodon peloponnesius sp. n. and M. andriotes sp. n. could not be distinguished 425 based on our ISSR profiles. A Bayesian clustering analysis implemented in STRUCTURE 426 revealed a most likely K = 2, and a secondary peak was obtained at K = 5. For K = 2, M. euri 427 sp. n. formed one cluster and all other taxa comprised the second cluster (Fig. 8). For K = 5, 428 the specimens are divided into five clusters (Fig. 8) that correspond to the clusters resolved in 429 the Nei Li distance derived UPGMA dendrogram (Fig. 7).
430 Figure 8.
431 Geometric morphometricFor evidence Review Only
432 Wing shape
433 Wing shape variation among 94 specimens (without a priori defined groups) was quantified 434 using PCA, which produced seven PCs with eigenvalues > 1. ANOVA revealed that six of 435 the seven PCs were linked to wing shape differences among the species previously grouped 436 according to genetic identification (Table S3). Additionally, DA evidenced significant 437 differences between all species pairs based on wing shape (Table 2). Overall classification 438 success was high, with 92% of all specimens being correctly classified into a priori defined 439 groups ( M. andriotes sp. n. 98%, M. erymanthius sp. n. 96%, M. luteomaculatus sp. n. 96%, 440 M. euri sp. n. 90%, M. peloponnesius sp. n. 83%).
441 Table 2.
442 Figure 9.
443 CVA produced four highly significant canonical axes that describe wing shape differences 444 among species. CV1 (Wilks’ Lambda = 0.028336; χ 2 = 646.7962; p < 0.01) representing the 445 majority of total wing shape variation (55%) clearly differentiates the two endemic species 446 M. erymanthius sp. n. and M. andriotes sp. n. (Fig. 9a). The second canonical axis (CV2, 447 Wilks’ Lambda = 0.135202; χ 2 = 363.1789; p < 0.01) separates M. euri sp. n. and M. 448 peloponnesius sp. n. from M. erymanthius sp. n., M. andriotes sp. n. and M. luteomaculatus 449 sp. n. (Fig. 9a). CV3 (Wilks’ Lambda = 0.398092; χ 2 = 167.1747; p < 0.01) encompasses 450 differences of M. peloponnesius sp. n. from M. euri sp. n., M. andriotes sp. n. and M. 16
Journal of Zoological Systematics and Evolutionary Research Page 18 of 84
451 erymanthius sp. n. (Fig. 9b). With only 5% of total wing shape variation, CV4 (Wilks’ 452 Lambda = 0.729216; χ 2 = 57.3150; p < 0.01) indicates differences between M. 453 luteomaculatus sp. n. and the species pair M. erymanthius sp. n. M. andriotes sp. n. (Fig. 454 9b).
455 Figure 10.
456 The dendrogram derived by UPGMA clustering of squared Mahalanobis distances shows the 457 phenetic relationships among the analysed species according to wing shape (Fig. 10a). The 458 species pair M. euri sp. n. M. peloponnesius sp. n. and M. luteomaculatus sp. n. have the 459 most similar wing Forshapes, whereas Review M. erymanthius sp. Only n. has the most distinct wing shape 460 (Fig. 10a). Pairwise differences in wing shape are represented as superimposed outline 461 drawings in Fig. 11. In concordance with our previous results, the most distinct wing shape 462 was presented by M. erymanthius sp. n., which had the widest wings and were clearly 463 different from those of M. andriotes sp. n. and M. peloponnesius sp. n. Discrete differences in 464 the distal parts of wings were found for the following species pairs: M. euri sp. n. M. 465 peloponnesius sp. n.; M. euri sp. n. M. andriotes sp. n.; M. peloponnesius sp. n. M. 466 andriotes sp. n.; M. erymanthius sp. n. M. luteomaculatus sp. n.; M. euri sp. n. M. 467 luteomaculatus sp. n.; and M. peloponnesius sp. n. M. luteomaculatus sp. n. The species 468 pairs M. erymanthius sp. n. M. euri sp. n. and M. andriotes sp. n. - M. luteomaculatus sp. n. 469 differed in the shapes of the central parts of their wings. Mantel tests revealed no significant 470 correlation between phenetic (squared Mahalanobis distances of wing shape) and 471 geographical distances (r = 0.21712, p = 0.74480).
472 Figure 11.
473 Surstylus shape
474 In order to improve discriminatory ability among the species of the Merodon luteomaculatus 475 complex, surstylus shape was quantified and compared using semi landmark geometric 476 morphometrics. DA shows that species within the M. luteomaculatus complex differ highly 477 significantly in surstylus shape (Table 2). Overall classification success was excellent, with 478 all specimens being correctly assigned to groups defined according to genetic and wing 479 morphometric results. Moreover, CVA revealed four highly significant canonical axes linked 17
Page 19 of 84 Journal of Zoological Systematics and Evolutionary Research
480 to differences in surstylus shape among species. The first canonical axis (CV1, Wilks’ 481 Lambda = 0.000764; χ 2 = 986.790; p < 0.01) representing the majority of total surstylus 482 shape variation (54%) clearly separates M. luteomaculatus sp. n. from the other species (Fig. 483 12a). With 26% of total shape variation, CV2 (Wilks’ Lambda = 0.01099; χ 2 = 620.1233; p < 484 0.01) separated the species pair M. erymanthius sp. n. M. euri sp. n. from M. andriotes sp. n. 485 M. peloponnesius sp. n. and M. luteomaculatus sp. n. (Fig. 12a). Separation of M. andriotes 486 sp. n. from all other investigated species is reflected in CV3 (Wilks’ Lambda = 0.080613; χ 2 487 = 346.237642; p < 0.01), whereas CV4 (Wilks’ Lambda = 0.290385; χ 2 = 170.02536; p < 488 0.01) describes differences between M. euri sp. n. and M. erymanthius sp. n. (Fig. 12b). Both 489 CV3 and CV4 representFor equal amountsReview of total surstylus Only shape variation (10%).
490 Figure 12.
491 Phenetic relationships constructed on the basis of surstylus shape do not follow the pattern 492 obtained for wing shape (Fig. 10b). M. euri sp. n., M. erymanthius sp. n. and M. 493 peloponnesius sp. n. have the most similar surstylus shapes, whereas those of M. andriotes 494 sp. n. and M. luteomaculatus sp. n. are the most distinct (Fig. 10b). Overall, differences in 495 surstylus shape among the investigated species are mostly related to the posterior part of the 496 posterior surstyle lobe (Fig. 13). The greatest differences are evident between the species 497 pairs M. andriotes sp. n. M. erymanthius sp. n., M. andriotes sp. n. - M. luteomaculatus sp. 498 n., M. luteomaculatus sp. n. M. peloponnesius sp. n., and M. euri sp. n. M. luteomaculatus 499 sp. n. (Fig. 13). A Mantel test revealed a strong, positive and significant correlation between 500 surstylus shape and spatial distances of the analysed species (r = 0.80559; p = 0.02290).
501 Figure 13.
502 Distribution and biology
503 Figure 14.
504 Members of the M. luteomaculatus complex are distributed over the central and southern part 505 of the Balkan Peninsula and a few Aegean islands (Fig. 14a, Appendix 1). There are two 506 island species M. andriotes sp. n. and M. naxius sp. n. and two species from the 507 Peloponnese Peninsula, i.e. M. erymanthius sp. n. and M. peloponnesius sp. n. (the former
18
Journal of Zoological Systematics and Evolutionary Research Page 20 of 84
508 inhabits high mountains of the northern Peloponnese and the latter lower altitudes in the 509 southern part of the Peninsula). Of the two continental species, M. euri sp. n. has a larger 510 distribution, extending from eastern to southern parts of the Balkan Peninsula, and even with 511 one population occurring in the northern Peloponnese. Another continental species, M. 512 luteomaculatus sp. n., is restricted to the Dinaric Mountains near the Adriatic coast in western 513 part of the Balkan Peninsula. None of the distributional ranges of the species from this 514 complex overlap. Although the range of the continental species M. euri sp. n. partly extends 515 into the northern area of the Peloponnese Peninsula, this species is not sympatric nor 516 synchronic with the Peloponnesian species M. erymanthius sp. n. and M. peloponnesius sp. 517 n., adults of whichFor occur from ReviewAugust to October (adults Only of M. euri sp. n. in this region are 518 found in April). Adults of all species from the complex appear mainly in late summer or 519 autumn (August to October), except for one population of the continental species M. euri sp. 520 n. that was registered in the northern part of the Peloponnese in April. Senecio L., Inula L. 521 and Echinops ritro L were the flower genera recorded as being visited by specimens. The 522 preferred habitats of M. luteomaculatus complex hoverflies are maquis and open areas in 523 Mediterranean evergreen forests (Fig. 15).
524 Figure 15.
525 Discussion
526 Diagnostic morphological characters have traditionally been used in species identification, 527 assuming that phenotypic discontinuities reflect genetic distinction and reproductive isolation. 528 However, evolutionary biologists generally consider genetically defined groups of 529 individuals as species. Nowadays, the perspective that views populations, subspecies, and 530 species as stages along an evolutionary continuum is mostly accepted (Mallet, 2001; Holland, 531 Dawson, Crow & Hofmann, 2004) and the new holistic approach to taxonomy that integrates 532 a greater range of data types is more widely adopted (e.g. Templeton, 1989; Crandall, 533 Bininda Emonds, Mace & Wayne, 2000; Knowlton, 2000; Padial, Miralles, De la Riva & 534 Vences, 2010; Pires & Marinoni, 2010). This type of so called integrative taxonomy has an 535 important role in detecting cryptic taxa that lack morphological divergence but exhibit high 536 genetic variability. Under such scenarios, it can be necessary to incorporate molecular, 537 geographical and ecological information to indicate reproductive isolation between putative
19
Page 21 of 84 Journal of Zoological Systematics and Evolutionary Research
538 species.
539 Investigation of the genus Merodon revealed the new taxon Merodon luteomaculatus from 540 the M. aureus group ( M. bessarabicus subgroup), a taxon endemic to the eastern 541 Mediterranean. Initial classical morphological studies showed discrete variation in somatic 542 characters (colour of pile, antennae and tarsi; distinctiveness of microtrichose bands on 543 tergites) across its distribution, as well as in morphology of the male genitalia. However, a 544 subsequent integrative analysis using DNA sequence data, ISSR, and geometric morphometry 545 of the wing and male genitalia uncovered a complex of six cryptic species (Fig. 16).
546 Figure 16. For Review Only
547 Our phylogenetic trees based on mitochondrial COI data revealed five different species 548 clusters: M. erymanthius sp. n., M. naxius sp. n., M. peloponnesius sp. n., M. andriotes sp. n., 549 and one combining M. euri sp. n. and M. luteomaculatus sp. n. (Fig. 4 and 5). Although M. 550 euri sp. n. and M. luteomaculatus sp. n. do not form monophyletic clusters on the COI trees, 551 they do not share COI haplotypes, which supports their genetic separation and possible 552 reproductive isolation. Cross species polymorphisms in mitochondrial DNA sequences can 553 arise through past introgression events and/or incomplete lineage sorting, both of which are 554 significant drawbacks to the application of mitochondrial markers for species delimitation 555 (Petit & Excoffier, 2009). Thus, for very young species or species that can hybridize, 556 additional independent molecular markers may be necessary to confirm species 557 identifications (Smith, Wood, Janzen, Hallwachs & Hebert, 2007). The nuclear 28S rRNA is 558 generally considered a conserved marker for species level studies and it has frequently been 559 used for phylogenetic analysis at genus level (Ståhls, Hippa, Rotheray, Muona & Gilbert, 560 2003; Ståhls, Stuke, Vujić, Doczkal & Muona, 2004; Mengual, Ståhls & Rojo, 2008a, b; 561 2012). It has been applied in conjunction with COI data as an additional support for defining 562 Merodon species (Mengual et al., 2006; Vujić et al., 2012), and also as an independent 563 marker in species delimitation within the Merodon nanus group (Kočiš et al., in prep.). In our 564 study, 28S sequence data separated M. luteomaculatus sp. n. and M. erymanthius sp. n. from 565 the other taxa (all of which shared the same 28S haplotype) by three mutational steps (Fig. 6). 566 Analysis of ISSR profiles generated five clusters in the UPGMA dendrogram (Fig. 7), which 567 is in agreement with the genetic structure analyses that revealed two main clusters (∆K = 2)
20
Journal of Zoological Systematics and Evolutionary Research Page 22 of 84
568 and a secondary structure of five clusters (∆K = 5) (Fig. 8). However, M. peloponnesius sp. n. 569 + M. andriotes sp. n. were resolved as one cluster, most likely due to our methodological 570 constraint of analysing only selected band sizes between 210 bp and 2500 bp within the ISSR 571 profile. Combined, our three molecular markers have revealed six genetically distinct species 572 within the M. luteomaculatus complex.
573 The presence of genetic diversity in the absence of morphological differentiation has 574 previously been reported for the M. aureus group (Šašić et al., 2016), as well as in the M. 575 equestris group (Marcos García et al., 2011), the M. avidus complex of the M. nigritarsis 576 group (Popović et Foral., 2015), andReview in studies of other hoverfly Only genera, i.e. Pipiza Fallén, 1810 577 and Chrysotoxum Meigen, 1803 (Syrphidae: Syrphinae) (Nedeljković et al., 2013; 2015; 578 Vujić et al., 2013b). These previous studies have revealed COI divergence among cryptic 579 hoverfly species ranging mainly from 0.3 – 2.5%, which matches our data for most members 580 of the M. luteomaculatus complex (0.3 1.9%), except for that of M. naxius sp. n. for which 581 the COI sequence divergence was 9 – 9.3% from other members of the M. luteomaculatus 582 complex.
583 Moreover, highly statistically significant divergences in wing and surstylus shape support 584 segregation of the M. luteomaculatus complex into five independent taxa. Note that M. naxius 585 sp. n. was excluded from morphometric analyses due to an insufficient number of specimens. 586 These findings are important given the considerable discriminatory power of geometric 587 morphometry (Zelditch et al., 2004; Mutanen & Pretorius, 2007; Vilemant, Simbolotti & 588 Kenis, 2007) and the taxonomic importance of the analysed traits. Studies of wing shape 589 heritability have already proven informative within two winged insects e.g. the genus 590 Drosophila Fallén, 1823 (Moraes et al., 2004; Mezey & Houle, 2005; Yeaman, Chen & 591 Whitlock, 2010) and in hoverfly taxonomy, particularly for differentiating cryptic species of 592 the genus Merodon (M. atratus complex from the M. cinereus subgroup of the M. aureus 593 group in Šašić et al. (2016); M. avidus complex of the M. nigritarsis group in Ačanski et al. 594 (2016)), and other hoverfly genera (Nedeljković et al., 2013; 2015; Vujić et al., 2013b). Wing 595 shape influences flight ability, but is also very important for the male species specific 596 courtship song (Cowling & Burnet, 1981; Stubbs & Falk, 1983; Ritchie & Gleason, 1995; 597 Tauber & Eberl, 2003; Menezes, Vigoder, Peixoto, Varaldi & Bitner Mathé, 2013; 598 Outomuro, Adams & Johansson, 2013; Sacchi & Hardersen, 2013). The most divergent wing 21
Page 23 of 84 Journal of Zoological Systematics and Evolutionary Research
599 shapes we detected were between two species with narrow ranges, i.e. the high mountain 600 species M. erymanthius sp. n. and the island species M. andriotes sp. n. Considering the 601 absence of a correlation between geographic and phenetic distances, differences in wing 602 shape are probably the result of other factors, such as genetic drift in fragmented populations.
603 Documented disparities in the posterior parts of the posterior surstyle lobe among hoverfly 604 species is not uncommon (e.g. Ačanski et al., 2016; Šašić et al., 2016) and are associated with 605 reproductive isolation arising from its function in gripping the female during copulation 606 (Rotheray & Gilbert, 2011). Merodon andriotes sp. n. and the geographically most distant M. 607 luteomaculatus sp.For n. hold the mostReview divergent surstylus Onlyshapes, whereas the proximal species 608 M. euri sp. n., M. erymanthius sp. n. and M. peloponnesius sp. n. have more similar surstyli. 609 This obvious isolation by distance pattern of male genital shape has also been found for 610 Drosophila (Soto et al., 2013).
611 Distribution patterns of taxa from the M. luteomacuatsus complex (Fig. 14) indicate their 612 possible separate evolutionary paths towards geographically isolated populations, resulting in 613 the formation of closely related species in different parts of the previously larger 614 distributional range of the common ancestor. For many terrestrial animals, including different 615 insect groups, the complex geological history of the East Mediterranean region during the late 616 Tertiary has determined their origins and distributions (Dennis et al., 2000; Fattorini, 2002; 617 Chatzimanolis et al., 2003). The geological history of the Aegean Archipelago, comprising 618 continental shelf islands that have become disconnected from each other and from the 619 adjacent continental areas in relatively recent geological times could be responsible for range 620 fragmentation and taxon diversification. We postulate that the most dominant evolutionary 621 process determining speciation in the Merodon luteomaculatus complex is range 622 fragmentation caused by Pliocene/Pleistocene changes in sea level and Pleistocene climate 623 change in continental areas of the Balkan Peninsula with subsequent divergence of the 624 fragmented ancestral population by genetic drift and restricted gene flow.
625 Figure 17.
626 The hypothetical biogeographic scenario of the M. luteomaculatus complex in the Eastern 627 Mediterranean is presented and discussed here (Fig. 17). According to our COI analyses (MP 628 and ML trees), the most divergent taxon is that from the Aegean island of Naxos. This 22
Journal of Zoological Systematics and Evolutionary Research Page 24 of 84
629 finding might be due to the complex geological history of the Aegean region. An event that 630 might be connected to the considerable genetic diversification of M. naxius sp. n. is the 631 separation of the southern from the northern Cyclades (ca. 3.5 Mya), with the latter still being 632 connected to the mainland at that time (Anastasakis & Dermitzakis, 1990). The continental 633 taxa M. luteomaculatus sp. n. and M. euri sp. n. were resolved within one cluster based on 634 MP and ML analyses of the COI gene. However, these two species do not share COI 635 haplotypes and show clear genetic structuring based on ISSR profile and 28S sequences. 636 Geometric morphometry of surstylus shape also strongly supported their differentiation. 637 These continental taxa most probably diverged much later (ca. 0.8 Mya) when the Cyclades 638 (including northernFor Cyclades) Review became disconnected Only from the mainland (see Fig. 4 in 639 Simaiakis & Mylonas (2008)). The current distribution of M. luteomaculatus sp. n. is 640 restricted to a small area of the Dinarides mountain chain (Fig. 14). The wide distribution of 641 M. euri sp. n. indicates that a range expansion pathway took place from the south, following 642 the eastward path of the Hellenic to the Dinaric mountains. Low genetic variability between 643 these two continental taxa suggests that they represent the most recent divergence event 644 within the M. luteomaculatus complex. Their divergence can probably be linked to past 645 climatic change in the Dinaric Alps, which was glaciated on several occasions during the 646 Pleistocene (Penck, 1900; Cvijić, 1900; 1917; Hughes, Woodward & Gibbard, 2006; 647 Milivojević et al., 2008; Djurović, 2009). Based on COI data, M. andriotes sp. n. from the 648 Aegean island of Andros, is the most closely related species to the Peloponnesian species M. 649 erymanthius sp. n. and M. peloponnesius sp. n. Divergence of M. andriotes sp. n. probably 650 occurred during the disconnection of the northern Cyclades from the southern Cyclades and 651 the mainland. The Peloponnesian lineage presumably arose during sea level fluctuations that 652 caused disconnection of the Peloponnese from the mainland. Separation of M. erymanthius 653 sp. n. from M. peloponnesius sp. n. is most likely related to the presence of multiple refugia 654 amongst mountains of the Peloponnese that played a key role in sustaining populations under 655 unfavourable conditions during the Pleistocene. Similar examples of species radiations in 656 Pleistocene refugia on the Peloponnese have been reported for genera of ants ( Csősz et al.,
657 2014), centipedes (Simaiakis & Mylonas, 2008), scorpions (Tropea, Fet, Parmakelis, 658 Kotsakiozi & Stathi, 2013) and lizards (Thanou et al., 2014).
659 Thus, we conclude that the palaeogeographic history of this region largely influenced the 660 speciation process in the M. luteomaculatus complex. Two principal factors, namely range 23
Page 25 of 84 Journal of Zoological Systematics and Evolutionary Research
661 fragmentation caused by Pliocene and Pleistocene sea level changes and isolation in separate 662 glacial refugia during the Pleistocene, with subsequent evolution of the fragmented ancestral 663 stock by genetic drift and restricted gene flow, led to the formation of the genetically distinct 664 yet morphologically indistinguishable species of the M. luteomaculatus complex. This 665 example of cryptic speciation arising from a complex biogeographical history is not unique 666 for Dipteran or other insects groups (e.g. Mc Evey, David & Tsacas, 1987; Dusfour et al., 667 2004; Yeh, Chang, Lin, Wu & Yang, 2004) but, for the first time, we present evidence for 668 possible routes of speciation in hoverflies that are linked to the palaeogeological history of 669 their area of occurrence.For Review Only 670
24
Journal of Zoological Systematics and Evolutionary Research Page 26 of 84
671 Acknowledgements
672 The study was funded by the European Union (European Social Fund – ESF) and Greek 673 national funds through the Operational Program "Education and Lifelong Learning" of the 674 National Strategic Reference Framework (NSRF)—Research Funding Program: THALES— 675 Investing in knowledge society through the European Social Fund (Petanidou et al., 2013). 676 Partial support came from the the Serbian Ministry of Education, Science and Technological 677 Development (projects OI173002, III43002), the Provincial Secretariat for Science and 678 Technological Development ("Evaluation of Ecological Networks in AP Vojvodina as 679 support for nature conservation").For Review We also thank John O’BrienOnly for English revision.
680
681 Author contributions
682 SR, GS, TP, AV performed the sampling; SR, LŠZ, JA, GS, AV conceived and designed the 683 study; SR, LŠZ, JA, NKT performed the experimental analysis, while SR, LŠZ, JA, NV, 684 NKT, AV participated in data analyses; SR, LŠZ, JA, ZM took part in draft preparation, 685 while AV, GS, MD, DOV, NV, TP contributed to discussions during preparation of the paper 686 and participated in critical revision of the manuscript. All authors read, commented on and 687 approved the final version of the manuscript.
688
689
25
Page 27 of 84 Journal of Zoological Systematics and Evolutionary Research
690 References
691 Ačanski, J., Vujić, A., Djan, M., Obreht Vidaković, D., Ståhls, G., & Radenković, S. (2016). 692 Defining species boundaries in the Merodon avidus complex (Diptera, Syrphidae) 693 using integrative taxonomy, with the description of a new species. European Journal 694 of Taxonomy 237, 1 25. doi: http://dx.doi.org/10.5852/ejt.2016.237
695 Anastasakis, G. C., & Dermitzakis, M. (1990). Post Middle Miocene paleogeographic 696 evolution of the Central Aegean Sea and detailed Quaternary reconstruction of the 697 region. Its possible influence on the distribution of the Quaternary mammals of the 698 Cyclades islands.For Neues ReviewJahrbuch , Geologie und OnlyPaleontologie Monatheft , 1, 1 16.
699 Andrić, A., Šikoparija, B., Obreht, D., Djan, M., Preradović, J., Radenković, S., Pérez Bañón, 700 C., & Vujić, A. (2014). DNA barcoding applied: identifying the larva of Merodon 701 avidus (Diptera: Syrphidae). Acta Entomologica Musei Nationalis Pragae , 54, 741 – 702 757.
703 Bandelt, H. J., Forster, P., & Röhl, A. (1999). Median joining networks for inferring 704 intraspecific phylogenies. Molecular biology and evolution , 16, 37 48. 705 doi: https://doi.org/10.1093/oxfordjournals.molbev.a026036
706 Beerli, P., Hotz, H., & Uzzell, T. (1996). Geologically dated sea barriers calibrate a protein 707 clock for Aegean water frogs. Evolution , 50, 1676 1687. doi:10.1111/j.1558 708 5646.1996.tb03939.x
709 Belshaw, R., Lopez Vaamonde, C., Degerli, N., & Quicke, D. L. (2001). Paraphyletic taxa 710 and taxonomic chaining: evaluating the classification of braconine wasps 711 (Hymenoptera: Braconidae) using 28S D2 3 rDNA sequences and morphological 712 characters. Biological Journal of the Linnean Society , 73, 411 424. 713 doi: https://doi.org/10.1111/j.1095 8312.2001.tb01370.x
714 Bookstein, F. L. (1991). Morphometrics tools for landmark data . Cambridge University Press.
715 Bookstein, F. L. (1997). Landmark methods for forms without landmarks: morphometrics of 716 group differences in outline shape. Medical Image Analysis , 1, 225 243.
26
Journal of Zoological Systematics and Evolutionary Research Page 28 of 84
717 doi: https://doi.org/10.1016/S1361 8415(97)85012 8
718 Chatzaki, M., Thaler, K., & Mylonas, M. (2002). Ground spiders (Gnaphosidae; Araneae) of 719 Crete (Greece). Taxonomy and distribution. I. Revue suisse de Zoologie , 109, 559 602.
720 Chatzaki, M., Lymberakis, P., Markakis, G., & Mylonas, M. (2005). The distribution of 721 ground spiders (Araneae, Gnaphosidae) along the altitudinal gradient of Crete, Greece: 722 species richness, activity and altitudinal range. Journal of Biogeography , 32, 813 831. 723 doi:10.1111/j.1365 2699.2004.01189.x
724 Chatzimanolis, S., ForTrichas, A., ReviewGiokas, S., & Mylonas, OnlyM. (2003). Phylogenetic analysis and 725 biogeography of Aegean taxa of the genus Dendarus (Coleoptera: Tenebrionidae). 726 Insect Systematics & Evolution , 34, 295 312. doi:10.1163/187631203788964773
727 Chen, H., Rangasamy, M., Tan, S. Y., Wang, H., & Siegfried, B. D. (2010). Evaluation of five 728 methods for total DNA extraction from western corn rootworm beetles. PLoS one , 5, 729 e11963. doi: https://doi.org/10.1371/journal.pone.0011963
730 Chroni, A., Djan, M., Vidaković, D. O., Petanidou, T., & Vujić, A. (2017). Molecular species 731 delimitation in the genus Eumerus (Diptera: Syrphidae). Bulletin of entomological 732 research , 107, 126 138. doi: https://doi.org/10.1017/S0007485316000729
733 Cowling, D. E., & Burnet, B. (1981). Courtship songs and genetic control of their acoustic 734 characteristics in sibling species of the Drosophila melanogaster subgroup. Animal 735 Behaviour , 29, 924 935. doi: https://doi.org/10.1016/S0003 3472(81)80030 9
736 Crandall, K. A., Bininda Emonds, O. R., Mace, G. M., & Wayne, R. K. (2000). Considering 737 evolutionary processes in conservation biology. Trends in ecology & evolution , 15, 738 290 295. doi: https://doi.org/10.1016/S0169 5347(00)01876 0
739 Csősz, S., Seifert, B., Müller, B., Trindl, A., Schulz, A., & Heinze, J. (2014). Cryptic 740 diversity in the Mediterranean Temnothorax lichtensteini species complex 741 (Hymenoptera: Formicidae). Organisms Diversity & Evolution , 14, 75 88. 742 doi: https://doi.org/10.1007/s13127 013 0153 3
27
Page 29 of 84 Journal of Zoological Systematics and Evolutionary Research
743 Cvijić, J. (1900, July). L'epoque glaciaire dans la Peninsule des Balkans. In Annales de 744 Géographie (Vol. 9, No. 46, pp. 359 372). Armand Colin.
745 Cvijić, J. (1917, May). L'époque glaciaire dans la péninsule balkanique. In Annales de 746 Géographie (Vol. 26, No. 141, pp. 189 218). Armand Colin.
747 Dennis, R. L., Shreeve, T. G., Olivier, A., & Coutsis, J. G. (2000). Contemporary geography 748 dominates butterfly diversity gradients within the Aegean archipelago (Lepidoptera: 749 Papilionoidea, Hesperioidea). Journal of Biogeography , 27, 1365 1383. 750 doi:10.1046/j.1365 2699.2000.00514.xFor Review Only 751 Dermitzakis, M. D. (1990). The colonization of Aegean islands in relation with the 752 paleogeographic evolution. Biologia gallo-hellenica , 14, 99 121.
753 Djurović, P. (2009). Reconstruction of the Pleistocene glaciers of Mt. Durmitor in 754 Montenegro. Acta Geographica Slovenica , 49, 263 289.
755 Douris, V., Rodakis, G. C., Giokas, S., Mylonas, M., & Lecanidou, R. (1995). Mitochondrial 756 DNA and morphological differentiation of Albinaria populations (Gastropoda: 757 Clausiliidae). Journal of Molluscan Studies , 61, 65 78. 758 doi: https://doi.org/10.1093/mollus/61.1.65
759 Dusfour, I., Linton, Y. M., Cohuet, A., Harbach, R. E., Baimai, V., Trung, H. D., Seng, C. M., 760 Matusop, A., & Manguin, S. (2004). Molecular evidence of speciation between island 761 and continental populations of Anopheles (Cellia ) sundaicus (Diptera: Culicidae), a 762 principal malaria vector taxon in Southeast Asia. Journal of medical entomology , 41, 763 287 295. doi: https://doi.org/10.1603/0022 2585 41.3.287
764 Evanno, G., Regnaut, S., & Goudet, J. (2005). Detecting the number of clusters of individuals 765 using the software STRUCTURE: a simulation study. Molecular ecology , 14, 2611 766 2620. doi:10.1111/j.1365 294X.2005.02553.x
767 Excoffier, L., & Lischer, H. E. (2010). Arlequin suite ver 3.5: a new series of programs to 768 perform population genetics analyses under Linux and Windows. Molecular ecology 769 resources , 10, 564 567. doi: https://doi.org/10.1111/j.1755 0998.2010.02847.x 28
Journal of Zoological Systematics and Evolutionary Research Page 30 of 84
770 Falush, D., Stephens, M., & Pritchard, J. K. (2007). Inference of population structure using 771 multilocus genotype data: dominant markers and null alleles. Molecular Ecology 772 Resources , 7, 574 578. doi:10.1111/j.1471 8286.2007.01758.x
773 Fattorini, S. (2002). Biogeography of the tenebrionid beetles (Coleoptera, Tenebrionidae) on 774 the Aegean Islands (Greece). Journal of Biogeography , 29, 49 67.
775 Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for 776 amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan 777 invertebrates.For Molecular Review marine biology and biotechnology Only, 3, 294 299. 778 Foufopoulos, J., & Ives, A. R. (1999). Reptile extinctions on land bridge islands: life history 779 attributes and vulnerability to extinction. The American Naturalist , 153, 1 25. 780 doi: https://doi.org/10.1086/303149
781 Gantenbein, B., Kropf, C., Largiader, C. R., & Scholl, A. (2000). Molecular and 782 morphological evidence for the presence of a new buthid taxon (Scorpiones: Buthidae) 783 on the island of Cyprus. Revue suisse de Zoologie , 107, 213 232.
784 Gantenbein, B., & Largiadèr, C. R. (2002). Mesobuthus gibbosus (Scorpiones: Buthidae) on 785 the island of Rhodes hybridization between Ulysses’ stowaways and native 786 scorpions?. Molecular Ecology , 11, 925 938. doi:10.1046/j.1365 294X.2002.01494.x
787 Goloboff, P. A. (1999). NONA Computer Program. Ver. 2.0. Published by the author, 788 Tucuman, Argentina.
789 Grković, A., Vujić, A., Radenković, S., Chroni, A., & Petanidou, T. (2015). Diversity of the 790 genus Eumerus Meigen (Diptera, Syrphidae) on the eastern Mediterranean islands 791 with description of three new species. Annales de la Société entomologique de France, 792 51, 361 373.
793 Haarto, A., & Ståhls, G. (2014). When mtDNA COI is misleading: congruent signal of ITS2 794 molecular marker and morphology for North European Melanostoma Schiner, 1860 795 (Diptera, Syrphidae). Zookeys , 431, 93 134. doi:10.3897/zookeys.431.7207
29
Page 31 of 84 Journal of Zoological Systematics and Evolutionary Research
796 Hadley, A. (2006). CombineZ. Vsn. 5.3. http://www.hadleyweb.pwp.blueyonder.co.uk 797 (accessed 15 February 2017)
798 Hall, T. A. (1999, January). BioEdit: a user friendly biological sequence alignment editor and 799 analysis program for Windows 95/98/NT. In Nucleic acids symposium series (Vol. 41, 800 No. 41, pp. 95 98). [London]: Information Retrieval Ltd., c1979 c2000..
801 Hijmans, R. J., Cameron, S. E., Parra, J. L., Jones, P. G., & Jarvis, A. (2005). Very high 802 resolution interpolated climate surfaces for global land areas. International journal of 803 climatology For, 25, 1965 1978. Review doi: http://dx.doi.org/10.1002/joc.1276 Only 804 Holland, B. S., Dawson, M. N., Crow, G. L., & Hofmann, D. K. (2004). Global 805 phylogeography of Cassiopea (Scyphozoa: Rhizostomeae): molecular evidence for 806 cryptic species and multiple invasions of the Hawaiian Islands. Marine Biology , 145, 807 1119 1128. doi: http://dx.doi.org/10.1007/s00227 004 1409 4
808 Hughes, P. D., Woodward, J. C., & Gibbard, P. L. (2006). Quaternary glacial history of the 809 Mediterranean mountains. Progress in physical geography , 30, 334 364. 810 doi:10.1191/0309133306pp481ra
811 Hughes, P. D., Woodward, J. C., Van Calsteren, P. C., Thomas, L. E., & Adamson, K. R. 812 (2010). Pleistocene ice caps on the coastal mountains of the Adriatic Sea. Quaternary 813 science reviews , 29, 3690 3708. doi: https://doi.org/10.1016/j.quascirev.2010.06.032
814 Hurkmans, W. (1993). A Monograph of Merodon (Diptera: Syrphidae). Part 1. Tijdschrift 815 voor Entomologie , 136, 147 234.
816 Kasapidis, P. A. M. E., Magoulas, A., Mylonas, M., & Zouros, E. (2005). The 817 phylogeography of the gecko Cyrtopodion kotschyi (Reptilia: Gekkonidae) in the 818 Aegean archipelago. Molecular Phylogenetics and Evolution , 35, 612 623. 819 doi: https://doi.org/10.1016/j.ympev.2005.02.005
820 Kehlmaier, C., & Assmann, T. (2010). Molecular analysis meets morphology based 821 systematics a synthetic approach for Chalarinae (Insecta: Diptera: Pipunculidae). 822 Systematic Entomology , 35, 181 195. doi: http://dx.doi.org/10.1111/j.1365 30
Journal of Zoological Systematics and Evolutionary Research Page 32 of 84
823 3113.2009.00500.x
824 Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions 825 through comparative studies of nucleotide sequences. Journal of molecular evolution , 826 16, 111–120. doi: https://doi.org/10.1007/BF01731581
827 Klingenberg, C. P. (2011). MORPHOJ: an integrated software package for geometric 828 morphometrics. Ver. 2.0. Molecular ecology resources , 11, 353 357. 829 doi: http://dx.doi.org/10.1111/j.1755 0998.2010.02924.x
830 Knowlton, N. (2000).For Molecular Review genetic analyses Only of species boundaries in the sea. 831 Hydrobiologia , 420, 73 90. doi: https://doi.org/10.1023/A:1003933603879
832 Kopelman, N. M., Mayzel, J., Jakobsson, M., Rosenberg, N. A., & Mayrose, I. (2015). 833 Clumpak: a program for identifying clustering modes and packaging population 834 structure inferences across K. Molecular ecology resources , 15, 1179 1191. 835 doi: http://dx.doi.org/10.1111/1755 0998.12387
836 Librado, P., & Rozas, J. (2009). DnaSP v5: A software for comprehensive analysis of DNA 837 polymorphism data. Bioinformatics , 25, 1451 1452. 838 doi: http://dx.doi.org/10.1093/bioinformatics/btp187
839 Mallet, J. (2001). The speciation revolution. Journal of Evolutionary Biology , 14, 887 888. 840 doi:10.1046/j.1420 9101.2001.00342.x
841 Mantel, N. A. (1967). The detection of disease clustering and a generalized regression 842 approach. Cancer Research , 27, 209 220.
843 Marcos García, M. A., Vujić, A., & Mengual, X. (2007). Revision of Iberian species of the 844 genus Merodon (Diptera: Syrphidae). European Journal of Entomology , 104, 531 572. 845 doi: http://dx.doi.org/10.14411/eje.2007.073
846 Marcos García, M. A., Vujić, A., Ricarte, A., & Ståhls, G. (2011). Towards an integrated 847 taxonomy of the Merodon equestris species complex (Diptera: Syrphidae) including 848 description of a new species, with additional data on Iberian Merodon . The Canadian
31
Page 33 of 84 Journal of Zoological Systematics and Evolutionary Research
849 Entomologist , 143, 332 348. doi: http://dx.doi.org/10.4039/n11 013
850 Mc Evey S. F., David J. R., & Tsacas, L. (1987). The Drosophila ananassae complex with 851 description of a new species from French Polynesia (Diptera: Drosophilidae). Annales 852 de la Société entomologique de France , 23, 377 385.
853 Menezes, B. F., Vigoder, F. M., Peixoto, A. A., Varaldi, J., & Bitner Mathé, B. C. (2013). 854 The influence of male wing shape on mating success in Drosophila melanogaster . 855 Animal Behaviour , 85, 1217 1223. doi: https://doi.org/10.1016/j.anbehav.2013.03.008
856 Mengual, X., Ståhls,For G., & Rojo,Review S. (2008a). First phylogenyOnly of predatory flower flies 857 (Diptera, Syrphidae, Syrphinae) using mitochondrial COI and nuclear 28S rRNA 858 genes: conflict and congruence with the current tribal classification. Cladistics , 24, 859 543–562. doi:10.1111/j.1096 0031.2008.00200.x
860 Mengual, X., Ståhls, G., & Rojo, S. (2008b). Molecular phylogeny of Allograpta (Diptera, 861 Syrphidae) reveals diversity of lineages and non monophyly of phytophagous taxa. 862 Molecular Phylogenetics and Evolution , 49, 715–727. 863 doi: https://doi.org/10.1016/j.ympev.2008.09.011
864 Mengual, X., Ståhls, G., & Rojo, S. (2012). Is the mega diverse genus Ocyptamus (Diptera, 865 Syrphidae) monophyletic? Evidence from molecular characters including the 866 secondary structure of 28S rRNA. Molecular Phylogenetics and Evolution , 62, 191 867 205. doi: https://doi.org/10.1016/j.ympev.2011.09.014
868 Mengual, X., Ståhls, G., Vujić, A., & Marcos García, M. (2006). Integrative taxonomy of 869 Iberian Merodon species (Diptera, Syrphidae). Zootaxa , 1377, 1 26.
870 Messerli, B. (1967). Die eiszeitliche und die gegenwartige Vertgletscherung im 871 Mittelemeerraum. Geographica Helvetica , 22, 105 228. 872 doi: https://doi.org/10.5194/gh 22 105 1967
873 Mezey, J. G., & Houle, D. (2005). The dimensionality of genetic variation for wing shape in 874 Drosophila melanogaster . Evolution , 59, 1027 1038. doi: https://doi.org/10.1554/04 875 491 32
Journal of Zoological Systematics and Evolutionary Research Page 34 of 84
876 Milivojević, M., Menković, L., & Ćalić, J. (2008). Pleistocene glacial relief of the central part 877 of Mt. Prokletije (Albanian Alps). Quaternary International , 190, 112 122. 878 doi: https://doi.org/10.1016/j.quaint.2008.04.006
879 Miller, M. A., Pfeiffer, W., & Schwartz, T. (2010, November). Creating the CIPRES Science 880 Gateway for inference of large phylogenetic trees. In Gateway Computing 881 Environments Workshop (GCE), 2010 (pp. 1 8). Ieee.
882 Moraes, E. M., Manfrin, M. H., Laus, A. C., Rosada, R. S., Bomfin S. C., & Sene, F. M. 883 (2004). Wing shape heritability and morphological divergence of the sibling species 884 Drosophila Formercatorum Reviewand Drosophila paranaensis Only. Heredity , 92, 466 473.
885 .Mutanen, M., & Pretorius, E. (2007). Subjective visual evaluation vs. traditional and 886 geometric morphometrics in species delimitation: a comparison of moth genitalia. 887 Systematic Entomology , 32, 371 386. doi:10.1111/j.1365 3113.2006.00372.x
888 Mylonas, M. (1982). The zoogeography and ecology of the terrestrial molluscs of Cyclades . 889 PhD Thesis, University of Athens.
890 Nedeljković, Z., Ačanski, J., Djan, M., Obreht Vidaković, D., Ricarte, A., & Vujić, A. (2015). 891 An integrated approach to delimiting species borders in the genus Chrysotoxum 892 Meigen, 1803 (Diptera: Syrphidae), with description of two new species. 893 Contributions to Zoology , 84, 285 304.
894 Nedeljković, Z., Ačanski, J., Vujić, A., Obreht, D., Djan, M., Ståhls, G., & Radenković, S. 895 (2013). Taxonomy of Chrysotoxum festivum Linnaeus, 1758 (Diptera: Syrphidae) – an 896 integrative approach. Zoological Journal of the Linnean Society ,169, 84 102. 897 doi: https://doi.org/10.1111/zoj.12052
898 Nei, M., & Li, W. H. (1979). Mathematical model for studying genetic variation in terms of
899 restriction endonucleases. Proceedings of the National Academy of Sciences , 76, 5269 900 5273.
901 Nixon, K. C. (2002). WinClada ver. 1.00. 08. Published by the author, Ithaca, New York.
33
Page 35 of 84 Journal of Zoological Systematics and Evolutionary Research
902 Oliveira, L. O. D., Venturini B. A., Rossi, A. A. B., & Hastenreiter S. S. (2010). Clonal 903 diversity and conservation genetics of the medicinal plant Carapichea ipecacuanha 904 (Rubiaceae). Genetics and molecular biology , 33, 86 93. 905 doi: http://dx.doi.org/10.1590/S1415 47572009005000096
906 Outomuro, D., Adams, D. C., & Johansson, F. (2013). The evolution of wing shape in 907 ornamented winged damselflies (Calopterygidae, Odonata). Evolutionary biology , 40, 908 300 309. doi: https://doi.org/10.1007/s11692 012 9214 3 909 Padial, J. M., Miralles,For A., De Review la Riva, I., & Vences, Only M. (2010). The integrative future of 910 taxonomy. Frontiers in zoology , 7, 1 14. doi: https://doi.org/10.1186/1742 9994 7 16
911 Page, R. D. M. (1996). TreeView: An application to display phylogenetic trees on personal 912 computers. Computer Applications in the Biosciences , 12, 357 358.
913 Parmakelis, A., Pfenninger, M., Spanos, L., Papagiannakis, G., Louis, C., & Mylonas, M. 914 (2005). Inference of a radiation in Mastus (Gastropoda, Pulmonata, Enidae) on the 915 island of Crete. Evolution , 59, 991 1005. doi: https://doi.org/10.1554/04 489
916 Parmakelis, A., Spanos, E., Papagiannakis, G., Louis, C., & Mylonas, M. (2003). 917 Mitochondrial DNA phylogeny and morphological diversity in the genus Mastus 918 (Beck, 1837): a study in a recent (Holocene) island group (Koufonisi, south east 919 Crete). Biological Journal of the Linnean Society , 78, 383 399. 920 doi: https://doi.org/10.1046/j.1095 8312.2003.00152.x
921 Parmakelis, A., Stathi, I., Chatzaki, M., Simaiakis, S., Spanos, L., Louis, C., & Mylonas, M. 922 (2006a). Evolution of Mesobuthus gibbosus (Brullé, 1832) (Scorpiones: Buthidae) in 923 the northeastern Mediterranean region. Molecular Ecology , 15, 2883 2894. 924 doi:10.1111/j.1365 294X.2006.02982.x
925 Parmakelis, A., Stathi, I., Spanos, L., Louis, C., & Mylonas, M. (2006b). Phylogeography of 926 Iurus dufoureius (Brullé, 1832) (Scorpiones, Iuridae). Journal of Biogeography , 33, 927 251 260. doi:10.1111/j.1365 2699.2005.01386.x
928 Pavlicek, A., Hrda, S., & Flegr, J. (1999). FreeTree Freeware program for construction of 34
Journal of Zoological Systematics and Evolutionary Research Page 36 of 84
929 phylogenetic trees on the basis of distance data and bootstrap/jackknife analysis of the 930 tree robustness. Application in the RAPD analysis of genus Frenkelia . Folia Biologica 931 (Praba) , 45, 97 99.
932 Penck, A. (1900). Die Eiszeit auf der Balkanhalbinsel. Globus , 78, 133 178.
933 Perissoratis, C., & Conispoliatis, N. (2003). The impacts of sea level changes during latest 934 Pleistocene and Holocene times on the morphology of the Ionian and Aegean seas (SE 935 Alpine Europe). Marine Geology , 196, 145 156. doi:https://doi.org/10.1016/S0025 936 3227(03)00047 1For Review Only 937 Petit, R. J., & Excoffier, L. (2009). Gene flow and species delimitation. Trends in Ecology &
938 Evolution , 24, 386 393. doi: https://doi.org/10.1016/j.tree.2009.02.011
939 Pinheiro, L. R., Rabbani, A. R. C., da Silva, A. V. C., da Silva Lédo, A., Pereira, K. L. G., & 940 Diniz, L. E. C. (2012). Genetic diversity and population structure in the Brazilian 941 Cattleya labiata (Orchidaceae) using RAPD and ISSR markers. Plant Systematics and 942 Evolution , 298, 1815 1825. doi: https://doi.org/10.1007/s00606 012 0682 9
943 Pires, A. C., & Marinoni, L. (2010). DNA barcoding and traditional taxonomy unified through 944 integrative taxonomy: a view that challenges the debate questioning both 945 methodologies. Biota Neotropica , 10, 339 346. doi:http://dx.doi.org/10.1590/S1676 946 06032010000200035
947 Popov, G. V. (2010). Merodon alexandri spec. nov. – a new species of hoverfly (Diptera: 948 Syrphidae) from the northern Black Sea Region. Studia Dipterologica , 16, 133 151.
949 Popović, D., Ačanski, J., Djan, M., Obreht, D., Vujić, A., & Radenković, S. (2015). Sibling 950 species delimitation and nomenclature of the Merodon avidus complex (Diptera: 951 Syrphidae). European Journal of Entomology , 112, 790 809. 952 doi:10.14411/eje.2015.100
953 Poulakakis, N., Lymberakis, P., Antoniou, A., Chalkia, D., Zouros, E., Mylonas, M., & 954 Valakos, E. (2003). Molecular phylogeny and biogeography of the wall–lizard 955 Podarcis erhardii (Squamata: Lacertidae). Molecular Phylogenetics and Evolution , 35
Page 37 of 84 Journal of Zoological Systematics and Evolutionary Research
956 28, 38 46. doi: https://doi.org/10.1016/S1055 7903(03)00037 X
957 Poulakakis, N., Lymberakis, P., Tsigenopoulos, C. S., Magoulas, A., & Mylonas, M. (2005a). 958 Phylogenetic relationships and evolutionary history of snake eyed skink Ablepharus 959 kitaibelii (Sauria: Scincidae). Molecular Phylogenetics and Evolution , 34, 245 256. 960 doi: https://doi.org/10.1016/j.ympev.2004.10.006
961 Poulakakis, N., Lymberakis, P., Valakos, E., Pafilis, P., Zouros, E., & Mylonas, M. (2005b). 962 Phylogeography of Balkan wall lizard ( Podarcis taurica ) and its relatives inferred 963 from mitochondrial DNA sequences. Molecular Ecology , 14, 2433 2443. 964 doi:10.1111/j.1365 294X.2005.02588.xFor Review Only
965 Poulakakis, N., Lymberakis, P., Valakos, E., Zouros, E., & Mylonas, M. (2005c). 966 Phylogenetic relationships and biogeography of Podarcis species from the Balkan 967 Peninsula, by Bayesian and maximum likelihood analyses of mitochondrial DNA 968 sequences. Molecular Phylogenetics and Evolution , 37, 845 857. 969 doi: https://doi.org/10.1016/j.ympev.2005.06.005
970 Pritchard, J. K., Stephens, M., & Donnelly, P. (2000). Inference of population structure using 971 multilocus genotype data. Genetics , 155, 945 959.
972 Puillandre, N., Lambert, A., Brouillet, S., & Achaz, G. (2012). ABGD, Automatic Barcode 973 Gap Discovery for primary species delimitation. Molecular Ecology , 21, 1864 1877. 974 doi: http://dx.doi.org/10.1111/j.1365 294X.2011.05239.x
975 Quantum GIS Development Team. (2016). Geographical Information System. Open Source 976 Geospatial Foundation Project. Available from http://qgis.osgeo.org
977 Radenković, S., Vujić, A., Ståhls, G., Pérez Bañón, C., Petanidou, T., & Šimić, S. (2011). 978 Three new cryptic species of the genus Merodon Meigen (Diptera: Syrphidae) from 979 the island of Lesvos (Greece). Zootaxa , 2735, 35 56.
980 Ritchie, M. G., & Gleason, J. M. (1995). Rapid evolution of courtship song pattern in
981 Drosophila willistoni sibling species. Journal of Evolutionary Biology , 8, 463 479.
36
Journal of Zoological Systematics and Evolutionary Research Page 38 of 84
982 Rodríguez, F. J. L. O. J., Oliver, J. L., Marín, A., & Medina, J. R. (1990). The general 983 stochastic model of nucleotide substitution. Journal of theoretical biology , 142, 485 984 501. doi: https://doi.org/10.1016/S0022 5193(05)80104 3
985 Rohlf, F. J. (2006). TpsDig Digitize landmarks and outlines. Ver.2.05. Department of 986 Ecology and Evolution, State University of New York at Stony Brook, New York.
987 Rohlf, F. J., & Slice, D. E. (1990). Extensions of the Procrustes method for the optimal 988 superimposition of landmarks. Systematic Biology , 39, 40 59. 989 doi: http://dx.doi.org/10.2307/2992207For Review Only 990 Rosenberg, M. S., & Anderson, C. D. (2011). PASSaGE: pattern analysis, spatial statistics 991 and geographic exegesis. Ver: 2. Methods in Ecology and Evolution , 2, 229 232 . 992 doi:10.1111/j.2041 210X.2010.00081.x
993 Rotheray, G. E., & Gilbert, F. (2011). The natural history of hoverflies . Forrest text.
994 Sacchi, R., & Hardersen, S. (2013). Wing length allometry in Odonata: differences between 995 families in relation to migratory behaviour. Zoomorphology , 132, 23 32. 996 doi:https://doi.org/10.1007/s00435 012 0172 1
997 Šašić, L., Ačanski, J., Vujić, A., Ståhls, G., Radenković, S., Milić, D., Obreht Vidaković, D., 998 & Djan, M. (2016). Molecular and morphological inference of three cryptic species 999 within the Merodon aureus species group (Diptera: Syrphidae). PLoS ONE , 11, 1000 e0160001. doi: http://dx.doi.org/10.1371/journal.pone.0160001
1001 Sfenthourakis, S. (1996). A biogeographical analysis of terrestrial isopods (Isopoda, 1002 Oniscidea) from the central Aegean islands (Greece). Journal of Biogeography , 23, 1003 687 698. doi:10.1111/j.1365 2699.1996.tb00029.x
1004 Sfenthourakis, S., & Giokas, S. (1998). A biogeographical analysis of the Greek Oniscidean 1005 endemism. Israel Journal of Zoology , 44, 273 282.
1006 Sfenthourakis, S., Giokas, S., & Mylonas, M. (1999). Testing for nestedness in the terrestrial 1007 isopods and snails of Kyklades islands (Aegean Sea, Greece). Ecography , 22, 384
37
Page 39 of 84 Journal of Zoological Systematics and Evolutionary Research
1008 395. doi:10.1111/j.1600 0587.1999.tb00575.x
1009 Sfenthourakis, S., & Legakis, A. (2001). Hotspots of endemic terrestrial invertebrates in
1010 southern Greece. Biodiversity and Conservation , 10, 1387 1417. 1011 doi: https://doi.org/10.1023/A:1016672415953
1012 Sheets, H. D. (2012). IMP software series. Canisius College, Buffalo, New York .
1013 Simaiakis, S., & Mylonas, M. (2008). The Scolopendra species (Chilopoda: 1014 Scolopendromorpha: Scolopendridae) of Greece (E Mediterranean): a theoretical 1015 approach onFor the effect Review of geography and palaeogeogr Onlyaphy on their distribution. 1016 Zootaxa , 1792, 39 53.
1017 Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., & Flook, P. (1994). Evolution, 1018 weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation 1019 of conserved polymerase chain reaction primers. Annals of the entomological Society 1020 of America , 87, 651 701. doi: http://dx.doi.org/10.1093/aesa/87.6.651
1021 Smith, M. A., Wood, D. M., Janzen, D. H., Hallwachs, W., & Hebert, P. D. (2007). DNA 1022 barcodes affirm that 16 species of apparently generalist tropical parasitoid flies 1023 (Diptera, Tachinidae) are not all generalists. Proceedings of the National Academy of 1024 Sciences , 104, 4967 4972. doi:10.1073/pnas.0700050104
1025 Soto, I. M., Carreira, V. P., Soto, E. M., Márquez, F., Lipko, P., & Hasson, E. (2013). Rapid 1026 divergent evolution of male genitalia among populations of Drosophila buzzatii . 1027 Evolutionary Biology , 40, 395 407. doi: http://dx.doi.org/10.1007/s11692 013 9223 x
1028 Ståhls, G., Hippa, H., Rotheray, G., Muona, J., & Gilbert, F. (2003). Phylogeny of Syrphidae 1029 (Diptera) inferred from combined analysis of molecular and morphological characters. 1030 Systematic Entomology , 28, 433–450. doi:10.1046/j.1365 3113.2003.00225.x
1031 Ståhls, G., Stuke, J. H., Vujić, A., Doczkal, D., & Muona, J. (2004). Phylogenetic 1032 relationships of the genus Cheilosia and the tribe Rhingiini (Diptera, Syrphidae) based 1033 on morphological and molecular characters. Cladistics , 20, 105 122. 1034 doi:10.1111/j.1096 0031.2004.00023.x 38
Journal of Zoological Systematics and Evolutionary Research Page 40 of 84
1035 Ståhls, G., Vujić, A., Pérez Bañón, C., Radenković, S., Rojo, S., & Petanidou, T. (2009). COI 1036 barcodes for identification of Merodon hoverflies (Diptera, Syrphidae) of Lesvos 1037 Island, Greece. Molecular Ecology Resources , 9, 1431 1438. 1038 doi: http://dx.doi.org/10.1111/j.1755 0998.2009.02592.x
1039 Ståhls, G., Vujić, A., Petanidou, T., Cardoso, P., Radenković, S., Ačanski, J., Pérez Bañón, 1040 C., & Rojo, S. (2016). Phylogeographic patterns of Merodon hoverflies in the Eastern 1041 Mediterranean region: revealing connections and barriers. Ecol Evol 6, 2226 2245. 1042 doi: http://dx.doi.org/10.1002/ece3.2021
1043 Stamatakis, A. (2014).For RAxML Review Version 8: A tool for phylogeneticOnly analysis and post analysis 1044 of large phylogenies. Bioinformatics , 30, 1312 1313. 1045 doi: https://doi.org/10.1093/bioinformatics/btu033
1046 Stathi, I., & Mylonas, M. (2001). New records of scorpions from the central and eastern 1047 Mediterranean area: biogeographical comments, with special reference to the Greek 1048 species. Scorpions , 287 295.
1049 StatSoft Inc (2015). STATISTICA (data analysis software system), version 12. Available 1050 from www.statsoft.com
1051 Strid, A. (1997). Introduction. In: A. Strid & K. Tan (Eds.), Flora Hellenica (Vol. 1, pp. 9 1052 35). Koenigstein: Koeltz Scientific Books.
1053 Stubbs, A. E., & Falk, S. (1983). British hoverflies: an illustrated guide. British 1054 Entomological and Natural History Society, London .
1055 Tauber, E., & Eberl, D. F. (2003). Acoustic communication in Drosophila . Behavioural 1056 processes , 64, 197 210. doi: https://doi.org/10.1016/S0376 6357(03)00135 9
1057 Templeton, A. R. (1989). The meaning of species and speciation: a genetic perspective. In: D. 1058 Otte & J. A. Endler (Eds.), Speciation and its consequences (pp. 3 27). Sunderland: 1059 Sinauer.
1060 Thanou, E., Giokas, S., & Kornilios, P. (2014). Phylogeography and genetic structure of the
39
Page 41 of 84 Journal of Zoological Systematics and Evolutionary Research
1061 slow worms Anguis cephallonica and Anguis graeca (Squamata: Anguidae) from the 1062 southern Balkan Peninsula. Amphibia-reptilia , 35, 263 269. doi: 10.1163/15685381 1063 00002947
1064 Thompson, F. C. (1999). A key to the genera of the flower flies (Diptera: Syrphidae) of the 1065 Neotropical region including descriptions of new genera and species and a glossary of 1066 taxonomic terms. Contributions on entomology, international , 3, 322 378.
1067 Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the 1068 sensitivity ofFor progressive Review multiple sequence alignm Onlyent through sequence weighting, 1069 position specific gap penalties and weight matrix choice. Nucleic acids research , 22, 1070 4673 4680. doi: https://doi.org/10.1093/nar/22.22.4673
1071 Trichas, A., & Legakis, A. (1987). General considerations on the distribution of Coleoptera in 1072 the Aegean islands. Biologia gallo-hellenica , 13, 127 132.
1073 Tropea, G., Fet, V., Parmakelis, A., Kotsakiozi, P., & Stathi, I. (2013). A new species of 1074 Euscorpius Thorell, 1876 from Peloponnese, Greece (Scorpiones: Euscorpiidae). 1075 Euscorpius , 1 11.
1076 Veselić, S., Vujić, A., & Radenković, S. (2017). Three new Eastern Mediterranean endemic 1077 species of the Merodon aureus group (Diptera: Syrphidae). Zootaxa , 4254, 401 434.
1078 Vilemant, C., Simbolotti, S., & Kenis, M. (2007). Discrimination of Eubazus (Hymenoptera, 1079 Braconidae) sibling species using geometric morphometrics analysis of wing venation.
1080 Systematic Entomology, 32, 625 634. doi:10.1111/j.1365 3113.2007.00389.x
1081 Vujić, A., Marcos García, M. Á., Sarıbıyık, S., & Ricarte, A. (2011). New data on the 1082 Merodon Meigen 1803 fauna (Diptera: Syrphidae) of Turkey including description of 1083 a new species and changes in the nomenclatural status of several taxa. Annales de la 1084 Société entomologique de France , 47, 78 88. 1085 doi: http://dx.doi.org/10.1080/00379271.2011.10697699
1086 Vujić, A., Pérez Bañón, C., Radenković, S., Ståhls, G., Rojo, S., Petanidou, T., & Šimić, S. 1087 (2007). Two new species of genus Merodon Meigen, 1803 (Syrphidae, Diptera) from 40
Journal of Zoological Systematics and Evolutionary Research Page 42 of 84
1088 the island of Lesvos (Greece), in the eastern Mediterranean. Annales de la Société 1089 entomologique de France , 43, 319 326. 1090 doi: http://dx.doi.org/10.1080/00379271.2007.10697527
1091 Vujić, A., Petanidou, T., Tscheulin, T., Cardoso, P., Radenković, S., Ståhls, G., Baturan, Ž., 1092 Mijatović, G., Rojo, S., Pérez Bañón, C., & Devalez, J. (2016). Biogeographical 1093 patterns of the genus Merodon Meigen, 1803 (Diptera: Syrphidae) in islands of the 1094 eastern Mediterranean and adjacent mainland. Insect Conservation and Diversity , 9, 1095 181 191. doi: http://dx.doi.org/10.1111/icad.12156
1096 Vujić, A., Radenković,For S., Ačanski, Review J., Grković, A., Taylor,Only M., enol, S. G., & Hayat, R 1097 (2015). Revision of the species of the Merodon nanus group (Diptera: Syrphidae) 1098 including three new species. Zootaxa , 4006, 439 462. 1099 doi: http://dx.doi.org/10.11646/zootaxa.4006.3.2
1100 Vujić, A., Radenković, S., Likov, L., Trifunov, S., & Nikolić, T. (2013a). Three new species 1101 of the Merodon nigritarsis group (Diptera: Syrphidae) from the Middle East. Zootaxa , 1102 3640, 442 464. doi: http://dx.doi.org/10.11646/zootaxa.3640.3.7
1103 Vujić, A., Radenković, S., Ståhls, G., Ačanski, J., Stefanović, A., Veselić, S., Andrić, A., & 1104 Hayat, R. (2012). Systematics and taxonomy of the ruficornis group of genus 1105 Merodon Meigen (Diptera: Syrphidae). Systematic Entomology , 37, 578 602. 1106 doi: http://dx.doi.org/10.1111/j.1365 3113.2012.00631.x
1107 Vujić, A., Ståhls, G., Ačanski, J., Bartsch, H., Bygebjerg, R., & Stefanović, A. (2013b). 1108 Systematics of Pipizini and taxonomy of European Pipiza Fallén: Molecular and 1109 morphological evidence (Diptera, Syrphidae). Zoologica Scripta , 42, 288 305. 1110 doi: http://dx.doi.org/10.1111/zsc.12005
1111 Weisrock, D. W., Macey, J. R., Ugurtas, I. H., Larson, A., & Papenfuss, T. J. (2001). 1112 Molecular phylogenetics and historical biogeography among salamandrids of the 1113 “true” salamander clade: rapid branching of numerous highly divergent lineages in 1114 Mertensiella luschani associated with the rise of Anatolia. Molecular phylogenetics 1115 and evolution , 18, 434 448. doi: https://doi.org/10.1006/mpev.2000.0905
41
Page 43 of 84 Journal of Zoological Systematics and Evolutionary Research
1116 Welter Schultes, F. W., & Williams, M. R. (1999). History, island area and habitat availability 1117 determine land snail species richness of Aegean islands. Journal of Biogeography , 26, 1118 239 249. doi:10.1046/j.1365 2699.1999.00276.x
1119 Yeaman, S., Chen, Y., & Whitlock, M. C. (2010). No effect of environmental heterogeneity 1120 on the maintenance of genetic variation in wing shape in Drosophila melanogaster . 1121 Evolution , 64, 3398 3408. doi:10.1111/j.1558 5646.2010.01075.x
1122 Yeh, W. B., Chang, Y. L., Lin, C. H., Wu, F. S., & Yang, J. T. (2004). Genetic differentiation 1123 of Loxoblemmus appendicularis complex (Orthoptera: Gryllidae): speciation through 1124 vicariant andFor glaciation Reviewevents. Annals of the EntomologicalOnly society of America , 97, 1125 613 623. doi: https://doi.org/10.1603/0013 8746(2004)097[0613:GDOLAC]2.0.CO;2
1126 Zelditch, M. L., Swiderski, D. L., Sheets, H. D., & Fink, W. L. (2004). Geometric 1127 morphometrics for biologists: a primer. Elsevier Academic Press, London.
1128
42
Journal of Zoological Systematics and Evolutionary Research Page 44 of 84
1129 Figure legends
1130 Figure 1. Merodon luteomaculatus sp. n., male, right wing with location of 11 landmarks 1131 selected for geometric morphometric analysis. Scale bar = 1 mm.
1132 Figure 2. Merodon luteomaculatus sp. n., male genitalia, lateral view. a) epandrium; b) 1133 hypandrium. Abbreviations: pl posterior surstyle lobe with location of 20 semi landmarks 1134 selected for geometric morphometric analysis, c cercus. Scale bar = 0.2 mm.
1135 Figure 3. Merodon luteomaculatus sp. n., habitus a) male, dorsal view; b) female, dorsal 1136 view; c) male, lateralFor view; d) female,Review lateral view. Abbreviation: Only t spike on metatrochanter. 1137 Scale bar = 1 mm.
1138 Figure 4. Molecular analyses of combined 3’ and 5’ ends of COI sequences. a) Strict 1139 consensus tree of 18 equally parsimonious trees. Length = 645 steps, Consistency index (CI) 1140 = 73%, Retention index (RI) = 88%. Bootstrap values ≥ 50% are indicated above branches. 1141 Filled circles represent non homoplasious characters, open circles are homoplasious 1142 characters. (● M. andriotes sp. n., ● M. euri sp. n., ● M. erymanthius sp. n., ● M. 1143 luteomaculatus sp. n., ● M. naxius sp. n., ● M. peloponnesius sp. n.).
1144 Figure 5. Maximum Likelihood tree of combined 3’ and 5’ ends of COI sequences. Bootstrap 1145 values (≥ 50%) for main species clusters are indicated above branches. (● M. andriotes sp. n., 1146 ● M. euri sp. n., ● M. erymanthius sp. n., ● M. luteomaculatus sp. n., ● M. naxius sp. n., ● M. 1147 peloponnesius sp. n.).
1148 Figure 6. Median joining network of 28S genotypes of the Merodon luteomaculatus complex.
1149 Figure 7. UPGMA dendrogram based on ISSR profile of the Merodon luteomaculatus 1150 complex constructed using the Nei Li coefficient of genetic distance. The numbers represent 1151 bootstrap percentages calculated with 5,000 repetitions. (● M. andriotes sp. n., ● M. euri sp. 1152 n., ● M. erymanthius sp. n., ● M. luteomaculatus sp. n., ● M. naxius sp. n., ● M. 1153 peloponnesius sp. n.).
1154 Figure 8. Genetic structure among species of the Merodon luteomaculatus complex based on 1155 ISSR profiles. The graphics display genetic structuring for K = 2 and K = 5. 43
Page 45 of 84 Journal of Zoological Systematics and Evolutionary Research
1156 Figure 9. Wing shape differences among species of the Merodon luteomaculatus complex. a) 1157 Scatter plot of individual scores of CV1 and CV2; b) Scatter plot of individual scores of CV3 1158 and CV4.
1159 Figure 10. Phenetic relationships among the species of the Merodon luteomaculatus complex. 1160 a) UPGMA phenogram based on wing shape differences; b) UPGMA phenogram based on 1161 surstylus shape differences.
1162 Figure 11. Superimposed outline drawings showing wing shape differences among species of 1163 the Merodon luteomaculatus complex. Differences between the species have been 1164 exaggerated five foldFor to make themReview more visible. Only
1165 Figure 12. Surstylus shape differences among species of the Merodon luteomaculatus 1166 complex. a) Scatter plot of individual scores of CV1 and CV2; b) Scatter plot of individual 1167 scores of CV3 and CV4.
1168 Figure 13. Superimposed outline drawings showing posterior surstyle lobe shape differences 1169 among species of the Merodon luteomaculatus complex. Differences between the species 1170 have been exaggerated three fold to make them more visible.
1171 Figure 14. Range of the Merodon luteomaculatus complex. a) species distributions: ● M. 1172 andriotes sp. n., ● M. euri sp. n., ● M. erymanthius sp. n., ● M. luteomaculatus sp. n., ● M. 1173 naxius sp. n., ● M. peloponnesius sp. n.; b) variability plot of species altitudinal gradients.
1174 Figure 15. Habitats. a) characteristic habitat of the Merodon euri sp. n. Locality information: 1175 Greece, Mt. Olympus; b) type locality of the M. erymanthius sp. n. Locality information: 1176 Greece, Mt. Erymanthos, Kalentzi. Photos by Vujić Ante.
1177 Figure 16. Summary of the results of integrative species delimitation. Each species is 1178 represented by a different colour. Solid colour boxes indicate successful species delimitation 1179 by a particular approach. Multicolour boxes depict clusters formed by multiple species. 1180 Merodon naxius sp. n. was not analyzed for geometric morphometrics due to a small sample 1181 size (N/A).
1182 Figure 17. The hypothetical biogeographical scenario of the Merodon luteomaculatus 44
Journal of Zoological Systematics and Evolutionary Research Page 46 of 84
1183 complex in the Eastern Mediterranean.
1184 Figure 18. Merodon luteomaculatus sp. n., head a) male, antero lateral view; b) male, anterior 1185 view; c) male, lateral view; d) male, dorsal view; e) female, antero lateral view; f) female, 1186 anterior view; g) female, lateral view; h) female, dorsal view. Scale bar = 1 mm.
1187 Figure 19. Merodon luteomaculatus sp. n., male, frontal triangle, anterior view. Abbreviation: 1188 p position of the protuberance. Scale bar = 0.2 mm.
1189 Figure 20. Merodon luteomaculatus sp. n., metaleg, lateral view. a) male; b) female. 1190 Abbreviation: t spikeFor on metatrochanter. Review Scale bar = 1 Onlymm.
1191 Figure 21. Merodon luteomaculatus sp. n., abdomen, dorsal view. a) male; b) female. Scale 1192 bar = 1 mm.
45
Page 47 of 84 Journal of Zoological Systematics and Evolutionary Research
1193 List of Supporting information
1194 Table S1. Haplotypes of combined 3' and 5' COI sequences of species of the Merodon 1195 luteomaculatus complex.
1196 Table S2. Genotypes of 28S rRNA gene sequences of species of the Merodon luteomaculatus 1197 complex.
1198 Table S3. Results of PCA and ANOVA conducted on wing shape variables.
1199 Table S4. The alignment of combined COI sequences of species from Merodon 1200 luteomaculatus complex.For Review Only
1201 Table S5. The alignment of 28S rRNA gene sequences of species from Merodon 1202 luteomaculatus complex.
1203 Figure S1. ISSR profiles of the Merodon luteomaculatus species complex produced using the
1204 primer (GACA) 4. DNA size standards are located at both margins and in the middle of the 1205 gel, and the size in base pairs (bp) is indicated along both margins.
1206
46
Journal of Zoological Systematics and Evolutionary Research Page 48 of 84
1207 Tables
1208 Table 1. Average uncorrected pairwise sequence divergences (p distances) of COI sequences 1209 are shown below diagonal for species of the Merodon luteomaculatus complex.
1 2 3 4 5
1: M. erymanthius sp. n.
2: M. luteomaculatus sp. n. 1.8%
3: M. euri sp. n. 1.7% 0.3%
4: M. andriotes sp. n. 1.1% 2.2% 2.2%
For Review Only 5: M. naxius sp. n. 9.0% 9.3% 9.2% 9.2% 6: M. peloponnesius sp. n. 0.5% 1.9% 1.8% 1.0% 9.3% 1210
1211
1212
1213 Table 2. Results of discriminant analysis conducted on wing and male genitalia (surstylus) 1214 shape variables. Results of wing shape analysis (p values/F values; df = 18,172) are shown 1215 below diagonal. Results of male genitalia (surstylus) shape analysis (p values/F values; df = 1216 38,118) are shown above diagonal.
1 2 3 4 5
1: M. erymanthius sp. n. < 0.001/23.12 < 0.001/8.75 < 0.001/14.70 < 0.001/16.59 2: M. luteomaculatus sp. n. < 0.001/9.99 < 0.001/24.96 < 0.001/27.39 < 0.001/34.02 3: M. euri sp. n. < 0.001/17.32 < 0.001/11.86 < 0.001/14.12 < 0.001/15.22
4: M. andriotes sp. n. < 0.001/33.59 < 0.001/10.56 < 0.001/26.24 < 0.001/8.99 5: M. peloponnesius sp. n. < 0.001/18.53 < 0.001/8.16 < 0.001/8.51 < 0.001/16.25 1217
47
Page 49 of 84 Journal of Zoological Systematics and Evolutionary Research
Appendix 1. List of specimens used for molecular and geometric morphometric analyses.
Molecular analyzes Geometric morphometry Produced sequences analyzes Samples Collection Taxon Sex Collecting locality ID GenBank GenBank + in DNA ID accession accession ISSR Surstylus Wing ID numbers for numbers for analyszes ID 28S 3' and 5' COI FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, S2 AU813 KY946841 KY946921 WM2631 S2 Forleg. Vujić A. Review Only FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, R85 AU812 KY946840 KY946920 WM2630 leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, S10 AU811 KY946839 KY946919 + WM2628 S10 leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, R80 AU810 KY946838 KY946918 + WM2627 R80 leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, R71 AU809 KY946837 KY946917 WM1103 R71 leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, R65 AU808 KY946836 KY946916 + WM2629 R65 leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, R74 AU807 KY946835 KY946915 + leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, S9 AU806 KY946834 KY946914 + leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. F Montenegro, Orijen, planinarski dom, 27/08/2011, R50 AU805 KY946833 KY946913 WM1254 leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, planinarski dom, 27/08/2011, R99 AU804 KY946832 KY946912 WM1253 leg. Vujić A. FSUNS Merodon andriotes sp. n. F Greece, Andros, Pithara, near Apikia, 08/10/2012, G2458 AU506 KY946892 KY946975 WM1289 leg. Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. M Greece, Andros, Pithara, near Apikia, 08/10/2012, G2455 AU505 KY946893 KY946976 WM1294 G2455 leg. Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. F Greece, Andros, 1500 m S Chora, 10/10/2012, leg. G2465 AU504 KY946894 KY946977 + WM1127 Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. F Greece, Andros, Pithara, near Apikia, 08/10/2012, G2463 WM1128 leg. Vujić A., Radenković S. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2443 AU502 KY946821 KY946900 WM1118 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2442 AU501 KY946901 WM1122 02/09/2012, leg. Vujić A. (continues)
1
Journal of Zoological Systematics and Evolutionary Research Page 50 of 84
Appendix 1 (continued) FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2440 AU500 KY946822 KY946902 WM1121 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2446 AU499 KY946823 KY946903 WM1124 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. M Greece, Mountain Erymanthos, Kalentzi, G2429 AU498 KY946824 KY946904 + WM1119 G2429 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. M Greece, Mountain Erymanthos, Kalentzi, G2430 AU497 KY946825 KY946905 + 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. M Greece, Mountain Erymanthos, Kalentzi, G2433 AU496 KY946826 KY946906 G2433 For02/09/2012, leg. VujićReview A. Only FSUNS Merodon erymanthius sp. n. M Greece, Mountain Erymanthos, Kalentzi, G2428 AU495 KY946827 KY946907 + G2428 02/09/2012, leg. Vujić A. FSUNS Merodon andriotes sp. n. F Greece, Andros, near Andros, 10/08/2012, leg. 07459 WM1129 Stahls FSUNS Merodon andriotes sp. n. F Greece, Andros, Pithara, near Apikia, 08/10/2012, G2459 AU408 KY946891 KY946974 + WM1126 leg. Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. F Greece, Andros, Mesa Vouni, 10/10/2012, leg. G2466 AU407 KY946890 KY946973 + WM1290 Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. F Greece, Andros, heliport, 10/10/2012, leg. Vujić A., G2464 AU406 KY946889 KY946972 WM1291 Radenković S. FSUNS Merodon andriotes sp. n. F Greece, Andros, Pithara, near Apikia, 08/10/2012, G2462 AU405 KY946888 KY946971 + WM1288 leg. Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. M Greece, Andros, Pithara, near Apikia, 08/10/2012, G2461 WM1125 G2461 leg. Vujić A., Radenković S. FSUNS Merodon naxius sp. n. M Greece, Naxos, near Eggares, 10/10/2014, leg. 08642 AU403 KY946887 KY946970 + Vujić A., Šimić S., Radenković S. FSUNS Merodon naxius sp. n. M Greece, Naxos, near Eggares, 10/10/2014, leg. 08638 AU402 KY946886 KY946969 + Vujić A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. F Greece, Laconia, Karyes, 07/10/2014, leg. Vujić A., 08616 AU401 KY946885 KY946968 + WM1243 Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. F Greece, Laconia, Karyes, 07/10/2014, leg. Vujić A., 08614 AU400 KY946884 KY946967 WM1242 Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Karyes, 07/10/2014, leg. Vujić A., 08617 AU399 KY946883 KY946966 WM1252 Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Karyes, 07/10/2014, leg. Vujić A., 08613 AU398 KY946882 KY946965 Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. F Greece, Mountain Mainalo, Kardaras, 07/10/2014, 08609 AU397 KY946881 KY946964 WM1241 leg. Vujić A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. F Greece, Mountain Mainalo, Kardaras, 07/10/2014, 08607 AU396 KY946880 KY946963 leg. Vujić A., Šimić S., Radenković S. (continues)
2
Page 51 of 84 Journal of Zoological Systematics and Evolutionary Research
Appendix 1 (continued)
FSUNS Merodon peloponnesius sp. n. F Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08598 AU395 KY946879 KY946962 WM1283 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08577 AU394 KY946878 KY946961 + WM1282 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08589 AU393 KY946877 KY946960 WM1296 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08585 AU392 KY946876 KY946959 + WM1293 08585 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M For Greece, Laconia, Aeropoli,Review 06/10/2014, leg. Vujić 08584 Only AU391 KY946875 KY946958 WM1292 08584 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08600 AU390 KY946874 KY946957 WM1240 08600 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08592 AU389 KY946873 KY946956 WM1239 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08588 AU388 KY946872 KY946955 + WM1238 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08583 AU387 KY946871 KY946954 WM1237 08583 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08582 AU386 KY946870 KY946953 + WM1251 08582 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08569 AU385 KY946869 KY946952 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08556 AU384 KY946868 KY946951 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08553 AU383 KY946867 KY946950 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08541 AU382 KY946866 KY946949 WM1281 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08558 AU381 KY946865 KY946948 WM1280 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08561 AU380 KY946864 KY946947 WM1279 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. M Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08559 AU379 KY946863 KY946946 + A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. M Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08543 AU378 KY946862 KY946945 + WM1276 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. M Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08540 AU377 KY946861 KY946944 WM1275 A., Šimić S., Radenković S. MAegean Merodon euri sp. n. M Greece, Evros, Dadia, 21 23/09/2012, leg. Tsalkatis AD29 AU31 KY946860 KY946943 AD29 P. (continues)
3
Journal of Zoological Systematics and Evolutionary Research Page 52 of 84
Appendix 1 (continued) FSUNS Merodon naxius sp. n. F Greece, Naxos, near Skeponi, 13/10/2012, leg. AC52 AU29 KY946859 KY946942 + Ståhls G. MAegean Merodon euri sp. n. M Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC54 AU28 KY946858 KY946941 WM1106 AC54 P. MAegean Merodon euri sp. n. F Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC57 AU27 KY946857 KY946940 P. MAegean Merodon euri sp. n. F Greece, Evros, Dadia, 21 23/09/2012, leg. Tsalkatis AC58 AU26 KY946856 KY946939 + WM1255 P. MAegean Merodon euri sp. n. F Greece, Evros, Dadia, 21 23/09/2012, leg. Tsalkatis AC63 AU25 KY946855 KY946938 ForP. Review Only MAegean Merodon euri sp. n. F Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC80 AU24 KY946854 KY946937 P. MAegean Merodon euri sp. n. F Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC83 AU23 KY946853 KY946936 P. MAegean Merodon euri sp. n. M Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC85 AU22 KY946852 KY946935 P. MAegean Merodon euri sp. n. M Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AB1 AU21 KY946851 KY946934 AB1 P. MAegean Merodon euri sp. n. M Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis LJ99 AU20 KY946850 KY946933 LJ99 P. FSUNS Merodon euri sp. n. F Serbia, Pčinja, Vogance, 06/09/2012, leg. Vujić A. G2470 AU19 KY946849 KY946932 + WM720
FSUNS Merodon euri sp. n. F Serbia, Pčinja, Vogance, 06/09/2012, leg. Vujić A. G2469 AU18 KY946848 KY946931 WM719
FSUNS Merodon euri sp. n. M Serbia, Pčinja, Vogance, 06/09/2012, leg. Vujić A., G2467 AU17 KY946847 KY946930 + WM718 G2467 Radenković S. FSUNS Merodon euri sp. n. F Serbia, Pčinja, Vogance, 06/09/2012, leg. Vujić A. G2468 AU16 KY946846 KY946929 + WM717
FSUNS Merodon andriotes sp. n. M Greece, Andros, Pithara, near Apikia, 08/10/2012, G2460 AU15 KY946845 KY946928 WM716 leg. Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. M Greece, Andros, Pithara, near Apikia, 08/10/2012, G2457 AU14 KY946844 KY946927 + WM715 G2457 leg. Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. F Greece, Andros, Pithara, near Apikia, 08/10/2012, G2456 AU13 KY946926 WM714 leg. Vujić A., Radenković S. FSUNS Merodon andriotes sp. n. F Greece, Andros, Vory, 09/10/2012, leg. Vujić A., G2454 AU12 KY946925 WM713 Radenković S. FSUNS Merodon euri sp. n. M Greece, Attiki, Manastir Daphni, near Atine, G2453 AU11 KY946843 KY946924 + WM712 07/10/2012, leg. Vujić A., Radenković S. FSUNS Merodon euri sp. n. F Greece, Magnisias, 50 km from Volos, 06/10/2012, G2452 AU10 KY946842 KY946923 + leg. Vujić A., Radenković S. (continues)
4
Page 53 of 84 Journal of Zoological Systematics and Evolutionary Research
Appendix 1 (continued) FSUNS Merodon euri sp. n. M Greece, Mountain Olympos, Manastir Prionia, G2451 AU09 KY946922 WM711 G2451 04/09/2012, leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, Vratna Subra, 31/08/2012, leg. G2450 AU08 KY946829 KY946909 WM710 G2450 Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, Vratna Subra, 31/08/2012, leg. G2449 AU07 KY946828 KY946908 WM709 Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2441 AU06 KY946820 KY946899 + WM708 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2434 AU05 KY946819 KY946898 + WM707 For02/09/2012, leg. VujićReview A. Only FSUNS Merodon erymanthius sp. n. M Greece, Mountain Erymanthos, Kalentzi, G2431 AU04 KY946818 KY946897 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2436 AU03 KY946817 KY946896 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. M Greece, Mountain Erymanthos, Kalentzi, G2427 AU02 KY946816 KY946895 WM705 G2427 02/09/2012, leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, Crkvice, 28/08/2011, leg. R1 WM2626 Vujić A. , Radišić FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2437 WM1287 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2435 WM1286 02/09/2012, leg. Vujić A. FSUNS Merodon peloponnesius sp. n. F Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08595 WM1284 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08565 WM1278 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08547 WM1277 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. M Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08562 WM1274 08562 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Attiki, Daphni, 10/10/1984 04214 WM1260
FSUNS Merodon euri sp. n. F Greece, Attiki, Daphni, 10/10/1984 04215 WM1256
FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08597 WM1250 08597 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08596 WM1249 08596 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08594 WM1248 08594 A., Šimić S., Radenković S. (continues)
5
Journal of Zoological Systematics and Evolutionary Research Page 54 of 84
Appendix 1 (continued) FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08591 WM1247 08591 A., Šimić S., Radenković S. FSUNS Merodon peloponnesius sp. n. M Greece, Laconia, Aeropoli, 06/10/2014, leg. Vujić 08590 WM1246 08590 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. M Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08549 WM1245 08549 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. M Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08542 WM1244 08542 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08567 WM1235 ForA., Šimić S., Radenković Review S. Only FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08546 WM1234 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08560 WM1233 A., Šimić S., Radenković S. FSUNS Merodon euri sp. n. F Greece, Achaia, near Patra, 10/04/2014, leg. Vujić 08545 WM1232 A., Šimić S., Radenković S. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2445 WM1123 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2448 WM1120 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2438 WM1117 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2444 WM1116 02/09/2012, leg. Vujić A. FSUNS Merodon erymanthius sp. n. F Greece, Mountain Erymanthos, Kalentzi, G2432 WM1115 02/09/2012, leg. Vujić A. Maegean Merodon euri sp. n. F Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AB2 WM1114 P. Maegean Merodon euri sp. n. M Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AB5 WM1112 AB5 P. Maegean Merodon euri sp. n. F Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC56 WM1111 P. FSUNS Merodon euri sp. n. F Greece, Attiki, Daphni, 28/09/1985. 04212 WM1110
FSUNS Merodon euri sp. n. F Greece, Attiki, Daphni, 09/09/1984 04216 WM1109
Maegean Merodon euri sp. n. F Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC61 WM1107 P. Maegean Merodon euri sp. n. F Greece, Evros, Dadia, 20 22/09/2012, leg. Tsalkatis AC77 WM1105 P. (continues)
6
Page 55 of 84 Journal of Zoological Systematics and Evolutionary Research
Appendix 1 (continued) FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, Crkvice, 28/08/2011, leg. R18 WM1102 R18 Vujić A., Radišić FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, Crkvice, 28/08/2011, leg. R3 WM1101 Vujić A., Radišić FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, Crkvice, 28/08/2011, leg. P92 P92 KY946830 KY946910 P92 Vujić A., Radišić FSUNS Merodon luteomaculatus sp. n. F Montenegro, Orijen, Crkvice, 28/08/2011, leg. R11 R11 KY946831 KY946911 Vujić A., Radišić FSUNS Merodon euri sp. n. F Greece 03917 WM1257 For Review Only RMHN Merodon erymanthius sp. n. M Greece, Peloponez, Acrogaliali Avia 10 km SO 02939 02939 Kalamata, 25/08/1987 FSUNS Merodon euri sp. n. M Greece, Evros, Dadia, 21 23/09/2012 leg. P. AC55 AC55 Tsalkatis FSUNS Merodon erymanthius sp. n. M Greece, Mountain Erymanthos, Kalentzi, G2426 G2426 02/09/2012, leg. Vujić A. FSUNS Merodon luteomaculatus sp. n. M Montenegro, Orijen, Crkvice, 28/08/2011, leg. P84 P84 Vujić A. , Radišić FSUNS Merodon luteomaculatus sp. n. M Montenegro, Boka Kotorska, Morinj, 27/08/2011, s33 S33 leg. Vujić A. FSUNS Merodon albifasciatus M Greece, Crete, Rethymnon, Orne Agia Galini, 06432 AU189 KU365422 25/4/2014, leg. Vujić A. FSUNS Eumerus amoenus M Italy, Sicily, via Messina Catania., 5/4/2015, leg. AU736 KU365421 Vujić A., Radenković S., Nedeljković Z., Ačanski J., Miličić M. FSUNS Xanthogramma citrofasciatum F Serbia, Dubašnica, Manastirište, 3/5/2012, leg. MS39 KU365420 Vujić A. FSUNS Archimicrodon sp. M RSA, wazulu Natal, Royal Natal NP, 4/12/2012, Y1778 KU365419 leg. Ståhls G. 1218
7
Journal of Zoological Systematics and Evolutionary Research Page 56 of 84
1219 Appendix 2
1220 Species description
1221 Classical morphological characters failed to distinguish taxa of the Merodon luteomaculatus 1222 species complex with certainty. Both considerable similarity and variability in morphological 1223 characters demanded use of other tools like molecular, geometric morphometric and 1224 distributional data to delimit cryptic species boundaries. Therefore, detailed description of 1225 Merodon luteomaculatus sp. n., as well as diagnostic molecular characters, data on wing and 1226 male genitalia morphometry are presented. Distributions of all species from the complex are 1227 provided. For Review Only
1228 Figure 18.
1229 Merodon luteomaculatus Vujić, Ačanski et Šašić sp. n.
1230 Diagnosis . Golden haired, largest species of the complex (approx. 10 mm in length). In most 1231 specimens dorsal half of eye covered with black pile, becoming light brown ventrally; 1232 antennae orange; microtrichose bands on tergites visible; apical two tarsomeres only vaguely 1233 darkened; female often with predominantly yellow pile on tergite 4. Differs from other 1234 species of the M. luteomaculatus complex by morphometric characters of wing and male 1235 genitalia (narrow distal part of the wing (Fig. 11); posterior surstyle lobe curved ventrally 1236 (Fig. 13)); DNA sequence data ( COI sequences: KY946908 KY946921; 28S sequences: 1237 KY946828 KY946841) and ISSR profile (Figure S1).
1238
1239 Type material
1240 Holotype . Montenegro : Orjen, planinarski dom, ♂, 27.viii.2011, leg. Vujić, A., Radišić, P., 1241 (deposited in the insect collection of the Faculty of Science University of Novi Sad, Serbia 1242 (FSUNS)).
1243 Paratypes . Bosnia and Herzegovina : Krupac, ♂, 15.ix.1911, (SAR); Montenegro : 1244 Durmitor, Komarnica, 2 ♀, 22.viii.1984, leg. Vujić, A., (FSUNS), Orjen, Crkvice, 6♂, ♀,
1
Page 57 of 84 Journal of Zoological Systematics and Evolutionary Research
1245 28.viii.2011, leg. Vujić, A., Radišić, P., (FSUNS), Orjen, Mountain hut, 8♂, ♀, 27.viii.2011, 1246 leg. Vujić, A., Radišić, P., (FSUNS), Orjen, Vratna Subra, 2♂, 31.viii.2012, leg. Vujić, A., 1247 (FSUNS), Boka Kotorska, Morinj, ♂, 27.viii.2011, leg. Vujić, A., (FSUNS).
1248 Etymology . The Latin name luteomaculatus refers to the presence of yellow lateral spots on 1249 tergites 2 and 3 (the adjective luteolus means yellow and the noun macula designates spots).
1250 Distribution . Continental species distributed on mountains in the western part of the Balkan 1251 Peninsula (Orjen and Durmitor Mountains in Montenegro; and Krupac, near Konjic, in 1252 Bosnia and Herzegovina) (Fig. 14a). Altitudinal range is from 300 to approx. 1,280 m.a.s.l. 1253 (Fig. 14b). Adults flyFor from August Review to September. Only
1254 Figure 19.
1255 Description
1256 Stubby, orange golden species, with bi coloured legs (Figs 1 3, 18 21).
1257 Male (Figs 2, 3a, c, 18a d, 19, 20a, 21a)
1258 Size: body length 9 10 mm; wing length 7 8 mm.
1259 Head (Fig. 18a d). Width:length:depth = 1:0.5 0.6:0.7 0.9. Face and frontal triangle (Fig. 18a 1260 and b) shiny black, covered with long orange golden pile (especially dense on frontal 1261 triangle); and with narrow microtrichose line along eye margins (some indistinct microtrichia 1262 present medially on face and above lunulae). Face (Fig. 18b) with parallel eye margins; width 1263 of face 0.3 0.4 times width of head. Frontal triangle (Fig. 18b) large; 0.4 times depth of head 1264 (0.6 length of head); with small central protuberance in lower fifth (Fig. 19: p). Oral margin 1265 (Fig. 18a c) shiny black, moderately protruded. Antenna (Fig. 18a c) orange, with slightly 1266 darker scape and pedicel; basoflagellomere 1.6 1.8 times as long as deep, 1.3 1.7 times 1267 longer than pedicel, with dorsal margin concave and acute apex; arista: second, third and 1268 thickened basal part of fourth flagellomere light brown, the rest dark brown to black, 1.2 1.4 1269 times longer than basoflagellomere; pedicel 1.5 as long as deep; setae on scape and pedicel 1270 all yellow. Eyes (Fig. 18a) covered with dense, long pile, black in upper part, brown or pale 1271 in lower part; pile as long as scape; eye contiguity (Fig. 18b) about 11 16 ommatidia long; 2
Journal of Zoological Systematics and Evolutionary Research Page 58 of 84
1272 length of eye contiguity:length of frontal triangle = 0.3 0.4:1; anterior angle of eye bridge 1273 about 70°. Length:width of subcranial cavity = 1.9 2; width of gena:width of subcranial 1274 cavity = 0.3 0.4. Vertical triangle (Fig. 18d) isosceles, twice as long as eye contiguity; width 1275 of vertical triangle:width of head = 0.1 0.2; with bronze lustre, anteriorly mostly covered 1276 with long black pile, and posteriorly with orange golden pile (in some specimens almost all 1277 pile on vertex orange golden). Ocellar triangle (Fig. 18d) equilateral, distance between 1278 anterior and posterior ocellus only slightly larger than the latter are from each other; distance 1279 from posterior ocellus to the upper eye corner as long as, or slightly shorter than, to the 1280 anterior ocellus. Occiput (Fig. 18d) almost the same width in the entire length; shiny silver 1281 golden, with long orange goldenFor Review pile becoming paler (almost Only white) ventrally, and with white 1282 microtrichose stripe along eye margin, narrow dorsally but widened laterally (⅓ width of 1283 occiput).
1284 Thorax. Scutum and scutellum (Fig. 3a) with golden lustre and sometimes with indistinct 1285 longitudinal golden stripes; dense, fine punctuation; covered with long, dense, erect orange 1286 golden pile (Fig. 3c), as long as basoflagellomere and pedicel together; scutellum 1287 length:width = 0.4; posterior margin with weak serration; subscutellum microtrichose; 1288 mediotergite bare or with small patch of scarce reduced microtrichia laterally. Pleurae with 1289 indistinct gray brown microtrichia; long, orange golden pile cover shiny golden areas of most 1290 of the anepisternum (except ventrally), as well as anteroventral and posterodorsal parts of the 1291 katepisternum, anepimeron, metasternum; shorter, thin, scarce, yellow pile on proepimeron.
1292 Legs bi coloured (Figs 3c, 20a). Femora black, except for orange apex and slightly paler 1293 base; tibiae and tarsi orange except tarsomeres 4 and 5 darkened dorsally (in some specimens 1294 only slightly shaded); pro and mesotibiae (rarely metatibiae) can be slightly darkened before 1295 apex (indication of dark ring in ¾) especially posteriorly. Leg pilosity orange golden, except 1296 for black pile on the following parts: pro and mesofemora dorsally and anteriorly, 1297 metafemora posterodorsally and most of metatarsi dorsally. A few black pile can also be 1298 present on the triangular plate of the metafemora, meso and metatibiae and mesotarsi 1299 dorsally. Metatrochanter with distinct spike (Fig. 20a: t). Metafemur moderately thickened 1300 and slightly arcuate dorsally, 0.2 0.3 times as wide as long; with less than ten long orange 1301 golden pile (as long as or a little shorter than width of femur) ventrally intermixed with short 1302 ones. Metatibia with ridge in basal half anteroventrally; 0.2 times as wide as long, minimum 3
Page 59 of 84 Journal of Zoological Systematics and Evolutionary Research
1303 width near base:maximum width in apical fourth = 0.5 0.6:1.
1304 Wing (Fig. 1). Wing membrane mostly hyaline (rarely brown along veins), but some cells 1305 (bc, c, sc) anteriorly yellowish; densely covered with microtrichia, except for bare cell bc, 1306 proximal end of cells c, bm, cup, and above and below spurious vein (sv) in basal 1/3 of cell 1307 br with reduced microtrichia; veins brown, except basally and mostly paler veins C, Sc and 1308 R1. Calypter pale yellow. Halter with yellow pedicel and brown capitulum.
1309 Abdomen (Figs 3a and c, 21a). Oval, as long as mesonotum; black with golden reflections; 1310 tergites 2 and 3 with triangular orange anterolateral spots (turned into bands on tergite 3) and 1311 more or less distinctFor white transverse Review bands of microtrichia Only interrupted in the middle; pile on 1312 tergites orange golden, relatively long, dense and erect. Sternites shiny black, covered with 1313 long yellow golden pile.
1314 Male genitalia (Fig. 2). Similar to all species from the aureus group. Epandrium with 1315 undeveloped anterior surstyle lobe and rounded posterior surstyle lobe (Fig. 2a: pl). Cercus 1316 (Fig. 2a: c) elongate, rectangular, without prominences. Hypandrium (Fig. 2b) sickle shaped, 1317 narrow and elongate, with reduced lateral sclerite of aedeagus.
1318 Figure 20.
1319 Female (Figs 3b, 18e h, 20b, 21b).
1320 Size: body length 7 9 mm; wing length 5 7 mm.
1321 Similar to the male except for normal sexual dimorphism and for the following 1322 characteristics: vertex (Fig. 18e and f) with more black pile anteriorly; width of vertex:width 1323 of head = 0.2 0.3. Scutum (Fig. 3b and d) with shorter pile (rarely with traces of longitudinal 1324 white microtrichose stripes). Metatrochanter (Fig. 20b) without spike. Tergites (Fig. 21b) 1325 besides short semi adpressed orange pile, also with black ones on tergites 2 3 posteriorly, 1326 mixed light and black pile anteriorly on tergite 3, and a few indistinct black pile on tergite 4 1327 posteromedially. Microtrichose bands (Figs 3b and d, 21b) on tergites 2 and 3 more 1328 developed and distinct, subparallel and also present on tergite 4, but oblique.
1329 Figure 21. 4
Journal of Zoological Systematics and Evolutionary Research Page 60 of 84
1330 Merodon andriotes Vujić, Radenković et Šašić sp. n.
1331 Diagnosis . Differs by morphometric wing and surstylus characters (subtle differences mostly 1332 present in the central part of the wing (Fig. 11); posterior surstyle lobe straight (Fig. 13)), and 1333 DNA sequence data ( COI sequences: KY946925 KY946928, KY946971 KY946977). It 1334 usually has predominantly pale pile on eyes (black pile present only in upper eye corner) and 1335 vertex. Female often with predominantly black pile on tergite 4, except yellow ones on 1336 microtrichose bands and posteriorly. 1337 For Review Only 1338 Type material
1339 Holotype . Greece : Andros, Pithara, near Apikia, ♂, 8.x.2012, leg. Vujić, A., Radenković, S., 1340 (FSUNS).
1341 Paratypes . Greece : Andros, 1,5 km S of Chora, ♀, 10.x.2012, leg. Vujić, A., Radenković, S., 1342 (FSUNS), Andros, Heliport, 1 km S of Chora, ♀, 10.x.2012, leg. Vujić, A., Radenković, S., 1343 (FSUNS), Andros, Mesa Vouni, ♀, 10.x.2012, leg. Vujić, A., Radenković, S., (FSUNS), 1344 Andros, near Andros, ♀, 10.viii.2012, leg. St åhls, G., (FSUNS), Andros, Pithara, near Apikia, 1345 3♂, 5♀, 8.x.2012, leg. Vujić, A., Radenković, S., (FSUNS), Andros, Vory, ♀, 9.x.2012, leg. 1346 Vujić, A., Radenković, S., (FSUNS).
1347 Etymology . The name andriotes is a Greek adjective for the name of the type locality, i.e. the 1348 island of Andros.
1349 Distribution . This is a local endemic species for Andros Island in the Cyclades archipelago 1350 (Fig. 14a). Altitudinal range is from 200 to approx. 550 m.a.s.l. (Fig. 14b). Adults fly in 1351 August to October.
1352
1353 Merodon euri Vujić et Radenković sp. n.
1354 Diagnosis . Differs by morphometric wing and surstylus characters (broader distal part of the
5
Page 61 of 84 Journal of Zoological Systematics and Evolutionary Research
1355 wing (Fig. 11); posterior surstyle lobe straight (Fig. 13)), and DNA sequence data ( COI 1356 sequences: KY946922 KY946924, KY946929 KY946941, KY946943 KY946952) and 1357 ISSR profile (Figure S1). Usually the smallest species (body length approx. 6.5 7 mm), with 1358 predominantly pale pile on eyes (black pile present only postero dorsally), darker antennae 1359 (scape brown, pedicel, apex and fossette of basoflagellomere light brown or only base of 1360 basoflagellomere pale and the rest brown), darker tarsi (tarsomeres 2(3) to 5 brown), and 1361 weak microtrichose bands on tergites. Female often with predominantly black, shorter and 1362 scarce pile on tergite 4, except yellow ones on microtrichose bands.
1363 For Review Only
1364 Material examined.
1365 Type material
1366 Holotype . Serbia : Pčinja, Vogance, ♂, 6.ix.2012, leg. Vujić, A., Radenković, S., (FSUNS).
1367 Paratypes . Bulgaria : Petrič, Melnik, 2♂, 15.viii 24.ix.1998, (J.S. coll.), Serbia: Pčinja, 1368 Vogance, 3♀, 6.ix.2012, leg. Vujić, A., (FSUNS), Greece: Attiki, Daphni, ♀, 9.ix.1984, 3♀, 1369 10.x.1984, ♀, 28.ix.1985, leg. Petanidou, T., (RMNH), Achaia, near Patra, 8♂, 13♀, 1370 10.iv.2014, ♀, 11.iv.2014, leg. Vujić, A., Šimić, S., Radenković, S., (FSUNS), Attiki, 1371 Daphni, ♂, 7.x.2012, leg. Vujić, A., Radenković, S., (FSUNS), Evros, Dadia, 6♂, 40♀, 20. 1372 22.ix.2012, 2 ♂, 6♀, 21. 23.ix.2012, leg. Tsalkatis, P., (MAegean), Evros, Kallithea, 2 ♂, 1373 26.ix.2007, leg. Williams, M. de C., (M.S. coll.), Magnisias, 50 km from Volos, ♀, 6.ix.2012, 1374 leg. Vujić, A., Radenković, S., (FSUNS), Magnisias, Platania, ♀, 7.x.2007, (C.C. coll.), Mt. 1375 Olympos, Prionia Monastery, ♂, 4.ix.2012, leg. Vujić, A., (FSUNS), Samothraki, Fengari, ♂, 1376 18.viii.1962, leg. Guichard, Harvey, (BMNH).
1377 Etymology . The name euri (genitive of eurus ) is the ancient Greek personification of the 1378 south east winds, but also means “the east”, referring to the species range in the South 1379 Eastern Balkans.
1380
1381 Distribution . A continental species recorded in Eastern and Southern parts of the Balkan
6
Journal of Zoological Systematics and Evolutionary Research Page 62 of 84
1382 Peninsula, from Serbia and Bulgaria to Greece. One population was recorded in the northern 1383 part of the Peloponnese in a lowland area near Patra (Fig. 14a). Altitudinal range is from 0 to 1384 approx. 1,100 m.a.s.l. (Fig. 14b). Adults fly from August to October, except in the northern 1385 part of the Peloponnese where they were encountered in April.
1386
1387 Merodon erymanthius Vujić, Ačanski et Šašić sp. n.
1388 Diagnosis . Differs by morphometric wing and surstylus characters (narrower proximal and 1389 wider distal part ofFor the wing (Fig.Review 11); slightly broader Onlyposterior surstyle lobe (Fig. 13)), and 1390 DNA sequence data ( COI sequences: KY946895 KY946907; 28S sequences: KY946816 1391 KY946827) and ISSR profile (Figure S1). It usually has darker antennae (scape, pedicel and 1392 fossette of basoflagellomere brown), lighter (light yellow) pile on frontal triangle and 1393 mesonotum, and well developed microtrichose bands on tergite 3.
1394
1395 Type material
1396 Holotype . Greece : Mt. Erymanthos, Kalentzi, ♀, 2.ix.2012, leg. Vujić, A., (FSUNS).
1397 Paratypes . Greece : Mt. Chelmos, Acrogaliali Avia 10 km SO Kalamata, ♂, 25.viii.1987, 1398 (RMNH), Mt. Erymanthos, Kalentzi, 6♂, 16 ♀, 2.ix.2012, leg. Vujić, A., (FSUNS).
1399 Etymology . The Greek adjective erymanthius refers to the type locality, i.e. Mount 1400 Erymanthos on the Peloponnese Peninsula.
1401 Distribution . This endemic species was recorded on the high mountains of Chelmos and 1402 Erymanthos on the Peloponnese Peninsula (Fig. 14a). Mountainous species with an 1403 altitudinal range from 1,200 to 1,550 m.a.s.l. (Fig. 14b). Adults fly in August/September.
1404
1405 Merodon naxius Vujić et Šašić sp. n.
7
Page 63 of 84 Journal of Zoological Systematics and Evolutionary Research
1406 Diagnosis . Differs by DNA sequence data ( COI sequences: KY946942, KY946969, 1407 KY946970) and ISSR profile (Figure S1). Usually with predominantly pale pile on eyes 1408 (black pile present only postero dorsally), darker antennae and tarsi (tarsomeres 2(3) to 5 1409 brown), and weak microtrichose bands on tergites.
1410
1411 Type material 1412 Holotype . Greece : ForNaxos, near ReviewEggares, ♂, 10.x.2014, leg.Only Vujić, A., (FSUNS). 1413 Paratypes . Greece : Naxos, near Eggares, ♂, 10.x.2014, leg. Radenković, S., (FSUNS); 1414 Naxos, near Skeponi, ♀, 13.x.2012, leg. Ståhls, G., ( FSUNS).
1415 Etymology . The Greek adjective naxius refers to the type locality, Naxos Island.
1416 Distribution . This species is endemic to Naxos, the largest island in the Cyclades archipelago 1417 (Fig. 14a). A lowland species with an altitudinal range from 120 to 250 m.a.s.l. (Fig. 14b). 1418 Adults fly in October.
1419
1420 Merodon peloponnesius Vujić, Radenković, Ačanski et Šašić sp. n.
1421 Diagnosis . Differs by morphometric wing and surstylus characters (slightly narrower wings 1422 (Fig. 11); posterior surstyle lobe straight (Fig. 13)), and DNA sequence data ( COI sequences: 1423 KY946953 KY946968). Usually with completely pale eye pile, darker antennae, metallic 1424 green mesonotum, light yellow pile on frontal triangle and mesonotum and well developed 1425 microtrichose triangular bands on tergite 3. Female often with predominantly black, shorter 1426 and scarce pile on tergite 4, except yellow ones on the microtrichose bands.
1427
1428 Type material
1429 Holotype . Greece: Laconia, Areopoli 1, ♂, 6.x.2014, leg. Vujić, A. (FSUN S).
8
Journal of Zoological Systematics and Evolutionary Research Page 64 of 84
1430 Paratypes . Greece: Laconia, Areopoli 1, 8 ♂, 2♀, 6.x.2014, 6♂, 6.x.2014, leg. Vujić, A., 1431 Šimić, S., Radenković, S., (FSUNS), Laconia, Karyes, 2♂, 2♀, 7.x.2014, leg. Vujić, A., 1432 Šimić, S., Radenković, S., (FSUNS), Mt. Mainalo, Kardaras, ♀, 7.x.2014, leg. Vujić, A., ♀, 1433 7.x.2014, leg. Šimić, S. (FSUNS).
1434 Etymology . The Greek adjective peloponnesius refers to the type locality, the Peloponnese 1435 Peninsula in Greece.
1436 Distribution . This species is endemic to the southern part of the Peloponnese, hitherto 1437 recorded at a few localities (Areopoli, Karyes, Kardaras) (Fig. 14a). Altitudinal range is from 1438 300 to approx. 1,270For m.a.s.l. (Fig. Review 14b). Adults fly in October. Only
1439
9
Page 65 of 84 Journal of Zoological Systematics and Evolutionary Research
For Review Only
Figure 1. Merodon luteomaculatus sp. n., male, right wing with location of 11 landmarks selected for geometric morphometric analysis. Scale bar = 1 mm.
80x34mm (300 x 300 DPI)
Journal of Zoological Systematics and Evolutionary Research Page 66 of 84
For Review Only
Figure 2. Merodon luteomaculatus sp. n., male genitalia, lateral view. a) epandrium; b) hypandrium. Abbreviations: pl - posterior surstyle lobe with location of 20 semi-landmarks selected for geometric morphometric analysis, c - cercus. Scale bar = 0.2 mm.
80x116mm (300 x 300 DPI)
Page 67 of 84 Journal of Zoological Systematics and Evolutionary Research
For Review Only
Figure 3. Merodon luteomaculatus sp. n., habitus a) male, dorsal view; b) female, dorsal view; c) male, lateral view; d) female, lateral view. Abbreviation: t - spike on metatrochanter. Scale bar = 1 mm.
180x153mm (300 x 300 DPI)
Journal of Zoological Systematics and Evolutionary Research Page 68 of 84
For Review Only Page 69 of 84 Journal of Zoological Systematics and Evolutionary Research
For Review Only For Review Only Journal of Zoological Systematics and EvolutionaryPage 70 of 84 Research For Review Only
Journal ofPage Zoological 71 of 84 Systematics and Evolutionary Research For Review Only Journal of Zoological Systematics and EvolutionaryPage 72 of 84 Research Page 73 ofFor 84 Journal Review of Zoological Systematics and Evolutionary Only Research ForJournal Review of Zoological Systematics and EvolutionaryOnly Research Page 74 of 84 For Review Only Journal ofPage Zoological 75 of 84 Systematics and Evolutionary Research Journal of Zoological Systematics and Evolutionary Research Page 76 of 84 For Review Only Page 77 of 84 Journal of Zoological Systematics and Evolutionary Research For Review Only Journal of Zoological Systematics and Evolutionary Research Page 78 of 84
For Review Only
Figure 14. Range of the Merodon luteomaculatus complex. a) species distributions: ● M. andriotes sp. n., ● M. euri sp. n., ● M. erymanthius sp. n., ● M. luteomaculatus sp. n., ● M. naxius sp. n., ● M. peloponnesius sp. n.; b) variability plot of species altitudinal gradients.
94x111mm (300 x 300 DPI)
Page 79 of 84 Journal of Zoological Systematics and Evolutionary Research
For Review Only
Figure 15. Habitats. a) characteristic habitat of the Merodon euri sp. n. Locality information: Greece, Mt. Olympus; b) type locality of the M. erymanthius sp. n. Locality information: Greece, Mt. Erymanthos, Kalentzi. Photos by Vujić Ante.
180x66mm (300 x 300 DPI)
Journal of Zoological Systematics and Evolutionary Research Page 80 of 84
For Review Only Page 81 of 84 Journal of Zoological Systematics and Evolutionary Research For Review Only Journal of Zoological Systematics and Evolutionary Research Page 82 of 84
For Review Only
Figure 18. Merodon luteomaculatus sp. n., head a) male, antero-lateral view; b) male, anterior view; c) male, lateral view; d) male, dorsal view; e) female, antero-lateral view; f) female, anterior view; g) female, lateral view; h) female, dorsal view. Scale bar = 1 mm.
92x47mm (300 x 300 DPI)
Page 83 of 84 Journal of Zoological Systematics and Evolutionary Research
For Review Only
Figure 19. Merodon luteomaculatus sp. n., male, frontal triangle, anterior view. Abbreviation: p - position of the protuberance. Scale bar = 0.2 mm.
80x104mm (300 x 300 DPI)
Journal of Zoological Systematics and Evolutionary Research Page 84 of 84
For Review Only
Figure 20. Merodon luteomaculatus sp. n., metaleg, lateral view. a) male; b) female. Abbreviation: t - spike on metatrochanter. Scale bar = 1 mm.
80x46mm (300 x 300 DPI)
Page 85 of 84 Journal of Zoological Systematics and Evolutionary Research
For Review Only
Figure 21. Merodon luteomaculatus sp. n., abdomen, dorsal view. a) male; b) female. Scale bar = 1 mm.
180x104mm (300 x 300 DPI)