bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 A translation control module coordinates germline stem cell differentiation with 2 ribosome biogenesis during Drosophila oogenesis

3 Elliot T. Martin1*, Patrick Blatt1*, Elaine Ngyuen2, Roni Lahr2, Sangeetha Selvam1, Hyun Ah M. 4 Yoon1,3, Tyler Pocchiari1,4, Shamsi Emtenani5, Daria E. Siekhaus5, Andrea Berman2, Gabriele 5 Fuchs1† and Prashanth Rangan1†

6 1Department of Biological Sciences/RNA Institute, University at Albany SUNY, Albany, NY 7 12202

8 2Department of Biological Sciences, University of Pittsburgh, Pittsburgh, PA 15260

9 3Albany Medical College, Albany, NY 12208

10 4SUNY Upstate Medical University, Syracuse, NY 13210-2375

11 5Institute of Science and Technology Austria, Klosterneuburg, Austria

12 *These authors contributed equally to this work

13 †Co-corresponding authors 14 Email: [email protected], [email protected]

15 Summary: Ribosomal defects perturb stem cell differentiation, causing diseases called 16 ribosomopathies. How ribosome levels control stem cell differentiation is not fully known. Here, 17 we discovered three RNA helicases are required for ribosome biogenesis and for Drosophila 18 oogenesis. Loss of these helicases, which we named Aramis, Athos and Porthos, lead to aberrant 19 stabilization of p53, cell cycle arrest and stalled GSC differentiation. Unexpectedly, Aramis is 20 required for efficient translation of a cohort of mRNAs containing a 5’-Terminal-Oligo-Pyrimidine 21 (TOP)-motif, including mRNAs that encode ribosomal proteins and a conserved p53 inhibitor, 22 Novel Nucleolar protein 1 (Non1). The TOP-motif co-regulates the translation of growth-related 23 mRNAs in mammals. As in mammals, the La-related protein co-regulates the translation of TOP- 24 motif containing RNAs during Drosophila oogenesis. Thus, a previously unappreciated TOP-motif 25 in Drosophila responds to reduced ribosome biogenesis to co-regulate the translation of ribosomal 26 proteins and a p53 repressor, thus coupling ribosome biogenesis to GSC differentiation.

27 Introduction

28 All life depends on the ability of ribosomes to translate mRNAs into proteins. Despite this universal 29 requirement, ribosome biogenesis is not universally equivalent. Stem cells, the unique cell type 30 that underlies the generation and expansion of tissues, in particular have a distinct ribosomal 31 requirement (Gabut et al., 2020; Sanchez et al., 2016; Woolnough et al., 2016; Zahradkal et al., 32 1991; Zhang et al., 2014). Ribosome production and levels are dynamically regulated to maintain 33 higher amounts in stem cells (Fichelson et al., 2009; Gabut et al., 2020; Sanchez et al., 2016; 34 Woolnough et al., 2016; Zahradkal et al., 1991; Zhang et al., 2014). For example, ribosome 35 biogenesis components are often differentially expressed, as observed during differentiation of 36 embryonic stem cells, osteoblasts, and myotubes (Gabut et al., 2020; Watanabe-Susaki et al., 37 2014; Zahradkal et al., 1991). In some cases, such as during Drosophila germline stem cell (GSC) 38 division, ribosome biogenesis factors asymmetrically segregate during asymmetric cell division, 39 such that a higher pool of ribosome biogenesis factors is maintained in the stem cell compared to 40 the daughter cell (Blatt et al., 2020a; Fichelson et al., 2009; Zhang et al., 2014). Reduction of

1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

41 ribosome levels in several stem cells systems can cause differentiation defects (Corsini et al., 42 2018; Fortier et al., 2015; Khajuria et al., 2018; Zhang et al., 2014). In Drosophila, perturbations 43 that reduce ribosome levels in the GSCs result in differentiation defects causing infertility 44 (Sanchez et al., 2016). Similarly, humans with reduced ribosome levels are afflicted with clinically 45 distinct diseases known as ribosomopathies, such as Diamond-Blackfan anemia, that often result 46 from loss of proper differentiation of tissue-specific progenitor cells (Armistead and Triggs-Raine, 47 2014; Barlow et al., 2010; Brooks et al., 2014; Higa-Nakamine et al., 2012; Lipton et al., 1986; 48 Mills and Green, 2017). However, the mechanisms by which ribosome biogenesis is coupled to 49 proper stem cell differentiation remain incompletely understood.

50 Ribosome production requires the transcription of ribosomal RNAs (rRNAs) and of mRNAs 51 encoding ribosomal proteins (Bousquet-Antonelli et al., 2000; de la Cruz et al., 2015; Granneman 52 et al., 2011, 2006; Tafforeau et al., 2013; Venema et al., 1997). Several factors, such as helicases 53 and endonucleases, transiently associate with maturing rRNAs to facilitate rRNA processing, 54 modification, and folding (Granneman et al., 2011; Sloan et al., 2017; Tafforeau et al., 2013; 55 Watkins and Bohnsack, 2012). Ribosomal proteins are imported into the nucleus, where they 56 assemble with rRNA to form the small 40S and large 60S ribosome subunits, which are then 57 exported to the cytoplasm (Baxter-Roshek et al., 2007; Decatur and Fournier, 2002; Granneman 58 et al., 2011, 2006; Koš and Tollervey, 2010; Nerurkar et al., 2015; Tafforeau et al., 2013; Zemp 59 and Kutay, 2007). Loss of RNA Polymerase I transcription factors, helicases, exonucleases, large 60 or small subunit ribosomal proteins, or other processing factors all compromise ribosome 61 biogenesis and trigger diverse stem cell-related phenotypes (Brooks et al., 2014; Calo et al., 2018; 62 Mills and Green, 2017; Sanchez et al., 2016; Yelick and Trainor, 2015; Zhang et al., 2014).

63 Nutrient availability influences the demand for de novo protein synthesis and thus ribosome 64 biogenesis (Anthony et al., 2000; Hong et al., 2012; Mayer and Grummt, 2006; Shu et al., 2020). 65 In mammals, nearly all of the mRNAs that encode the ribosomal proteins contain a Terminal Oligo 66 Pyrimidine (TOP) motif within their 5’ untranslated region (UTR), which regulates their translation 67 in response to nutrient levels (Fonseca et al., 2015; Hong et al., 2017; Lahr et al., 2017; 68 Tcherkezian et al., 2014). Under growth-limiting conditions, La related protein 1 (Larp1) binds to 69 the TOP sequences and to mRNA caps to inhibit translation of ribosomal proteins (Fonseca et 70 al., 2015; Jia et al., 2021; Lahr et al., 2017; Philippe et al., 2018). When growth conditions are 71 suitable, Larp1 is phosphorylated by the nutrient/redox/energy sensor mammalian Target of 72 rapamycin (mTOR) complex 1 (mTORC1), and does not efficiently bind the TOP sequence, thus 73 allowing for efficient translation of ribosomal proteins (Fonseca et al., 2018, 2015; Hong et al., 74 2017; Jia et al., 2021). In some instances, Larp1 binding can also stabilize TOP-containing 75 mRNAs (Aoki et al., 2013; Berman et al., 2020; Gentilella et al., 2017; Ogami et al., 2020), linking 76 mRNA translation with mRNA stability to promote ribosome biogenesis (Aoki et al., 2013; Berman 77 et al., 2020; Fonseca et al., 2018, 2015; Hong et al., 2017; Lahr et al., 2017; Ogami et al., 2020; 78 Philippe et al., 2018). Cellular nutrient levels are known to affect stem cell differentiation and 79 oogenesis in Drosophila (Hsu et al., 2008), however whether TOP motifs exist in Drosophila to 80 coordinate ribosome protein synthesis is unclear. The Drosophila ortholog of Larp1, La related 81 protein (Larp) is required for proper cytokinesis and meiosis in Drosophila testis as well as for 82 female fertility, but its targets remain undetermined (Blagden et al., 2009; Ichihara et al., 2007).

83 Germline depletion of ribosome biogenesis factors manifests as a stereotypical GSC 84 differentiation defect during Drosophila oogenesis (Sanchez et al., 2016). Female Drosophila 85 maintain 2-3 GSCs in the germarium (Figure 1A) (Kai et al., 2005; Twombly et al., 1996; Xie, 86 2000; Xie and Li, 2007; Xie and Spradling, 1998). Asymmetric cell division of GSCs produces a 87 self-renewing daughter GSC, and a differentiating daughter, called the cystoblast (CB) (Chen and 88 McKearin, 2003; McKearin and Ohlstein, 1995). This asymmetric division is unusual: following

2 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

89 mitosis, the abscission of the GSC and CB is not completed until the following G2 phase (Figure 90 1A’) (De Cuevas and Spradling, 1998; Hsu et al., 2008). The GSC is marked by a round structure 91 called the spectrosome, which elongates and eventually bridges the GSC and CB, similar to the 92 fusomes that connect differentiated cysts (Figure 1A’). During abscission the extended 93 spectrosome structure is severed and a round spectrosome is established in the GSC and the 94 CB (De Cuevas and Spradling, 1998; Hsu et al., 2008). Ribosome biogenesis defects result in 95 failed GSC-CB abscission, causing cells to accumulate as interconnected cysts marked by a 96 fusome-like structure called “stem cysts” (Figure 1A’) (Mathieu et al., 2013; Sanchez et al., 2016). 97 In contrast with differentiated cysts (McKearin and Ohlstein, 1995; McKearin and Spradling, 1990; 98 Ohlstein and McKearin, 1997), these stem cysts lack expression of the differentiation factor Bag 99 of Marbles (Bam), do not differentiate, and typically die, resulting in sterility (Sanchez et al., 2016). 100 How proper ribosome biogenesis promotes GSC abscission and differentiation is not known.

101 By characterizing three RNA helicases that promote ribosome biogenesis, we identified a 102 translational control module that is sensitive to proper ribosome biogenesis and coordinates 103 ribosome levels with GSC differentiation. When ribosome biogenesis is optimal, ribosomal 104 proteins and a p53 repressor are both efficiently translated allowing for proper GSC cell cycle 105 progression and its differentiation. However, when ribosome biogenesis is perturbed, we observe 106 diminished translation of both ribosomal proteins and the p53 repressor. As a consequence, p53 107 is stabilized, cell cycle progression is blocked and GSC differentiation is stalled. Thus, our work 108 reveals an elegant tuning mechanism that links ribosome biogenesis with a cell cycle progression 109 checkpoint and thus stem cell differentiation. Given that ribosome biogenesis defects in humans 110 result in ribosomopathies, which often result from stem cell differentiation defects, our data lay 111 the foundation for understanding the etiology of developmental defects that arise due to 112 ribosomopathies.

113 Results

114 Three conserved RNA helicases are required in the germline for GSC differentiation 115 We performed a screen to identify RNA helicases that are required for female fertility in 116 Drosophila, and identified three predicted RNA helicases with previously uncharacterized 117 functions, CG5589, CG4901, and CG9253 (Figure 1B-C) (Supplemental Table 1) (Blatt et al., 118 2020b). We named these candidate genes aramis, athos, and porthos, respectively, after 119 Alexandre Dumas’ three musketeers who fought in service of their queen. To further investigate 120 how these helicases promote fertility, we depleted aramis, athos, and porthos in the germline 121 using the germline-driver nanos-GAL4 (nosGAL4) in combination with RNAi lines. We detected 122 the germline and spectrosomes/fusomes in ovaries by immunostaining for Vasa and 1B1, 123 respectively. In contrast to controls, aramis, athos, and porthos germline RNAi flies lacked 124 spectrosome-containing cells, and instead displayed cells with fusome-like structures proximal to 125 the self-renewal niche (Figure 1D-H; Figure S1A-A’’’). The cells in this cyst-like structure 126 contained ring canals, a marker of cytoplasmic bridges, suggesting that they are indeed 127 interconnected (Figure S1B-B’’’) (Zhang et al., 2014). In addition to forming cysts in an aberrant 128 location, the aramis, athos, and porthos germline RNAi ovaries failed to form egg chambers 129 (Figure 1D-H). 130 131 Aberrant cyst formation proximal to the niche could reflect stem cysts with GSCs that divide to 132 give rise to CBs but fail to undergo cytokinesis or differentiated cysts that initiate differentiation 133 but cannot progress further to form egg chambers. To discern between these possibilities, first 134 we examined the expression of a marker of GSCs, phosphorylated Mothers against 135 decapentaplegic (pMad). We observed pMad expression in the cells closest to the niche, but not 136 elsewhere in the germline cysts of aramis, athos, and porthos germline RNAi flies (Figure S1C-

3 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

137 F’) (Kai and Spradling, 2003). Additionally, none of the cells connected to the GSCs in aramis, 138 athos, and porthos germline RNAi flies expressed the differentiation reporter bamGFP (Figure 139 1D-G’’) (McKearin and Ohlstein, 1995). Thus, loss of aramis, athos, or porthos in the germline 140 results in the formation of stem cysts, however with variable severity. This variability could be due 141 to a differential requirement for these genes or different RNAi efficiencies. Overall, we infer that 142 Aramis, Athos, and Porthos are required for proper GSC cytokinesis to produce a stem cell and 143 differentiating daughter.

144 Athos, Aramis, and Porthos are required for ribosome biogenesis 145 We found that Aramis, Athos, and Porthos are conserved from yeast to humans (Figure 1B). The 146 closest orthologs of Aramis, Athos, and Porthos are Rok1, Dhr2, and Rrp3 in yeast and DExD- 147 Box Helicase 52 (DDX52), DEAH-Box Helicase 33 (DHX33), and DEAD-Box Helicase 47 148 (DDX47) in humans, respectively (Hu et al., 2011). Both the yeast and human orthologs have 149 been implicated in rRNA biogenesis (Bohnsack et al., 2008; Khoshnevis et al., 2016; Martin et al., 150 2014; O ’day et al., 1996; Sekiguchi et al., 2006; Tafforeau et al., 2013; Venema et al., 1997; 151 Venema and Tollervey, 1995; Vincent et al., 2017; Zhang et al., 2011). In addition, the GSC- 152 cytokinesis defect that we observed in aramis, athos, and porthos RNAi flies is a hallmark of 153 reduced ribosome biogenesis in the germline (Sanchez et al., 2016). Based on these 154 observations, we hypothesized that Aramis, Athos, and Porthos could enhance ribosome 155 biogenesis to promote proper GSC differentiation.

156 Many factors involved in rRNA biogenesis localize to the nucleolus and interact with rRNA (Arabi 157 et al., 2005; Grandori et al., 2005; Henras et al., 2008; Karpen et al., 1988). To detect the 158 subcellular localization of Aramis and Athos, we used available lines that express 159 Aramis::GFP::FLAG or Athos::GFP::FLAG fusion proteins under endogenous control. For 160 Porthos, we expressed a Porthos::FLAG::HA fusion under the control of UASt promoter in the 161 germline using a previously described approach (DeLuca and Spradling, 2018). We found that in 162 the germline, Aramis, Athos and Porthos colocalized with Fibrillarin, which marks the nucleolus, 163 the site of rRNA synthesis (Figure 2A-C’’’) (Ochs et al., 1985). Aramis was also in the cytoplasm 164 of the germline and somatic cells of the gonad. To determine if Aramis, Athos, and Porthos directly 165 interact with rRNA, we performed immunoprecipitation (IP) followed by RNA-seq. We found that 166 rRNA immunopurified with Aramis, Athos, and Porthos (Figure 2D-D'’, Figure S2A-A’’). Thus, 167 Aramis, Athos, and Porthos are present in the nucleolus and interact with rRNA, suggesting that 168 they might regulate rRNA biogenesis.

169 Nucleolar size, and in particular nucleolar hypotrophy, is associated with reduced ribosome 170 biogenesis and nucleolar stress (Neumüller et al., 2008; Zhang et al., 2011). If Aramis, Athos, 171 and Porthos promote ribosome biogenesis, then their loss would be expected to cause nucleolar 172 stress and a reduction in mature ribosomes. Indeed, immunostaining for Fibrillarin revealed 173 hypotrophy of the nucleolus in aramis, athos, and porthos germline RNAi flies compared to in 174 control flies, consistent with nucleolar stress (Figure S2B-C). Next, we used polysome profile 175 analysis to evaluate the ribosomal subunit ratio and translation status of ribosomes in S2 cells 176 depleted of aramis, athos, or porthos (Boamah et al., 2012; Õunap et al., 2013). We found that 177 upon the depletion of all three helicases, the heights of the polysome peaks were reduced (Figure 178 2E-E’’). We found that depletion of aramis and porthos diminished the height of the 40S subunit 179 peak compared to the 60S subunit peak, characteristic of defective 40S ribosomal subunit 180 biogenesis (Figure 2E, E’’, Figure S2D) (Cheng et al., 2019), whereas athos depletion 181 diminished the height of the 60S subunit peak compared to the 80S peaks, characteristic of a 60S 182 ribosomal subunit biogenesis defect (Figure 2E’, Figure S2D’) (Cheng et al., 2019). RNAi- 183 mediated depletion of the orthologs of these helicases in HeLa cells similarly affected the

4 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

184 polysome profiles (Figure 2F’-F’’, Figure S2E-G). Taken together our findings indicate that these 185 helicases promote ribosome biogenesis in Drosophila and mammalian cells.

186 Aramis promotes cell cycle progression via p53 repression 187 Our data so far indicate that Aramis, Athos and Porthos promote ribosome biogenesis, which is 188 known to be required for GSC abscission (Sanchez et al., 2016). Yet the connections between 189 ribosome biogenesis and GSC abscission are poorly understood. To explore the connection, we 190 further examined the aramis germline RNAi line, as its defect was highly penetrant but maintained 191 sufficient germline for analysis (Figure 1E, H). First, we compared the mRNA profiles of aramis 192 germline RNAi ovaries to bam germline RNAi to determine if genes that are known to be involved 193 in GSC abscission have altered expression. We used germline bam depletion as a control 194 because it leads to the accumulation of CBs with no abscission defects (Flora et al., 2018a; 195 Gilboa et al., 2003; McKearin and Ohlstein, 1995; Ohlstein and McKearin, 1997), whereas loss of 196 aramis resulted in accumulation of CBs that do not abscise from the GSCs. 197 198 We performed RNA-seq and found that 607 RNAs were downregulated and 673 RNAs were 199 upregulated in aramis germline RNAi versus bam germline RNAi (cut-offs for differential gene 200 expression were log2(foldchange) >|1.5|, FDR < 0.05) (Figure S3A, Supplemental Table 2). 201 Gene Ontology (GO) analysis for biological processes on these genes encoding these 202 differentially expressed mRNAs (Thomas et al., 2003) revealed that the genes that were 203 downregulated upon aramis germline depletion were enriched for GO terms related to the cell 204 cycle, whereas the upregulated genes were enriched for GO terms related to stress response 205 (Figure 3A, Figure S3B). The downregulated genes included Cyclin A, which is required for cell 206 cycle progression, Cyclin B (CycB) and aurora B, which are required for both cell cycle 207 progression and cytokinesis; in contrast the housekeeping gene Actin 5C was unaffected (Figure 208 3B-C, Figure S3C-C’) (Mathieu et al., 2013; Matias et al., 2015). We confirmed that CycB was 209 reduced in the ovaries of aramis germline RNAi flies compared to bam germline RNAi flies by 210 immunofluorescence (Figure 3D-F). These results suggest that aramis is required for the proper 211 expression of key regulators of GSC abscission. 212 213 CycB is expressed during G2 phase after asymmetric cell division to promote GSC abscission 214 (Flora et al., 2018a; Mathieu et al., 2013). To test if the loss of germline aramis leads to GSC 215 abscission defects due to diminished expression of CycB, we attempted to express a functional 216 CycB::GFP fusion protein in the germline under the control of a UAS/GAL4 system (Figure S3D- 217 D’) (Mathieu et al., 2013). Unexpectedly, the CycB::GFP fusion protein was not expressed in the 218 aramis-depleted germline, unlike the wild type (WT) germline (Figure S3E-E’) (Glotzer et al., 219 1991; Mathieu et al., 2013; Zielke et al., 2014). We considered the possibility that progression into 220 G2 is blocked in the absence of aramis, precluding expression of CycB. To monitor the cell cycle, 221 we used the Fluorescence Ubiquitin-based Cell Cycle Indicator (FUCCI) system. Drosophila 222 FUCCI utilizes a GFP-tagged degron from E2f1 to mark G2, M, and G1 phases and an RFP- 223 tagged degron from CycB to mark S, G2, and M phases (Zielke et al., 2014). We observed cells 224 in different cell cycle stages in both WT and bam-depleted germaria, but the aramis-depleted 225 germaria expressed neither GFP nor RFP (Figure S3F-H’’). Double negative reporter expression 226 is thought to indicate early S phase, when expression of E2f1 is low and CycB is not expressed 227 (Hinnant et al., 2017). The inability to express FPs is not due to a defect in translation as aramis- 228 depleted germline can express GFP that is not tagged with the degron (Figure S3I-I’). Taken 229 together, we infer that loss of aramis blocks cell cycle progression around late G1 phase/early S 230 phase and prevents progression to G2 phase, when GSCs abscise from CBs.

231 In mammals, cells defective for ribosome biogenesis stabilize p53, which is known to impede the 232 G1 to S transition (Agarwal et al., 1995; Senturk and Manfredi, 2013). Therefore, we hypothesized

5 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

233 that the reduced ribosome biogenesis in the aramis-depleted germline leads to p53 stabilization 234 in undifferentiated cells, driving cell cycle arrest and GSC abscission defects. To test this 235 hypothesis, we detected p53 and Vasa in the germline by immunostaining. A hybrid dysgenic 236 cross that expresses p53 in undifferentiated cells was utilized as a positive control, and p53 null 237 flies were used as negative controls (Figure S3J-K) (Moon et al., 2018). In WT, we observed p53 238 expression in the meiotic stages of germline but p53 expression in GSCs and CBs was attenuated 239 as previously reported (Figure 3G-G’’) (Lu et al., 2010). However, compared to WT GSCs/CBs, 240 we observed p53 expression in the stem cysts of the aramis-depleted germline (Figure 3G-I). 241 Similarly, we observed p53 expression in the stem cysts of athos- and porthos-depleted germlines 242 (Figure S3L-M), further supporting that reduced ribosome biogenesis stabilizes p53. To 243 determine if p53 stabilization is required for the cell cycle arrest in aramis-depleted germline cysts, 244 we depleted aramis in the germline of p53 mutants. We observed a partial but significant 245 alleviation of the cyst phenotype, such that spectrosomes were restored (Figure 3J-L). This 246 finding indicates that p53 contributes to cytokinesis failure upon loss of aramis, but that additional 247 factors are also involved. Taken together, we find that aramis-depleted germ cells display reduced 248 ribosome biogenesis, aberrant expression of p53 protein and a block in cell cycle progression. 249 Reducing p53 partially alleviates the cell cycle block and GSC cytokinesis defect.

250 Aramis promotes translation of Non1, a negative regulator of p53, linking ribosome 251 biogenesis to the cell cycle 252 Although p53 protein levels were elevated upon loss of aramis in the germline, p53 mRNA levels 253 were not significantly altered (log2 fold change: -0.49; FDR: 0.49). Given that ribosome biogenesis 254 is affected, we considered that translation of p53 or one of its regulators was altered in aramis- 255 depleted germlines. To test this hypothesis, we performed polysome-seq of gonads enriched for 256 GSCs or CBs as developmental controls, as well as gonads depleted for aramis in the germline 257 (Flora et al., 2018b). We plotted the ratios of polysome-associated RNAs to total RNAs (Figure 258 4A-A’’, Supplemental Table 3) and identified 87 mRNAs with a reduced ratio upon depletion of 259 aramis, suggesting that they were translated less efficiently compared to developmental controls. 260 Loss of aramis reduced the levels of these 87 downregulated transcripts in polysomes, without 261 significantly affecting their total mRNA levels (Figure 4B, Figure S4A-A’). These 87 transcripts 262 encode proteins mostly associated with translation including ribosomal proteins (Figure 4C). To 263 validate that Aramis regulates translation of these target mRNAs, we utilized a reporter line for 264 the Aramis-regulated transcript encoding Ribosomal protein S2 (RpS2) that is expressed in the 265 context of the endogenous promoter and regulatory sequences (Buszczak et al., 2007; Zhang et 266 al., 2014). We observed reduced levels of RpS2::GFP in germlines depleted of aramis but not in 267 those depleted of bam (Figure 4D-F). To ensure that reduced RpS2::GFP levels did not reflect a 268 global decrease in translation, we visualized nascent translation using O-propargyl-puromycin 269 (OPP). OPP is incorporated into nascent polypeptides and can be detected using click-chemistry 270 (Sanchez et al., 2016). We observed that global translation in the germlines of ovaries depleted 271 of aramis was not reduced compared to bam (Figure 4G-I). Thus, loss of aramis results in 272 reduced translation of a subset of transcripts.

273 None of these 87 translational targets have been implicated in directly controlling abscission 274 (Mathieu et al., 2013; Matias et al., 2015). However, we noticed that the mRNA encoding Novel 275 Nucleolar protein 1 (Non1/CG8801) was reduced in polysomes upon loss of aramis in the 276 germline (Figure 4C). The human ortholog of Non1 is GTP Binding Protein 4 (GTPBP4), and 277 these proteins are known to physically interact with p53 in both Drosophila and human cells and 278 have been implicated in repressing p53 (mentioned as CG8801 in Lunardi et al.) (Li et al., 2018; 279 Lunardi et al., 2010). To determine if translation of Non1 is reduced upon depletion of aramis, we 280 monitored the abundance of Non1::GFP, a transgene that is under endogenous control (Sarov et 281 al., 2016), and found that Non1::GFP was expressed in the undifferentiated GSCs and CBs

6 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

282 (Figure 5A-A’’). Non1::GFP levels were reduced in the aramis-depleted stem cysts compared to 283 the CBs that accumulated upon bam-depletion (Figure 5B-D), suggesting that Aramis and 284 ribosome biogenesis promote efficient translation of Non1.

285 During normal oogenesis, p53 protein is expressed in cyst stages in response to recombination- 286 induced double strand breaks (Lu et al., 2010). We found that Non1 was highly expressed at 287 undifferentiated stages and in two- and four-cell cysts when p53 protein levels were low, whereas 288 its expression was attenuated at eight- and 16-cell cyst stages when p53 protein levels were high 289 (Figure 5A-A’’, Figure S5A-B’). Non1 was highly expressed in egg chambers, which express 290 low levels of p53 protein suggesting that Non1 could regulate p53 protein levels. To determine if 291 Non1 regulates GSC differentiation and p53, we depleted Non1 in the germline. We found that 292 germline-depletion of Non1 results in stem cyst formation and loss of later stages, as well as 293 increased p53 expression, phenocopying germline-depletion of aramis, athos, and porthos 294 (Figure 5E-F, H, Figure S5C-E). In addition, we found that loss of p53 from Non1-depleted 295 germaria partially suppressed the phenotype (Figure 5F-H). Thus, Non1 is regulated by aramis 296 and is required for p53 suppression, cell cycle progression, and GSC abscission.

297 To determine if Aramis promotes GSC differentiation via translation of Non1, we restored Non1 298 expression in germ cells depleted of aramis. Briefly, we cloned Non1 with heterologous UTR 299 elements under the control of the UAS/GAL4 system (see Methods) (Rørth, 1998). We found that 300 restoring Non1 expression in the aramis-depleted germline significantly attenuated the stem cysts 301 and increased the number of cells with spectrosomes (Figure 5I-K). Taken together, we conclude 302 that Non1 can partially suppress the cytokinesis defect caused by germline aramis depletion.

303 Aramis-regulated targets contain a TOP motif in their 5’UTR 304 We next asked how aramis and efficient ribosome biogenesis promote the translation of a subset 305 of mRNAs, including Non1, to regulate GSC differentiation. We hypothesized that the 87 mRNA 306 targets share a property that make them sensitive to rRNA and ribosome levels. To identify shared 307 characteristics, we performed de novo motif discovery of target genes compared to non-target 308 genes (Heinz et al., 2010) and identified a polypyrimidine motif in the 5’UTRs of most target genes 309 (UCUUU; E-value: 6.6e-094). This motif resembles the previously described TOP motif at the 5’ 310 end of mammalian transcripts (Philippe et al., 2018; Thoreen et al., 2012). Although the existence 311 of TOP-containing mRNAs in Drosophila has been speculated, to our knowledge their presence 312 has not been explicitly demonstrated (Chen and Steensel, 2017; Qin et al., 2007). This 313 observation motivated us to precisely determine the 5’ end of transcripts, so we analyzed 314 previously published cap analysis of gene expression sequencing (CAGE-seq) data that had 315 determined transcription start sites (TSS) in total mRNA from the ovary (Figure 6A, Figure S6A- 316 A’) (Boley et al., 2014; Chen et al., 2014; dos Santos et al., 2015). Of the 87 target genes, 76 had 317 sufficient expression in the CAGE-seq dataset to define their TSS. We performed motif discovery 318 using the CAGE-seq data and found that 72 of 76 Aramis-regulated mRNAs have a polypyrimidine 319 motif that starts within the first 50 nt of their TSS (Figure 6B-C). In mammals, it was previously 320 thought that the canonical TOP motif begins with an invariant ‘C’ (Meyuhas, 2000; Philippe et al., 321 2020). However, systematic characterization of the sequence required in order for an mRNA to 322 be regulated as a TOP containing mRNA revealed that TOP mRNAs can start with either a ‘C’ or 323 a ‘U’ (Philippe et al., 2020). Thus, mRNAs whose efficient translation is dependent on aramis 324 share a terminal polypyrimidine-rich motif in their 5’UTR that resembles a TOP motif.

325 In vertebrates, most canonical TOP-regulated mRNAs encode ribosomal proteins and translation 326 initiation factors that are coordinately upregulated in response to growth cues mediated by the 327 Target of Rapamycin (TOR) pathway and the TOR complex 1 (mTORC1) (Hornstein et al., 2001; 328 Iadevaia et al., 2014; Kim et al., 2008; Meyuhas and Kahan, 2015; Pallares-Cartes et al., 2012)

7 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

329 Indeed, 76 of the 87 Aramis targets were ribosomal proteins, and 9 were known or putative 330 translation factors, consistent with TOP-containing RNAs in vertebrates (Figure 4C, 331 Supplemental Table 4). To determine if the putative TOP motifs that we identified are sensitive 332 to TORC1 activity, we designed “TOP reporter” constructs. Specifically, the germline-specific 333 nanos promoter was employed to drive expression of an mRNA with 1) the 5’UTR of the aramis 334 target RpL30, which contains a putative TOP motif, 2) the coding sequence for a GFP-HA fusion 335 protein and 3) a 3’UTR (K10) that is not translationally repressed (Flora et al., 2018b; Serano et 336 al., 1994), referred to as the WT-TOP reporter (Figure S6B). As a control, we created a construct 337 in which the polypyrimidine sequence was mutated to a polypurine sequence referred to as the 338 Mut-TOP reporter (Figure S6B).

339 In Drosophila, TORC1 activity increases in 8- and 16-cell cysts (Hong et al., 2012; Kim et al., 340 2017). We found that the WT-TOP reporter displayed peak expression in 8-cell cysts, whereas 341 the Mutant-TOP reporter did not (Figure 6D-E’’), suggesting that the WT-TOP reporter is 342 sensitive to TORC1 activity. Moreover, depletion of Nitrogen permease regulator-like 3 (Nprl3), 343 an inhibitor of TORC1 (Wei et al., 2014), led to a significant increase in expression of the WT- 344 TOP reporter but not the Mutant-TOP reporter (Figure S6C-G). Additionally, to attenuate TORC1 345 activity, we depleted raptor, one of the subunits of the TORC1 complex (Hong et al., 2012; Loewith 346 and Hall, 2011). Here we found that the WT-TOP reporter had a significant decrease in reporter 347 expression while the Mutant-TOP reporter did not show a decrease in expression (Figure S6H- 348 L). Taken together, our data suggest that Aramis-target transcripts contain TOP motifs that are 349 sensitive to TORC1 activity. However, we note that our TOP reporter did not recapitulate the 350 pattern of Non1::GFP expression, suggesting that Non1 may have additional regulators that 351 modulate its protein levels in the cyst stages.

352 TOP mRNAs show increased translation in response to TOR signaling, leading to increased 353 ribosome biogenesis (Jefferies et al., 1997; Jia et al., 2021; Powers and Walter, 1999; Thoreen 354 et al., 2012). However, to our knowledge, whether reduced ribosome biogenesis can coordinately 355 diminish the translation of TOP mRNAs to balance and lower ribosome protein production and 356 thus balance the levels of the distinct components needed for full ribosome assembly is not 357 known. To address this question, we crossed the transgenic flies carrying the WT-TOP reporter 358 and Mutant-TOP reporter into bam and aramis germline RNAi backgrounds. We found that the 359 expression from the WT-TOP reporter was reduced by 2.9-fold in the germline of aramis RNAi 360 ovaries compared to bam RNAi ovaries (Figure 6F-G, J). In contrast, the Mutant-TOP reporter 361 was only reduced by 1.6-fold in the germline of aramis RNAi ovaries compared to bam RNAi 362 ovaries (Figure 6H-J). This suggests that the TOP motif-containing mRNAs are sensitive to 363 ribosome biogenesis.

364 Larp binds TOP sequences in Drosophila 365 Next, we sought to determine how TOP-containing mRNAs are regulated downstream of Aramis. 366 In mammalian cells, Larp1 is a critical negative regulator of TOP-containing RNAs during nutrient 367 deprivation (Berman et al., 2020; Fonseca et al., 2015; Hong et al., 2017; Philippe et al., 2020; 368 Tcherkezian et al., 2014). Therefore, we hypothesized that Drosophila Larp reduces the 369 translation of TOP-containing mRNAs when rRNA biogenesis is reduced upon loss of aramis. 370 First, using an available gene-trap line in which endogenous Larp is tagged with GFP and 371 3xFLAG, we confirmed that Larp was robustly expressed throughout all stages of oogenesis 372 including in GSCs (Figure S7A-A’).

373 Next, we performed electrophoretic mobility shift assays (EMSA) to examine protein-RNA 374 interactions with purified Drosophila Larp-DM15, the conserved domain that binds to TOP 375 sequences in vertebrates (Lahr et al., 2017). As probes, we utilized capped 42-nt RNAs

8 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

376 corresponding to the 5’UTRs of RpL30 and Non1, including their respective TOP sequences. We 377 observed a gel shift with these RNA oligos in the presence of increasing concentrations of Larp- 378 DM15 (Figure 7A-A’, Figure S7B), and this shift was abrogated when the TOP sequences were 379 mutated to purines (Figure S7C-C’). To determine if Larp interacts with TOP-containing mRNAs 380 in vivo, we immunopurified Larp::GFP::3xFLAG from the ovaries of the gene-trap line and 381 performed RNA-seq (Figure S7D). We uncovered 156 mRNAs that were bound to Larp, and 84 382 of these were among the 87 aramis translationally regulated targets, including Non1, RpL30, and 383 RpS2 (Figure 7B-C, Supplemental Table 5). Thus, Drosophila Larp binds to TOP sequences in 384 vitro and TOP-containing mRNAs in vivo.

385 To test our hypothesis that Drosophila Larp inhibits the translation of TOP-containing mRNAs 386 upon loss of aramis, we immunopurified Larp::GFP::3xFLAG from germline bam RNAi ovaries 387 and germline aramis RNAi ovaries. Larp protein is not expressed at higher levels in aramis RNAi 388 compared to developmental control bam RNAi (Figure S7E-G). We found that Larp binding to 389 aramis target mRNAs Non1 and RpL30 was increased in aramis RNAi ovaries compared to bam 390 RNAi ovaries (Figure 7D, Figure S7H). In contrast, a non-target mRNA that does not contain a 391 TOP motif, alpha-tubulin mRNA, did not have a significant increase in binding to Larp in aramis 392 RNAi ovaries compared to bam RNAi ovaries. Overall, these data suggest that reduced rRNA 393 biogenesis upon loss of aramis increases Larp binding to the TOP-containing mRNAs Non1 and 394 RpL30.

395 If loss of aramis inhibits the translation of TOP-containing mRNAs due to increased Larp binding, 396 then overexpression of Larp would be expected to phenocopy germline depletion of aramis. 397 Unphosphorylated Larp binds to TOP motifs more efficiently, but the precise phosphorylation sites 398 of Drosophila Larp, to our knowledge, are currently unknown (Hong et al., 2017). To circumvent 399 this issue, we overexpressed the DM15 domain of Larp which we showed binds the RpL30 and 400 Non1 TOP motifs in vitro (Figure 7A-A’), and, based on homology to mammalian Larp1, lacks 401 majority of the putative phosphorylation sites (Jia et al., 2021; Lahr et al., 2017; Philippe et al., 402 2018). We found that overexpression of a Larp-DM15::GFP fusion in the germline resulted in 403 fusome-like structures extending from the niche (Figure 7E-F’). Additionally, ovaries 404 overexpressing Larp-DM15 had 32-cell egg chambers, which were not observed in control ovaries 405 (Figure S7I-I’). The presence of 32-cell egg chambers is emblematic of cytokinesis defects that 406 occur during early oogenesis (Mathieu et al., 2013; Matias et al., 2015; Sanchez et al., 2016). 407 Our findings indicate that these cells are delayed in cytokinesis and that over expression of Larp 408 partially phenocopies depletion of aramis.

409 Discussion 410 During Drosophila oogenesis, efficient ribosome biogenesis is required in the germline for proper 411 GSC cytokinesis and differentiation. The outstanding questions that needed to be addressed 412 were: 1) Why does disrupted ribosome biogenesis impair GSC abscission and differentiation? 413 and 2) How does the GSC monitor and couple ribosome abundance to differentiation? Our results 414 suggest that germline ribosome biogenesis defect stalls the cell cycle, resulting a loss of 415 differentiation and the formation of stem cysts. We discovered that proper ribosome biogenesis 416 is monitored through a translation control module that allows for co-regulation of ribosomal 417 proteins and a p53 repressor. Loss of aramis, athos and porthos reduces ribosome biogenesis 418 and inhibits translation of a p53 repressor, leading to p53 stabilization, cell cycle arrest and loss 419 of stem cell differentiation (Figure 7G). 420 421 Aramis, Athos, and Porthos are required for efficient ribosome biogenesis in Drosophila 422 We provide evidence that Aramis, Athos and Porthos play a role in ribosome biogenesis in 423 Drosophila, similar to their orthologs in yeast (Bohnsack et al., 2008; Granneman et al., 2006;

9 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

424 Khoshnevis et al., 2016; O ’day et al., 1996) and mammals (Sekiguchi et al., 2006; Tafforeau et 425 al., 2013; Zhang et al., 2011). Their role in ribosome biogenesis is likely a direct function of these 426 helicases as they physically interact with precursor rRNA. In yeast, Rok1, the ortholog of Aramis, 427 binds to several sites on pre-rRNA, predominantly in the 18S region (Bohnsack et al., 2008; 428 Khoshnevis et al., 2016; Martin et al., 2014). This is consistent with the small subunit ribosome 429 biogenesis defect we observe upon loss of aramis in Drosophila. Rrp3, the yeast ortholog of 430 Porthos, promotes proper cleavage of pre-rRNA and is required for proper 18S rRNA production 431 (Granneman et al., 2006; O ’day et al., 1996). DDX47, the mammalian ortholog of Porthos, binds 432 to early rRNA precursors as well as proteins involved in ribosome biogenesis (Sekiguchi et al., 433 2006). Consistent with these findings, we find that Aramis and Porthos promote 40S ribosome 434 biogenesis. DHX33, the mammalian ortholog of Athos, has been implicated in facilitating rRNA 435 synthesis (Zhang et al., 2011). In contrast, we find that Athos promotes 60S ribosome biogenesis 436 by directly interacting with rRNA. However, we cannot rule out that Athos also affects transcription 437 of rRNA in Drosophila as it does in mammals (Zhang et al., 2011). Overall, we find that each 438 mammalian ortholog of Aramis, Athos, and Porthos has consistent ribosome subunit defects, 439 suggesting that the function of these helicases is conserved from flies to mammals. Intriguingly, 440 DDX52 (Aramis) is one of the 15 genes deleted in 17q12 syndrome (Hendrix et al., 2012). 17q12 441 syndrome results in delayed development, intellectual disability, and, more rarely, 442 underdevelopment of organs such as the uterus (Bernardini et al., 2009; Hendrix et al., 2012). 443 Our finding that Aramis disrupts stem cell differentiation could explain some of the poorly 444 understood defects in 17q12 syndrome. 445 446 Ribosome biogenesis defects leads to cell cycle defects mediated by p53 447 Here we report that three RNA helicases, aramis, athos, and porthos, that promote proper 448 ribosome biogenesis in Drosophila are required in the germline for fertility. Loss of aramis, athos, 449 and porthos causes formation of a “stem cyst” and loss of later stage oocytes. Stem cysts are a 450 characteristic manifestation of ribosome biogenesis deficiency wherein GSCs are unable to 451 complete cytokinesis and fail to express the differentiation factor Bam, which in GSCs is initiated 452 at G2 of the cell cycle (Sanchez et al., 2016; Zhang et al., 2014). Our RNA seq and cell cycle 453 analysis indicates that depletion of aramis blocks the cell cycle at G1, and that failure to progress 454 to G2 prevents abscission and expression of Bam. Thus, our results suggest that ribosome 455 biogenesis defects in the germline stall the cell cycle, resulting in formation of stem cysts and 456 sterility. 457 458 In most tissues in Drosophila, p53 primarily activates apoptosis, however, in the germline p53 is 459 activated during meiosis and does not cause cell death (Fan et al., 2010; Lu et al., 2010). 460 Furthermore, p53 activation in the germline is required for germline repopulation and GSC survival 461 after genetic insult, implicating p53 as a potential cell cycle regulator (Ma et al., 2016; Tasnim and 462 Kelleher, 2018). Our observation that reduction of p53 partially rescues a stem cyst defect caused 463 by ribosome deficiency due to germline depletion of aramis indicates that the G1 block in GSCs 464 is, in part, mediated by p53 activation. Thus, in Drosophila GSCs, p53 blocks the GSC cell cycle 465 and is sensitive to rRNA production. The developmental upregulation of p53 during GSC 466 differentiation concomitant with lower ribosome levels parallels observations in disease states, 467 such as ribosomopathies (Calo et al., 2018; Deisenroth and Zhang, 2010; Pereboom et al., 2011; 468 Yelick and Trainor, 2015). 469 470 We find that p53 levels in GSCs are regulated by conserved p53 regulator Non1. In mammalian 471 cells, increased free RpS7 protein due to nucleolar stress binds and sequesters MDM2, a 472 repressor of p53, freeing p53, resulting in G1 cell cycle arrest (Deisenroth and Zhang, 2010; 473 Zhang and Lu, 2009). Drosophila have no identified homolog to MDM2. It is not fully known how 474 ribosome levels are monitored in Drosophila in the absence of MDM2 and how this contributes to

10 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

475 cell cycle progression. In Drosophila, Non1 levels are high in the GSCs and p53 is low, and 476 reciprocally Non1 levels are low during meiosis, but p53 is expressed. Our finding that loss of 477 Aramis leads to diminished Non1 and elevated p53, and that either loss of p53 or elevated Non1 478 suppress differentiation defects caused by loss of Aramis, suggests that, in the female germline, 479 Non1 may fulfill the function of Mdm2 by promoting p53 degradation during Drosophila oogenesis. 480 While Non1 has been shown to directly interact with p53, how it regulates p53 levels in both 481 humans and Drosophila is not known (Li et al., 2018; Lunardi et al., 2010). Overall, our data place 482 Non1 downstream of ribosome biogenesis and upstream of p53 in controlling cell cycle 483 progression and GSC differentiation. However, our data do not rule out that Non1 may also act 484 upstream of or in parallel to Aramis. 485 486 The vertebrate ortholog of Non1, GTPBP4, also controls p53 levels and is upregulated in some 487 cancers (Li et al., 2018; Lunardi et al., 2010; Yu et al., 2016). This suggests that there may be 488 parallel pathways for monitoring ribosome levels via p53 in different tissue types. Unlike 489 Drosophila Non1, its ortholog, GTPBP4 has not been identified as a TOP mRNA, so if it similarly 490 acts as a mediator between ribosome biogenesis and the cell cycle it is likely activated in a 491 somewhat different manner (Philippe et al., 2020). However, mammalian Larp1 is required for 492 proper cell cycle progression and cytokinesis (Burrows et al., 2010; Tcherkezian et al., 2014). 493 Excitingly several differentiation and cell cycle regulation genes in mammals are TOP mRNAs 494 regulated by Larp1, including Tumor Protein, Translationally-Controlled 1 (TPT1) and 495 Nucleosome Assembly Protein 1 Like 1 (NAP1L1) (Philippe et al., 2020). TPT1 is a cancer 496 associated factor that has been implicated in activating pluripotency (Burrows et al., 2010; Qiao 497 et al., 2018). Similarly, NAP1L1, a nucleosome assembly protein, is required to maintain proper 498 cell cycle control as loss of NAP1L1 results in cell cycle exit and premature differentiation. Overall, 499 although the specific targets of Larp1 in mammals may differ from those in Drosophila, the 500 mechanism by which Larp modulates cell cycle and differentiation may be conserved. 501 502 Ribosome biogenesis defects leads to repression of TOP-containing mRNA 503 TOP-containing mRNAs are known to be coregulated to coordinate ribosome production in 504 response to nutrition or other environmental cues (Kimball, 2002; Meyuhas and Kahan, 2015; 505 Tang et al., 2001). Surprisingly, our observation that loss of aramis reduces translation of a cohort 506 of TOP-containing mRNAs, including Non1, suggests that the TOP motif also sensitizes their 507 translation to lowered levels of rRNA. This notion is supported by TOP reporter assays 508 demonstrating that reduced translation upon loss of aramis requires the TOP motif. We 509 hypothesize that limiting TOP mRNA translation lowers ribosomal protein production to maintain 510 a balance with reduced rRNA production. This mechanism would prevent the production of excess 511 ribosomal proteins that cannot be integrated into ribosomes and the ensuing harmful aggregates 512 (Tye et al., 2019). Additionally, it would coordinate rRNA production and ribosomal protein 513 translation during normal germline development, where it is known that the level of ribosome 514 biogenesis and of global translation are dynamic (Blatt et al., 2020a; Fichelson et al., 2009; 515 Sanchez et al., 2016; Zhang et al., 2014). 516 517 Larp transduces growth status to ribosome biogenesis targets 518 Recent work has shown that the translation and stability of TOP-containing mRNAs are mediated 519 by Larp1 and its phosphorylation (Berman et al., 2020; Hong et al., 2017; Jia et al., 2021). We 520 found that perturbing rRNA production and thus ribosome biogenesis, without directly targeting 521 ribosomal proteins, similarly results in dysregulation of TOP mRNAs. Our data show that 522 Drosophila Larp binds the RpL30 and Non1 5’UTR in a TOP-dependent manner in vitro and to 523 nearly all of the translation targets we identified in vivo. Together these data suggest that rRNA 524 production regulates TOP mRNAs via Larp. Furthermore, the cytokinesis defect caused by 525 overexpression of Larp-DM15 in the germline suggests that Larp regulation could maintain the

11 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

526 homeostasis of ribosome biogenesis more broadly by balancing the expression of ribosomal 527 protein production with the rate of other aspects of ribosome biogenesis, such as rRNA 528 processing, during development. 529 530 Previous studies indicate that unphosphorylated Larp1 binds to and represses its targets more 531 efficiently than phosphorylated Larp1 (Fonseca et al., 2018; Hong et al., 2017; Jia et al., 2021). 532 Thus, although we do not know the identity of the kinase that phosphorylates Larp in Drosophila, 533 we hypothesize that Larp is not phosphorylated upon loss of aramis, athos and porthos, when 534 ribosome biogenesis is perturbed. We propose that until ribosome biogenesis homeostasis is 535 reached, this kinase will remain inactive, continuously increasing the pool of dephosphorylated 536 Larp. In this scenario, as dephosphorylated Larp accumulates, it begins to bind its targets. Initially, 537 it will bind its highest affinity targets, presumably encoding ribosomal proteins and repress their 538 translation to rebalance ribosomal protein production with rRNA production. Consistent with this 539 model, the TOP motif in RpL30 is bound by Larp even more tightly with a nearly 9-fold higher 540 affinity compared to the Non1 TOP site (Figure S7B). We propose that such differences in affinity 541 may allow Larp to repress ribosomal protein translation to facilitate cellular homeostasis without 542 immediately causing cell cycle arrest. However, if homeostasis cannot be achieved and sufficient 543 dephosphorylated Larp accumulates, Larp will also bind and repress the translation of lower 544 affinity targets. Repression of Non1 in this manner would result in cell cycle arrest and block 545 differentiation as occurs upon aramis depletion. 546 547 Ribosome biogenesis in stem cell differentiation and ribosomopathies 548 Ribosomopathies arise from defects in ribosomal components or ribosome biogenesis and 549 include a number of diseases such as Diamond-Blackfan anemia, Treacher Collins syndrome, 550 Shwachman-Diamond syndrome, and 5q-myelodysplastic syndrome (Armistead and Triggs- 551 Raine, 2014; Draptchinskaia et al., 1999; McGowan et al., 2011; Valdez et al., 2004; Warren, 552 2018). Despite the ubiquitous requirement for ribosomes and translation, ribosomopathies cause 553 tissue-specific disease (Armistead and Triggs-Raine, 2014). The underlying mechanisms of 554 tissue specificity remain unresolved. 555 556 In this study we demonstrate that loss of helicases involved in rRNA processing lead to perturbed 557 ribosome biogenesis and, ultimately, cell cycle arrest. Given that Drosophila germ cells undergo 558 an atypical cell cycle program as a normal part of their development it may be that this underlying 559 cellular program in the germline leads to the tissue-specific symptom of aberrant stem cyst 560 formation (McKearin and Spradling, 1990). This model implies that other tissues would likewise 561 exhibit unique tissue-specific manifestations of ribosomopathies due to their underlying cell state 562 and underscores the need to further explore tissue-specific differentiation programs and 563 development to shed light not only on ribosomopathies but on other tissue-specific diseases 564 associated with ubiquitous processes. Although it is also possible that phenotypic differences 565 arise from a common molecular cause, our data suggests two sources of potential tissue 566 specificity: 1) tissues express different cohorts of mRNAs, such as Non1, that are sensitive to 567 ribosome levels. For example, we find that in Drosophila macrophages, RNAs that regulate the 568 metabolic state of macrophages and influence their migration require increased levels of 569 ribosomes for their translation (Emtenani et al., 2021). 2) p53 activation, as has been previously 570 described, is differentially tolerated in different developing tissues (Bowen and Attardi, 2019; Calo 571 et al., 2018; Jones et al., 2008). Together, both mechanisms could begin to explain the tissue- 572 specific nature of ribosomopathies and their link to differentiation. 573 574 Acknowledgements 575 We are grateful to all members of the Rangan and Fuchs labs for their discussion and comments 576 on the manuscript. We also thanks Dr. Sammons, Dr. Marlow, Life Science Editors, for their

12 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

577 thoughts and comments the manuscript Additionally, we thank the Bloomington Stock Center, the 578 Vienna Drosophila Resource Center, the BDGP Gene Disruption Project, and Flybase for fly 579 stocks, reagents, and other resources. P.R. is funded by the NIH/NIGMS (R01GM111779-06 and 580 RO1GM135628-01), G.F. is funded by NSF MCB-2047629 and NIH RO3 AI144839, D.E.S. was 581 funded by Marie Curie CIG 334077/IRTIM and the Austrian Science Fund (FWF) grant 582 ASI_FWF01_P29638S, and A.B is funded by NIH R01GM116889 and American Cancer Society 583 RSG-17-197-01-RMC. 584 585 Author Contributions 586 Conceptualization, E.T.M., P.B., G.F., and P.R.; Methodology, E.T.M., P.B., G.F., and P.R.; 587 Investigation, E.T.M., P.B., E.N., R.L., S.S., H.Y., T.P., and S.E.; Writing – Original Draft, E.T.M., 588 D.E.S., and P.R.; Writing – Review & Editing, E.T.M., P.B., D.E.S, A.B., G.F., and P.R.; Funding 589 Acquisition, G.F. and P.R.; Visualization, E.T.M., E.N.; Supervision, G.F. and P.R. 590 591

13 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

592 593 Figure 1: RNA helicases Aramis, Athos and Porthos are required for GSC differentiation. 594 (A) Schematic of Drosophila germarium. Germline stem cells are attached to the somatic niche 595 (dark red). The stem cells divide and give rise to a stem cell and a cystoblast (CB) that expresses 596 the differentiation factor Bag-of-marbles (Bam). GSCs and CBs are marked by spectrosomes. 597 The CB undergoes four incomplete mitotic divisions giving rise to a 16-cell cyst (blue). Cysts are 598 marked by branched spectrosome structures known as fusomes (red). One cell of the 16-cell cyst 599 is specified as the oocyte. The 16-cell cyst is encapsulated by the surrounding somatic cells giving

14 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

600 rise to an egg chamber. (A’) Ribosome biogenesis promotes GSC cytokinesis and differentiation. 601 Disruption of ribosome biogenesis results in undifferentiated stem cyst accumulation. (B) 602 Representation of conserved protein domains for three RNA helicases in Drosophila compared 603 to H. sapiens and S. cerevisiae orthologs. Percentage values represent similarity to Drosophila 604 orthologs. (C) Egg laying assay after germline RNAi knockdown of aramis, athos or porthos 605 indicating a loss of fertility compared to nosGAL4, driver control (n=3 trials). *** = p < 0.001, 606 Tukey’s post-hoc test after one-way ANOVA, p < 0.001. Error bars represent standard error (SE). 607 (D-G’’) Confocal micrographs of ovaries from control, UAS-Dcr2;nosGAL4;bam-GFP (D-D’’) and 608 germline RNAi depletion targeting (E-E’’) aramis, (F-F’’) athos or (G-G’’) porthos stained for 1B1 609 (red, left grayscale), Vasa (green), and Bam-GFP (blue, right grayscale). Depletion of these genes 610 (E-G’’) results in a characteristic phenotype in which early germ cells are connected marked by a 611 1B1 positive, fusome-like structure highlighted by a yellow dotted line in contrast to the single 612 cells present in (D-D’’) controls (white arrow) or differentiating cysts (yellow dashed line). Bam 613 expression, if present, is followed by loss of the germline. (H) Phenotype quantification of ovaries 614 depleted of aramis, athos or porthos compared to control ovaries (n=50 ovarioles, df=2, *** = p < 615 0.001, Fisher’s exact tests with Holm-Bonferroni correction). Scale bars are 15 micron.

15 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

616 617 Figure 2. Athos, Aramis, and Porthos are required for efficient ribosome biogenesis. (A- 618 C’’) Confocal images of ovariole immunostained for Fibrillarin (red, right grayscale), Vasa (blue), 619 (A-A’’) Aramis::GFP, (B-B’’) Athos::GFP and (C-C’’) Porthos::HA (green, left grayscale). (A’’’- 620 C’’’) Fluorescence intensity plot generated from a box of averaged pixels centered around the 621 punctate of Fibrillarin in the white box. R values denote Spearman correlation coefficients 622 between GFP and Fibrillarin from plot profiles generated using Fiji, taken from the nucleolus 623 denoted by the white box. Aramis, Athos and Porthos are expressed throughout oogenesis and 624 localize to the nucleolus. Aramis is also present in the cytoplasm. (D-D’’) RNA IP-seq of (D) 625 Aramis, (D’) Athos, and (D’’) Porthos aligned to rDNA displayed as genome browser tracks. Bar 626 height represents log scaled rRNA reads mapping to rDNA normalized to input and spike-in. Grey 627 boxes outline rRNA precursors that are significantly enriched in the IP compared to the IgG control 628 (bootstrapped paired t-tests, n=3, * = p-value < 0.05). (E-E’’) Polysome traces from Drosophila

16 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

629 S2 cells treated with dsRNA targeting (E) aramis, (E’) athos, (E’’) porthos (red line) compared to 630 a mock control (black line). aramis and porthos are required to maintain a proper 40S/60S 631 ribosomal subunit ratio compared to control and have a smaller 40S/60S ratio. athos is required 632 to maintain a proper 40S/60S ribosomal subunit ratio compared to control and has a larger 633 40S/60S ratio. Additionally, aramis, athos, and porthos are required to maintain polysome levels. 634 (F-F’’) Polysome preparations from HeLa cells depleted of DDX52, DHX33, DDX47, and control 635 siRNA treated cells. DDX52, DHX33, and DDX47 are required to maintain a proper 40S/60S 636 ribosomal subunit ratio. Additionally, all three are required to maintain polysome levels. Scale bar 637 for all images is 15 micron. 638

17 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

639 640 Figure 3. Athos, Aramis, and Porthos are required for cell cycle progression during early 641 oogenesis. (A) Bar plot representing the most significant Biological Process GO terms of 642 downregulated genes in ovaries depleted of aramis compared to bam RNAi control (FDR = False 643 Discovery Rate from p-values using a Fisher’s exact test). (B-C) Genome browser tracks 644 representing the gene locus of (B) CycB and (C) aurora B in ovaries depleted of aramis compared 645 to the developmental control, bam RNAi. Y-axis represents the number of reads mapping to the

18 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

646 locus in bases per million (BPM). (D-E’’) Confocal images of germaria stained for CycB (red, left 647 grayscale) and Vasa (blue, right grayscale) in (D-D’’’) bam RNAi control ovaries and (E-E’’) 648 aramis germline RNAi. (F) Boxplot of CycB intensity in the germline normalized to Cyc B intensity 649 in the soma in bam RNAi and aramis RNAi (n=12-14 germaria per sample, *** = p< 0.001, Welch 650 t-test. (G-H’’) Confocal images of germaria stained for p53 (red, left grayscale) and Vasa (blue, 651 right grayscale) in (G-G’’) nosGAL4, driver control ovaries and (H-H’’) germline depletion of 652 aramis. Cells highlighted by a dashed yellow circle represent cell shown in the inset. Driver control 653 nosGAL4 ovaries exhibit attenuated p53 expression in GSCs and CBs, but higher expression in 654 cyst stages as previously reported, while p53 punctate are visible in the germline of aramis RNAi 655 in the undifferentiated cells. (I) Box plot of percentage of pixel area exceeding the background 656 threshold for p53 in GSCs and CBs in driver control nosGAL4 ovaries and the germline of aramis 657 RNAi indicates p53 expression is elevated in the germline over the GSCs/CBs of control ovaries. 658 (n=10 germaria per sample, *** = p < 0.001, Welch’s t-test. (J-K’’) Confocal images of germaria 659 stained for 1B1 (red, left grayscale) and Vasa (blue, right grayscale) in (J-J’’) germline aramis 660 RNAi in a wild type background and (K-K’’) germline aramis RNAi with a mutant, null, p535-A-14 661 background showing presence of spectrosomes upon loss of p53. (L) Quantification of stem cyst 662 phenotypes demonstrates a significant rescue upon of loss of p535-A-14 in aramis germline 663 depletion compared to the wild type control (n=43-55 germaria per genotype, df=2, Fisher’s exact 664 test p< 0.05). Scale bar for main images is 15 micron, scale bar for insets is 3.75 micron. 665

19 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

666 667 Figure 4. Aramis is required for efficient translation of a subset of mRNAs. (A-A’’) Biplots 668 of poly(A)+ mRNA Input versus polysome associated mRNA from (A) ovaries genetically enriched 669 for GSCs (UAS-tkv), (A’) Undifferentiated GSC daughter cells (bam RNAi) or (A’’) germline 670 aramis RNAi ovaries. (B) Boxplot of translation efficiency of target genes in UAS-tkv, bam RNAi,

20 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

671 and aramis RNAi samples (ANOVA p<0.001, post-hoc Welch’s t-test, n=87, *** = p < 0.001). (C) 672 Summary of downregulated target genes identified from polysome-seq. (D-E’) Confocal images 673 of germaria stained for 1B1 (red), RpS2::GFP (green, grayscale), and Vasa (blue) in (D-D’) bam 674 RNAi control and (E-E’) aramis RNAi (yellow dashed line marks approximate region of germline 675 used for quantification). (F) A.U. quantification of germline RpS2::GFP expression normalized to 676 RpS2::GFP expression in the surrounding soma in undifferentiated daughter cells of bam RNAi 677 compared to aramis RNAi. RpS2::GFP expression is significantly lower in aramis RNAi compared 678 to control (n=14 germaria per sample, Welch’s t-test, *** = p < 0.001). (G-H’) Confocal images of 679 germaria stained for 1B1 (red), OPP (green, grayscale), and Vasa (blue) in (G-G’) bam RNAi and 680 (H-H’) aramis RNAi (yellow dashed line marks approximate region of germline used for 681 quantification). (I) A.U. quantification of OPP intensity in undifferentiated daughter cells in bam 682 RNAi and aramis RNAi (n=11-17 germaria per genotype, Welch’s t-test, *** = p < 0.001). OPP 683 intensity is not downregulated in aramis RNAi compared to the control. Scale bar for all images 684 is 15 micron. 685

21 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

686 687 Figure 5. Non1 represses p53 expression to allow for GSC differentiation. (A-A’) Confocal 688 images of Non1::GFP germaria stained for 1B1 (red), GFP (green, grayscale), and Vasa (blue). 689 (A’’) Boxplot of Non1::GFP expression over germline development in GSCs, CBs and Cyst (CC) 690 stages (n=5-25 cysts of each type, * = p < 0.05, ** = p < 0.01, ANOVA with Welch’s post-hoc 691 tests). (B-C’) Confocal images of (B-B’) bam RNAi and (C-C’) aramis RNAi germaria both carrying 692 Non1::GFP transgene stained for 1B1 (red), Vasa (blue), and Non1::GFP (green, grayscale).

22 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

693 Yellow dashed line marks region of germline used for quantification. (D) Boxplot of Non1::GFP 694 expression in the germline normalized to somatic Non1::GFP expression in bam RNAi and aramis 695 RNAi (n=24 germaria per genotype, Welch’s t-test, *** = p < 0.001). Non1 expression is 696 significantly lower in the germline of aramis RNAi compared to bam RNAi control. (E-G’) Confocal 697 images of germaria stained for 1B1 (red, grayscale), and Vasa (blue) in (E-E’) nosGAL4, driver 698 control ovaries, (F-F’) germline Non1 RNAi, and (G-G’) germline Non1 RNAi in a p535-A-1-4 699 background. Arrow marks the presence of a single cell (E, G), yellow dashed line marks a stem 700 cyst emanating from the niche (F-F’) or the presence of proper cysts (E-E’). (H) Quantification of 701 percentage of germaria with no defect (black), presence of single cell (salmon), presence of a 702 stem cyst emanating from the niche (brown-red), or germline loss (dark red) demonstrates a 703 significant rescue of stem cyst formation upon of loss of Non1 in p535-A-14 compared to the p53 704 wild type control (n=35-55 germaria per genotype, df=3, Fisher’s exact test with Holm-Bonferroni 705 correction ** = p< 0.01, *** = p< 0.001). (I-J’) Confocal images of germaria stained for 1B1 (red, 706 grayscale), and Vasa (blue) in (I-I’) aramis germline RNAi exhibiting stem cyst phenotype (yellow 707 dashed line) and (J-J’) aramis germline RNAi with Non1 overexpression exhibiting single cells 708 (arrow). (K) Phenotypic quantification of aramis RNAi with Non1 overexpression demonstrates a 709 significant alleviation of the stem cyst phenotype (n=33-57 germaria per genotype, df=2, Fisher’s 710 exact test, ** = p< 0.01). Scale bar for all images is 15 micron.

23 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

711 712 713 Figure 6. Aramis regulated mRNAs contain a TOP motif. (A) Genome browser tract of RpL30 714 locus in ovary CAGE-seq data showing the proportion of transcripts that are produced from a 715 given TSS (orange). Predominant TSSs are shown in orange and putative TOP motif indicated 716 with a green box. The bottom blue and red graph represents sequence conservation of the locus 717 across Diptera. The dominant TSS initiates with a canonical TOP motif. (B) Sequence logo 718 generated from de novo motif discovery on the first 200 bases downstream of CAGE derived 719 TSSs of aramis translation target genes resembles a canonical TOP motif. (C) Histogram 720 representing the location of the first 5-mer polypyrimidine sequence from each CAGE based TSS 721 of aramis translation target genes demonstrates that the TOP motifs occur proximal to the TSS 722 (n=76 targets). (D-E’’) Confocal images and quantifications of (D-D’) WT-TOP-GFP and (E-E’) 723 Mut-TOP-GFP reporter expression stained for 1B1 (red), GFP (green, grayscale), and Vasa 724 (blue). Yellow dotted-line marks increased reporter expression in 8-cell cysts of WT-TOP-GFP 725 but not in Mut-TOP-GFP. Reporter expression was quantified over germline development for (D’’) 726 WT-TOP-GFP and (E’’) Mut-TOP-GFP reporter expression and normalized to expression in the

24 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

727 GSC reveals dynamic expression based on the presence of a TOP motif. (F-G’) Confocal images 728 of WT-TOP-GFP reporter ovarioles showing 1B1 (red), GFP (green, grayscale), and Vasa (blue) 729 in (F-F’) bam germline depletion as a developmental control and (G-G’) aramis germline depleted 730 ovaries. Yellow dotted lines indicate germline. (H-I’) Confocal images of Mut-TOP-GFP reporter 731 expression showing 1B1 (red), GFP (green, grayscale), and Vasa (blue) in (H-H’) bam RNAi and 732 (I-I’) aramis germline RNAi. Yellow dotted lines indicate germline. (J) A.U. quantification of WT 733 and Mutant TOP reporter expression in undifferentiated daughter cells in bam RNAi compared 734 aramis RNAi demonstrates that the WT-TOP-GFP reporter shows significantly lower expression 735 in aramis RNAi than the Mut-TOP-GFP relative to the expression of the respective reporters in 736 bam RNAi (n=17-25 germaria per genotype, with Welch’s t-test *** = p<0.001). Scale bar for all 737 images is 15 micron. 738

25 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

739 740 741 Figure 7. Larp binds to TOP mRNAs and binding is regulated by Aramis. (A-A’) EMSA of 742 Larp-DM15 and the leading 42 nucleotides of (A) RpL30 and (A’) Non1 with increasing

26 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

743 concentrations of Larp-DM15 from left to right indicates that both RNAs bind to Larp-DM15. (B) 744 Volcano plot of mRNAs in Larp::GFP::3xFLAG IP compared to input. Blue points represent 745 mRNAs significantly enriched in Larp::GFP::3xFLAG compared to input, but not enriched in an 746 IgG control compared to input. (C) Venn diagram of overlapping Larp IP targets and aramis RNAi 747 polysome seq targets indicates that Larp physically associates with mRNAs that are 748 translationally downregulated in germline aramis RNAi (p < 0.001, Hypergeometric Test). (D) Bar 749 plot representing the fold enrichment of mRNAs from Larp RNA IP in germline aramis RNAi 750 relative to matched bam RNAi ovaries as a developmental control measured with qPCR (n=3, * 751 = p<0.5, ** = p<0.01, NS = nonsignificant, One-sample t-test, mu=1) indicates that more of two 752 aramis translation targets Non1 and RpL30 are bound by Larp in aramis RNAi. (E-F’’) Confocal 753 images of (E-E’’) nosGAL4, driver control and (F-F’’) ovaries overexpressing the DM15 region of 754 Larp in the germline ovaries stained for 1B1 (red, left grayscale), Vasa (blue), and Larp- 755 DM15::GFP (green, right grayscale). Overexpression of Larp results in an accumulation of 756 extended 1B1 structures (highlighted with a dotted yellow line), marking interconnected cells when 757 Larp-DM15 is overexpressed compared to nosGAL4, driver control ovaries. (G) In conditions with 758 normal ribosome biogenesis Non1 is efficiently translated, downregulating p53 levels allowing for 759 progression through the cell cycle. When ribosome biogenesis is perturbed Non1 is not translated 760 to sufficient levels, resulting in the accumulation of p53 and cell cycle arrest. Scale bar for all 761 images is 15 micron.

27 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

762 763 Supplemental Figure 1. Aramis, Athos, and Porthos are required for proper cytokinesis 764 and differentiation, related to Figure 1. (A-A’’’) Confocal images of (A) nosGAL4, driver control 765 and germline RNAi knockdown using additional RNAi lines for (A’) aramis and (A’’) athos stained 766 for 1B1 (red) and Vasa (green). (A’’’) Quantification of percentage of germaria with no defect

28 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

767 (black), stem cysts (salmon), or germline loss (dark red) in ovaries depleted of athos, aramis, or 768 porthos compared to control ovaries recapitulates the phenotypes with independent RNAi lines 769 (n=50, df=2, *** = p<0.001, Fisher’s exact test with Holm-Bonferroni correction). (B-B’’’) Confocal 770 images of germaria stained for 1B1 (red) and Phospho-tyrosine (green). Ring canals, marked by 771 Phosopho-tyrosine, connect differentiating cysts in (B) control nosGAL4 ovaries and in between 772 the interconnected cells of ovaries depleted of (B’) athos, (B’’) aramis, and (B’’’) porthos with 1B1 773 positive structures going through the ring canals. (C-F’) Confocal images of germaria stained for 774 pMad (red, grayscale) and Vasa (green). In (C) control ovaries nuclear pMad staining occurs in 775 cells proximal to the niche marking GSCs. Nuclear pMad staining in ovaries depleted of (D) athos, 776 (E) aramis, and (F) porthos demonstrates that the observed cysts are not composed of GSCs. 777 Scale bar for main images is 15 micron, scale bar for insets is 3.75 micron.

29 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

778 779 Supplemental Figure 2. Athos, Aramis, and Porthos are required for efficient ribosome 780 biogenesis., related to Figure 2. (A-A’’) Western blots of immunoprecipitations from ovaries for 781 FLAG-tagged (A) Aramis, (A’) Athos, , and (A’’) Porthos. (B-B’’’) Confocal images of (B) 782 nosGAL4, driver control, (B’) aramis (B’’) athos and (B’’’) porthos germline RNAi germaria 783 stained for Fibrillarin (red), DAPI (blue), and Vasa (green). (C) Quantification of nucleolar volume 784 in GSCs of aramis, athos, and porthos RNAi, compared to control normalized to somatic nucleolar 785 volume indicates loss of each helicase results in nucleolar stress (n=24 GSCs per genotype, One- 786 way ANOVA, p<0.001, with Welch’s t-test, * = p<0.05, ** = p<0.01). (D-D’) Polysome preparations

30 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

787 from Drosophila S2 cells in cells treated with dsRNA targeting (D) RpS19a or (D’) RpL30. (E-G) 788 Western blot against proteins targeted for depletion by siRNA in HeLa cells. The human homologs 789 of (E) Aramis (DDX52), (F) Athos (DHX33), and (G) Porthos (DDX47) are efficiently depleted with 790 siRNA treatment after 72 hours (n=3, Welch’s t-test, * = p<0.05). Scale bar for all images is 15 791 micron.

31 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

792

32 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

793 Supplemental Figure 3. Aramis is required for proper cell cycle progression, related to 794 Figure 3. (A) Volcano plot of mRNA expression in aramis RNAi compared to bam RNAi. Blue 795 points represent mRNAs significantly upregulated aramis RNAi compared to bam RNAi, red 796 points represent mRNAs significantly downregulated aramis RNAi compared to bam RNAi. (B) 797 Bar plot representing the most significant Biological Process GO terms of upregulated genes in 798 ovaries depleted of aramis compared to the developmental control, bam RNAi. (C-C’) Genome 799 browser tracks of mRNA expression at the (C) Cyclin A and (C’) Actin 5C loci indicate that the 800 RNAseq target gene Cyclin A expression is downregulated, while a non-target, Actin 5C is not 801 downregulated. (D-E’) Confocal images of germaria stained for 1B1 (red), Vasa (blue), and Cyclin 802 B::GFP (green, grayscale) in (D-D’) control and (E-E’) germline depletion of aramis demonstrates 803 that functional Cyclin B::GFP cannot be efficiently expressed in germline depleted of aramis. (F- 804 H’’) Confocal images of germaria that express Fly-FUCCI in the germline stained for Vasa (blue). 805 GFP-E2f1degron (green, right grayscale) and RFP-CycBdegron (red, left grayscale) in (F-F’’) 806 nosGAL4, driver control ovaries, (G-G’’) bam RNAi as a developmental control, and (H-H’’) 807 ovaries with germline depletion of aramis demonstrates that the germline of aramis RNAi germline 808 depleted ovaries are negative for both G1 and G2 cell cycle markers. (I-I’) Confocal images of 809 aramis germline RNAi expressing GFP in the germline, stained for 1B1 (red), Vasa (blue), and 810 GFP (green, grayscale) indicates productive translation of transgenes still occurs. (J-M) Confocal 811 images of germaria stained for p53 (red) and Vasa (blue) in (J) hybrid dysgenic, Harwich, ovaries 812 and (K) p5311-B-1 ovaries stained for p53 (red) and Vasa (blue) demonstrate the expected p53 813 staining patterns. (L-M) Confocal images of germaria stained for p53 (red) and Vasa (blue) in 814 ovaries depleted of (L) athos or (M) porthos in the germline exhibit p53 punctate staining. Cells 815 highlighted by a dashed yellow circle represent cells shown in the inset. Scale bar for main images 816 is 15 micron, scale bar for insets is 3.75 micron.

817 818 Supplemental Figure 4. The mRNA levels of Aramis polysome-seq targets are not 819 significantly changing, related to Figure 4. (A-A’) Volcano plot of mRNA expression from 820 poly(A)+ mRNA input libraries in germline aramis RNAi compared to (A) germline driven UAS-tkv 821 and (A’) bam RNAi of targets identified from polysome-seq. No target genes identified from 822 polysome-seq meet the differential expression cutoff for mRNA in UAS-tkv compared to aramis 823 RNAi or bam RNAi compared to aramis RNAi input libraries.

33 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

824 825 Supplemental Figure 5. Non1 and p53 are inversely expressed, related to Figure 5. (A-A’’) 826 Confocal images of ovarioles expressing Non1::GFP stained for p53 (red, right grayscale), Vasa 827 (blue), and Non1::GFP (green, left grayscale). (B-B’) Quantifications of staining, (B) peak Non1 828 expression in control ovaries occurs in GSC-4 cell cyst stages and 16-cell cyst-region 2b stages 829 where (B’) p53 expression is low. (C-D’) Confocal images of nosGAL4, driver control (C-C’) and 830 germline Non1 RNAi germaria stained for p53 (red, grayscale) and Vasa (blue). (E) Quantification 831 of p53 punctate area above cutoff are markedly brighter in the germline of Non1 RNAi depleted 832 ovaries compared to the control. Cells highlighted by a dashed yellow circle represent cells shown 833 in the inset. Scale bar for main images is 15 micron, scale bar for insets is 3.75 micron.

34 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

834

35 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

835 Supplemental Figure 6. TORC1 activity regulates TOP expression in the germarium, related 836 to Figure 6. (A-A’) Genome browser tracks of the (A) Non1 and (A’) RpS2 loci in ovary CAGE- 837 seq data showing the proportion of transcripts that are produced from a given TSS (orange). 838 Predominant TSSs are shown in orange and putative TOP motif beginning at the dominant TSS 839 is indicated with a green box. The bottom blue and red graph represents sequence conservation 840 of the locus across Diptera. The dominant TSS of Non1 initiates with a canonical TOP motif and 841 the RpS2 TSS initiates at a sequence resembling a TOP motif. (B) Diagram of the WT and Mut- 842 TOP-GFP reporter constructs indicating the TOP sequence that is mutated by transversion in the 843 Mutant reporter (blue). (C-D’) Confocal images of WT-TOP reporter expression stained for 1B1 844 (red), GFP (green, grayscale), and Vasa (blue) in (C-C’) nosGAL4, driver control ovaries and (D- 845 D’) ovaries depleted of Nprl3 in the germline. (E-F’) Confocal images of Mut-TOP-GFP reporter 846 expression stained for 1B1 (red), GFP (green, grayscale), and Vasa (blue) in (E-E’) nosGAL4, 847 driver control ovaries and (F-F’) ovaries depleted of Nprl3 in the germline. (G) A.U. quantification 848 of WT and Mutant TOP reporter expression in GSCs of nosGAL4, driver control ovaries and GSCs 849 of Nprl3 germline depleted ovaries normalized to Vasa expression indicate that the relative 850 expression of the WT-TOP-GFP reporter is higher than the Mut-TOP-GFP reporter (n=9-11 851 germaria per genotype, Welch’s t-test, * = p<0.05, ** = p<0.01, *** = p<0.001). (H-I’) Confocal 852 images of WT-TOP reporter expression stained for 1B1 (red), GFP (green, grayscale), and Vasa 853 (blue) in (H-H’) nosGAL4, driver control ovaries and (I-I’) ovaries depleted of raptor in the 854 germline. (J-K’) Confocal images of Mut-TOP-GFP reporter expression stained for 1B1 (red), 855 GFP (green, grayscale), and Vasa (blue) in (J-J’) nosGAL4, driver control ovaries and (K-K’) 856 ovaries depleted of raptor in the germline. (L) A.U. quantification of WT and Mutant TOP reporter 857 expression in GSCs of nosGAL4, driver control ovaries and GSCs of raptor germline depleted 858 ovaries normalized to Vasa expression indicate that the relative expression of the WT-TOP-GFP 859 reporter is lower than the Mut-TOP-GFP reporter (n=10 germaria per genotype, Welch’s t-test, * 860 = p<0.05, ** = p<0.01). Scale bar for images is 15 micron.

36 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

861 862 Supplemental Figure 7. Larp binds specifically to TOP containing mRNAs and regulates 863 cytokinesis, related to Figure 7. (A-A’) Confocal images of germaria stained for 1B1 (red), Vasa

37 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

864 (blue), and Larp GFP-3xFLAG (green, grayscale) indicates Larp is expressed throughout early 865 oogenesis. (B) Quantification of EMSAs and summary of Kd of the protein-RNA interactions. (C- 866 C’) EMSA of Larp-DM15 and the leading 42 nucleotides of (B) RpL30 and (B’) Non1 with their 867 TOP sequence mutated to purines as a negative control with increasing concentrations of Larp- 868 DM15 from left to right indicates that Larp-DM15 requires a leading TOP sequence for its binding. 869 (D) Western of representative IP of Larp::GFP::FLAG from ovary tissue used for RNA IP-seq. (E- 870 F’) Confocal images of Larp::GFP::FLAG reporter expression stained for 1B1 (red), GFP (green, 871 grayscale), and Vasa (blue) in (E-E’) bam and (F-F’) aramis depleted germaria. (G) A.U. 872 quantification of Larp::GFP::FLAG reporter expression in the germline of bam RNAi and aramis 873 RNAi demonstrates that the germline expression of Larp is not elevated in aramis germline RNAi 874 compared to bam germline RNAi as a developmental control (n=10, p>0.05, Welch’s t-test). (H) 875 Western of representative IP of Larp::GFP::FLAG from ovary tissue used for RNA IP qPCR. (I-I’) 876 Confocal images of (I) nosGAL4, driver control and (I’) ovaries overexpressing the DM15 region 877 of Larp in the germline ovaries stained for DAPI (green) and Vasa (blue). Overexpression of Larp- 878 DM15 results in the production of 32-cell egg chambers which indicates it causes a cytokinesis 879 defect. Scale bar for all images is 15 micron. 880 881 Supplemental Table 1. Results of germline helicase RNAi screen on ovariole morphology. 882 Results of screen of RNA helicases depleted from the germline. Reported is the majority 883 phenotype from n=50 ovarioles. 884 885 Supplemental Table 2. Differential expression analysis from RNAseq of ovaries depleted 886 of aramis in the germline compared to a developmental control. DEseq2 output from RNAseq 887 of ovaries depleted of aramis in the germline compared to ovaries depleted of bam in the germline 888 as a developmental control. Sheet 1 (Downregulated Genes) contains genes and corresponding 889 DEseq2 output meeting the cutoffs to be considered downregulated in aramis RNAi compared to 890 bam RNAi. Sheet 2 (Upregulated Genes) contains genes and corresponding DEseq2 output 891 meeting the cutoffs to be considered upregulated in aramis RNAi compared to bam RNAi. Sheet 892 3 (All Genes) contains DEseq2 output for all genes in the dm6 assembly. 893 894 Supplemental Table 3. Analysis of polysome-seq of ovaries depleted of aramis in the 895 germline compared to developmental controls. Results of polysome-seq from ovaries 896 depleted of aramis in the germline, ovaries depleted of bam, and ovaries overexpressing tkv in 897 the germline as developmental controls. Sheet 1 (Downregulated Genes) contains genes and 898 corresponding polysome/input ratio values and values representing the difference in the 899 polysome/input ratios between aramis RNAi and the developmental controls meeting the cutoffs 900 to be considered downregulated in aramis RNAi. Sheet 2 (Upregulated Genes) contains genes 901 and corresponding polysome/input ratio values and values representing the difference in the 902 polysome/input ratios between aramis RNAi and the developmental controls meeting the cutoffs 903 to be considered upregulated in aramis RNAi. Sheet 3 (All Genes) contains DEseq2 output for 904 all genes in the dm6 assembly. 905 906 Supplemental Table 4. Aramis translation targets contain TOP sequences. List of aramis 907 RNAi polysome downregulated targets and the position and sequence of the first instance of a 5- 908 mer pyrimidine sequence downstream of the CAGE-defined TSS of each gene. 909 910 Supplemental Table 5. Enrichment analysis of Larp RNA IP mRNA-seq. Results of 911 Larp::GFP::FLAG IP/IgG/Input mRNAseq. Each sheet contains the output of DEseq2. Sheet 1 912 (Larp Targets) contains Larp IP targets as defined in methods. Sheet 2 (IP vs In Enriched) 913 contains genes significantly enriched in the Larp IP samples compared to the input samples. 914 Sheet 3 (IgG vs In Enriched) contains genes significantly enriched (see methods) in the IgG

38 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

915 samples compared to the input samples. Sheet 4 (IPvsIn All Genes) contains the DEseq2 output 916 of all genes in the Larp IP samples compared to the input samples. Sheet 5 (IgG vs In All Genes) 917 contains the DEseq2 output of all genes in the IgG samples compared to the input samples. 918

919 Materials and Methods 920 Fly lines: 921 The following Bloomington Stock Center lines were used in this study: #25751 UAS- 922 Dcr2;nosGAL4, #4442 nosGAL4;MKRS/TM6, #32334 Aramis RNAi#1 CG5589HMS00325, #56977 923 Athos RNAi#1 CG4901HMC04417, #36589 Porthos RNAi#1 CG9253GL00549, #36537 UAS-tkv.CA, 924 #33631 bam RNAiHMS00029, #6815 p535A-1-4, #4264 Harwich, #6816 p5311-1B-1, #55101 FUCCI: 925 UASp-GFP.E2f1.1-230, UASp-mRFP1.CycB.1-266/TM6B, #5431 UAS-EGFP, #78777 Non1 926 RNAi P{TRiP.HMS05872}, #61790 Larp::GFP::3xFLAG Mi{PT-GFSTF.1}larpMI06928-GFSTF.1, #8841 927 w[1118]; Df(3R)Hsp70A, Df(3R)Hsp70B, #55384 Nprl3 RNAi P{TRiP.HMC04072}attP40, #34814 928 raptor RNAi P{TRiP.HMS00124}attP2 929 930 The following Vienna Stock Center lines were used in this study: Aramis RNAi#2 CG5589v44322, 931 Athos RNAi#2 CG4901v34905, Aramis::GFP PBac{fTRG01033.sfGFP-TVPTBF}VK00002, 932 Athos::GFP PBac{fTRG01233.sfGFP-TVPTBF}VK00033, Non1::GFP PBac{fTRG00617.sfGFP- 933 TVPTBF}VK00033 934 935 The following additional fly lines were used in the study: UASp-CycB::GFP (Mathieu et al., 2013), 936 UAS-Dcr2;nosGAL4;bamGFP, If/CyO;nosGAL4 (Lehmann Lab), w1118 (Lehmann lab), 937 tjGAL4/CyO (Tanentzapf et al., 2007), RpS2::GFPCB02294 (Buszczak et al., 2007; Zhang et al., 938 2014), UASp-Non1 (this study), UASp-Larp-DM15 (this study), WT-TOP-Reporter (this study), 939 Mutant-TOP-Reporter (this study). 940 941 Antibodies IF 942 The following antibodies were used for immunoflourenscence: mouse anti-1B1 1:20 (DSHB 1B1), 943 rabbit anti-Vasa 1:833-1:4000 (Rangan Lab), chicken anti-Vasa 1:833-1:4000 (Rangan Lab) 944 (Upadhyay et al., 2016), rabbit anti-pTyr 1:500 (Sigma T1235), rabbit anti-pMad 1:200 (Abcam 945 ab52903), rabbit anti-GFP 1:2000 (abcam, ab6556), mouse anti-p53 1:200 (DSHB 25F4), Rabbit 946 anti-CycB 1:200 (Santa Cruz Biotechnology, 25764), Rabbit anti-Fibrillarin 1:200 (Abcam 947 ab5821), Mouse anti-Fibrillarin 1:50 (Fuchs Lab) (McCarthy et al., 2018). Alexa 488 (Molecular 948 Probes), Cy3 and Cy5 (Jackson Labs) were used at a dilution of 1:500. 949 950 Antibodies Western/IP 951 Mouse anti-FLAG-HRP 1:5000 (Sigma Aldrich, A8592) 952 Mouse anti-FLAG (Sigma Aldrich, F1804) 953 Anti-GAPDH-HRP 1:10,000 (Cell Signaling, 14C10) 954 Rabbit anti-DDX52 1:5000 (Bethyl, A303-053A) 955 Rabbit anti-DHX33 1:5000 (Bethyl, A300-800A) 956 Rabbit anti-DDX47 1:1000 (Bethyl, A302-977A) 957 958 Protein Domain Analysis: 959 Protein domain figures were adapted from: The Pfam protein families database in 2019: S. El- 960 Gebali et al. Nucleic Acids Research (2019). Protein Similarity values were obtained from the 961 DRSC/TRiP Functional Genomics Resources. 962 963 TOP Reporter Cloning

39 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

964 gBlocks (see primer list for details) were cloned into pCasper2 containing a Nos promoter, HA- 965 tag, GFP-tag, and K10 3’UTR. PCR was used in order to amplify the gBlock and to remove the 966 5’-end of the RpL30 5’UTR in order to generate the 5’-UTR discovered via CAGE-seq. In order to 967 clone the Nos promoter followed by the RpL30 5’UTR without an intervening restriction site, the 968 portion of the plasmid 5’ of the 5’UTR consisting of a portion of the plasmid backbone, a NotI 969 restriction site, and the Nos Promoter was amplified from the pCasper plasmid using PCR. HiFi 970 cloning was performed on the amplified fragments. The backbone was cut with NotI and SpeI and 971 HiFi cloning was performed according to the manufactures’ instructions except the HiFi incubation 972 was performed for 1 hour to increase cloning efficiency. Colonies were picked and cultured and 973 plasmids were purified using standard techniques. Sequencing was performed by Eton 974 Bioscience Inc. to confirm the correct sequence was present in the final plasmids. Midi-prep scale 975 plasmid was prepared using standard methods and plasmids were sent to BestGene Inc. for 976 microinjection. 977 978 Gateway Cloning 979 Gateway cloning was performed as described according to the manufacture's manual. Briefly, 980 primers containing the appropriate Gateway attb sequence on the 5’-ends and gene specific 981 sequences on the 3’-ends (see primer list for sequences) were used to PCR amplify each gene 982 of interest. PCR fragments were BP cloned into pEntr221 as detailed in the Thermofisher 983 Gateway Cloning Manual and used to transform Invitrogen One Shot OmniMAX 2 T1 Phage- 984 Resistant Cells. Resulting clones were picked and used to perform LR cloning into either pPGW 985 or pPWG as appropriate. Cloning was carried out according to the Thermofisher Gateway Cloning 986 Manual except the LR incubation was carried out up to 16 hours. Colonies were picked and 987 cultured and plasmids were purified using standard techniques. Sequencing was performed by 988 Eton Bioscience Inc. to confirm the correct sequence was present in the final plasmids. Midi-prep 989 scale plasmid was prepared using standard methods and plasmids were sent to BestGene Inc. 990 for microinjection. 991 992 Egg Laying Test 993 Newly eclosed flies were collected and fattened overnight on yeast. Six female flies were crossed 994 to 4 male controls and kept in cages at 25°C. Flies were allowed to lay for three days, and plates 995 were changed and counted daily. Total number of eggs laid over the three day laying periods 996 were determined and averaged between three replicate crosses for control and experimental 997 crosses. 998 999 Immunostaining 1000 Ovaries were dissected and teased apart with mounting needles in cold PBS and kept on ice for 1001 subsequent dissections. All incubations were performed with nutation. Ovaries were fixed for 10- 1002 15 min in 5% methanol-free formaldehyde in PBS. Ovaries were washed with PBT (1x PBS, 0.5% 1003 Triton X-100, 0.3% BSA) once quickly, twice for 5 min, and finally for 15 min. Ovaries were 1004 incubated overnight, up to 72 hours in PBT with the appropriate primary antibodies. Ovaries were 1005 again washed with PBT once quickly, twice for 5 min, and finally for 15 min. Ovaries were then 1006 incubated with the appropriate secondary antibodies in PBT overnight up to 72 hours at 4°C. 1007 Ovaries were washed once quickly, twice for 5 min, and finally for 15 min in PBST (1x PBS, 0.2% 1008 Tween 20 Ovaries). Ovaries were mounted with Vectashield with 4′,6-diamidino-2-phenylindole 1009 (DAPI) (Vector Laboratories) and imaged on a Zeiss 710. All gain, laser power, and other relevant 1010 settings were kept constant for any immunostainings being compared. Image processing was 1011 performed in Fiji, gain was adjusted, and images were cropped in Photoshop CC 2018. 1012 1013 Florescent Imaging

40 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1014 Tissues were visualized and imaged were acquired using a Zeiss LSM-710 confocal microscope 1015 under the 20× and 40× oil objectives. 1016 1017 Measurement of global protein synthesis 1018 OPP (Thermo Fisher, C10456) treatment was performed as in McCarthy (2019). Briefly, ovaries 1019 were dissected in Schneider’s media (Thermo Fisher, 21720024) and incubated in 50 μM of OPP 1020 reagent for 30 minutes. Tissue was washed in 1x PBS and fixed for 10 minutes in 1x PBS plus 1021 5% methanol-free formaldehyde. Tissue was permeabilized with 1% Triton X-100 in 1x PBST (1x 1022 PBS, 0.2% Tween 20) for 30 minutes. Samples were washed with 1x PBS and incubated with 1023 Click-iT reaction cocktail, washed with Click-iT reaction rinse buffer according to manufacturer’s 1024 instructions. Samples were then immunostained according to previously described procedures. 1025 1026 Image Quantifications 1027 All quantifications were performed on images using the same confocal settings. 1028 A.U. quantifications were performed in Fiji on images taken with identical settings using the 1029 “Measure” function. Intensities were normalized as indicated in the figure legends, boxplots of 1030 A.U. measurements were plotted using R and statistics were calculated using R. 1031 Quantification of nucleolar size was measured in Fiji by measuring the diameter of the nucleolus 1032 using the measure tool in Fiji. Volumes were calculated using the formula for a sphere. 1033 Quantification of p53 area of expression was performed from control, nosGAL4 and 1034 nosGAL4>aramis RNAi germaria. A manual threshold was set based off of qualitative assessment 1035 of a “punctate”. For control ovaries, cells proximal to the niche consisting of GSCs/CBs were 1036 outlined and for aramis RNAi the entire germline proximal to the niche was outlined and a Fiji 1037 script was used to determine the number of pixels above the threshold and the total number of 1038 pixels. Data from each slice for each replicate was summed prior to plotting and statistical 1039 analysis. 1040 Colocalization analysis of helicases with Fibrillarin was performed in Fiji using the Plot Profile tool. 1041 A selection box was drawn over a Fibrillarin punctate of interest (indicated with a box in the 1042 images) and Plot Profiles was acquired for each channel of interest. Data was plotted and 1043 Spearman correlations calculated using R. 1044 Quantification of Non1-GFP expression and p53 expression over development was calculated in 1045 Fiji using the Auto Threshold tool with the Yen method (Sezgin and Sankur, 2004) to threshold 1046 expression. Quantifications were performed on 3 merged slices and egg chambers were cropped 1047 out of quantified images prior to thresholding to prevent areas outside of the germarium from 1048 influencing the thresholding algorithm. Areas of germline with “high” and “low” expression of 1049 Non1-GFP were outlined manually and a custom Fiji script was used in order to quantify the 1050 proportion of pixels in the selected marked as positive for expression for either Non1-GFP or p53, 1051 staging was inferred from the results of the Non1-GFP quantification performed using 1B1 to 1052 determine the stages of peak Non1 expression. Percent area was plotted with ggplot2 as boxplots 1053 in a custom R script. 1054 1055 RNA Extraction from Ovaries 1056 RNA extraction was performed using standard methods. Ovaries were dissected into PBS and 1057 transferred to microcentrifuge tubes. PBS was removed and 100ul of Trizol was added and 1058 ovaries were flash frozen and stored at -80 °C. Ovaries were lysed in the microcentrifuge tube 1059 using a plastic disposable pestle. Trizol was added to 1 mL total volume and sample was 1060 vigorously shaken and incubated for 5 min at RT. The samples were centrifuged for x min at 1061 >13,000 g at 4 °C and the supernatant was transferred to a fresh microcentrifuge tube. 500 ul of 1062 chloroform was added and the samples were vigorously shaken and incubated for 5 minutes at 1063 RT. Samples were spun at max speed for 10 minutes at 4 °C. The supernatant was transferred 1064 to a fresh microcentrifuge tube and ethanol precipitated. Sodium acetate was added equaling

41 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1065 10% of the volume transferred and 2-2.5 volumes of 100% ethanol were added. The samples 1066 were shaken thoroughly and left to precipitate at -20 °C overnight. The samples were centrifuged 1067 at max speed at 4 °C for 15 min to pellet the RNA. The supernatant was discarded and 500 ul of 1068 75% ethanol was added to wash the pellet. The samples were vortexed to dislodge the pellet to 1069 ensure thorough washing. The samples were spun at 4 °C for 5 min and the supernatant was 1070 discarded. The pellets were left for 10-20 min until dry. The pellets were resuspended in 20-50ul 1071 of RNAse free water and the absorbance at 260 was measured on a nanodrop to measure the 1072 concentration of each sample. 1073 1074 S2 Cell RNAi 1075 DRSC-S2 cells (Stock #181, DGRC) were cultured according to standard methods in M3+BPYE 1076 media supplemented with 10% heat-inactivated FBS. dsRNA for RNAi was prepared as described 1077 by the SnapDragon manual. Briefly, template was prepared from S2 cell cDNA using the 1078 appropriate primers (see primer list) designed using SnapDragon 1079 (https://www.flyrnai.org/snapdragon). For in-vitro transcription the T7 Megascript kit (AM1334) 1080 was used following manufacturer’s instructions and in-vitro transcriptions were incubated 1081 overnight at 37°C. The RNA was treated with DNAse according to the T7 Megascript manual and 1082 the RNA was purified using acid-phenol chloroform extraction and ethanol precipitated. The 1083 resulting RNA was annealed by heating at 65°C for 5 minutes and slow cooling to 37°C for an 1084 hour. S2 cell RNAi was performed essentially as previously described using Effectine (Zhou et 1085 al., 2013). 1.0x106 cells were seeded 30 minutes prior to transfection and allowed to attach. After 1086 30 minutes, just prior to transfection, the media was changed for 500 µl of fresh media. 500 µl of 1087 transfection complexes using 1 µg of dsRNA was prepared per well of a 6-well plate and pipetted 1088 dropwise onto seeded cells. After 24 hours an additional 1 mL of media was added to each well. 1089 After an additional 24 hours cells were passaged to 10 cm dishes. After an additional 3 days cells 1090 were harvested for further analysis. 1091 1092 HeLa Cell RNAi 1093 HeLa cells were cultured under standard conditions in DMEM (Gibco) supplemented with 10% 1094 FBS, and 2 mM L-glutamine at 37°C and 5% CO2. RNAi was performed in HeLa cells using the 1095 siRNAs in the primer list. 5% of cells from a 10 cm dishes with cells between 70-85% confluency 1096 were seeded to 6-well plates. Transfection was performed the following day using Dharmafect 1097 (PerkinElmer T-2001-03) according to the manufacture’s procedure. Briefly, per well to be 1098 transfected Transfection Master Mix was prepared by mixing 5 µl of Dharmafect with 200 µl of 1099 OptiMEM (ThermoFisher 31985070) and incubated for 5 minutes at RT. 50 µl of OptiMEM was 1100 mixed with the given 3.75 µl of 20 µM siRNA and added to 100 µl of Transfection Master Mix and 1101 incubated for 20-30 minutes at RT. Each transfection reaction was added to 600 µl of DMEM. 1102 Media from the previous day was removed from the cells and replaced with the transfection mix. 1103 Cells were incubated at 37°C for one day, then passaged to 10 cm dishes and cultured for an 1104 additional two days. Cells were subsequently prepared for Western Blotting or Polysome Profiling 1105 (see respective sections). 1106 1107 Polysome-profiling 1108 Polysome-profiling in S2 and HeLa cells was performed as in Fuchs et al. (2011) with minor 1109 modifications. HeLa cells were washed in cold PBS and lysed on the plate by scraping under 400 1110 µl lysis buffer (300 mM NaCl, 15 mM Tris-HCl, pH 7.5, 15 mM EDTA, 100 μg/mL cycloheximide, 1111 1% Triton X-100). S2 cells were resuspended by pipetting, pelleted by centrifugation at 800g for 1112 one minute, and washed in cold PBS. S2 cells were again pelleted and resuspended in 400 µl of 1113 lysis buffer. HeLa and S2 cells were then allowed to continue to lyse for 15 min on ice. Lysate 1114 was cleared by centrifugation at 8500g for 5 min at 4°C. Cleared lysate was loaded onto 10%- 1115 50% sucrose gradients (300 mM NaCl, 15 mM Tris-HCl, pH 7.5, 15 mM MgCl2, 100 g/mL

42 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1116 cycloheximide) and centrifuged in an SW41 rotor at 35,000 RPM, for 3 hours. Gradients were 1117 fractionated on a Density Gradient Fractionation System (Brandel, #621140007) at 0.75 mL/min. 1118 Data generated from gradients were plotted using R. 1119 1120 Western Blot 1121 HeLa cells were harvested for Western by in RIPA buffer by scraping. Western blotting were 1122 performed according to standard methods, briefly, each sample was loaded onto a 4-20% 1123 commercial, precast gels and run at 100V for 60-90m depending on the size of the protein of 1124 interest. Gels were transferred to nitrocellulose membranes at 100V for 1hr at 4°C. Blot was 1125 blocked in 1% milk in PBS and washed 3 times with PBS-T for 5 minutes. Primary antibodies 1126 were diluted in PBS-T+5% BSA and incubated overnight. Blot was washed once quickly, once for 1127 5m, and once for 10m in PBS-T. Blot was subsequently imaged with ECL for conjugated 1128 primaries. For unconjugated primaries, the appropriate secondary was diluted 1:10,000 in 5% 1129 milk and incubated for 2-4 hours at RT. Blot was washed once quickly, once for 5m, and once for 1130 10m in PBS-T and imaged. Images were quantified using Fiji. 1131 1132 mRNAseq Library Preparation and Analysis 1133 Libraries were prepared with the Biooscientific kit (Bioo Scientific Corp., NOVA-5138-08) 1134 according to manufacturer's instructions with minor modifications. Briefly, RNA was prepared with 1135 Turbo DNAse according to manufacturer’s instructions (TURBO DNA-free Kit, Life Technologies, 1136 AM1907), and incubated at 37°C for 30 min. DNAse was inactivated using the included DNAse 1137 Inactivation reagent and buffer according to manufactures instructions. The RNA was centrifuged 1138 at 1000 g for 1.5 min and 19 μl of supernatant was transferred into a new 1.5 mL tube. This tube 1139 was again centrifuged at 1000 g for 1.5 min and 18 μl of supernatant was transferred to a new 1140 tube to minimize any Inactivation reagent carry-over. RNA concentration was measured on a 1141 nanodrop. Poly-A selection was performed on a normalized quantity of RNA dependent on the 1142 lowest amount of RNA in a sample, but within the manufacturer's specifications for starting 1143 material. Poly-A selection was performed according to manufacturer’s instructions (Bioo Scientific 1144 Corp., 710 NOVA-512991). Following Poly-A selection mRNA libraries were generated according 1145 to manufactures instructions (Bioo Scientific Corp., NOVA-5138-08) except RNA was incubated 1146 for 13 min at 95°C to generate optimal fragment sizes. Library quantity was assessed via Qubit 1147 according to manufacturer's instructions and library quality was assessed with a Bioanalyzer or 1148 Fragment Analyzer according to manufacturer's instructions to assess the library size distribution. 1149 Sequencing was performed on biological duplicates from each genotype on an Illumina 1150 NextSeq500 by the Center for Functional Genomics (CFG) to generate single end 75 base pair 1151 reads. Reads were aligned to the dm6.01 assembly of the Drosophila genome using HISAT 1152 v2.1.0. Reads were counted using featureCounts v1.4.6.p5. UCSC genome browser tracks were 1153 generated using the bam coverage module of deeptools v3.1.2.0.0. Differential expression 1154 analysis was performed using DEseq2 (v1.24.0) and data was plotted using R. Differentially 1155 expressed genes were those with log2(foldchange) > |1.5| and FDR < 0.05. GO-term analysis of 1156 GO biological processes was performed on differentially expressed genes using PANTHER via 1157 http://geneontology.org/. Fisher’s exact test was used to calculate significance and FDR was used 1158 to correct for multiple testing. GO-term analysis results were plotted using R. 1159 1160 Polysome-seq 1161 Polysome-seq was performed as in Flora et al. (2018b) with minor modifications. Ovaries were 1162 dissected in PBS and transferred to a microcentrifuge tube in liquid nitrogen. Ovaries were lysed 1163 in 300 µl of lysis buffer (300 mM NaCl, 15 mM Tris-HCl, pH 7.5, 15 mM EDTA, 100 μg/mL 1164 cycloheximide, 1% Triton X-100) and allowed to lyse for 15 min on ice. Lysate was cleared by 1165 centrifugation at 8500g for 5 min at 4°C. 20% of the lysate was reserved as input, 1 mL of Trizol 1166 (Invitrogen, 15596026) was added and RNA was stored at -80°C. Cleared lysate was loaded onto

43 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1167 10%-50% sucrose gradients (300 mM NaCl, 15 mM Tris-HCl, pH 7.5, 15 mM MgCl2, 100 g/mL 1168 cycloheximide) and centrifuged in an SW41 rotor at 35,000 RPM, for 3 hours. Gradients were 1169 fractionated on a Density Gradient Fractionation System (Brandel, #621140007) at 0.75 mL/min, 1170 20 μl of 20% SDS, 8 μl of 0.5 M pH 8 EDTA, and 16 μl of proteinase K (NEB, P8107S) was added 1171 to each polysome fraction. Fractions were incubated for 30m at 37°C. Standard acid phenol 1172 chloroform purification followed by ethanol precipitation was performed on each fraction. The RNA 1173 from polysome fractions was pooled and RNAseq libraries were prepared. 1174 1175 S2 Polysome-seq Data Analysis 1176 Reads were checked for quality using FastQC. Reads were mapped to the Drosophila genome 1177 (dm6.01) using Hisat version 2.1.0. Mapped reads were assigned to features using featureCount 1178 version v1.6.4. Translation efficiency was calculated as in (Flora et al., 2018) using a custom R 1179 script. Briefly, CPMs (counts per million) values were calculated. Any gene having zero reads in 1180 any library was discarded from further analysis. The log2 ratio of CPMs between the polysome 1181 fraction and total mRNA was calculated and averaged between replicates. This ratio represents 1182 TE, TE of each replicate was averaged and delta TE was calculated (Porthos RNAi TE)/(GFP 1183 RNAi TE). This ratio represents delta TE. The group of highly expressed targets was defined as 1184 transcripts falling greater or less than one standard deviation from the median of delta TE with 1185 log2(TPM) expression greater than five. 1186 1187 CAGE-seq Tracks 1188 CAGE-seq tracks were visualized using the UCSC Genome Browser after adding the publicly 1189 available track hub ‘EPD Viewer Hub’. 1190 1191 CAGE-seq Data Reanalysis 1192 Publicly available genome browser tracks were obtained of CAGE-seq data (generated by Chen 1193 et al. (2014) and viewed through the UCSC Genome Browser. The original CAGE-seq data from 1194 ovaries was obtained from SRA under the accession number SRR488282. Reads were aligned 1195 to the dm6.01 assembly of the Drosophila genome using HISAT v2.1.0. cageFightR was used to 1196 determine the dominant TSS for every gene with sufficient expression in from the aligned dataset 1197 according to its documentation with default parameters excepting the following: For getCTSS, a 1198 mappingQualityThreshold of 10 was used. For normalizeTagCount the method used was 1199 “simpleTPM”. For clusterCTSS the following parameters were used; threshold = 1, 1200 thresholdIsTpm = TRUE, nrPassThreshold = 1, method = "paraclu", maxDist = 20, 1201 removeSingletons = TRUE, keepSingletonsAbove = 5. Custom Rcripts were used in order to 1202 obtain genome sequence information downstream of the TSS of each gene identified. 1203 1204 Motif Enrichment Analysis 1205 Motif enrichment analysis was performed using Homer (Heinz et al., 2010) using the findmotifs.pl 1206 module, supplying Homer with the first 200 nucleotides downstream of the TSS as determined by 1207 CAGE-seq for polysome-seq targets and non-targets as a background control with the following 1208 parameters “-rna -nogo -p 6 -len 6”. Only motifs not marked as potential false positives were 1209 considered. The position of the putative TOP motifs was determined using a custom R script by 1210 searching for the first instance of any five pyrimidines in a row within the first 200 nucleotides of 1211 the TSS using the Biostrings package (Pagès et al., 2019). Results were plotted as a histogram 1212 in R. 1213 1214 RNA Immunoprecipitation (RNA IP) 1215 All RIPs were performed with biological triplicates. 50-60 ovary pairs were dissected for each 1216 sample in RNase free PBS and dissected ovaries were kept on ice during subsequent dissections. 1217 After dissection, ovaries were washed with 500 µl of PBS to remove any debris. This PBS was

44 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1218 removed, and ovaries were lysed in 100 µl of RIPA buffer (10 mM Tris-Cl Buffer (pH 8.0), 1 mM 1219 EDTA, 1% Triton X-100,0.1% Sodium deoxycholate, 0.1% SDS, 140 mM NaCl, 1 mM PMSF, 1 1220 cOmplete, EDTA-free Protease Inhibitor/10mLbuffer (Roche, 11873580001), RNase free H2O) 1221 supplemented with 8 µl of RNase Out. Following lysis an additional 180 µl of RIPA was added to 1222 each sample. Lysate was cleared with centrifugation at 14,000g for 20m at 4°C. Cleared lysate 1223 was transferred to a new 1.5 mL tube. 10% of this lysate was reserved for RNA input and 5% was 1224 reserved as a protein input. To the RNA input 100 µl of Trizol was added and the input was stored 1225 at -80°C. To the protein input SDS loading buffer was added to a 1X working concentration and 1226 the sample was heated at 95°C for 5m and stored at -20°C. The remaining lysate was equally 1227 divided into two new 1.5 mL tubes. To one tube 3 µg of mouse anti-FLAG antibody was added 1228 and to the other tube 3 µg of mouse IgG was added. These samples were incubated for 3 hours 1229 with nutation at 4°C. NP40 buffer was diluted to a 1X working concentration from a 10X stock (10x 1230 NP40 Buffer: 50 mM Tris-Cl Buffer (pH 8.0), 150 mM NaCl, 10% NP-40, 1 cOmplete, EDTA-free 1231 Protease Inhibitor Cocktail Pill/10mL buffer, RNase free H2O). 30 µl of Protein-G beads per RIP 1232 were pelleted on a magnetic stand and supernatant was discarded. 500 µl of 1X NP40 buffer was 1233 used to resuspend Protein-G beads by nutation. Once beads were resuspended, they were again 1234 pelleted on the magnetic stand. This washing process was repeated a total of 5 times. Washed 1235 Protein-G beads were added to each lysate and incubated overnight. The next day fresh 1X NP40 1236 buffer was prepared. Lysates were pelleted on a magnetic stand at 4°C and supernatant was 1237 discarded. 300 µl of 1X NP40 buffer was added to each sample and samples were resuspended 1238 by nutation at 4°C. Once samples were thoroughly resuspended, they were pelleted on a 1239 magnetic stand. These washing steps were repeated 6 times. Following the final washing steps, 1240 beads were resuspended in 25 ul of 1X NP40 Buffer. 5 µl of beads were set aside for Western 1241 and the remaining beads were stored at -80°C in 100 µl of Trizol. SDS loading buffer was added 1242 was added to a 1X working concentration and the sample was heated at 95°C for 5m and stored 1243 at -20°C or used for Western (refer to Western Blot section). 1244 1245 Helicase RNA IPseq 1246 RNA was purified as previously described. RNA yield was quantified using Qubit or nanodrop 1247 according to manufactures instructions. RNA was run on a Fragment Analyzer according to 1248 manufactures instructions to assess quality. Inputs were diluted 1:50 to bring them into a similar 1249 range as the IgG and IP samples. To each sample 0.5 ng of Promega Luciferase Control RNA 1250 was added as a spike-in. Libraries were prepared as previously described except Poly(A) 1251 selection steps were skipped and library preparation was started with between 1-100 ng of total 1252 RNA. Reads were mapped to the M21017.1 NCBI Drosophila rRNA sequence record and the 1253 sequence of Luciferase obtained from Promega. All further analysis was performed using custom 1254 R scripts. Reads were assigned to features using featureCounts based off of a custom GTF file 1255 assembled based off of the Flybase record of rRNA sequences. Reads mapping to rRNA were 1256 normalized to reads mapping to the Luciferase spike-in control. Reads were further normalized to 1257 the reads from the corresponding input library to account for differences in input rRNA 1258 concentration between replicates and replicates were subsequently averaged. Tracks were 1259 visualized using the R package ‘ggplot’, with additional formatting performed using ‘scales’ and 1260 ‘egg’. The rRNA GTF was read into R using ‘rtracklayer’ and visualized using ‘gggenes’. Average 1261 reads mapping to rRNA from IgG control and IP was plotted and a one-sided bootstrapped paired 1262 t-test for was performed on regions on rRNA that appeared to be enriched in the IP samples 1263 compared to the IgG control as it is a non-parametic test suitable for use with low n using R with 1264 100,000 iterations. 1265 1266 Larp Gel Shifts 1267 Cloning, Protein expression and purification

45 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1268 The Larp-DM15 protein expression construct (amino acids 1330-1481 corresponding to isoform 1269 D) was cloned into a modified pET28a vector by PCR using cDNA corresponding to accession ID 1270 NP_733244.5. The resulting fusion protein has an N-fHis10-maltose binding protein (MBP)- 1271 tobacco etch virus (TEV) protease recognition site tag. Protein expression and purification were 1272 performed as described previously (Lahr et al., 2015). Briefly, plasmid was transformed into 1273 BL21(DE3) E. coli cells and plated onto kanamycin-supplemented agar plates. A confluent plate 1274 was used to inoculate 500 mL of autoinduction media (Studier, 2005). Cells were grown for three 1275 hours at 37ºC and induced overnight at 18ºC. Cells were harvested, flash frozen, and stored at - 1276 80ºC. 1277 1278 Cells were resuspended in lysis buffer (50 mM Tris, pH 8, 400 mM NaCl, 10 mM imidazole, 10% 1279 glycerol) supplemented with aprotinin (Gold Bio), leupeptin (RPI Research), and PMSF (Sigma) 1280 protease inhibitors. Cells were lysed via homogenization. Lysate was clarified by centrifugation 1281 and incubated with Ni-NTA resin (ThermoScientific) for batch purification. Resin was washed with 1282 lysis buffer supplemented with 35 mM imidazole to remove non-specific interactions. His10-MBP- 1283 DM15 was eluted with 250 mM imidazole. The tag was removed via proteolysis using TEV 1284 protease and simultaneously dialyzed overnight (3 mg TEV to 40 mL protein elution). Larp-DM15 1285 was further purified by tandem anion (GE HiTrap Q) and cation exchange (GE HiTrap SP) 1286 chromatography using an AKTA Pure (GE) to remove nucleic acid and protein contaminants. The 1287 columns were washed with in buffer containing 50 mM Tris, pH 7, 175 mM NaCl, 0.5 mM EDTA, 1288 and 10% glycerol and eluted with a gradient of the same buffer containing higher salt (1 M NaCl). 1289 Fractions containing Larp-DM15 were pooled, and 3 M ammonium sulfate was added to a final 1290 concentration of 1 M. A butyl column (GE HiTrap Butyl HP) was run to remove TEV contamination. 1291 The wash buffer contained 50 mM Tris, pH 7, 1 M ammonium sulfate, and 5% glycerol, and the 1292 elution buffer contained 50 mM Tris pH 7 and 2 mM DTT. Fractions containing Larp-DM15 were 1293 buffer exchanged into storage buffer (50 mM Tris pH, 7.5, 250 mM NaCl, 2 mM DTT, 25% 1294 glycerol), flash frozen in liquid nitrogen, and stored at -80°C. The purification scheme and buffer 1295 conditions were the same as with HsDM15 (Lahr et al., 2015), except cation and anion exchange 1296 buffers were at pH 7, as noted above. 1297 1298 RNA preparation 1299 5’-triphosphorylated RpL30 and Non1 42-mers were synthesized (ChemGenes). Purine- 1300 substituted controls were synthesized by in vitro transcription using homemade P266L T7 RNAP 1301 polymerase (Guillerez et al., 2005). The transcription reaction containing 40 mM Tris, pH 8, 10 1302 mM DTT, 5 mM spermidine, 2 mM NTPs, and 10-15 mM MgCl2 was incubated at 37°C for 4 hours. 1303 Transcripts were subsequently purified from an 8% polyacrylamide/6M urea/1XTBE denaturing 1304 gel, eluted passively using 10 mM sodium cacodylate, pH 6.5, and concentrated using spin 1305 concentrators (Millipore Amicon). All oligos were radioactively capped using Vaccinia virus 1306 capping system (NEB) and [α-32P]-GTP (Perkin-Elmer). Labelled oligos were purified using a 10% 1307 polyacrylamide/6M urea/1XTBE denaturing gel, eluted with 10 mM sodium cacodylate, pH 6.5, 1308 and concentrated by ethanol precipitation. 1309 1310 The RNA sequences used were: 1311 RpL30: CUUUUGCCAUUGUCAGCCGACGAAGUGCUUUAACCCAAACUA 1312 Non1: CUUUUUGGAAUACGAAGCUGACACCGCGUGGUGUUUUUGCUU 1313 *Purine-substituted RPL30 control: 1314 GAAAAGCCAUUGUCAGCCGACGAAGUGCUUUAACCCAAACUA 1315 *Purine-substituted Non1 control: 1316 GAAAAAGGAAUACGAAGCUGACACCGCGUGGUGUUUUUGCUU 1317 1318 Oligos used for run-off transcription

46 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

DNA oligo Sequence (5’ to 3’) **RpL30 GCGCGCGAATTCTAATACGACTCACTATAGAAAAGCCATTGTCAGCC control gene GACGAAGTGCTTTAACCCAAACTAGGGTCGGCATGGCATCTCCACCT block (with 3’ CCTCGCGGTCCGACCTGGGCTACTTCGGTAGGCTAAGGGAGAAGCT HDV) TGGCACTGGCCGTCGTTT Non1 control GCGCGCGAATTCTAATACGACTCACTATAGGAAAAAGGAATACGAAG Forward CTGACA

Non1 control AAGCAAAAACACCACGCGGTGTCAGCTTCGTATTCCTTTTTCCTATAG Reverse TGAG

5’ GEN amp GCGCGCGAATTCTAATACGACTCA RpL30 amp TAGTTTGGGTTAAAGCACTTCGTCGGC Reverse Non1 amp AAGCAAAAACACCACGCGGTGTCA Reverse

1319 * These RNAs were synthesized using run-off transcription. 1320 1321 Electrophoretic mobility shift assays (EMSAs) 1322 Each binding reaction contained 125 total radioactive counts with final reaction conditions of: 20 1323 mM Tris-HCl, pH 8, 150 mM NaCl, 10% glycerol, 1 mM DTT, 0.5 μg tRNA (Ambion), 1 μg BSA 1324 (Invitrogen), and <90 pM RNA. To anneal RNA, oligos were snap-cooled by heating at 95°C for 1325 1 min and cooled on ice for 1 hour. For capped RpL30 shifts and capped purine-substituted 1326 controls, final concentrations of 0, 0.001, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, and 100 nM 1327 Larp-DM15 were titrated. For capped Non1 shifts, final concentrations of 0, 0.01, 0.03, 0.1, 0.3, 1328 1, 3, 10, 30, 100, 300, and 1000 nM Larp-DM15 were titrated. Native 7% polyacrylamide 0.5X 1329 TBE gels were pre-run on ice at 120 V for 30 min. Binding reactions were run at 120 V on ice for 1330 45-52 min. Gels were dried for 30 min and allowed to expose overnight using a phosphor screen 1331 (GE). Screens were imaged using GE Amersham Typhoon. Bands were quantified using 1332 ImageQuant TL (GE). Background subtraction was first done using the rolling ball method and 1333 then subtracting the signal from the zero-protein lane from each of the shifted bands. Fraction 1334 shifted was determined by dividing the background-corrected intensity of the shifted band by total 1335 intensity of bands in each lane. Three independent experiments were done for each oligo, with 1336 the average plotted and standard deviation shown. 1337 1338 Larp RNA IPseq 1339 Larp IP was performed as described in the RNA IP-seq section above in triplicate. mRNA libraries 1340 were prepared as described in mRNAseq Library Preparation and Data Processing using a 1341 constant volume of RNA from each sample with input samples having been diluted 1:50. Data 1342 was processed as described as in the mRNAseq Library Preparation and Data Processing 1343 section. Targets are defined as genes with >2 fold enrichment and an adjusted p-value <0.05 in 1344 the Larp-IP libraries compared to input libraries, but not meeting those criteria in the IgG libraries 1345 compared to input. 1346 1347 Larp RNA IP qPCR 1348 Larp RNA IP was performed as described in the Larp RNA IPseq section with the following 1349 modifications. As the ovaries used were small, they were flash frozen in order to accumulate 40- 1350 50 ovaries for each biological replicate. Additionally, 5% input was taken for both RNA and protein

47 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1351 samples. Once RNA was purified all of the RNA was treated with Turbo DNAse as in the 1352 mRNAseq Library Preparation and Analysis section. Reverse transcription (RT) was performed 1353 using Superscript II according to the manufacture’s protocol with equivalent volumes of RNA for 1354 each sample. cDNA was diluted 1:8 before performing qPCR using Syber Green. Each reaction 1355 consisted of 5ul Syber Green master mix, 0.4 ul water, 0.3 ul of each primer, and 4 ul of diluted 1356 cDNA. For each sample 3 biological and 3 technical replicates were performed. Oulier values of 1357 technical replicates were removed using a Dixon test with a cutoff of p<0.05. Remaining technical 1358 replicates were averaged, and the IP Input Ct value, the log2 of the Input dilution (20) was also 1359 subtracted to account for the Input being 5% of the total sample as follows: 1360 ΔCt[normalized IP] = (Average Ct[IP] − (Average Ct[Input] − log2(Input Dilution Factor))) 1361 1362 Next, RNA recovery was normalized using the spike-in control for each sample as follows: 1363 ΔΔCt= ΔCt[normalized IP] − ΔCt[Luciferase] 1364 1365 Next, Each sample was normalized to it’s matched bam RNAi control as follows: 1366 bam RNAi normalized Ct= ΔΔCt[aramis RNAi IP] − ΔΔCt[[bam RNAi IP] 1367 1368 Finally, fold increase of IP from aramis RNAi over bam RNAi was calculated as follows: 1369 Fold Enrichment = 2(−bam RNAi normalized Ct ) 1370 1371 Fold enrichment was plotted and One-sample t-test performed on aramis RNAi samples in R 1372 using a mu of 1. 1373 1374 References 1375 Agarwal, M.L., Agarwal, A., Taylor, W.R., Stark, G.R., 1995. p53 controls both the G2/M and the 1376 G1 cell cycle checkpoints and mediates reversible growth arrest in human fibroblasts. 1377 Proc. Natl. Acad. Sci. 92, 8493–8497. 1378 Anthony, J.C., Anthony, T.G., Kimball, S.R., Vary, T.C., Jefferson, L.S., 2000. Orally 1379 Administered Leucine Stimulates Protein Synthesis in Skeletal Muscle of Postabsorptive 1380 Rats in Association with Increased eIF4F Formation. J. Nutr. 130, 139–145. 1381 https://doi.org/10.1093/jn/130.2.139 1382 Aoki, K., Adachi, S., Homoto, M., Kusano, H., Koike, K., Natsume, T., 2013. LARP1 specifically 1383 recognizes the 3′ terminus of poly(A) mRNA. FEBS Lett. 587, 2173–2178. 1384 https://doi.org/10.1016/j.febslet.2013.05.035 1385 Arabi, A., Wu, S., Ridderstråle, K., Bierhoff, H., Shiue, C., Fatyol, K., Fahlén, S., Hydbring, P., 1386 Söderberg, O., Grummt, I., Larsson, L.-G., Wright, A.P.H., 2005. c-Myc associates with 1387 ribosomal DNA and activates RNA polymerase I transcription. Nat. Cell Biol. 7, 303–310. 1388 https://doi.org/10.1038/ncb1225 1389 Armistead, J., Triggs-Raine, B., 2014. Diverse diseases from a ubiquitous process: The 1390 ribosomopathy paradox. FEBS Lett. 588, 1491–1500. 1391 https://doi.org/10.1016/j.febslet.2014.03.024 1392 Barlow, J.L., Drynan, L.F., Trim, N.L., Erber, W.N., Warren, A.J., Mckenzie, A.N.J., 2010. Cell 1393 Cycle New insights into 5q-syndrome as a ribosomopathy. Cell Cycle 9, 4286–4293. 1394 https://doi.org/10.4161/cc.9.21.13742 1395 Baxter-Roshek, J.L., Petrov, A.N., Dinman, J.D., 2007. Optimization of ribosome structure and 1396 function by rRNA base modification. PLoS ONE 2, e174. 1397 https://doi.org/10.1371/journal.pone.0000174 1398 Berman, A.J., Thoreen, C.C., Dedeic, Z., Chettle, J., Roux, P.P., Blagden, S.P., 2020. 1399 Controversies around the function of LARP1. RNA Biol. 1–11. 1400 https://doi.org/10.1080/15476286.2020.1733787

48 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1401 Bernardini, L., Gimelli, S., Gervasini, C., Carella, M., Baban, A., Frontino, G., Barbano, G., 1402 Divizia, M., Fedele, L., Novelli, A., Béna, F., Lalatta, F., Miozzo, M., Dallapiccola, B., 1403 2009. Recurrent microdeletion at 17q12 as a cause of Mayer-Rokitansky-Kuster-Hauser 1404 (MRKH) syndrome: two case reports. Orphanet J. Rare Dis. 4, 25. 1405 https://doi.org/10.1186/1750-1172-4-25 1406 Blagden, S.P., Gatt, M.K., Archambault, V., Lada, K., Ichihara, K., Lilley, K.S., Inoue, Y.H., 1407 Glover, D.M., 2009. Drosophila Larp associates with poly (A)-binding protein and is 1408 required for male fertility and syncytial embryo development. Dev. Biol. 334, 186–197. 1409 https://doi.org/10.1016/J.YDBIO.2009.07.016 1410 Blatt, P., Martin, E.T., Breznak, S.M., Rangan, P., 2020a. Post-transcriptional gene regulation 1411 regulates germline stem cell to oocyte transition during Drosophila oogenesis, in: 1412 Current Topics in Developmental Biology. Elsevier, pp. 3–34. 1413 Blatt, P., Wong-Deyrup, S.W., McCarthy, A., Breznak, S., Hurton, M.D., Upadhyay, M., Bennink, 1414 B., Camacho, J., Lee, M.T., Rangan, P., 2020b. RNA degradation sculpts the maternal 1415 transcriptome during Drosophila oogenesis. bioRxiv 2020.06.30.179986. 1416 https://doi.org/10.1101/2020.06.30.179986 1417 Boamah, E.K., Kotova, E., Garabedian, M., Jarnik, M., Tulin, A.V., 2012. Poly(ADP-Ribose) 1418 Polymerase 1 (PARP-1) Regulates Ribosomal Biogenesis in Drosophila Nucleoli. PLoS 1419 Genet. 8. https://doi.org/10.1371/journal.pgen.1002442 1420 Bohnsack, M.T., Kos, M., Tollervey, D., 2008. Quantitative analysis of snoRNA association with 1421 pre-ribosomes and release of snR30 by Rok1 helicase. EMBO Rep. 9, 1230–1236. 1422 https://doi.org/10.1038/embor.2008.184 1423 Boley, N., Wan, K.H., Bickel, P.J., Celniker, S.E., 2014. Navigating and Mining modENCODE 1424 Data. Methods San Diego Calif 68, 38–47. https://doi.org/10.1016/j.ymeth.2014.03.007 1425 Bousquet-Antonelli, C.C., Vanrobays, E., Gélugne, J.-P., Caizergues-Ferrer, M., Henry, Y., 1426 2000. Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre- 1427 rRNA cleavage at site A2. Rna 6, 826–843. 1428 Bowen, M.E., Attardi, L.D., 2019. The role of p53 in developmental syndromes. J. Mol. Cell Biol. 1429 11, 200–211. https://doi.org/10.1093/jmcb/mjy087 1430 Brooks, S.S., Wall, A.L., Golzio, C., Reid, D.W., Kondyles, A., Willer, J.R., Botti, C., Nicchitta, 1431 C.V., Katsanis, N., Davis, E.E., 2014. A novel ribosomopathy caused by dysfunction of 1432 RPL10 disrupts neurodevelopment and causes X-linked microcephaly in humans. 1433 Genetics 198, 723–33. https://doi.org/10.1534/genetics.114.168211 1434 Burrows, C., Abd Latip, N., Lam, S.-J., Carpenter, L., Sawicka, K., Tzolovsky, G., Gabra, H., 1435 Bushell, M., Glover, D.M., Willis, A.E., Blagden, S.P., 2010. The RNA binding protein 1436 Larp1 regulates cell division, apoptosis and cell migration. Nucleic Acids Res. 38, 5542– 1437 5553. https://doi.org/10.1093/nar/gkq294 1438 Buszczak, M., Paterno, S., Lighthouse, D., Bachman, J., Planck, J., Owen, S., Skora, A.D., 1439 Nystul, T.G., Ohlstein, B., Allen, A., Wilhelm, J.E., Murphy, T.D., Levis, R.W., Matunis, 1440 E., Srivali, N., Hoskins, R.A., Spradling, A.C., 2007. The Carnegie Protein Trap Library: 1441 A Versatile Tool for Drosophila Developmental Studies. Genetics 175, 1505–1531. 1442 https://doi.org/10.1534/genetics.106.065961 1443 Calo, E., Gu, B., Bowen, M.E., Aryan, F., Zalc, A., Liang, J., Flynn, R.A., Swigut, T., Chang, 1444 H.Y., Attardi, L.D., 2018. Tissue-selective effects of nucleolar stress and rDNA damage 1445 in developmental disorders. Nature 554, 112. 1446 Chen, D., McKearin, D.M., 2003. A discrete transcriptional silencer in the bam gene determines 1447 asymmetric division of the Drosophila germline stem cell. Development 130, 1159–1170. 1448 https://doi.org/10.1242/dev.00325 1449 Chen, T., Steensel, B. van, 2017. Comprehensive analysis of nucleocytoplasmic dynamics of 1450 mRNA in Drosophila cells. PLOS Genet. 13, e1006929. 1451 https://doi.org/10.1371/journal.pgen.1006929

49 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1452 Chen, Z.-X., Sturgill, D., Qu, J., Jiang, H., Park, S., Boley, N., Suzuki, A.M., Fletcher, A.R., 1453 Plachetzki, D.C., FitzGerald, P.C., Artieri, C.G., Atallah, J., Barmina, O., Brown, J.B., 1454 Blankenburg, K.P., Clough, E., Dasgupta, A., Gubbala, S., Han, Y., Jayaseelan, J.C., 1455 Kalra, D., Kim, Y.-A., Kovar, C.L., Lee, S.L., Li, M., Malley, J.D., Malone, J.H., Mathew, 1456 T., Mattiuzzo, N.R., Munidasa, M., Muzny, D.M., Ongeri, F., Perales, L., Przytycka, T.M., 1457 Pu, L.-L., Robinson, G., Thornton, R.L., Saada, N., Scherer, S.E., Smith, H.E., Vinson, 1458 C., Warner, C.B., Worley, K.C., Wu, Y.-Q., Zou, X., Cherbas, P., Kellis, M., Eisen, M.B., 1459 Piano, F., Kionte, K., Fitch, D.H., Sternberg, P.W., Cutter, A.D., Duff, M.O., Hoskins, 1460 R.A., Graveley, B.R., Gibbs, R.A., Bickel, P.J., Kopp, A., Carninci, P., Celniker, S.E., 1461 Oliver, B., Richards, S., 2014. Comparative validation of the D. melanogaster 1462 modENCODE transcriptome annotation. Genome Res. 24, 1209–1223. 1463 https://doi.org/10.1101/gr.159384.113 1464 Cheng, Z., Mugler, C.F., Keskin, A., Hodapp, S., Chan, L.Y.-L., Weis, K., Mertins, P., Regev, A., 1465 Jovanovic, M., Brar, G.A., 2019. Small and Large Ribosomal Subunit Deficiencies Lead 1466 to Distinct Gene Expression Signatures that Reflect Cellular Growth Rate. Mol. Cell 73, 1467 36-47.e10. https://doi.org/10.1016/j.molcel.2018.10.032 1468 Corsini, N.S., Peer, A.M., Moeseneder, P., Roiuk, M., Burkard, T.R., Theussl, H.-C., Moll, I., 1469 Knoblich, J.A., 2018. Coordinated Control of mRNA and rRNA Processing Controls 1470 Embryonic Stem Cell Pluripotency and Differentiation. Cell Stem Cell 22, 543-558.e12. 1471 https://doi.org/10.1016/j.stem.2018.03.002 1472 De Cuevas, M., Spradling, A.C., 1998. Morphogenesis of the Drosophila fusome and its 1473 implications for oocyte specification. Development 125, 2781 LP – 2789. 1474 de la Cruz, J., Karbstein, K., Woolford, J.L., 2015. Functions of ribosomal proteins in assembly 1475 of eukaryotic ribosomes in vivo. Annu. Rev. Biochem. 84, 93–129. 1476 https://doi.org/10.1146/annurev-biochem-060614-033917 1477 Decatur, W.A., Fournier, M.J., 2002. rRNA modifications and ribosome function. Trends 1478 Biochem. Sci. 27, 344–351. https://doi.org/10.1016/S0968-0004(02)02109-6 1479 Deisenroth, C., Zhang, Y., 2010. Ribosome biogenesis surveillance: Probing the ribosomal 1480 protein-Mdm2-p53 pathway. Oncogene 29, 4253–4260. 1481 https://doi.org/10.1038/onc.2010.189 1482 DeLuca, S.Z., Spradling, A.C., 2018. Efficient Expression of Genes in the Drosophila Germline 1483 Using a UAS Promoter Free of Interference by Hsp70 piRNAs. Genetics 209, 381–387. 1484 https://doi.org/10.1534/genetics.118.300874 1485 dos Santos, G., Schroeder, A.J., Goodman, J.L., Strelets, V.B., Crosby, M.A., Thurmond, J., 1486 Emmert, D.B., Gelbart, W.M., 2015. FlyBase: introduction of the Drosophila 1487 melanogaster Release 6 reference genome assembly and large-scale migration of 1488 genome annotations. Nucleic Acids Res. 43, D690–D697. 1489 https://doi.org/10.1093/nar/gku1099 1490 Draptchinskaia, N., Gustavsson, P., Andersson, B., Pettersson, M., Willig, T.-N., Dianzani, I., 1491 Ball, S., Tchernia, G., Klar, J., Matsson, H., Tentler, D., Mohandas, N., Carlsson, B., 1492 Dahl, N., 1999. The gene encoding ribosomal protein S19 is mutated in Diamond- 1493 Blackfan anaemia. Nat. Genet. 21, 169–175. https://doi.org/10.1038/5951 1494 Emtenani, S., Martin, E.T., Gyoergy, A., Bicher, J., Genger, J.-W., Hurd, T.R., Köcher, T., 1495 Bergthaler, A., Rangan, P., Siekhaus, D.E., 2021. A genetic program boosts 1496 mitochondrial function to power macrophage tissue invasion. bioRxiv 1497 2021.02.18.431643. https://doi.org/10.1101/2021.02.18.431643 1498 Fan, Y., Lee, T.V., Xu, D., Chen, Z., Lamblin, A.-F., Steller, H., Bergmann, A., 2010. Dual roles 1499 of Drosophila p53 in cell death and cell differentiation. Cell Death Differ. 17, 912–921. 1500 https://doi.org/10.1038/cdd.2009.182 1501 Fichelson, P., Moch, C., Ivanovitch, K., Martin, C., Sidor, C.M., Lepesant, J.-A., Bellaiche, Y., 1502 Huynh, J.-R., 2009. Live-imaging of single stem cells within their niche reveals that a

50 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1503 U3snoRNP component segregates asymmetrically and is required for self-renewal in 1504 Drosophila. Nat. Cell Biol. 11, 685. 1505 Flora, P., Schowalter, S., Wong-Deyrup, S., DeGennaro, M., Nasrallah, M.A., Rangan, P., 1506 2018a. Transient transcriptional silencing alters the cell cycle to promote germline stem 1507 cell differentiation in Drosophila. Dev. Biol. 434, 84–95. 1508 https://doi.org/10.1016/j.ydbio.2017.11.014 1509 Flora, P., Wong-Deyrup, S.W., Martin, E.T., Palumbo, R.J., Nasrallah, M., Oligney, A., Blatt, P., 1510 Patel, D., Fuchs, G., Rangan, P., 2018b. Sequential Regulation of Maternal mRNAs 1511 through a Conserved cis-Acting Element in Their 3’ UTRs. Cell Rep. 25, 3828-3843.e9. 1512 https://doi.org/10.1016/j.celrep.2018.12.007 1513 Fonseca, B.D., Jia, J.-J., Hollensen, A.K., Pointet, R., Hoang, H.-D., Niklaus, M.R., Pena, I.A., 1514 Lahr, R.M., Smith, E.M., Hearnden, J., Wang, X.-D., Yang, A.-D., Celucci, G., Graber, 1515 T.E., Dajadian, C., Yu, Y., Damgaard, C.K., Berman, A.J., Alain, T., 2018. LARP1 is a 1516 major phosphorylation substrate of mTORC1 (preprint). Biochemistry. 1517 Fonseca, B.D., Zakaria, C., Jia, J.-J., Graber, T.E., Svitkin, Y., Tahmasebi, S., Healy, D., 1518 Hoang, H.-D., Jensen, J.M., Diao, I.T., 2015. La-related protein 1 (LARP1) represses 1519 terminal oligopyrimidine (TOP) mRNA translation downstream of mTOR complex 1 1520 (mTORC1). J. Biol. Chem. 290, 15996–16020. 1521 Fortier, S., MacRae, T., Bilodeau, M., Sargeant, T., Sauvageau, G., 2015. Haploinsufficiency 1522 screen highlights two distinct groups of ribosomal protein genes essential for embryonic 1523 stem cell fate. Proc. Natl. Acad. Sci. 112, 2127–2132. 1524 https://doi.org/10.1073/pnas.1418845112 1525 Fuchs, G., Diges, C., Kohlstaedt, L.A., Wehner, K.A., Sarnow, P., 2011. Proteomic Analysis of 1526 Ribosomes: Translational Control of mRNA Populations by Glycogen Synthase GYS1. J. 1527 Mol. Biol. 410, 118–130. https://doi.org/10.1016/J.JMB.2011.04.064 1528 Gabut, M., Bourdelais, F., Durand, S., 2020. Ribosome and Translational Control in Stem Cells. 1529 Cells 9, 497. https://doi.org/10.3390/cells9020497 1530 Gentilella, A., Morón-Duran, F.D., Fuentes, P., Zweig-Rocha, G., Riaño-Canalias, F., Pelletier, 1531 J., Ruiz, M., Turón, G., Castaño, J., Tauler, A., Bueno, C., Menéndez, P., Kozma, S.C., 1532 Thomas, G., 2017. Autogenous Control of 5′TOP mRNA Stability by 40S Ribosomes. 1533 Mol. Cell 67, 55-70.e4. https://doi.org/10.1016/j.molcel.2017.06.005 1534 Gilboa, L., Forbes, A., Tazuke, S.I., Fuller, M.T., Lehmann, R., 2003. Germ line stem cell 1535 differentiation in Drosophila requires gap junctions and proceeds via an intermediate 1536 state. Development 130, 6625–6634. https://doi.org/10.1242/dev.00853 1537 Glotzer, M., Murray, A.W., Kirschner, M.W., 1991. Cyclin is degraded by the ubiquitin pathway. 1538 Nature 349, 132–138. https://doi.org/10.1038/349132a0 1539 Grandori, C., Gomez-Roman, N., Felton-Edkins, Z.A., Ngouenet, C., Galloway, D.A., Eisenman, 1540 R.N., White, R.J., 2005. c-Myc binds to human ribosomal DNA and stimulates 1541 transcription of rRNA genes by RNA polymerase I. Nat. Cell Biol. 7, 311–318. 1542 https://doi.org/10.1038/ncb1224 1543 Granneman, S., Bernstein, K.A., Bleichert, F., Baserga, S.J., 2006. Comprehensive Mutational 1544 Analysis of Yeast DEXD/H Box RNA Helicases Required for Small Ribosomal Subunit 1545 Synthesis Downloaded from. Mol. Cell. Biol. 26, 1183–1194. 1546 https://doi.org/10.1128/MCB.26.4.1183-1194.2006 1547 Granneman, S., Petfalski, E., Tollervey, D., Hurt, E.C., 2011. A cluster of ribosome synthesis 1548 factors regulate pre-rRNA folding and 5.8S rRNA maturation by the Rat1 exonuclease. 1549 EMBO J. 30, 4006–19. https://doi.org/10.1038/emboj.2011.256 1550 Guillerez, J., Lopez, P.J., Proux, F., Launay, H., Dreyfus, M., 2005. A mutation in T7 RNA 1551 polymerase that facilitates promoter clearance. Proc. Natl. Acad. Sci. 102, 5958–5963. 1552 https://doi.org/10.1073/pnas.0407141102

51 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1553 Heinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y.C., Laslo, P., Cheng, J.X., Murre, C., 1554 Singh, H., Glass, C.K., 2010. Simple combinations of lineage-determining transcription 1555 factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. 1556 Cell 38, 576–589. https://doi.org/10.1016/j.molcel.2010.05.004 1557 Hendrix, N.W., Clemens, M., Canavan, T.P., Surti, U., Rajkovic, A., 2012. Prenatally Diagnosed 1558 17q12 Microdeletion Syndrome with a Novel Association with Congenital Diaphragmatic 1559 Hernia. Fetal Diagn. Ther. 31, 129–133. https://doi.org/10.1159/000332968 1560 Henras, A.K., Soudet, J., Gérus, M., Lebaron, S., Caizergues-Ferrer, M., Mougin, A., Henry, Y., 1561 2008. The post-transcriptional steps of eukaryotic ribosome biogenesis. Cell. Mol. Life 1562 Sci. 65, 2334–2359. https://doi.org/10.1007/s00018-008-8027-0 1563 Higa-Nakamine, S., Suzuki, T.T., Uechi, T., Chakraborty, A., Nakajima, Y., Nakamura, M., 1564 Hirano, N., Suzuki, T.T., Kenmochi, N., 2012. Loss of ribosomal RNA modification 1565 causes developmental defects in zebrafish. Nucleic Acids Res. 40, 391–398. 1566 https://doi.org/10.1093/nar/gkr700 1567 Hinnant, T.D., Alvarez, A.A., Ables, E.T., 2017. Temporal remodeling of the cell cycle 1568 accompanies differentiation in the Drosophila germline. Dev. Biol. 429, 118–131. 1569 https://doi.org/10.1016/j.ydbio.2017.07.001 1570 Hong, S., Freeberg, M.A., Han, T., Kamath, A., Yao, Y., Fukuda, T., Suzuki, T., Kim, J.K., Inoki, 1571 K., 2017. LARP1 functions as a molecular switch for mTORC1-mediated translation of 1572 an essential class of mRNAs. Elife 6, e25237. 1573 Hong, S., Mannan, A.M., Inoki, K., 2012. Evaluation of the Nutrient-Sensing mTOR Pathway, in: 1574 Weichhart, T. (Ed.), MTOR: Methods and Protocols, Methods in Molecular Biology. 1575 Humana Press, Totowa, NJ, pp. 29–44. 1576 Hornstein, E., Tang, H., Meyuhas, O., 2001. Mitogenic and nutritional signals are transduced 1577 into translational efficiency of TOP mRNAs, in: Cold Spring Harbor Symposia on 1578 Quantitative Biology. Cold Spring Harbor Laboratory Press, pp. 477–484. 1579 Hsu, H.-J., LaFever, L., Drummond-Barbosa, D., 2008. Diet controls normal and tumorous 1580 germline stem cells via insulin-dependent and -independent mechanisms in Drosophila. 1581 Dev. Biol. 313, 700–712. https://doi.org/10.1016/j.ydbio.2007.11.006 1582 Hu, Y., Flockhart, I., Vinayagam, A., Bergwitz, C., Berger, B., Perrimon, N., Mohr, S.E., 2011. 1583 An integrative approach to ortholog prediction for disease-focused and other functional 1584 studies. BMC Bioinformatics 12, 357. https://doi.org/10.1186/1471-2105-12-357 1585 Iadevaia, V., Liu, R., Proud, C.G., 2014. mTORC1 signaling controls multiple steps in ribosome 1586 biogenesis. Semin. Cell Dev. Biol., Development of the urogenital system & mTOR 1587 Signalling & Tight Junctions in Health and Disease 36, 113–120. 1588 https://doi.org/10.1016/j.semcdb.2014.08.004 1589 Ichihara, K., Shimizu, H., Taguchi, O., Yamaguchi, M., Inoue, Y.H., 2007. A Drosophila 1590 orthologue of larp protein family is required for multiple processes in male meiosis. Cell 1591 Struct. Funct. 710190003. 1592 Jefferies, H.B.J., Fumagalli, S., Dennis, P.B., Reinhard, C., Pearson, R.B., Thomas, G., 1997. 1593 Rapamycin suppresses 5′TOP mRNA translation through inhibition of p70s6k. EMBO J. 1594 16, 3693–3704. https://doi.org/10.1093/emboj/16.12.3693 1595 Jia, J.-J., Lahr, R.M., Solgaard, M.T., Moraes, B.J., Pointet, R., Yang, A.-D., Celucci, G., 1596 Graber, T.E., Hoang, H.-D., Niklaus, M.R., Pena, I.A., Hollensen, A.K., Smith, E.M., 1597 Chaker-Margot, M., Anton, L., Dajadian, C., Livingstone, M., Hearnden, J., Wang, X.-D., 1598 Yu, Y., Maier, T., Damgaard, C.K., Berman, A.J., Alain, T., Fonseca, B.D., 2021. 1599 mTORC1 promotes TOP mRNA translation through site-specific phosphorylation of 1600 LARP1. Nucleic Acids Res. https://doi.org/10.1093/nar/gkaa1239 1601 Jones, N.C., Lynn, M.L., Gaudenz, K., Sakai, D., Aoto, K., Rey, J.-P., Glynn, E.F., Ellington, L., 1602 Du, C., Dixon, J., Dixon, M.J., Trainor, P.A., 2008. Prevention of the neurocristopathy

52 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1603 Treacher Collins syndrome through inhibition of p53 function. Nat. Med. 14, 125–133. 1604 https://doi.org/10.1038/nm1725 1605 Kai, T., Spradling, A., 2003. An empty Drosophila stem cell niche reactivates the proliferation of 1606 ectopic cells. 1607 Kai, T., Williams, D., Spradling, A.C., 2005. The expression profile of purified Drosophila 1608 germline stem cells. Dev. Biol. 283, 486–502. 1609 Karpen, G.H., Schaefer, J.E., Laird, C.D., 1988. A Drosophila rRNA gene located in 1610 euchromatin is active in transcription and nucleolus formation. Genes Dev. 2, 1745– 1611 1763. 1612 Khajuria, R.K., Munschauer, M., Ulirsch, J.C., Fiorini, C., Ludwig, L.S., McFarland, S.K., 1613 Abdulhay, N.J., Specht, H., Keshishian, H., Mani, D.R.R., Jovanovic, M., Ellis, S.R., 1614 Fulco, C.P., Engreitz, J.M., Schütz, S., Lian, J., Gripp, K.W., Weinberg, O.K., Pinkus, 1615 G.S., Gehrke, L., Regev, A., Lander, E.S., Gazda, H.T., Lee, W.Y., Panse, V.G., Carr, 1616 S.A., Sankaran, V.G., 2018. Ribosome levels selectively regulate translation and lineage 1617 commitment in human hematopoiesis. Cell 173, 90–103. 1618 https://doi.org/10.1016/J.CELL.2018.02.036 1619 Khoshnevis, S., Askenasy, I., Johnson, M.C., Dattolo, M.D., Young-Erdos, C.L., Stroupe, M.E., 1620 Karbstein, K., 2016. The DEAD-box Protein Rok1 Orchestrates 40S and 60S Ribosome 1621 Assembly by Promoting the Release of Rrp5 from Pre-40S Ribosomes to Allow for 60S 1622 Maturation. PLOS Biol. 14, e1002480. https://doi.org/10.1371/journal.pbio.1002480 1623 Kim, E., Goraksha-Hicks, P., Li, L., Neufeld, T.P., Guan, K.-L., 2008. Regulation of TORC1 by 1624 Rag GTPases in nutrient response. Nat. Cell Biol. 10, 935. 1625 Kim, W., Jang, Y.-G., Yang, J., Chung, J., 2017. Spatial Activation of TORC1 Is Regulated by 1626 Hedgehog and E2F1 Signaling in the Drosophila Eye. Dev. Cell 42, 363-375.e4. 1627 https://doi.org/10.1016/j.devcel.2017.07.020 1628 Kimball, S.R., 2002. Regulation of Global and Specific mRNA Translation by Amino Acids. J. 1629 Nutr. 132, 883–886. https://doi.org/10.1093/jn/132.5.883 1630 Koš, M., Tollervey, D., 2010. Yeast pre-rRNA processing and modification occur 1631 cotranscriptionally. Mol. Cell 37, 809–820. 1632 Lahr, R.M., Fonseca, B.D., Ciotti, G.E., Al-Ashtal, H.A., Jia, J.-J., Niklaus, M.R., Blagden, S.P., 1633 Alain, T., Berman, A.J., 2017. La-related protein 1 (LARP1) binds the mRNA cap, 1634 blocking eIF4F assembly on TOP mRNAs. Elife 6, e24146. 1635 Lahr, R.M., Mack, S.M., Héroux, A., Blagden, S.P., Bousquet-Antonelli, C., Deragon, J.-M., 1636 Berman, A.J., 2015. The La-related protein 1-specific domain repurposes HEAT-like 1637 repeats to directly bind a 5′TOP sequence. Nucleic Acids Res. 43, 8077–8088. 1638 https://doi.org/10.1093/nar/gkv748 1639 Li, L., Pang, X., Zhu, Z., Lu, L., Yang, J., Cao, J., Fei, S., 2018. GTPBP4 Promotes Gastric 1640 Cancer Progression via Regulating P53 Activity. Cell. Physiol. Biochem. 45, 667–676. 1641 Lipton, J.M., Kudisch, M., Gross, R., Nathan, D.G., 1986. Defective Erythroid Progenitor 1642 Differentiation System in Congenital Hypoplastic (Diamond-Blackfan) Anemia. Blood 67, 1643 962–968. https://doi.org/10.1182/blood.V67.4.962.962 1644 Loewith, R., Hall, M.N., 2011. Target of Rapamycin (TOR) in Nutrient Signaling and Growth 1645 Control. Genetics 189, 1177–1201. https://doi.org/10.1534/genetics.111.133363 1646 Lu, W.-J., Chapo, J., Roig, I., Abrams, J.M., 2010. Meiotic Recombination Provokes Functional 1647 Activation of the p53 Regulatory Network. Science 328, 1278–1281. 1648 https://doi.org/10.1126/science.1185640 1649 Lunardi, A., Di Minin, G., Provero, P., Dal Ferro, M., Carotti, M., Del Sal, G., Collavin, L., 2010. 1650 A genome-scale protein interaction profile of Drosophila p53 uncovers additional nodes 1651 of the human p53 network. Proc. Natl. Acad. Sci. 107, 6322–6327.

53 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1652 Ma, X., Han, Y., Song, X., Do, T., Yang, Z., Ni, J., Xie, T., 2016. DNA damage-induced 1653 Lok/CHK2 activation compromises germline stem cell self-renewal and lineage 1654 differentiation. Development 143, 4312–4323. https://doi.org/10.1242/dev.141069 1655 Martin, R., Hackert, P., Ruprecht, M., Simm, S., Brüning, L., Mirus, O., Sloan, K.E., Kudla, G., 1656 Schleiff, E., Bohnsack, M.T., 2014. A pre-ribosomal RNA interaction network involving 1657 snoRNAs and the Rok1 helicase. RNA 20, 1173–1182. 1658 https://doi.org/10.1261/rna.044669.114 1659 Mathieu, J., Cauvin, C., Moch, C., Radford, S.J.J., Sampaio, P., Perdigoto, C.N., Schweisguth, 1660 F., Bardin, A.J., Sunkel, C.E., McKim, K., Echard, A., Huynh, J.-R., 2013. Aurora B and 1661 cyclin B have opposite effects on the timing of cytokinesis abscission in Drosophila germ 1662 cells and in vertebrate somatic cells. Dev. Cell 26, 250–265. 1663 https://doi.org/10.1016/J.DEVCEL.2013.07.005 1664 Matias, N.R., Mathieu, J., Huynh, J.-R., 2015. Abscission is regulated by the ESCRT-III protein 1665 shrub in Drosophila germline stem cells. PLoS Genet. 11, e1004653. 1666 https://doi.org/10.1371/journal.pgen.1004653 1667 Mayer, C., Grummt, I., 2006. Ribosome biogenesis and cell growth: mTOR coordinates 1668 transcription by all three classes of nuclear RNA polymerases. Oncogene 25, 6384. 1669 McCarthy, A., Deiulio, A., Martin, E.T., Upadhyay, M., Rangan, P., 2018. Tip60 complex 1670 promotes expression of a differentiation factor to regulate germline differentiation in 1671 female Drosophila. Mol. Biol. Cell 29, 2933–2945. https://doi.org/10.1091/mbc.E18-06- 1672 0385 1673 McCarthy, A., Sarkar, K., Martin, E.T., Upadhyay, M., James, J.R., Lin, J.M., Jang, S., Williams, 1674 N.D., Forni, P.E., Buszczak, M., Rangan, P., 2019. MSL3 coordinates a transcriptional 1675 and translational meiotic program in female Drosophila. bioRxiv 2019.12.18.879874. 1676 https://doi.org/10.1101/2019.12.18.879874 1677 McGowan, K.A., Pang, W.W., Bhardwaj, R., Perez, M.G., Pluvinage, J.V., Glader, B.E., Malek, 1678 R., Mendrysa, S.M., Weissman, I.L., Park, C.Y., Barsh, G.S., 2011. Reduced ribosomal 1679 protein gene dosage and p53 activation in low-risk myelodysplastic syndrome. Blood 1680 118, 3622–3633. https://doi.org/10.1182/blood-2010-11-318584 1681 McKearin, D., Ohlstein, B., 1995. A role for the Drosophila bag-of-marbles protein in the 1682 differentiation of cystoblasts from germline stem cells. Development 121, 2937 LP – 1683 2947. 1684 McKearin, D.M., Spradling, A.C., 1990. bag-of-marbles: a Drosophila gene required to initiate 1685 both male and female gametogenesis. Genes Dev. 4, 2242–2251. 1686 https://doi.org/10.1101/gad.4.12b.2242 1687 Meyuhas, O., 2000. Synthesis of the translational apparatus is regulated at the translational 1688 level. Eur. J. Biochem. 267, 6321–6330. https://doi.org/10.1046/j.1432- 1689 1327.2000.01719.x 1690 Meyuhas, O., Kahan, T., 2015. The race to decipher the top secrets of TOP mRNAs. Biochim. 1691 Biophys. Acta BBA - Gene Regul. Mech. 1849, 801–811. 1692 https://doi.org/10.1016/j.bbagrm.2014.08.015 1693 Mills, E.W., Green, R., 2017. Ribosomopathies: There’s strength in numbers. Science 358, 1694 eaan2755. https://doi.org/10.1126/science.aan2755 1695 Moon, S., Cassani, M., Lin, Y.A., Wang, L., Dou, K., Zhang, Z.Z.Z., 2018. A Robust 1696 Transposon-Endogenizing Response from Germline Stem Cells. Dev. Cell 47, 660–671. 1697 Nerurkar, P., Altvater, M., Gerhardy, S., Schütz, S., Fischer, U., Weirich, C., Panse, V.G., 2015. 1698 Eukaryotic ribosome assembly and nuclear export. Int. Rev. Cell Mol. Biol. 319, 107–40. 1699 https://doi.org/10.1016/bs.ircmb.2015.07.002 1700 Neumüller, R.A., Betschinger, J., Fischer, A., Bushati, N., Poernbacher, I., Mechtler, K., Cohen, 1701 S.M., Knoblich, J.A., 2008. Mei-P26 regulates microRNAs and cell growth in the

54 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1702 Drosophila ovarian stem cell lineage. Nature 454, 241–5. 1703 https://doi.org/10.1038/nature07014 1704 O ’day, C.L., Chavanikamannil, F., Abelson, J., 1996. 18S rRNA processing requires the RNA 1705 helicase-like protein Rrp3. Nucleic Acids Res. 24. 1706 Ochs, R.L., Lischwe, M.A., Spohn, W.H., Busch, H., 1985. Fibrillarin: a new protein of the 1707 nucleolus identified by autoimmune sera. Biol. Cell 54, 123–133. 1708 https://doi.org/10.1111/j.1768-322X.1985.tb00387.x 1709 Ogami, K., Oishi, Y., Nogimori, T., Sakamoto, K., Hoshino, S., 2020. LARP1 facilitates 1710 translational recovery after amino acid refeeding by preserving long poly(A)-tailed TOP 1711 mRNAs. bioRxiv 716217. https://doi.org/10.1101/716217 1712 Ohlstein, B., McKearin, D., 1997. Ectopic expression of the Drosophila Bam protein eliminates 1713 oogenic germline stem cells. Development 124, 3651–3662. 1714 Õunap, K., Käsper, L., Kurg, A., Kurg, R., 2013. The Human WBSCR22 Protein Is Involved in 1715 the Biogenesis of the 40S Ribosomal Subunits in Mammalian Cells. PLoS ONE 8. 1716 https://doi.org/10.1371/journal.pone.0075686 1717 Pagès, H., Aboyoun, P., Gentleman, R., DebRoy, S., 2019. Biostrings: Efficient manipulation of 1718 biological strings. 1719 Pallares-Cartes, C., Cakan-Akdogan, G., Teleman, A.A., 2012. Tissue-specific coupling 1720 between insulin/IGF and TORC1 signaling via PRAS40 in Drosophila. Dev. Cell 22, 172– 1721 182. 1722 Pereboom, T.C., van Weele, L.J., Bondt, A., MacInnes, A.W., 2011. A zebrafish model of 1723 dyskeratosis congenita reveals hematopoietic stem cell formation failure resulting from 1724 ribosomal protein-mediated p53 stabilization. Blood 118, 5458–5465. 1725 Philippe, L., van den Elzen, A.M.G., Watson, M.J., Thoreen, C.C., 2020. Global analysis of 1726 LARP1 translation targets reveals tunable and dynamic features of 5′ TOP motifs. Proc. 1727 Natl. Acad. Sci. 117, 5319–5328. https://doi.org/10.1073/pnas.1912864117 1728 Philippe, L., Vasseur, J.-J., Debart, F., Thoreen, C.C., 2018. La-related protein 1 (LARP1) 1729 repression of TOP mRNA translation is mediated through its cap-binding domain and 1730 controlled by an adjacent regulatory region. Nucleic Acids Res. 46, 1457–1469. 1731 https://doi.org/10.1093/nar/gkx1237 1732 Powers, T., Walter, P., 1999. Regulation of ribosome biogenesis by the rapamycin-sensitive 1733 TOR-signaling pathway in Saccharomyces cerevisiae. Mol. Biol. Cell 10, 987–1000. 1734 Qiao, H., Li, Y., Feng, C., Duo, S., Ji, F., Jiao, J., 2018. Nap1l1 Controls Embryonic Neural 1735 Progenitor Cell Proliferation and Differentiation in the Developing Brain. Cell Rep. 22, 1736 2279–2293. https://doi.org/10.1016/j.celrep.2018.02.019 1737 Qin, X., Ahn, S., Speed, T.P., Rubin, G.M., 2007. Global analyses of mRNA translational control 1738 during early Drosophila embryogenesis. Genome Biol. 8, R63. 1739 https://doi.org/10.1186/gb-2007-8-4-r63 1740 Rørth, P., 1998. Gal4 in the Drosophila female germline. Mech. Dev. 78, 113–118. 1741 https://doi.org/10.1016/S0925-4773(98)00157-9 1742 Sanchez, C.G., Teixeira, F.K., Czech, B., Preall, J.B., Zamparini, A.L., Seifert, J.R.K., Malone, 1743 C.D., Hannon, G.J., Lehmann, R., 2016. Regulation of ribosome biogenesis and protein 1744 synthesis controls germline stem cell differentiation. Cell Stem Cell 18, 276–290. 1745 https://doi.org/10.1016/J.STEM.2015.11.004 1746 Sarov, M., Barz, C., Jambor, H., Hein, M.Y., Schmied, C., Suchold, D., Stender, B., Janosch, S., 1747 KJ, V.V., Krishnan, R., Krishnamoorthy, A., Ferreira, I.R., Ejsmont, R.K., Finkl, K., 1748 Hasse, S., Kämpfer, P., Plewka, N., Vinis, E., Schloissnig, S., Knust, E., Hartenstein, V., 1749 Mann, M., Ramaswami, M., VijayRaghavan, K., Tomancak, P., Schnorrer, F., 2016. A 1750 genome-wide resource for the analysis of protein localisation in Drosophila. eLife 5, 1751 e12068. https://doi.org/10.7554/eLife.12068

55 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1752 Sekiguchi, T., Hayano, T., Yanagida, M., Takahashi, N., Nishimoto, T., 2006. NOP132 is 1753 required for proper nucleolus localization of DEAD-box RNA helicase DDX47. Nucleic 1754 Acids Res. 34, 4593–4608. https://doi.org/10.1093/nar/gkl603 1755 Senturk, E., Manfredi, J.J., 2013. p53 and Cell Cycle Effects After DNA Damage. Methods Mol. 1756 Biol. Clifton NJ 962, 49–61. https://doi.org/10.1007/978-1-62703-236-0_4 1757 Serano, T.L., Cheung, H.-K., Frank, L.H., Cohen, R.S., 1994. P element transformation vectors 1758 for studying Drosophila melanogaster oogenesis and early embryogenesis. Gene 138, 1759 181–186. https://doi.org/10.1016/0378-1119(94)90804-4 1760 Sezgin, M., Sankur, B., 2004. Survey over image thresholding techniques and quantitative 1761 performance evaluation. J. Electron. Imaging 13, 146–166. 1762 Shu, X.E., Swanda, R.V., Qian, S.-B., 2020. Nutrient Control of mRNA Translation. Annu. Rev. 1763 Nutr. 40, 51–75. https://doi.org/10.1146/annurev-nutr-120919-041411 1764 Sloan, K.E., Warda, A.S., Sharma, S., Entian, K.D., Lafontaine, D.L.J., Bohnsack, M.T., 2017. 1765 Tuning the ribosome: The influence of rRNA modification on eukaryotic ribosome 1766 biogenesis and function. RNA Biol. 14, 1138–1152. 1767 https://doi.org/10.1080/15476286.2016.1259781 1768 Studier, F.W., 2005. Protein production by auto-induction in high-density shaking cultures. 1769 Protein Expr. Purif. 41, 207–234. https://doi.org/10.1016/j.pep.2005.01.016 1770 Tafforeau, L., Zorbas, C., Langhendries, J.-L., Mullineux, S.-T., Stamatopoulou, V., Mullier, R., 1771 Wacheul, L., Lafontaine, D.L.J., 2013. The Complexity of Human Ribosome Biogenesis 1772 Revealed by Systematic Nucleolar Screening of Pre-rRNA Processing Factors. Mol. Cell 1773 51, 539–551. https://doi.org/10.1016/J.MOLCEL.2013.08.011 1774 Tanentzapf, G., Devenport, D., Godt, D., Brown, N.H., 2007. Integrin-dependent anchoring of a 1775 stem-cell niche. Nat. Cell Biol. 9, 1413–1418. https://doi.org/10.1038/ncb1660 1776 Tang, H., Hornstein, E., Stolovich, M., Levy, G., Livingstone, M., Templeton, D., Avruch, J., 1777 Meyuhas, O., 2001. Amino Acid-Induced Translation of TOP mRNAs Is Fully Dependent 1778 on Phosphatidylinositol 3-Kinase-Mediated Signaling, Is Partially Inhibited by 1779 Rapamycin, and Is Independent of S6K1 and rpS6 Phosphorylation. Mol. Cell. Biol. 21, 1780 8671–8683. https://doi.org/10.1128/MCB.21.24.8671-8683.2001 1781 Tasnim, S., Kelleher, E.S., 2018. p53 is required for female germline stem cell maintenance in 1782 P-element hybrid dysgenesis. Dev. Biol. 434, 215–220. 1783 Tcherkezian, J., Cargnello, M., Romeo, Y., Huttlin, E.L., Lavoie, G., Gygi, S.P., Roux, P.P., 1784 2014. Proteomic analysis of cap-dependent translation identifies LARP1 as a key 1785 regulator of 5′TOP mRNA translation. Genes Dev. 28, 357–371. 1786 https://doi.org/10.1101/gad.231407.113 1787 Thomas, P.D., Campbell, M.J., Kejariwal, A., Mi, H., Karlak, B., Daverman, R., Diemer, K., 1788 Muruganujan, A., Narechania, A., 2003. PANTHER: A Library of Protein Families and 1789 Subfamilies Indexed by Function. Genome Res. 13, 2129–2141. 1790 https://doi.org/10.1101/gr.772403 1791 Thoreen, C.C., Chantranupong, L., Keys, H.R., Wang, T., Gray, N.S., Sabatini, D.M., 2012. A 1792 unifying model for mTORC1-mediated regulation of mRNA translation. Nature 485, 109– 1793 113. https://doi.org/10.1038/nature11083 1794 Twombly, V., Blackman, R.K., Jin, H., Graff, J.M., Padgett, R.W., Gelbart, W.M., 1996. The 1795 TGF-beta signaling pathway is essential for Drosophila oogenesis. Development 122, 1796 1555 LP – 1565. 1797 Tye, B.W., Commins, N., Ryazanova, L.V., Wühr, M., Springer, M., Pincus, D., Churchman, 1798 L.S., 2019. Proteotoxicity from aberrant ribosome biogenesis compromises cell fitness. 1799 eLife 8, e43002. https://doi.org/10.7554/eLife.43002 1800 Upadhyay, M., Martino Cortez, Y., Wong-Deyrup, S., Tavares, L., Schowalter, S., Flora, P., Hill, 1801 C., Nasrallah, M.A., Chittur, S., Rangan, P., 2016. Transposon Dysregulation Modulates

56 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1802 dWnt4 Signaling to Control Germline Stem Cell Differentiation in Drosophila. PLOS 1803 Genet. 12, e1005918. https://doi.org/10.1371/journal.pgen.1005918 1804 Valdez, B.C., Henning, D., So, R.B., Dixon, J., Dixon, M.J., 2004. The Treacher Collins 1805 syndrome (TCOF1) gene product is involved in ribosomal DNA gene transcription by 1806 interacting with upstream binding factor. Proc. Natl. Acad. Sci. 101, 10709–10714. 1807 https://doi.org/10.1073/pnas.0402492101 1808 Venema, J., Cile Bousquet-Antonelli, C., Gelugne, J.-P., Le Caizergues-Ferrer, M., Tollervey, 1809 D., 1997. Rok1p Is a Putative RNA Helicase Required for rRNA Processing 17, 3398– 1810 3407. 1811 Venema, J., Tollervey, D., 1995. Processing of pre-ribosomal RNA inSaccharomyces 1812 cerevisiae. Yeast 11, 1629–1650. https://doi.org/10.1002/yea.320111607 1813 Vincent, N.G., Charette, J.M., Baserga, S.J., 2017. The SSU processome interactome in 1814 Saccharomyces cerevisiae reveals potential new protein subcomplexes. RNA 1815 rna.062927.117. https://doi.org/10.1261/rna.062927.117 1816 Warren, A.J., 2018. Molecular basis of the human ribosomopathy Shwachman-Diamond 1817 syndrome. Adv. Biol. Regul. 67, 109–127. https://doi.org/10.1016/j.jbior.2017.09.002 1818 Watanabe-Susaki, K., Takada, H., Enomoto, K., Miwata, K., Ishimine, H., Intoh, A., Ohtaka, M., 1819 Nakanishi, M., Sugino, H., Asashima, M., 2014. Biosynthesis of ribosomal RNA in 1820 nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells. Stem 1821 Cells 32, 3099–3111. 1822 Watkins, N.J., Bohnsack, M.T., 2012. The box C/D and H/ACA snoRNPs: Key players in the 1823 modification, processing and the dynamic folding of ribosomal RNA. Wiley Interdiscip. 1824 Rev. RNA 3, 397–414. https://doi.org/10.1002/wrna.117 1825 Wei, Y., Reveal, B., Reich, J., Laursen, W.J., Senger, S., Akbar, T., Iida-Jones, T., Cai, W., 1826 Jarnik, M., Lilly, M.A., 2014. TORC1 regulators Iml1/GATOR1 and GATOR2 control 1827 meiotic entry and oocyte development in Drosophila. Proc. Natl. Acad. Sci. 111, E5670– 1828 E5677. 1829 Woolnough, J.L., Atwood, B.L., Liu, Z., Zhao, R., Giles, K.E., 2016. The Regulation of rRNA 1830 Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells. 1831 PLOS ONE 11, e0157276. https://doi.org/10.1371/journal.pone.0157276 1832 Xie, T., 2000. A Niche Maintaining Germ Line Stem Cells in the Drosophila Ovary. Science 290, 1833 328–330. https://doi.org/10.1126/science.290.5490.328 1834 Xie, T., Li, L., 2007. Stem cells and their niche: an inseparable relationship. Development 134, 1835 2001 LP – 2006. https://doi.org/10.1242/dev.002022 1836 Xie, T., Spradling, A.C., 1998. decapentaplegic Is Essential for the Maintenance and Division of 1837 Germline Stem Cells in the Drosophila Ovary. Cell 94, 251–260. 1838 https://doi.org/10.1016/S0092-8674(00)81424-5 1839 Yelick, P.C., Trainor, P.A., 2015. Ribosomopathies: Global process, tissue specific defects. 1840 Rare Dis. 3, e1025185. https://doi.org/10.1080/21675511.2015.1025185 1841 Yu, H., Jin, S., Zhang, N., Xu, Q., 2016. Up-regulation of GTPBP4 in colorectal carcinoma is 1842 responsible for tumor metastasis. Biochem. Biophys. Res. Commun. 480, 48–54. 1843 https://doi.org/10.1016/j.bbrc.2016.10.010 1844 Zahradkal, P., Larson, DawnE., Sells, BruceH., 1991. Regulation of ribosome biogenesis in 1845 differentiated rat myotubes. Mol. Cell. Biochem. 104. 1846 https://doi.org/10.1007/BF00229819 1847 Zemp, I., Kutay, U., 2007. Nuclear export and cytoplasmic maturation of ribosomal subunits. 1848 FEBS Lett. 581, 2783–2793. 1849 Zhang, Q., Shalaby, N.A., Buszczak, M., 2014. Changes in rRNA transcription influence 1850 proliferation and cell fate within a stem cell lineage. Science 343, 298–301.

57 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1851 Zhang, Y., Forys, J.T., Miceli, A.P., Gwinn, A.S., Weber, J.D., 2011. Identification of DHX33 as 1852 a Mediator of rRNA Synthesis and Cell Growth. Mol. Cell. Biol. 31, 4676–4691. 1853 https://doi.org/10.1128/MCB.05832-11 1854 Zhang, Y., Lu, H., 2009. Signaling to p53: Ribosomal Proteins Find Their Way. Cancer Cell 16, 1855 369–377. https://doi.org/10.1016/j.ccr.2009.09.024 1856 Zhou, R., Mohr, S., Hannon, G.J., Perrimon, N., 2013. Inducing RNAi in Drosophila Cells by 1857 Transfection with dsRNA. Cold Spring Harb. Protoc. 2013, pdb.prot074351- 1858 pdb.prot074351. https://doi.org/10.1101/pdb.prot074351 1859 Zielke, N., Korzelius, J., van Straaten, M., Bender, K., Schuhknecht, G.F.P., Dutta, D., Xiang, J., 1860 Edgar, B.A., 2014. Fly-FUCCI: A versatile tool for studying cell proliferation in complex 1861 tissues. Cell Rep. 7, 588–598. 1862

58