DOCSLIB.ORG

A Translation Control Module Coordinates Germline Stem Cell Differentiation with 2 Ribosome Biogenesis During Drosophila Oogenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Translation Control Module Coordinates Germline Stem Cell Differentiation with 2 Ribosome Biogenesis During Drosophila Oogenesis bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 A translation control module coordinates germline stem cell differentiation with 2 ribosome biogenesis during Drosophila oogenesis 3 Elliot T. Martin1*, Patrick Blatt1*, Elaine Ngyuen2, Roni Lahr2, Sangeetha Selvam1, Hyun Ah M. 4 Yoon1,3, Tyler Pocchiari1,4, Shamsi Emtenani5, Daria E. Siekhaus5, Andrea Berman2, Gabriele 5 Fuchs1† and Prashanth Rangan1† 6 1Department of Biological Sciences/RNA Institute, University at Albany SUNY, Albany, NY 7 12202 8 2Department of Biological Sciences, University of Pittsburgh, Pittsburgh, PA 15260 9 3Albany Medical College, Albany, NY 12208 10 4SUNY Upstate Medical University, Syracuse, NY 13210-2375 11 5Institute of Science and Technology Austria, Klosterneuburg, Austria 12 *These authors contributed equally to this work 13 †Co-corresponding authors 14 Email: [email protected], [email protected] 15 Summary: Ribosomal defects perturb stem cell differentiation, causing diseases called 16 ribosomopathies. How ribosome levels control stem cell differentiation is not fully known. Here, 17 we discovered three RNA helicases are required for ribosome biogenesis and for Drosophila 18 oogenesis. Loss of these helicases, which we named Aramis, Athos and Porthos, lead to aberrant 19 stabilization of p53, cell cycle arrest and stalled GSC differentiation. Unexpectedly, Aramis is 20 required for efficient translation of a cohort of mRNAs containing a 5’-Terminal-Oligo-Pyrimidine 21 (TOP)-motif, including mRNAs that encode ribosomal proteins and a conserved p53 inhibitor, 22 Novel Nucleolar protein 1 (Non1). The TOP-motif co-regulates the translation of growth-related 23 mRNAs in mammals. As in mammals, the La-related protein co-regulates the translation of TOP- 24 motif containing RNAs during Drosophila oogenesis. Thus, a previously unappreciated TOP-motif 25 in Drosophila responds to reduced ribosome biogenesis to co-regulate the translation of ribosomal 26 proteins and a p53 repressor, thus coupling ribosome biogenesis to GSC differentiation. 27 Introduction 28 All life depends on the ability of ribosomes to translate mRNAs into proteins. Despite this universal 29 requirement, ribosome biogenesis is not universally equivalent. Stem cells, the unique cell type 30 that underlies the generation and expansion of tissues, in particular have a distinct ribosomal 31 requirement (Gabut et al., 2020; Sanchez et al., 2016; Woolnough et al., 2016; Zahradkal et al., 32 1991; Zhang et al., 2014). Ribosome production and levels are dynamically regulated to maintain 33 higher amounts in stem cells (Fichelson et al., 2009; Gabut et al., 2020; Sanchez et al., 2016; 34 Woolnough et al., 2016; Zahradkal et al., 1991; Zhang et al., 2014). For example, ribosome 35 biogenesis components are often differentially expressed, as observed during differentiation of 36 embryonic stem cells, osteoblasts, and myotubes (Gabut et al., 2020; Watanabe-Susaki et al., 37 2014; Zahradkal et al., 1991). In some cases, such as during Drosophila germline stem cell (GSC) 38 division, ribosome biogenesis factors asymmetrically segregate during asymmetric cell division, 39 such that a higher pool of ribosome biogenesis factors is maintained in the stem cell compared to 40 the daughter cell (Blatt et al., 2020a; Fichelson et al., 2009; Zhang et al., 2014). Reduction of 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 41 ribosome levels in several stem cells systems can cause differentiation defects (Corsini et al., 42 2018; Fortier et al., 2015; Khajuria et al., 2018; Zhang et al., 2014). In Drosophila, perturbations 43 that reduce ribosome levels in the GSCs result in differentiation defects causing infertility 44 (Sanchez et al., 2016). Similarly, humans with reduced ribosome levels are afflicted with clinically 45 distinct diseases known as ribosomopathies, such as Diamond-Blackfan anemia, that often result 46 from loss of proper differentiation of tissue-specific progenitor cells (Armistead and Triggs-Raine, 47 2014; Barlow et al., 2010; Brooks et al., 2014; Higa-Nakamine et al., 2012; Lipton et al., 1986; 48 Mills and Green, 2017). However, the mechanisms by which ribosome biogenesis is coupled to 49 proper stem cell differentiation remain incompletely understood. 50 Ribosome production requires the transcription of ribosomal RNAs (rRNAs) and of mRNAs 51 encoding ribosomal proteins (Bousquet-Antonelli et al., 2000; de la Cruz et al., 2015; Granneman 52 et al., 2011, 2006; Tafforeau et al., 2013; Venema et al., 1997). Several factors, such as helicases 53 and endonucleases, transiently associate with maturing rRNAs to facilitate rRNA processing, 54 modification, and folding (Granneman et al., 2011; Sloan et al., 2017; Tafforeau et al., 2013; 55 Watkins and Bohnsack, 2012). Ribosomal proteins are imported into the nucleus, where they 56 assemble with rRNA to form the small 40S and large 60S ribosome subunits, which are then 57 exported to the cytoplasm (Baxter-Roshek et al., 2007; Decatur and Fournier, 2002; Granneman 58 et al., 2011, 2006; Koš and Tollervey, 2010; Nerurkar et al., 2015; Tafforeau et al., 2013; Zemp 59 and Kutay, 2007). Loss of RNA Polymerase I transcription factors, helicases, exonucleases, large 60 or small subunit ribosomal proteins, or other processing factors all compromise ribosome 61 biogenesis and trigger diverse stem cell-related phenotypes (Brooks et al., 2014; Calo et al., 2018; 62 Mills and Green, 2017; Sanchez et al., 2016; Yelick and Trainor, 2015; Zhang et al., 2014). 63 Nutrient availability influences the demand for de novo protein synthesis and thus ribosome 64 biogenesis (Anthony et al., 2000; Hong et al., 2012; Mayer and Grummt, 2006; Shu et al., 2020). 65 In mammals, nearly all of the mRNAs that encode the ribosomal proteins contain a Terminal Oligo 66 Pyrimidine (TOP) motif within their 5’ untranslated region (UTR), which regulates their translation 67 in response to nutrient levels (Fonseca et al., 2015; Hong et al., 2017; Lahr et al., 2017; 68 Tcherkezian et al., 2014). Under growth-limiting conditions, La related protein 1 (Larp1) binds to 69 the TOP sequences and to mRNA caps to inhibit translation of ribosomal proteins (Fonseca et 70 al., 2015; Jia et al., 2021; Lahr et al., 2017; Philippe et al., 2018). When growth conditions are 71 suitable, Larp1 is phosphorylated by the nutrient/redox/energy sensor mammalian Target of 72 rapamycin (mTOR) complex 1 (mTORC1), and does not efficiently bind the TOP sequence, thus 73 allowing for efficient translation of ribosomal proteins (Fonseca et al., 2018, 2015; Hong et al., 74 2017; Jia et al., 2021). In some instances, Larp1 binding can also stabilize TOP-containing 75 mRNAs (Aoki et al., 2013; Berman et al., 2020; Gentilella et al., 2017; Ogami et al., 2020), linking 76 mRNA translation with mRNA stability to promote ribosome biogenesis (Aoki et al., 2013; Berman 77 et al., 2020; Fonseca et al., 2018, 2015; Hong et al., 2017; Lahr et al., 2017; Ogami et al., 2020; 78 Philippe et al., 2018). Cellular nutrient levels are known to affect stem cell differentiation and 79 oogenesis in Drosophila (Hsu et al., 2008), however whether TOP motifs exist in Drosophila to 80 coordinate ribosome protein synthesis is unclear. The Drosophila ortholog of Larp1, La related 81 protein (Larp) is required for proper cytokinesis and meiosis in Drosophila testis as well as for 82 female fertility, but its targets remain undetermined (Blagden et al., 2009; Ichihara et al., 2007). 83 Germline depletion of ribosome biogenesis factors manifests as a stereotypical GSC 84 differentiation defect during Drosophila oogenesis (Sanchez et al., 2016). Female Drosophila 85 maintain 2-3 GSCs in the germarium (Figure 1A) (Kai et al., 2005; Twombly et al., 1996; Xie, 86 2000; Xie and Li, 2007; Xie and Spradling, 1998). Asymmetric cell division of GSCs produces a 87 self-renewing daughter GSC, and a differentiating daughter, called the cystoblast (CB) (Chen and 88 McKearin, 2003; McKearin and Ohlstein, 1995). This asymmetric division is unusual: following 2 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.04.438367; this version posted April 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 89 mitosis, the abscission of the GSC and CB is not completed until the following G2 phase (Figure 90 1A’) (De Cuevas and Spradling, 1998; Hsu et al., 2008). The GSC is marked by a round structure 91 called the spectrosome, which elongates and eventually bridges the GSC and CB, similar to the 92 fusomes that connect differentiated cysts (Figure 1A’). During abscission the extended 93 spectrosome structure is severed and a round spectrosome is established in the GSC and the 94 CB (De Cuevas and Spradling, 1998; Hsu et al., 2008). Ribosome biogenesis defects result in 95 failed GSC-CB abscission, causing cells to accumulate as interconnected cysts marked by a 96 fusome-like structure called “stem cysts” (Figure 1A’) (Mathieu et al., 2013; Sanchez et al., 2016). 97 In contrast with differentiated cysts (McKearin and Ohlstein, 1995; McKearin and Spradling, 1990; 98 Ohlstein and McKearin, 1997), these stem cysts lack expression of the differentiation factor Bag 99 of Marbles (Bam), do not differentiate, and typically die, resulting in sterility (Sanchez et al., 2016).
Load more

Recommended publications
  • The DEAD-Box RNA Helicase-Like Utp25 Is an SSU Processome Component
    Downloaded from rnajournal.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press The DEAD-box RNA helicase-like Utp25 is an SSU processome component J. MICHAEL CHARETTE1,2 and SUSAN J. BASERGA1,2,3 1Department of Molecular Biophysics & Biochemistry, Yale University School of Medicine, New Haven, Connecticut 06520, USA 2Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut 06520, USA 3Department of Genetics, Yale University School of Medicine, New Haven, Connecticut 06520, USA ABSTRACT The SSU processome is a large ribonucleoprotein complex consisting of the U3 snoRNA and at least 43 proteins. A database search, initiated in an effort to discover additional SSU processome components, identified the uncharacterized, conserved and essential yeast nucleolar protein YIL091C/UTP25 as one such candidate. The C-terminal DUF1253 motif, a domain of unknown function, displays limited sequence similarity to DEAD-box RNA helicases. In the absence of the conserved DEAD-box sequence, motif Ia is the only clearly identifiable helicase element. Since the yeast homolog is nucleolar and interacts with components of the SSU processome, we examined its role in pre-rRNA processing. Genetic depletion of Utp25 resulted in slowed growth. Northern analysis of pre-rRNA revealed an 18S rRNA maturation defect at sites A0,A1, and A2. Coimmunoprecipitation confirmed association with U3 snoRNA and with Mpp10, and with components of the t-Utp/UtpA, UtpB, and U3 snoRNP subcomplexes. Mutation of the conserved motif Ia residues resulted in no discernable temperature- sensitive or cold-sensitive growth defects, implying that this motif is dispensable for Utp25 function.
    [Show full text]
  • Proteotoxicity from Aberrant Ribosome Biogenesis Compromises Cell Fitness
    Proteotoxicity From Aberrant Ribosome Biogenesis Compromises Cell Fitness The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Tye, Blake Wells. 2019. Proteotoxicity From Aberrant Ribosome Biogenesis Compromises Cell Fitness. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42013104 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Proteotoxicity from Aberrant Ribosome Biogenesis Compromises Cell Fitness A dissertation presented by Blake Wells Tye to The Committee on Higher Degrees in Chemical Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Chemical Biology Harvard University Cambridge, Massachusetts May 2019 © 2019 Blake Wells Tye All rights reserved. Dissertation Advisor: Author: L. Stirling Churchman, PhD Blake Wells Tye Proteotoxicity from Aberrant Ribosome Biogenesis Compromises Cell Fitness Abstract Proteins are the workhorses of the cell, carrying out much of the structural and enzymatic work of life. Many proteins function as part of greater assemblies, or complexes, with other proteins and/or biomolecules. As the cell grows and divides, it must double its proteome, which requires synthesis and folding of individual proteins, assembly into complexes, and proper subcellular localization. This is repeated for millions of proteins molecules compromising thousands of potential assemblies, making up a rather tricky set of tasks for cells to carry out simultaneously.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • DDX47 Polyclonal Antibody
    PRODUCT DATA SHEET Bioworld Technology,Inc. DDX47 polyclonal antibody Catalog: BS71653 Host: Rabbit Reactivity: Human,Mouse,Rat BackGround: munogen and the purity is > 95% (by SDS-PAGE). This gene encodes a member of the DEAD box protein Applications: family. DEAD box proteins, characterized by the con- WB 1:500 - 1:2000 served motif Asp-Glu-Ala-Asp (DEAD), are putative IHC 1:50 - 1:200 RNA helicases. They are implicated in a number of cellu- Storage&Stability: lar processes involving alteration of RNA secondary Store at 4°C short term. Aliquot and store at -20°C long structure, such as translation initiation, nuclear and mito- term. Avoid freeze-thaw cycles. chondrial splicing, and ribosome and spliceosome assem- Specificity: bly. Based on their distribution patterns, some members DDX47 polyclonal antibody detects endogenous levels of of this family are believed to be involved in embryogene- DDX47 protein. sis, spermatogenesis, and cellular growth and division. DATA: The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript var- iants encoding distinct isoforms have been found for this gene. Product: Rabbit IgG, 1mg/ml in PBS with 0.02% sodium azide, 50% glycerol, pH7.2 Western blot analysis of extracts of various cell lines, using DDX47 an- Molecular Weight: tibody. ~ 50 kDa Note: Swiss-Prot: For research use only, not for use in diagnostic procedure. Q9H0S4 Purification&Purity: The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific im- Bioworld Technology, Inc. Bioworld technology, co. Ltd.
    [Show full text]
  • An Adipocyte-Specific Lncrap2 - Igf2bp2 Complex Enhances Adipogenesis and Energy Expenditure by Stabilizing Target Mrnas
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.29.318980; this version posted September 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. An adipocyte-specific lncRAP2 - Igf2bp2 complex enhances adipogenesis and energy expenditure by stabilizing target mRNAs Juan R. Alvarez-Dominguez1,4, Sally Winther2, Jacob B. Hansen2, Harvey F. Lodish1,3,* and Marko Knoll1,5,* 1 Whitehead Institute for Biomedical Research, 455 Main Street, Cambridge, MA 02142, USA 2 Department of Biology, University of Copenhagen, Universitetsparken 13, DK-2100 Copenhagen, Denmark 3 Departments of Biology and Biological Engineering, Massachusetts Institute of Technology, 21 Ames Street, Cambridge, MA, 02142, USA 4 Department of Stem Cell and Regenerative Biology, Harvard Stem Cell Institute, Harvard University, Cambridge, MA 02138, USA 5 Institute for Diabetes Research, Helmholtz Zentrum München, Heidemannstrasse 1, 80939 München, Germany *correspondence: [email protected], [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.09.29.318980; this version posted September 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract lncRAP2 is a conserved cytoplasmic adipocyte-specific lncRNA required for adipogenesis. Using hybridization-based purification combined with in vivo interactome analyses, we show that lncRAP2 forms ribonucleoprotein complexes with several mRNA stability and translation modulators, among them Igf2bp2.
    [Show full text]
  • 1 Title 1 Discovery of a Small Molecule That Inhibits Bacterial Ribosome Biogenesis 2 3 Authors and Affiliations 4 Jonathan M. S
    1 Title 2 Discovery of a small molecule that inhibits bacterial ribosome biogenesis 3 4 Authors and Affiliations 5 Jonathan M. Stokes1, Joseph H. Davis2, Chand S. Mangat1, James R. Williamson2, and Eric D. Brown1* 6 7 1Michael G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and 8 Biomedical Sciences, McMaster University, Hamilton, Ontario, Canada, L8N 3Z5 9 2Department of Integrative Structural and Computational Biology, Department of Chemistry and The Skaggs 10 Institute for Chemical Biology, The Scripps Research Institute, La Jolla, CA 92037, USA 11 12 Contact 13 *Correspondence: [email protected] 14 15 Competing Interests Statement 16 All authors declare no competing interests. 17 18 Impact Statement 19 We report the discovery of a small molecule inhibitor of bacterial ribosome biogenesis. The first probe of its 20 kind, this compound revealed an unexplored role for IF2 in ribosome assembly. 21 22 Major Subject Areas 23 Biochemistry; Microbiology and infectious disease 24 25 Keywords 26 Cold sensitivity; ribosome biogenesis; lamotrigine; translation initiation factor IF2 27 28 1 29 Abstract 30 While small molecule inhibitors of the bacterial ribosome have been instrumental in understanding protein 31 translation, no such probes exist to study ribosome biogenesis. We screened a diverse chemical collection 32 that included previously approved drugs for compounds that induced cold sensitive growth inhibition in the 33 model bacterium Escherichia coli. Among the most cold sensitive was lamotrigine, an anticonvulsant drug. 34 Lamotrigine treatment resulted in the rapid accumulation of immature 30S and 50S ribosomal subunits at 35 15°C. Importantly, this was not the result of translation inhibition, as lamotrigine was incapable of perturbing 36 protein synthesis in vivo or in vitro.
    [Show full text]
  • Nucleolin and Its Role in Ribosomal Biogenesis
    NUCLEOLIN: A NUCLEOLAR RNA-BINDING PROTEIN INVOLVED IN RIBOSOME BIOGENESIS Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf vorgelegt von Julia Fremerey aus Hamburg Düsseldorf, April 2016 2 Gedruckt mit der Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf Referent: Prof. Dr. A. Borkhardt Korreferent: Prof. Dr. H. Schwender Tag der mündlichen Prüfung: 20.07.2016 3 Die vorgelegte Arbeit wurde von Juli 2012 bis März 2016 in der Klinik für Kinder- Onkologie, -Hämatologie und Klinische Immunologie des Universitätsklinikums Düsseldorf unter Anleitung von Prof. Dr. A. Borkhardt und in Kooperation mit dem ‚Laboratory of RNA Molecular Biology‘ an der Rockefeller Universität unter Anleitung von Prof. Dr. T. Tuschl angefertigt. 4 Dedicated to my family TABLE OF CONTENTS 5 TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................................... 5 LIST OF FIGURES ......................................................................................................10 LIST OF TABLES .......................................................................................................12 ABBREVIATION .........................................................................................................13 ABSTRACT ................................................................................................................19 ZUSAMMENFASSUNG
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 Gene Symbol Ddx47 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.73790 Ensembl Gene ID ENSRNOG00000007838 Entrez Gene ID 297685 Assay Information Unique Assay ID qRnoCID0019436 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000011096 Amplicon Context Sequence AAGGCGAGGTCCATTCTCCTAGCGACTGATGTGGCCAGCAGAGGTCTGGACATA CCCCATGTGGATGTAGTAGTCAATTTTGACATTCCGACTCATTCTAAGGATTATAT CCATCGAGTAGGACGAACTGCGAGAGCTGGGCGCTC Amplicon Length (bp) 116 Chromosome Location 4:233055569-233057354 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9985 cDNA Cq 20.96 cDNA Tm (Celsius) 81.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Ddx47, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Translation Factors and Ribosomal Proteins Control Tumor Onset and Progression: How?
    Oncogene (2014) 33, 2145–2156 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc REVIEW Translation factors and ribosomal proteins control tumor onset and progression: how? F Loreni1, M Mancino2,3 and S Biffo2,3 Gene expression is shaped by translational control. The modalities and the extent by which translation factors modify gene expression have revealed therapeutic scenarios. For instance, eukaryotic initiation factor (eIF)4E activity is controlled by the signaling cascade of growth factors, and drives tumorigenesis by favoring the translation of specific mRNAs. Highly specific drugs target the activity of eIF4E. Indeed, the antitumor action of mTOR complex 1 (mTORc1) blockers like rapamycin relies on their capability to inhibit eIF4E assembly into functional eIF4F complexes. eIF4E biology, from its inception to recent pharmacological targeting, is proof-of-principle that translational control is druggable. The case for eIF4E is not isolated. The translational machinery is involved in the biology of cancer through many other mechanisms. First, untranslated sequences on mRNAs as well as noncoding RNAs regulate the translational efficiency of mRNAs that are central for tumor progression. Second, other initiation factors like eIF6 show a tumorigenic potential by acting downstream of oncogenic pathways. Third, genetic alterations in components of the translational apparatus underlie an entire class of inherited syndromes known as ‘ribosomopathies’ that are associated with increased cancer risk. Taken together, data suggest that in spite of their evolutionary conservation and ubiquitous nature, variations in the activity and levels of ribosomal proteins and translation factors generate highly specific effects. Beside, as the structures and biochemical activities of several noncoding RNAs and initiation factors are known, these factors may be amenable to rational pharmacological targeting.
    [Show full text]
  • Genome-Wide Insights on Gastrointestinal Nematode
    www.nature.com/scientificreports OPEN Genome‑wide insights on gastrointestinal nematode resistance in autochthonous Tunisian sheep A. M. Ahbara1,2, M. Rouatbi3,4, M. Gharbi3,4, M. Rekik1, A. Haile1, B. Rischkowsky1 & J. M. Mwacharo1,5* Gastrointestinal nematode (GIN) infections have negative impacts on animal health, welfare and production. Information from molecular studies can highlight the underlying genetic mechanisms that enhance host resistance to GIN. However, such information often lacks for traditionally managed indigenous livestock. Here, we analysed 600 K single nucleotide polymorphism genotypes of GIN infected and non‑infected traditionally managed autochthonous Tunisian sheep grazing communal natural pastures. Population structure analysis did not fnd genetic diferentiation that is consistent with infection status. However, by contrasting the infected versus non‑infected cohorts using ROH, LR‑GWAS, FST and XP‑EHH, we identifed 35 candidate regions that overlapped between at least two methods. Nineteen regions harboured QTLs for parasite resistance, immune capacity and disease susceptibility and, ten regions harboured QTLs for production (growth) and meat and carcass (fatness and anatomy) traits. The analysis also revealed candidate regions spanning genes enhancing innate immune defence (SLC22A4, SLC22A5, IL‑4, IL‑13), intestinal wound healing/repair (IL‑4, VIL1, CXCR1, CXCR2) and GIN expulsion (IL‑4, IL‑13). Our results suggest that traditionally managed indigenous sheep have evolved multiple strategies that evoke and enhance GIN resistance and developmental stability. They confrm the importance of obtaining information from indigenous sheep to investigate genomic regions of functional signifcance in understanding the architecture of GIN resistance. Small ruminants (sheep and goats) make immense socio-economic and cultural contributions across the globe.
    [Show full text]
  • Expression of Distinct Maternal and Somatic 5.8S, 18S, and 28S Rrna Types During Zebrafish Development
    Downloaded from rnajournal.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press REPORT Expression of distinct maternal and somatic 5.8S, 18S, and 28S rRNA types during zebrafish development MAURO D. LOCATI,1,3 JOHANNA F.B. PAGANO,1,3 GENEVIÈVE GIRARD,1 WIM A. ENSINK,1 MARINA VAN OLST,1 SELINA VAN LEEUWEN,1 ULRIKE NEHRDICH,2 HERMAN P. SPAINK,2 HAN RAUWERDA,1 MARTIJS J. JONKER,1 ROB J. DEKKER,1 and TIMO M. BREIT1 1RNA Biology and Applied Bioinformatics Research Group, Swammerdam Institute for Life Sciences, Faculty of Science, University of Amsterdam, Amsterdam 1090 GE, the Netherlands 2Department of Molecular Cell Biology, Institute of Biology, Leiden University, Gorlaeus Laboratories–Cell Observatorium, Leiden 2333 CE, the Netherlands ABSTRACT There is mounting evidence that the ribosome is not a static translation machinery, but a cell-specific, adaptive system. Ribosomal variations have mostly been studied at the protein level, even though the essential transcriptional functions are primarily performed by rRNAs. At the RNA level, oocyte-specific 5S rRNAs are long known for Xenopus. Recently, we described for zebrafish a similar system in which the sole maternal-type 5S rRNA present in eggs is replaced completely during embryonic development by a somatic-type. Here, we report the discovery of an analogous system for the 45S rDNA elements: 5.8S, 18S, and 28S. The maternal-type 5.8S, 18S, and 28S rRNA sequences differ substantially from those of the somatic-type, plus the maternal-type rRNAs are also replaced by the somatic-type rRNAs during embryogenesis. We discuss the structural and functional implications of the observed sequence differences with respect to the translational functions of the 5.8S, 18S, and 28S rRNA elements.
    [Show full text]
  • DEAH)/RNA Helicase a Helicases Sense Microbial DNA in Human Plasmacytoid Dendritic Cells
    Aspartate-glutamate-alanine-histidine box motif (DEAH)/RNA helicase A helicases sense microbial DNA in human plasmacytoid dendritic cells Taeil Kima, Shwetha Pazhoora, Musheng Baoa, Zhiqiang Zhanga, Shino Hanabuchia, Valeria Facchinettia, Laura Bovera, Joel Plumasb, Laurence Chaperotb, Jun Qinc, and Yong-Jun Liua,1 aDepartment of Immunology, Center for Cancer Immunology Research, University of Texas M. D. Anderson Cancer Center, Houston, TX 77030; bDepartment of Research and Development, Etablissement Français du Sang Rhône-Alpes Grenoble, 38701 La Tronche, France; and cDepartment of Biochemistry, Baylor College of Medicine, Houston, TX 77030 Edited by Ralph M. Steinman, The Rockefeller University, New York, NY, and approved July 14, 2010 (received for review May 10, 2010) Toll-like receptor 9 (TLR9) senses microbial DNA and triggers type I Microbial nucleic acids, including their genomic DNA/RNA IFN responses in plasmacytoid dendritic cells (pDCs). Previous and replicating intermediates, work as strong PAMPs (13), so studies suggest the presence of myeloid differentiation primary finding PRR-sensing pathogenic nucleic acids and investigating response gene 88 (MyD88)-dependent DNA sensors other than their signaling pathway is of general interest. Cytosolic RNA is TLR9 in pDCs. Using MS, we investigated C-phosphate-G (CpG)- recognized by RLRs, including RIG-I, melanoma differentiation- binding proteins from human pDCs, pDC-cell lines, and interferon associated gene 5 (MDA5), and laboratory of genetics and physi- regulatory factor 7 (IRF7)-expressing B-cell lines. CpG-A selectively ology 2 (LGP2). RIG-I senses 5′-triphosphate dsRNA and ssRNA bound the aspartate-glutamate-any amino acid-aspartate/histi- or short dsRNA with blunt ends.
    [Show full text]