1 RNA Helicase, DDX27 Regulates Proliferation And
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The DEAD-Box RNA Helicase-Like Utp25 Is an SSU Processome Component
Downloaded from rnajournal.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press The DEAD-box RNA helicase-like Utp25 is an SSU processome component J. MICHAEL CHARETTE1,2 and SUSAN J. BASERGA1,2,3 1Department of Molecular Biophysics & Biochemistry, Yale University School of Medicine, New Haven, Connecticut 06520, USA 2Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut 06520, USA 3Department of Genetics, Yale University School of Medicine, New Haven, Connecticut 06520, USA ABSTRACT The SSU processome is a large ribonucleoprotein complex consisting of the U3 snoRNA and at least 43 proteins. A database search, initiated in an effort to discover additional SSU processome components, identified the uncharacterized, conserved and essential yeast nucleolar protein YIL091C/UTP25 as one such candidate. The C-terminal DUF1253 motif, a domain of unknown function, displays limited sequence similarity to DEAD-box RNA helicases. In the absence of the conserved DEAD-box sequence, motif Ia is the only clearly identifiable helicase element. Since the yeast homolog is nucleolar and interacts with components of the SSU processome, we examined its role in pre-rRNA processing. Genetic depletion of Utp25 resulted in slowed growth. Northern analysis of pre-rRNA revealed an 18S rRNA maturation defect at sites A0,A1, and A2. Coimmunoprecipitation confirmed association with U3 snoRNA and with Mpp10, and with components of the t-Utp/UtpA, UtpB, and U3 snoRNP subcomplexes. Mutation of the conserved motif Ia residues resulted in no discernable temperature- sensitive or cold-sensitive growth defects, implying that this motif is dispensable for Utp25 function. -
Proteotoxicity from Aberrant Ribosome Biogenesis Compromises Cell Fitness
Proteotoxicity From Aberrant Ribosome Biogenesis Compromises Cell Fitness The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Tye, Blake Wells. 2019. Proteotoxicity From Aberrant Ribosome Biogenesis Compromises Cell Fitness. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42013104 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Proteotoxicity from Aberrant Ribosome Biogenesis Compromises Cell Fitness A dissertation presented by Blake Wells Tye to The Committee on Higher Degrees in Chemical Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Chemical Biology Harvard University Cambridge, Massachusetts May 2019 © 2019 Blake Wells Tye All rights reserved. Dissertation Advisor: Author: L. Stirling Churchman, PhD Blake Wells Tye Proteotoxicity from Aberrant Ribosome Biogenesis Compromises Cell Fitness Abstract Proteins are the workhorses of the cell, carrying out much of the structural and enzymatic work of life. Many proteins function as part of greater assemblies, or complexes, with other proteins and/or biomolecules. As the cell grows and divides, it must double its proteome, which requires synthesis and folding of individual proteins, assembly into complexes, and proper subcellular localization. This is repeated for millions of proteins molecules compromising thousands of potential assemblies, making up a rather tricky set of tasks for cells to carry out simultaneously. -
1 Title 1 Discovery of a Small Molecule That Inhibits Bacterial Ribosome Biogenesis 2 3 Authors and Affiliations 4 Jonathan M. S
1 Title 2 Discovery of a small molecule that inhibits bacterial ribosome biogenesis 3 4 Authors and Affiliations 5 Jonathan M. Stokes1, Joseph H. Davis2, Chand S. Mangat1, James R. Williamson2, and Eric D. Brown1* 6 7 1Michael G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and 8 Biomedical Sciences, McMaster University, Hamilton, Ontario, Canada, L8N 3Z5 9 2Department of Integrative Structural and Computational Biology, Department of Chemistry and The Skaggs 10 Institute for Chemical Biology, The Scripps Research Institute, La Jolla, CA 92037, USA 11 12 Contact 13 *Correspondence: [email protected] 14 15 Competing Interests Statement 16 All authors declare no competing interests. 17 18 Impact Statement 19 We report the discovery of a small molecule inhibitor of bacterial ribosome biogenesis. The first probe of its 20 kind, this compound revealed an unexplored role for IF2 in ribosome assembly. 21 22 Major Subject Areas 23 Biochemistry; Microbiology and infectious disease 24 25 Keywords 26 Cold sensitivity; ribosome biogenesis; lamotrigine; translation initiation factor IF2 27 28 1 29 Abstract 30 While small molecule inhibitors of the bacterial ribosome have been instrumental in understanding protein 31 translation, no such probes exist to study ribosome biogenesis. We screened a diverse chemical collection 32 that included previously approved drugs for compounds that induced cold sensitive growth inhibition in the 33 model bacterium Escherichia coli. Among the most cold sensitive was lamotrigine, an anticonvulsant drug. 34 Lamotrigine treatment resulted in the rapid accumulation of immature 30S and 50S ribosomal subunits at 35 15°C. Importantly, this was not the result of translation inhibition, as lamotrigine was incapable of perturbing 36 protein synthesis in vivo or in vitro. -
Nucleolin and Its Role in Ribosomal Biogenesis
NUCLEOLIN: A NUCLEOLAR RNA-BINDING PROTEIN INVOLVED IN RIBOSOME BIOGENESIS Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf vorgelegt von Julia Fremerey aus Hamburg Düsseldorf, April 2016 2 Gedruckt mit der Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf Referent: Prof. Dr. A. Borkhardt Korreferent: Prof. Dr. H. Schwender Tag der mündlichen Prüfung: 20.07.2016 3 Die vorgelegte Arbeit wurde von Juli 2012 bis März 2016 in der Klinik für Kinder- Onkologie, -Hämatologie und Klinische Immunologie des Universitätsklinikums Düsseldorf unter Anleitung von Prof. Dr. A. Borkhardt und in Kooperation mit dem ‚Laboratory of RNA Molecular Biology‘ an der Rockefeller Universität unter Anleitung von Prof. Dr. T. Tuschl angefertigt. 4 Dedicated to my family TABLE OF CONTENTS 5 TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................................... 5 LIST OF FIGURES ......................................................................................................10 LIST OF TABLES .......................................................................................................12 ABBREVIATION .........................................................................................................13 ABSTRACT ................................................................................................................19 ZUSAMMENFASSUNG -
A Bootstrap-Based Regression Method for Comprehensive Discovery of Differential Gene Expressions: an Application to the Osteoporosis Study
A bootstrap-based regression method for comprehensive discovery of differential gene expressions: an application to the osteoporosis study Yan Lu1,2, Yao-Zhong Liu3, Peng–Yuan Liu2, Volodymyr Dvornyk4, and Hong–Wen Deng1,3 1. College of Life Sciences and Bioengineering, Beijing Jiaotong University, Beijing 100044, P. R. China 2. Department of Physiology and the Cancer Center, Medical College of Wisconsin, Milwaukee, WI 53226, USA 3. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, New Orleans, LA 70112, USA 4. School of Biological Sciences, University of Hong Kong, Pokfulam Rd., Pokfulam, Hong Kong, P.R. China Running title: Bootstrap-based regression method for microarray analysis Key words: microarray, bootstrap, regression, osteoporosis Corresponding author: Hong–Wen Deng, Ph. D. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, 1440 Canal Street, Suite 2001, New Orleans, LA 70112 Tel: 504-988-1310 Email: [email protected] 1 Abstract A common purpose of microarray experiments is to study the variation in gene expression across the categories of an experimental factor such as tissue types and drug treatments. However, it is not uncommon that the studied experimental factor is a quantitative variable rather than categorical variable. Loss of information would occur by comparing gene-expression levels between groups that are factitiously defined according to the quantitative threshold values of an experimental factor. Additionally, lack of control for some sensitive clinical factors may bring serious false positive or negative findings. In the present study, we described a bootstrap-based regression method for analyzing gene expression data from the non-categorical microarray experiments. -
DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties with Poor Prognosis in Breast Cancer
DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties With Poor Prognosis in Breast Cancer Shan Li The First Aliated Hospital of China Medical University Jinfei Ma The First Aliated Hospital of China Medical University Ang Zheng The First Aliated Hospital of China Medical University Xinyue Song China Medical University Si Chen China Medical University Feng Jin ( [email protected] ) The First Aliated Hospital of China Medical University https://orcid.org/0000-0002-0325-5362 Research Article Keywords: DEAD-box helicase 27 (DDX27), Breast cancer, Stem cell-like properties, Prognosis Posted Date: June 7th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-521379/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Journal of Translational Medicine on August 6th, 2021. See the published version at https://doi.org/10.1186/s12967-021-03011-0. Page 1/22 Abstract Background Although the rapid development of diagnosis and treatment has improved prognosis in early breast cancer, challenges from different therapy response remain due to breast cancer heterogeneity. DEAD-box helicase 27 (DDX27) had been proved to inuence ribosome biogenesis and identied as a promoter in gastric and colorectal cancer associated with stem cell-like properties, while the impact of DDX27 on breast cancer prognosis and biological functions is unclear. We aimed to explore the inuence of DDX27 on stem cell-like properties and prognosis in breast cancer. Methods The expression of DDX27 was evaluated in 24 pairs of fresh breast cancer and normal tissue by western blot. -
Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research. -
Dissertation
Regulation of gene silencing: From microRNA biogenesis to post-translational modifications of TNRC6 complexes DISSERTATION zur Erlangung des DOKTORGRADES DER NATURWISSENSCHAFTEN (Dr. rer. nat.) der Fakultät Biologie und Vorklinische Medizin der Universität Regensburg vorgelegt von Johannes Danner aus Eggenfelden im Jahr 2017 Das Promotionsgesuch wurde eingereicht am: 12.09.2017 Die Arbeit wurde angeleitet von: Prof. Dr. Gunter Meister Johannes Danner Summary ‘From microRNA biogenesis to post-translational modifications of TNRC6 complexes’ summarizes the two main projects, beginning with the influence of specific RNA binding proteins on miRNA biogenesis processes. The fate of the mature miRNA is determined by the incorporation into Argonaute proteins followed by a complex formation with TNRC6 proteins as core molecules of gene silencing complexes. miRNAs are transcribed as stem-loop structured primary transcripts (pri-miRNA) by Pol II. The further nuclear processing is carried out by the microprocessor complex containing the RNase III enzyme Drosha, which cleaves the pri-miRNA to precursor-miRNA (pre-miRNA). After Exportin-5 mediated transport of the pre-miRNA to the cytoplasm, the RNase III enzyme Dicer cleaves off the terminal loop resulting in a 21-24 nt long double-stranded RNA. One of the strands is incorporated in the RNA-induced silencing complex (RISC), where it directly interacts with a member of the Argonaute protein family. The miRNA guides the mature RISC complex to partially complementary target sites on mRNAs leading to gene silencing. During this process TNRC6 proteins interact with Argonaute and recruit additional factors to mediate translational repression and target mRNA destabilization through deadenylation and decapping leading to mRNA decay. -
A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer. -
Translation Factors and Ribosomal Proteins Control Tumor Onset and Progression: How?
Oncogene (2014) 33, 2145–2156 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc REVIEW Translation factors and ribosomal proteins control tumor onset and progression: how? F Loreni1, M Mancino2,3 and S Biffo2,3 Gene expression is shaped by translational control. The modalities and the extent by which translation factors modify gene expression have revealed therapeutic scenarios. For instance, eukaryotic initiation factor (eIF)4E activity is controlled by the signaling cascade of growth factors, and drives tumorigenesis by favoring the translation of specific mRNAs. Highly specific drugs target the activity of eIF4E. Indeed, the antitumor action of mTOR complex 1 (mTORc1) blockers like rapamycin relies on their capability to inhibit eIF4E assembly into functional eIF4F complexes. eIF4E biology, from its inception to recent pharmacological targeting, is proof-of-principle that translational control is druggable. The case for eIF4E is not isolated. The translational machinery is involved in the biology of cancer through many other mechanisms. First, untranslated sequences on mRNAs as well as noncoding RNAs regulate the translational efficiency of mRNAs that are central for tumor progression. Second, other initiation factors like eIF6 show a tumorigenic potential by acting downstream of oncogenic pathways. Third, genetic alterations in components of the translational apparatus underlie an entire class of inherited syndromes known as ‘ribosomopathies’ that are associated with increased cancer risk. Taken together, data suggest that in spite of their evolutionary conservation and ubiquitous nature, variations in the activity and levels of ribosomal proteins and translation factors generate highly specific effects. Beside, as the structures and biochemical activities of several noncoding RNAs and initiation factors are known, these factors may be amenable to rational pharmacological targeting. -
Ddx27 (BC011321) Mouse Tagged ORF Clone – MR208999
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR208999 Ddx27 (BC011321) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ddx27 (BC011321) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Ddx27 Synonyms: C86129 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Ddx27 (BC011321) Mouse Tagged ORF Clone – MR208999 ORF Nucleotide >MR208999 representing BC011321 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGCCGCCCGCCGCCCGTCTCGCGCTGCTCTCCGCCGCTGCGCTCACTCTGGCGGCCCGGCCCGCGC CCGGTCCCCGCTCCGGCCCCGAGTGCTTCACAGCCAACGGTGCAGATTACAGGGGAACACAGAGCTGGAC AGCGCTGCAAGGTGGGAAGCCATGTCTGTTCTGGAACGAGACTTTCCAGCATCCGTACAACACGCTGAAG TACCCCAACGGGGAAGGAGGACTGGGCGAGCACAATTATTGCAGAAATCCAGATGGAGACGTGAGCCCTT GGTGCTACGTGGCCGAGCATGAGGACGGAGTCTACTGGAAGTACTGTGAAATTCCTGCCTGCCAGATGCC TGGAAACCTTGGCTGCTACAAGGATCATGGAAACCCACCTCCTCTCACGGGCACCAGTAAAACCTCTAAC AAGCTCACCATACAAACCTGTATCAGCTTCTGTCGGAGTCAGAGATTCAAGTTTGCTGGGATGGAGTCAG GCTATGCCTGCTTCTGTGGGAACAATCCTGACTACTGGAAGCACGGGGAGGCGGCCAGCACCGAGTGCAA TAGTGTCTGCTTCGGGGACCACACGCAGCCCTGCGGTGGGGACGGCAGGATTATCCTCTTTGACACTCTC -
The DNA Sequence and Comparative Analysis of Human Chromosome 20
articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.