Increased Apical Sodium-Dependent Glucose Transporter Abundance in the Ctenidium of the Giant Clam Tridacna Squamosa Upon Illumination Christabel Y

Home , Ctenidium (mollusc), Solute carrier family, Symporter

RESEARCH ARTICLE Increased apical sodium-dependent glucose transporter abundance in the ctenidium of the giant clam Tridacna squamosa upon illumination Christabel Y. L. Chan1, Kum C. Hiong1, Celine Y. L. Choo1, Mel V. Boo1, Wai P. Wong1, Shit F. Chew2 and Yuen K. Ip1,3,*

ABSTRACT relationships with certain dinoflagellates (zooxanthellae) (Trench, Giant clams contain phototrophic zooxanthellae, and live in nutrient- 1987). Giant clams are common members of coral reefs throughout deficient tropical waters where light is available. We obtained the the tropical Indo-Pacific (Neo et al., 2017). They can harbor three – complete cDNA coding sequence of a homolog of mammalian sodium/ genera of dinoflagellates of the family Symbiodiniaceae glucose cotransporter 1 (SGLT1) – SGLT1-like – from the ctenidium of Symbiodinium (formerly Symbiodinium clade A), Cladocopium the fluted giant clam, Tridacna squamosa. SGLT1-like had a host origin (formerly Symbiodinium clade C) and Durusdinium (formerly and was expressed predominantly in the ctenidium. Molecular Symbiodinium clade D) (Takabayashi et al., 2004; Hernawan, – characterizations reveal that SGLT1-like of T. squamosa could 2008; LaJeunesse et al., 2018) extracellularly in a branched transport urea, in addition to glucose, as other SGLT1s do. It has an tubular system. These symbionts live inside the zooxanthellal tubules apical localization in the epithelium of ctenidial filaments and water located mainly in the extensible and colorful outer mantle (Norton channels, and the apical anti-SGLT1-like immunofluorescence was et al., 1992), where they conduct photosynthesis during insolation. stronger in individuals exposed to light than to darkness. Furthermore, They transfer >95% of photosynthates to the host, which can ’ the protein abundance of SGLT1-like increased significantly in the generally satisfy the host s energy requirements (Fitt, 1993; Griffiths ctenidium of individuals exposed to light for 12 h, although the SGLT1- and Klumpp, 1996). With that, giant clams can perform light- like transcript level remained unchanged. As expected, T. squamosa enhanced shell formation (calcification) and maintain a high growth could perform light-enhanced glucose absorption, which was impeded rate in nutrient-deficient tropical waters where light is available by exogenous urea. These results denote the close relationships (Lucas et al., 1989). As the photosynthesizing zooxanthellae require a between light-enhanced glucose absorption and light-enhanced supply of inorganic carbon, research in the past has focused on SGLT1-like expression in the ctenidium of T. squamosa. Although inorganic carbon uptake and metabolism in giant clams (Rees et al., glucose absorption could be trivial compared with the donation of 1993b; Baillie and Yellowlees, 1998; Leggat et al., 2002, 2005; photosynthates from zooxanthellae in symbiotic adults, SGLT1-like Yellowlees et al., 2008). Nonetheless, giant clams can also obtain might be essential for the survival of aposymbiotic larvae, leading to some nutrients through filter feeding (Fankboner and Reid, 1986), its retention in the symbiotic stage. Apriori, glucose uptake through possible digestion of zooxanthellae in the digestive tract (Reid et al., SGLT1-like might be augmented by the surface microbiome through 1984), and uptake of dissolved organic molecules from the external nutrient cycling, and the absorbed glucose could partially fulfill the medium (Fitt, 1993). metabolic needs of the ctenidial cells. Additionally, SGLT1-like could More than a century ago, Putter (1909) suggested that marine partake in urea absorption, as T. squamosa is known to conduct light- organisms might be able to obtain nutrients by directly absorbing enhanced urea uptake to benefit the nitrogen-deficient zooxanthellae. certain molecules from the ambient seawater. Since then, evidence has been gathered to substantiate the absorption of isotopically labelled KEY WORDS: Carbohydrate, Calcification, Nitrogen, Symbiodinium, sugars and amino acids against their concentration gradients through Urea, Zooxanthellae epidermal tissues of annelids, echinoderms and pogonophores (Stephens and Schinske, 1961; Ferguson, 1967; Ahearn and INTRODUCTION Gomme, 1975; Davis and Stephens, 1984; Manahan, 1989; Pajor Tropical waters are poor in nutrients owing to a lack of overturn, and et al., 1989). Péquignat (1973) provided categorical evidence to therefore referred to as ‘deserts’ of the sea. To compensate for nutrient support the presence of a similar epidermal route of absorption for shortage in tropical waters, some marine invertebrates, including glucose and amino acids in the ctenidium (gill) and mantle of the giant clams and scleractinian corals, acquire and maintain symbiotic filibranch bivalve Mytilus edulis. Subsequently, by measuring D-glucose transport in brush-border membrane vesicles derived from the ctenidium of M. edulis, the functional presence of a sodium- 1Department of Biological Sciences, National University of Singapore, Kent Ridge, Singapore 117543, Republic of Singapore. 2Natural Sciences and Science dependent glucose transporter (SGLT) in its labial palps has been Education, National Institute of Education, Nanyang Technological University, confirmed (Pajor et al., 1989). Furthermore, in vitro incubation of the 1 Nanyang Walk, Singapore 637616, Republic of Singapore. 3The Tropical Marine ctenidium of the oyster Crassostrea gigas in artificial seawater reveals Science Institute, National University of Singapore, Kent Ridge, Singapore 119227, Republic of Singapore. that it can absorb D-glucose and D-galactose, but not 3-O-methyl-D- glucose, via an active carrier-mediated system (Bamford and Gingles, *Author for correspondence ([email protected]) 1974). In the absence of exogenous Na+, glucose uptake occurs by + Y.K.I., 0000-0001-9124-7911 simple diffusion, but an Na -dependent carrier-mediated process sensitive to phlorizin [a potent inhibitor of sodium/glucose

Received 1 November 2018; Accepted 5 March 2019 cotransporter 1 (SGLT1); Panayotova-Heiermann et al., 1996] Journal of Experimental Biology

1 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644 inhibition is operating to absorb glucose in the ctenidium and the glucose (and urea) uptake in giant clams, which may offer insights mantle of C. gigas. A kinetic analysis of glucose uptake confirms the into ways to enhance their growth and survivorship in this rapidly presence of a saturable component at low substrate concentrations, and changing climate. a diffusive component at high substrate concentrations. Subsequently, asequenceofSGLT-like has been obtained from the oyster C. gigas MATERIALS AND METHODS (Huvet et al., 2004) that has a high mRNA expression level in the Animals ctenidium and the mantle edge but low expression in other tissues/ Adult Tridacna squamosa Lamarck 1819 (mass=500±180 g, N=42) organs (Hanquet et al., 2011). were procured from Xanh Tuoi Tropical Fish (Ho Chi Minh City, SGLTs cotransport Na+ and glucose down the electrochemical Vietnam). The giant clams were maintained in tanks as described by potential gradient of Na+ but up against the concentration gradient of Ip et al. (2015) but with slight modifications. The water temperature glucose across cell membranes. Six isoforms of the SGLT gene was maintained at 26±1°C, the salinity was 30–32 and the belonging to the SLC5 gene family have been identified in humans pH ranged between 8.1 and 8.3. The carbonate hardness was (Wright et al., 2011). All SGLTs have 14 transmembrane regions 143–179 ppm and the calcium concentration was 280–400 ppm. (TMs) in topology (Wright et al., 2011). In humans, SGLT1 is Each tank was illuminated from the top by two sets of Aquazonic T5 expressed mainly in the intestine and kidney, where it functions lighting systems (Yi Hu Fish Farm Trading, Singapore), and each as a glucose/galactose transporter. In mouse intestine, SGLT1 is system consisted of two sun and two actinic blue fluorescence tubes expressed in the brush-border membranes, and glucose absorption (39 W each). Using a Skye SKP 200 display meter connected with a across these membranes disappears in SGLT1-deficient mouse, SKP 215 PAR Quantum sensor (Skye Instruments, UK), the light indicating that intestinal glucose absorption is mediated intensity at the level of the giant clams was determined as predominantly by SGLT1 (Gorboulev et al., 2012). ∼100 μmol m−2 s−1. Institutional approval was not necessary for Until now, it was unknown whether giant clams express a homolog research on giant clams (National University of Singapore of SGLT1 (SGLT1-like) in their ctenidia, and whether they can Institutional Animal Care and Use Committee). absorb glucose from the ambient seawater. Nonetheless, giant clams are known to display light-dependent physiological properties, Exposure of animals to experimental conditions for tissue including light-enhanced shell formation (Sano et al., 2012; Ip collection et al., 2017a) and light-enhanced nitrogen uptake (Wilkerson and At the end of the 12 h dark period of the 12 h:12 h light:dark regime, Trench, 1986; Chan et al., 2018). In addition, the gene and/or protein one batch of giant clam (N=5; control) was killed and sampled. The expression levels of some of their enzymes and transporters are also other 15 individuals were separated into three batches (N=5 for light dependent (Hiong et al., 2017a,b; Boo et al., 2017, 2018; Ip every time point) and exposed to 3, 6 or 12 h of light before et al., 2015, 2017a,b, 2018; Koh et al., 2018; Chan et al., 2018; Chew being killed for tissue sampling. They were anesthetized in 0.2% et al., 2019). As such, it is highly probable that giant clams can phenoxyethanol, and forced open to cut the adductor muscles. Then, increase the expression of SGLT1-like/SGLT1-like in the ctenidium samples of outer mantle, inner mantle, ctenidium, adductor muscle, and the rate of glucose uptake during light exposure. foot muscle, hepatopancreas and kidney were excised. The tissue Therefore, the present study was undertaken to clone and sequence samples were dabbed dry and then freeze-clamped with aluminum SGLT1-like from the ctenidium of the fluted giant clam, Tridacna tongs in liquid nitrogen. All samples were stored at −80°C prior to squamosa. Sequence similarity analysis was conducted to verify that processing. Tissue samples for immunofluorescence microscopy the SGLT1-like of T. squamosa was derived from the host. Molecular were harvested separately from another batch of individuals that had characterization of the deduced SGLT1-like amino acid sequence was been exposed to either darkness or light for 12 h (N=4 for each performed to elucidate its roles in the co-transport of Na+ and condition) followed with anesthetization in 0.2% phenoxyethanol. glucose. Furthermore, the gene expression of SGLT1-like in various organs and tissues of T. squamosa was examined. The hypothesis Extraction of mRNA and DNA synthesis tested was that SGLT1-like was expressed predominantly in the Extraction of the total RNA from the ctenidium of T. squamosa ctenidium, where glucose uptake could occur. Based on the deduced was achieved using TRI Reagent® (Sigma-Aldrich, St Louis, amino acid sequences, a custom-made anti-SGLT1-like polyclonal MO, USA). Further purification of extracted total RNA was antibody was produced commercially, and immunofluorescence accomplished using the RNeasy Plus Mini Kit (Qiagen, Hilden, microscopy was performed to test the proposition that SGLT1-like Germany), and the concentration of total RNA was verified using a was localized in the apical membrane of the epithelial cells of the Shimadzu BioSpec-nano spectrophotometer (Shimadzu, Tokyo, ctenidial filament and water channels, where it could engage in active Japan). Electrophoresis was used to verify total RNA integrity. The glucose absorption. In addition, quantitative real-time PCR (qPCR) RevertAid™ first-strand cDNA synthesis kit (Thermo Fisher and western blotting were performed to examine whether the gene Scientific, Waltham, MA, USA) was used to reverse transcribe and/or protein expression of SGLT1-like/SGLT1-like in the ctenidium the purified total RNA into cDNA. of T. squamosa could be upregulated by light. To verify that T. squamosa could indeed perform light-enhanced glucose Sequence analysis of the isolated gene absorption, the rates of glucose absorption in T. squamosa exposed The partial SGLT1-like sequence was isolated using primers (given 5′ to darkness (control) or to light were determined. Efforts were also to 3′; forward: GGWTGGGTGTTTGTMCCTGT; reverse: GGWT- made to elucidate the possible relationship between glucose and urea GCACSAAYATYGCMTATC; where W, M, S and Y represent absorption in T. squamosa, as SGLT1 is known to have the capacity degenerate bases) designed from the homologous regions of to transport urea (Panayotova-Heiermann and Wright, 2001; Bankir Crassostrea gigas sodium glucose cotransporter (AY551098.1), and Yang, 2012). As a crucial part of the coral reef, giant clams are Octopus bimaculoides sodium/glucose cotransporter 4-like (XM_ sensitive to adverse changes in their environment, particularly in 014916561.1), Homo sapiens solute carrier family 5 member 1 connection with global warming and ocean acidification. Results (NM_000343.3; SGLT1)andAcropora digitifera sodium/glucose obtained from this study may shed light on the mechanisms of cotransporter 1-like (XM_015901071.1). The PCR reaction was Journal of Experimental Biology

2 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644 conducted using DreamTaq™ polymerase (Thermo Fisher Scientific) accomplished through holding 95°C for 3 min, followed by 35 in a 9902 Veriti 96-well thermal cycler (Applied Biosystems, cycles of 95°C (30 s) for denaturation, 55°C (30 s) for annealing and Carlsbad, CA, USA). Following the methods previously described 72°C (1 min) for extension, and one final extension at 72°C (Hiong et al., 2017a,b) with minor modifications, PCR and cloning (10 min). Electrophoresis in 1% agarose gel was used to separate the experiments were used to isolate and analyze the gene. For the PCR PCR products. experiments, initial denaturation was at 95°C held for 3 min, followed by 40 cycles of denaturation, annealing and extension at 95°C for 30 s, Determination of mRNA expression by quantitative real-time 55°C for 30 s and 72°C for 1.5 min. A final extension for 10 min was PCR (qPCR) held at 72°C. An absence of isoforms was observed from the analysis Absolute quantification through qPCR was performed using a of multiple clones of SGLT1-like fragments. 5′ and 3′ RACE StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific). (SMARTer™ RACE cDNA amplification kit, Clontech cDNA (4 µg) was synthesized from RNA using random hexamer Laboratories, Mountain View, CA, USA) PCR was performed with primers and the RevertAid™ first-strand cDNA synthesis kit. The specific primers (forward: GCCAGGTACAGGTTCAAGTGTA- mRNA expression level of SGLT1-like in the ctenidium was CAGACT; reverse: ATCCAATGCCAAAGCGGGTACAATTCTG) determined through the use of specific qPCR primers (forward: to amplify and isolate the full coding sequence of SGLT1-like.The TCTTACACAGCCGATTGACGA; reverse: ATCCGAACACTG- BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher AGATGTCCT). The amplification efficiency for SGLT1-like was Scientific) with ethanol/sodium acetate precipitation was used to 86.6%. The absolute quantification of transcripts was calculated prepare the samples for gene sequencing. Sequencing was performed using the plasmid standard curve expressed as copy number per using a 3130XL Genetic Analyzer (Thermo Fisher Scientific). The nanogram total RNA, with methodology following previous sequence was subsequently analyzed and assembled using BioEdit publications (Hiong et al., 2017a,b). version 7.2.5. The SGLT1-like sequence has been deposited into GenBank with accession number MF073182. Antibodies The SGLT1-like amino acid sequence was translated from the A custom-made rabbit polyclonal anti-SGLT1-like antibody was SGLT1-like nucleotide sequence using the ExPASy Proteomic developed by a commercial firm (GenScript, Piscataway, NJ, USA) server (http://web.expasy.org/translate/). To confirm the identity of against residues 243–256 (PPDNSMNLIRSYDD) of SGLT1-like of SGLT1-like from T. squamosa, the deduced amino acid sequence T. squamosa, and used for immunofluorescence microscopy and was aligned with selected SGLT and SGLT1-like sequences from immunoblotting. α-Tubulin was chosen as the reference protein for various species of mollusk and other animals to generate a sequence western blotting, and the anti-α-tubulin antibody (12G10) was procured similarity table (see Table 1 for details). The TMs of the deduced from the Developmental Studies Hybridoma Bank (Department of amino acid sequence were predicted using the TMpred server of Biological Sciences, University of Iowa, Iowa City, IA, USA) the ExPASy portal (https://embnet.vital-it.ch/software/TMPRED_ form.html). Immunofluorescence microscopy The immuno-labeling of ctenidial samples of T. squamosa with the Gene expression in various tissues and organs anti-SGLT1-like antibody (1.35 µg ml−1) was performed following The mRNA expression of SGLT1-like in the outer mantle, inner the methods of Hiong et al. (2017b) with Alexa Fluor 488, and goat mantle, ctenidium, adductor muscle, foot muscle, kidney and anti-rabbit (Invitrogen, 2.5 µg ml−1) secondary labeling in green. hepatopancreas of T. squamosa was investigated qualitatively by Nuclei were counterstained using 4′6′-diamidino-2-phenylindole PCR using SGLT1-like specific primers (forward: AAATCTAT- (DAPI) (Sigma-Aldrich; 50 ng ml−1). Slides were mounted in CCAATGCCAAAGCGG; reverse: TTCTATCCCACAAATCCA- ProLong Gold Antifade Mountant (Life Technologies, USA) and CTGACC). DreamTaq™ polymerase (Thermo Fisher Scientific) cured in the dark at room temperature prior to storing at 4°C for was used for each PCR reaction, with each reaction having a total further image acquisition. Image acquisition was conducted with a volume of 10 µl. For the thermal cycling, initial denaturation was fluorescence microscope (Olympus BX60 equipped with a DP73

Table 1. Percentage similarities between the deduced amino acid sequence of sodium/glucose cotransporter 1-like (SGLT1-like) from Tridacna squamosa and SGLT sequences from other species obtained from GenBank Classification Species (accession number) Protein Similarity (%) Mollusca Lottia gigantea (XP_009051606.1) Solute carrier 5,6-like 86.0 Crassostrea gigas (AAT44356.1) Sodium/glucose cotransporter 84.3 Brachiopoda Lingula anatina (XP_013421875.1) Sodium/glucose cotransporter 4-like 80.0 Priapulus caudatus (XP_014663590.1) Sodium/glucose cotransporter 4-like 78.3 Echinodermata Strongylocentrotus purpuratus (XP_798065.2) Sodium/glucose cotransporter 4 74.7 Hemichordata Branchiostoma belcheri (XP_019620396.1) Sodium/glucose cotransporter 4-like 72.2 Branchiostoma floridae (XP_002587561.1) Solute carrier 5,6-like 72.1 Chordata Homo sapiens (NP_000334.1) Sodium/glucose cotransporter 1 71.8 Mus musculus (AAF17249.1) Sodium/glucose cotransporter 1 70.8 Bos taurus (NP_777031.1) Sodium/glucose cotransporter 1 70.7 Arthropoda Limulus polyphemus (XP_013789754.1) Sodium/glucose cotransporter 4-like 70.5 Plantae Vigna angularis (KOM56425.1) Solute carrier 5,6-like 32.7 Vitis vinifera (CAN65174.1) Solute carrier 5,6-like 30.7 Fusarium oxysporum (EGU86911.1) Solute carrier 5,6-like 31.0 Talaromyces islandicus (CRG86372.1) Solute carrier 5,6-like 30.2 Fungi Paracoccidioides brasiliensis (EEH21459.2) Solute carrier 5,6-like 12.9

Sequences are arranged in order of descending similarity. Journal of Experimental Biology

3 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

CCD digital camera) with the appropriate fluorescent filter sets 50 µmol l−1 glucose, while another three individuals were exposed to (Ip et al., 2018). A DIC slider (U-DICT, Olympus) was used to light for 6 h in seawater containing 50 µmol l−1 glucose+50 µmol l−1 produce differential interference contrast (DIC) images of the urea. The experiment lasted only 6 h because preliminary results tissue structures such as ctenidial filaments and water channels. obtained indicated that the glucose concentration would decrease by Micrographs were collected using CellSens Imaging Software ∼50% over a 6-h period. Waters containing glucose or glucose+urea, (Olympus) under optimal exposure settings of 200–400 ms. Images but without giant clams, were regarded as blanks. Water samples were further processed with Adobe Photoshop CC (Adobe Systems, were collected at 0, 2, 4 or 6 h, and kept at −20°C. The glucose assay, San Jose, CA, USA) with adjusted brightness and contrast. following the methods of Bergmeyer et al. (1974), was performed within 7 days of the uptake experiment. Briefly, the water samples Western blotting were pre-incubated in 1.5 ml of reaction mixture containing −1 −1 The extraction of protein from ctenidial samples was performed 250 mmol l triethanolamine (pH 7.5), 2.5 mmol l MgSO4, following the methods of Hiong et al. (2017b). Twenty micrograms 0.8 mmol l−1 NADP, 10 mmol l−1 ATP and 2.1 i.u. glucose-6- of ctenidial proteins was subjected to 8% SDS-PAGE and then phosphate dehydrogenase. After incubation at 25°C for 5 min, the blotted onto polyvinylidene difluoride membrane. The membranes absorbance was determined at 340 nm using a Shimadzu UV160 were blocked with Pierce Fast blocking buffer for 30 min at 25°C, UV-VIS spectrophotometer and the reaction was initiated by the followed by incubation with anti-SGLT1-like (1.25 μgml−1)or addition of 2.8 i.u. hexokinase. The absorbance was recorded after anti-α-tubulin (12G10, 0.1 μgml−1) antibodies for 1 h at 25°C. 10 min and the change in absorbance was used for calculation. Subsequently, the membranes were incubated in horseradish Freshly prepared glucose solution was used as a standard for peroxidase-conjugated secondary antibodies (Santa Cruz comparison. Percentage changes were used to express the decreases Biotechnology; 1:10,000) for 1 h at 25°C. Blots were washed in the glucose concentration in the external medium, because of with TBST (0.05% Tween 20 in Tris-buffered saline: 20 mmol l−1 minor variations in the initial glucose concentrations at hour 0. The Tris HCl; 500 mmol l−1 NaCl, pH 7.6) three times and developed rate of glucose absorption was expressed as µmol g–1 h–1. with the ECL system (Thermo Fisher Scientific). Scanning and quantification of the protein bands were performed as described by Statistical analysis Ip et al. (2017a,b). The quantitation of the SGLT1-like protein Values are given as means±s.e.m. Student’s t-test for independent abundance was normalized with that of α-tubulin. Prior to samples was applied to compare the differences between two means. immunoblotting, immunizing peptide (Genscript) was incubated As for multiple means, the homogeneity of variance among the with anti-SGLT1-like antibody for 1 h to further determine the means was analyzed using Levene’s test. Subsequently, one-way specificity of the custom-made antibody. ANOVA was used to evaluate the difference between the means of data sets, followed by Dunnett’sT3post hoc test or Tukey’s post hoc Uptake of glucose by T. squamosa test, where appropriate. Statistical analysis of data was performed Experiments were designed to demonstrate glucose absorption in using SPSS Statistics version 19 (IBM Corporation, Armonk, NY, T. squamosa by monitoring the reduction in glucose concentration USA) with the significance level set at P<0.05. in the external medium, which represented the sum of glucose influx and efflux. It was not feasible to determine increases in glucose RESULTS concentration in the hemolymph related to glucose absorption, as SGLT1-like from T. squamosa: analysis of nucleotide the hemolymph has high and fluctuating concentrations of glucose sequence and deduced amino acid sequence (500–600 mmol l−1) owing to the donation of photosynthates, The full cDNA coding sequence of SGLT1-like consisting of 1946 bp including glucose, from zooxanthellae (Deane and O’Brien, 1980; was obtained from the ctenidium of T. squamosa (GenBank accession Rees et al., 1993a). Uptake of radiolabeled glucose was not adopted no.: MF073182). The deduced SGLT1-like of T. squamosa in the present study, because it would reflect at best the comprised 649 amino acids with an estimated molecular mass of unidirectional influx of exogenous glucose without information 72.4 kDa. It had the highest sequence similarity with the SGLTs of on the possible glucose efflux. molluscs (84.3–86.0%; Table 1), followed by those of brachiopods, Sixteen individuals of T. squamosa were randomly selected at the echinoderms, hemichordates and chordates (70.5–80.0%), but it had end of a 12 h:12 h light:dark regime, and transferred separately to clear low sequence similarity with the SGLTs of plants (30.7–34.6%). A plastic tanks (21.5×11.5×12.5 cm, length×width×height) in complete comparison with the SGLT sequence of the green alga darkness. Each plastic tank contained eight volumes (8×mass of Auxenochlorella protothecoides indicated only 34.6% similarity clam) of aerated artificial seawater, and the individual clam was (Table 1). Hence, it can be confirmed that the SGLT1-like obtained allowed to acclimatize therein for 2 h in darkness. Then, concentrated from T. squamosa was derived from the host clam and not the glucose solution was added to the artificial seawater to make a final zooxanthellae. concentration of 50 µmol l−1. Although natural seawater has relatively An alignment with SGLT1 sequences from other organisms low glucose concentrations (∼0.23 μmol l−1; Mopper et al., 1980), (Crassostrea gigas, Homo sapiens and Vibrio parahaemolyticus) preliminary results indicated that 50 µmol l−1 of exogenous glucose obtained from GenBank revealed that SGLT1-like of T. squamosa was needed for the giant clam to sustain a relatively linear uptake of contained five glucose-binding residues (D12, E85, D187, K306 and glucose for 6 h. Approximately 2 min was required for the glucose Q440) (Fig. 1). Moreover, it also contained five residues (N61, Y275, concentration to become homogeneous; hence, 2 min after the W276, S377 and S378) known to be involved in the binding of Na+ addition of glucose was taken as time 0. and sugar in human SGLT1-like. Particularly, the conserved residues To examine the effects of light on glucose uptake by T. squamosa, F436 and Q440 are known to contribute to urea permeability (Fig. 1). five giant clams were exposed to light at 100–105 µmol m−2 s−1,and The backbone carbonyls of the conserved residues A59 and I62 also another five giant clams were kept as controls in darkness. In order to contributed to the formation of the sugar-binding site, whereas examine whether urea would interfere with glucose absorption, three residues W274, Y275 and W276 (indicated in the open black box in individuals were exposed to light for 6 h in seawater containing Fig. 1) formed an aromatic triad contributing to the transport of sugar Journal of Experimental Biology

4 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

T. squamosa SGLT1-like C. gigas SGLT H. sapiens hSGLT1 V. parahaemolyticus vSGLT

Fig. 1. A multiple sequence alignment of sodium/glucose cotransporter 1-like (SGLT1-like) of Tridacna squamosa with SGLT1 of Crassostrea gigas (AAT44356.1), hSGLT1 of Homo sapiens (NP_000334.1) and vSGLT of Vibrio parahaemolyticus (AAF80602.1). Identical or similar residues are indicated by shading. An asterisk indicates residues involved in binding of sugar molecules. An open circle indicates residues involved in binding of both sugar and Na+. An open triangle indicates residues involved in the structural backbone of the sugar binding site. A shaded circle indicates residues involved in urea binding. The transmembrane regions (TM1 to TM14) are indicated in the underlined sections, and are predicted from TMpred server of the ExPASy portal. The open black box indicates the aromatic triad involved in the transport of sugar molecules. molecules. There were 14 predicted TMs in the SGLT1-like of Gene expression in various organs and tissues T. squamosa. A domain analysis using PROSITE (Sigrist et al., 2002) The SGLT1-like gene was strongly expressed in the ctenidium but denoted that SGLT1-like of T. squamosa displayed the profile of weakly expressed in the outer mantle, foot muscle and kidney of

Sodium/Solute Symporter 3 (SSS3) family transporters. T. squamosa kept in darkness for 12 h (Fig. 2). Journal of Experimental Biology

5 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

Ladder OM IM CT FM AM KID HP NTC Effects of light on the transcript level and protein abundance of ctenidial SGLT1-like/SGLT1-like The SGLT1-like transcript level in the ctenidium of T. squamosa exposed to light for 3, 6 or 12 h of light remained unchanged as 3 kb compared with the control kept in darkness for 12 h (Fig. 5). By contrast, there was a progressive, albeit insignificant, increase in 2 kb the protein abundance of SGLT1-like in the ctenidium of clams exposed to light for 3 or 6 h, and by the 12th hour of light exposure, the protein abundance of SGLT1-like increased 1 kb significantly (by ∼10-fold) as compared with the control kept in darkness (Fig. 6).

Effects of light exposure with or without urea on glucose 0.5 kb absorption in T. squamosa Without giant clams, the glucose concentration in seawater remained unchanged during the 6-h period. However, the glucose concentration in the seawater containing T. squamosa decreased almost linearly during 6 h of exposure to darkness Fig. 2. mRNA expression of SGLT1-like in the tissues of Tridacna (control) or light (N=5; Fig. 7A). The change in ambient squamosa kept in darkness for 12 h. Expression was measured in the outer glucose concentration was consistently greater in light than mantle (OM), inner mantle (IM), ctenidium (CT), foot muscle (FM), adductor in darkness, with significant differences between them at muscle (AM), kidney (KID) and hepatopancreas (HP). NTC, no template control. hours 4 and 6. At hour 4, the calculated rate of glucose absorption in individuals exposed to light was significantly Cellular localization of SGLT1-like in the ctenidium higher than that in individuals exposed to darkness (N=5; Immunofluorescence microscopy revealed that SGLT1-like was Fig. 7B). localized in the apical membrane of epithelial cells of the When T. squamosa were exposed to glucose plus urea (both at filaments (Fig. 3) and some epithelial cells of the water channels 50 µmol l−1), the decrease in ambient glucose concentration (Fig. 4) in the ctenidium of T. squamosa. An apparently stronger during exposure to light for 6 h was constantly and significantly apical anti-SGLT1-like immunofluorescence was observed in the lower than that of giant clams exposed to 50 µmol l−1 glucose only ctenidial filaments of giant clams exposed to 12 h of light than (N=3; Fig. 8A). At hour 6, the calculated rate of glucose that of the control kept in 12 h of darkness, with reproducible absorption in giant clams exposed to glucose plus urea was results being obtained from four individual clams for each significantly lower than that exposed to glucose without urea condition (Figs 3 and 4). (N=3; Fig. 8B).

ABC12 h light (DIC/DAPI) 12 h light (SGLT1-like) 12 h light (merged)

DEF12 h dark (DIC/DAPI) 12 h dark (SGLT1-like) 12 h dark (merged)

Fig. 3. Immunofluorescence localization of SGLT1-like in the ctenidial filaments (CFs) of the ctenidium of Tridacna squamosa exposed to 12 h of light or 12 h of darkness (control). Differential interference contrast (DIC) images overlaid with DAPI nuclei stain in blue show the histological structure of CFs that are arranged in parallel series (A,D). The green immunofluorescence represents SGLT1-like labeling (B,E). Merged images of DIC and DAPI with green SGLT1-like labeling are shown (C,F) with insets of higher magnification. Arrowheads denote SGLT1-like immunostaining of the apical membrane of the epithelial cells of CFs, where a stronger staining can be observed in the ctenidium of a giant clam exposed to light for 12 h (B,C) as compared with that exposed to darkness for 12 h (E,F). Reproducible results were obtained from four individual clams for each condition. Scale bars: 20 µm. Journal of Experimental Biology

6 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

ABC12 h light (DIC/DAPI) 12 h light (SGLT1-like) 12 h light (merged) WC

WC HL HL

DEF12 h dark (DIC/DAPI) 12 h dark (SGLT1-like) 12 h dark (merged)

WC HL

Fig. 4. Immunofluorescence localization of SGLT1-like in the tertiary water channels (WCs) of the ctenidium of Tridacna squamosa exposed to 12 h of light or 12 h of darkness (control). DIC images overlaid with DAPI nuclei stain in blue show the histological structure of lattice formation of collagenous connective tissue containing WCs lined with epithelial cells (A,D). The green immunofluorescence represents SGLT1-like labeling (B,E). Merged images of DIC and DAPI with green SGLT1-like labeling are shown (C,F) with insets of higher magnification. Arrowheads mark SGLT1-like immunostaining of the apical membrane of the epithelial cells lining the WCs, where a stronger staining can be observed in the ctenidium of a giant clam exposed to light for 12 h (B,C) as compared with that exposed to darkness for 12 h (E,F). Reproducible results were obtained from four individual clams for each condition. HL, hemolymph. Scale bars: 20 µm.

DISCUSSION discovered (Hediger et al., 1989). To date, 11 SGLT genes have been SGLT1-like from T. squamosa: molecular characterization identified in the human genome and at least six of them are known to There are two families of glucose transporters: SGLTs and be expressed as integral proteins in the plasma membrane (Wright facilitative glucose transporters (GLUTs). GLUTs transport and Turk, 2004). Homologs of some of these SGLTs have been glucose via facilitated diffusion, but SGLTs are secondary active identified in invertebrates, including shrimp, lobsters, horseshoe glucose transporters that tap into the electrochemical gradient of crabs, insects, snails, mussels and oysters (see Martínez-Quintana Na+ generated by Na+/K+-ATPase across the plasma membrane. and Yepiz-Plascencia, 2012 for a review). In the present study, we SGLT1 was first cloned by Hediger et al. (1987) from rabbit have successfully cloned the complete coding sequence of SGLT1- intestine, and soon after that the human SGLT1 analogue was like from the ctenidium of T. squamosa. SGLT1-like of T. squamosa comprised 14 predicted TMs, 20 corresponding to the 14 TMs characterized in SGLT1 of H. sapiens (Turk et al., 1996). SGLT1 is known to have an extracellular N-terminus (Turk et al., 1996), which contains a highly conserved 16 aspartate residue that is involved in sugar translocation (Turk et al., ) 2000). This aspartate residue (D12) is conserved in SGLT1-like of T. squamosa (Fig. 1). The hydrophobic C-terminus of SGLT1 is involved in the formation of a transmembrane helix (Turk et al., 12 total RNA 1996), which is also reflected in SGLT1-like of T. squamosa –1 (TM14; Fig. 1). Furthermore, SGLT1-like of T. squamosa contains the five conserved residues (D12, E85, D187, K306 and Q440) 8 involved in binding of sugar molecules (Loo et al., 2013). transcripts in the ctenidium copies ng

3 It also comprises residues (N61, Y275, W276, S377 and S378) + like 10

- that bind to Na and sugar (Loo et al., 2013), as well as residues ϫ ( 4 W274, Y275 and W276 (indicated by an open black box; Fig. 1) that form an aromatic triad crucial for both sugar and Na+ binding SGLT1 (Loo et al., 2013). As SGLT1 can also transport urea (Leung et al., 2000), which 0 12 h dark 3 h light 6 h light 12 h light may follow the path of sugar transport (Zeuthen et al., 2016), the (control) sugar-binding residues in SGLT1-like of T. squamosa may also bind with urea (Panayotova-Heiermann and Wright, 2001; Wright et al., Fig. 5. Transcript levels (×103 copies of transcripts per nanogram of total RNA) of SGLT1-like in the ctenidium of Tridacna squamosa kept in 2011). Moreover, residues F436 and Q440, which are conserved darkness for 12 h (control), or exposed to light for 3, 6 or 12 h. Results in SGLT1-like of T. squamosa, have been shown to contribute to represent means+s.e.m. (N=4). urea permeability (Zeuthen et al., 2016). Hence, SGLT1-like of Journal of Experimental Biology

7 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

A 12 h 3 h 6 h 12 h 12 h B Ladder dark light light light Ladder light (control) (PCA) 0.5

0.4 b

120 kDa 0.3 120 kDa a,b a,b 100 kDa 100 kDa 0.2

a 80 kDa 80 kDa 0.1

0 12 h dark 3 h light 6 h light 12 h light 60 kDa 60 kDa

SGLT1-like No band protein Relative normalized SGLT1-like (control) abundance in the ctenidium (arbitrary units)

50 kDa 50 kDa

40 kDa 40 kDa

50 kDa Tubulin

Fig. 6. Protein abundance of SGLT1-like in the ctenidium of Tridacna squamosa kept in darkness for 12 h (control), or exposed to light for 3, 6or12h.(A) Examples of immunoblot of SGLT1-like, with or without the anti-SGLT1-like antibody neutralized by the immunizing peptide, and with tubulin as the reference protein. (B) The intensity of the SGLT1-like band for 20 µg protein was normalized with respect to that of tubulin. Results represent means+s.e.m. (N=4). Means not sharing the same letter are significantly different (P<0.05).

T. squamosa can probably transport not only glucose, but also Light-enhanced expression of SGLT1-like in the ctenidium urea, with Na+ being used as a motive force to drive their indicates that T. squamosa can conduct light-enhanced active uptake. glucose absorption It has been reported that the protein expression level of SGLT1 in SGLT1-like is expressed predominantly in the ctenidium of the intestinal brush border of mammals can be upregulated by T. squamosa, and has an apical localization in the ctenidial glucose (Wood et al., 2000), and protein kinases (PKA and PKC) epithelial cells regulate the transport of SGLT1 by rapidly inserting it into the Many mollusks, including bivalves, cephalopods and aquatic plasma membrane (Turk and Wright, 1997). Similarly, SGLT1-like gastropods, possess a pair of ctenidia inside their mantle cavities. of oyster (C. gigas) is regulated according to trophic conditions, A ctenidium is primarily a respiratory organ in water, but can also including food abundance and quality (Hanquet et al., 2011). participate in filter feeding, ionoregulation and acid–base balance. Nevertheless, this is the first report on the upregulation of the protein In T. squamosa, the ctenidia are whitish in color, and each ctenidium abundance of SGLT1-like in the ctenidium of T. squamosa in consists of two demibranches (dorsal and ventral). The ctenidium is response to light. Our results indicate that SGLT1-like was regulated comb-shaped, and has a central part from which many filaments principally through translation, as light exposure did not have a protrude and line up in a row to increase the surface area for various significant effect on its transcript level. This differs from Dual physiological functions (Norton and Jones, 1992). The surface area Domain Carbonic Anhydrase (Koh et al., 2018), Glutamine is further increased by numerous water channels found below the Synthetase (Hiong et al., 2017a) and Na+/H+ Exchanger 3-like filaments inside the ctenidium. (Hiong et al., 2017b), of which both the transcript level and the The ctenidium of T. squamosa is known to express transporters protein abundance increase significantly in the ctenidium of and enzymes (Ip et al., 2015) related to nitrogen transport and T. squamosa during 12 h of light exposure. Overall, these results assimilation (DUR3-like, Chan et al., 2018; Ammonia corroborate the proposition that T. squamosa could perform light- Transporter 1, Boo et al., 2018; Glutamine Synthetase, Hiong enhanced glucose/urea absorption. et al., 2017a), inorganic carbon absorption (Dual Domain Carbonic Anhydrase; Koh et al., 2018) and proton excretion Light-enhanced glucose uptake in T. squamosa (Na+/H+ Exchanger 3-like, Hiong et al., 2017b; Vacuolar-type The hemolymph of giant clams is known to have very high H+-ATPase subunit A, Ip et al., 2018). In the present study, we concentrations of glucose (500–600 mmol l−1; Deane and O’Brien, demonstrated that SGLT1-like was expressed predominantly in 1980; Rees et al., 1993a) owing to the donation of photosynthates the ctenidium of T. squamosa. Importantly, SGLT1-like had an from zooxanthellae. Yet, T. squamosa could reduce the ambient apical localization in epithelial cells covering the ctenidial glucose concentration (50 mmol l−1) by 45% during 6 h of light filament and lining the tertiary water channels. These results exposure despite such a huge concentration gradient. Hence, it can denote that SGLT1-like is positioned to transport Na+ together be concluded that T. squamosa could actively absorb glucose form with glucose (or urea) from the ambient seawater into the the environment. Notably, the observation on the rate of glucose ctenidial epithelial cells, and suggest the ctenidium as the site of uptake being higher in light than in darkness is novel. Although active glucose uptake. glucose uptake is known to occur in non-symbiotic mussels Journal of Experimental Biology

8 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

A A 100 100 * 90 80 * * 80 60

70 * 40 60 * 20 in the external medium (%) the external medium (%) 50 Change in glucose concentration 0 Change in glucose concentration 40 0 2 4 6 0246 Time (h) Time (h) B 4 B 4 ) 3 –1 h

* –1 )

–1 3 2 * h –1 µmol g –2 2 10 1 ϫ µmol g ( –2 Rate of glucose uptake 10

ϫ 1 ( 0 Rate of glucose uptake 246 Time (h) 0 2 4 6 Fig. 8. Effects of urea on the absorption of glucose in Tridacna squamosa Time (h) in light. (A) The change in glucose concentration (%) in the external medium, containing glucose at an initial concentration of 0.05 mmol l−1, without clams Fig. 7. Effects of light on the absorption of glucose in Tridacna − (▵), with clams (○), or with clams and 0.05 mmol l 1 urea (●) for 2, 4 or 6 h. squamosa. (A) The change in glucose concentration (%) in the external −2 −1 −1 −1 (B) The rate of glucose absorption (×10 µmol g h )byT. squamosa at medium, containing glucose at an initial concentration of 0.05 mmol l , − hour 2, 4 or 6 in seawater containing 0.05 mmol l 1 glucose (open bars) or without clams (▵), or with clams exposed to light (○) or darkness (●; control) − − 0.05 mmol l 1 glucose+0.05 mmol l 1 urea (closed bars). Results represent for 2, 4 or 6 h. (B) The rate of glucose absorption (×10−2 µmol g−1 h−1)by means+s.e.m. (N=3). *Significantly different from clams exposed to T. squamosa at hour 2, 4 or 6 of exposure to darkness (closed bars; control) − 0.05 mmol l 1 glucose at the specific time point (P<0.05). or light (open bars). Results represent means±s.e.m. (N=5). *Significantly different from clams kept in darkness at the specific time point (P<0.05). uptake obtained for T. squamosa is non-physiological, although (Péquignat, 1973) and oysters (Bamford and Gingles, 1974), there is its ability to absorb glucose is affirmed. However, in effect, the no indication of it being a light-dependent process. Scleractinian absorption rate of glucose should be defined by the concentrations of corals (e.g. Fungia) can also absorb glucose from the external glucose in the unstirred mucus layer covering the ctenidial epithelium, medium (Stephens, 1960, 1962), but the possibility of it being and not the glucose concentrations in the ambient seawater. enhanced by light has not been explored. In scleractinian corals, the oral ectoderm, consisting of Natural seawater contains dissolved organic molecules that multiple specialized cells such as cnidocytes, mucocytes and comprise a wide variety of carbohydrates, lipids, amino acids, as epitheliomuscular cells (Fautin and Mariscal, 1991), is involved in well as vitamins and hormones (Duursma, 1965). Specifically, the transport of Ca2+ into calicoblastic cells associated with calcification glucose is the major monosaccharide in seawater (Ittekkot et al., (Tambutté et al., 2007). During insolation, the Ca2+ concentration (14.5 1981), derived largely from oligosaccharide hydrolysis. ±0.7 mmol l−1)inthe10–20 μm thick mucus layer coating the oral Phytoplankton produces and stores glucan oligosaccharides (Lewin, ectoderm is consistently higher than that (11.3±0.3 mmol l−1)inthe 1974), which can be released to the ambient seawater through ambient seawater (Clode and Marshall, 2002). Hence, the existence of a exudation or cell lysis. The degradation of these glucan mucus boundary between the seawater and oral ectoderm could oligosaccharides in seawater produces monosaccharides including facilitate the efficient absorption of Ca2+ into the oral ectodermal cells. glucose. Generally, the concentration of glucose in open seawater Similarly, type 2 and type 3 mucin gland cells have been identified in ranges between 10−6 and 10−8 mol l−1 (Vaccaro et al., 1968). the ctenidium of T. squamosa, and these cells can secrete mucus onto Although the glucose concentration can be higher in waters around surfaces of the epithelial cells lining the filaments and water channels coral reefs owing to both algal and coral exudations that contain (Norton and Jones, 1992). If the microbiome of the ctenidial surface can saccharides, proteins and lipids (Haas and Wild, 2010; Nelson et al., perform oligosaccharide degradation, the glucose concentration in the 2013), it is unlikely to reach the concentration of 0.05 mmol l−1 mucus layer could be higher than that in the seawater, but the adopted in this study. Therefore, it is possible that the rate of glucose confirmation of this proposition awaits future study. Journal of Experimental Biology

9 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

Possible relationships between nutrient cycling by the Exogenous glucose uptake may support the metabolic surface microbiome of the ctenidium and glucose uptake needs of the ctenidium The assimilation of dissolved organic matter by sponge holobionts The ctenidium of T. squamosa is metabolically active owing to its is known to facilitate the cycling of dissolved organic matters in important roles in, for example, inorganic carbon absorption (Koh benthic habitats (de Goeij et al., 2013). Microbes contribute to this et al., 2018), excretion of excess H+ (Hiong et al., 2017b; Ip et al., assimilation process (Rix et al., 2016), accounting for ∼90% of the 2018), and nitrogen transport and assimilation (Chan et al., 2018; holobiont’s total heterotrophic carbon uptake (Morganti et al., Boo et al., 2018; Hiong et al., 2017a). It contains few zooxanthellae, 2017; Hoer et al., 2018). In corals, the associated microbial and is located inside the mantle cavity with no direct exposure to communities are also important components of the coral sunlight. Although the ctenidium can undoubtedly receive some holobionts (Leggat et al., 2007; Rosenberg et al., 2007), as they photosynthates from the outer mantle through the hemolymph, participate in nutrient cycling and influence coral health and these two organs are separated far apart. Importantly, other tissues diseases (Rosenberg and Loya, 2004; Rosenberg et al., 2007). such as the inner mantle, which adjoins the outer mantle and Kimes et al. (2010) analyzed the microbiome associated with conducts light-enhanced shell formation, would also compete for the scleractinian coral Montastraea faveolata and detected nutrients, especially during insolation. Therefore, the expression of 134 ribulose-1,5-bisphosphate carboxylase/oxygenase genes SGLT1-like in the ctenidium could be advantageous to symbiotic (RuBisCO) of archaea and bacteria origins, indicating that these T. squamosa, as the absorbed glucose can specifically fuel the microbes could fix CO2 and produce organic compounds through metabolic needs of this organ. It is possible that the problem photosynthesis (Berg et al., 2002). Furthermore, Kimes et al. concerning low ambient glucose concentrations could be remedied (2010) detected 825 microbial genes involved in polysaccharide by the activities of its surface microbiome. degradation, including bacterial, archaeal and fungal cellulases (359 sequences), chitinases (206 sequences), mannanases (55 Ctenidial SGLT1-like may also participate in urea absorption sequences) and polygalactases (63 sequences). Degradation of in symbiotic T. squamosa to benefit the nitrogen-deficient polysaccharide by these microbes could release glucose and other zooxanthellae monosaccharides close to the surface of the host. In fact, the It has been established that SGLT1 can transport urea in addition to ability of microbes to metabolize nutrients, which can then be glucose (Leung et al., 2000; Panayotova-Heiermann and Wright, translocated to their host, is likely a driver in the establishment of 2001), with the coupling of urea transport to its cotransport cycle coral-associated microbial assemblages. Assuming that the surface (Zeuthen et al., 2001). This could explain why urea interfered with microbiome of giant clams can do the same, the concentration of light-enhanced glucose absorption in T. squamosa, and the rate of glucose in the mucus layer covering the ctenidial epithelium could glucose uptake in individuals exposed to glucose+urea was be higher than that in the ambient seawater, rendering an effective lower than that in individuals exposed to glucose only. Although uptake of glucose though SGLT1-like. the host clam benefits from photosynthates donated by symbiotic However, the contribution of light-enhanced glucose zooxanthellae (Streamer et al., 1993), the symbionts require a absorption through ctenidial SGLT1-like to the overall supply of nutrients from the host (Furla et al., 2005). Specifically, metabolic needs of the host clam could be inconsequential the host clam would need to absorb exogenous nitrogen and when compared with the donation of carbohydrates, including supply it to the symbiotic zooxanthellae, which are nitrogen glucose, from the photosynthesizing zooxanthellae (Rees et al., deficient. Dissolved inorganic nitrogen is present in seawater 1993a; Ishikura et al., 1999). In fact, it has been established as ammonium, nitrite and nitrate, whereas dissolved organic that the photosynthates transferred from the symbionts to the nitrogen is represented mainly by urea and amino acids. In reef host clam can satisfy ∼100% of the host’s energy requirements environments, urea concentrations range between 0.2 and (Fisher et al., 1985; Klumpp et al., 1992). Therefore, the 2.0 µmol N l−1 (Wafar et al., 1986; Beauregard, 2004), but the physiological significance of active glucose absorption in urea concentration in the mucus covering the ctenidial epithelium symbiotic T. squamosa is obscure. Nonetheless, there could of T. squamosa could be higher, attributable to the activities of its be three physiological reasons, related separately to the microbiome. Indeed, nitrogen cycling is often cited as a probable metabolic needs of the aposymbiotic larva, the ctenidium and role filled by the microbial community of coral reefs (Rosenberg the zooxanthellae. et al., 2007), and bacteria are known to produce and excrete urea (Pedersen et al., 1993). Exogenous glucose uptake may be essential for the survival Recently, it has been demonstrated that T. squamosa can perform of aposymbiotic larvae light-enhanced urea absorption, and its ctenidium expresses a urea- Giant clam larvae are aposymbiotic, and they acquire symbiotic active (energy-dependent) transporter, DUR3-like, of animal origin zooxanthellae only during the veliger stage through filter feeding (Chan et al., 2018). Urea can be a good nitrogen source for the (Fitt and Trench, 1981; Heslinga et al., 1984; Mies and Sumida, symbiotic zooxanthellae because it contains two nitrogen atoms and 2012). It has been reported that veliger larvae of oyster (C. gigas) one carbon atom (H2NCONH2), and zooxanthellae possess urease, and red abalone (Haliotis rufescens) absorb glucose and some which can catabolize urea. The degradation of urea by urease in other complex sugars from the external medium, which allows zooxanthellae releases NH3 to support amino acid metabolism and them to utilize a greater part of the dissolved organic material in CO2 to sustain photosynthesis. Therefore, it would be beneficial for the sea as a source of nutrition (Welborn and Manahan, 1990). T. squamosa to possess multiple mechanisms in the ctenidium, Therefore, it is probable that the absorption of exogenous glucose including DUR3-like and SGLT1-like, to absorb urea from the through SGLT1-like in the rudimentary ctenidium contributes to ambient seawater. Notably, the competition between glucose and the successful survival of giant clam larvae, which needs to be urea for transport by SGLT1-like would be defined by the confirmed in future studies. Nevertheless, this could lead to the transporter’s kinetic properties towards these two substrates, as retention of SGLT1-like expression in the ctenidium of symbiotic well as the effective concentrations of these two substrates in the

T. squamosa. vicinity of the transporter. Journal of Experimental Biology

10 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

Conclusions de Goeij, J. M., van Oevelen, D., Vermeij, M. J. A., Osinga, R., Middelburg, J. J., Tridacna squamosa expresses SGLT1-like in its ctenidia, and the de Goeij, A. F. P. M. and Admiraal, W. (2013). Surviving in a marine desert: the sponge loop retains resources within coral reefs. Science 342, 108-110. protein abundance of SGLT1-like is upregulated by light exposure. It Duursma, E. K. (1965). The dissolved organic constituents of seawater. In also increases the absorption of glucose from the ambient seawater in Chemical Oceanography, Vol. 1 (ed. J. P. Riley and G. Skirrow), pp. 433-475. response to light. When taken together with information in the New York: Academic Press. Fankboner, P. V. and Reid, R. G. B. (1986). Nutrition in giant clams (Tridacnidae). literature, it can be concluded that the ctenidium of T. squamosa is not In The Bivalvia-Proceedings of a Memorial Symposium in Honour of Sir Charles simply a respiratory organ, as it also participates in various absorptive Maurice Yonge, Edinburgh, 1986 (ed. B. Morton), pp. 195-209. Hong Kong: Hong and excretory processes. Many of these processes are light dependent Kong University Press. and they involve enzymes and transporters that can respond to light Fautin, D. G. and Mariscal, R. N. (1991). Cnidaria: Anthozoa. In Microscopic Anatomy of Invertebrates, Vol. 2 (ed. F. W. Harrison and J. A. Westfall), pp. through transcriptional and/or translational changes. Such phenomena 267-358. New York: Wiley-Liss. probably stem from the symbiotic association of the clam host with Ferguson, J. C. (1967). An autoradiographic study of the utilization of free phototrophic zooxanthellae, as the light-dependent properties of these exogenous amino acids by starfishes. Biol. Bull. 33, 317-329. enzymes and transporters would allow the host to react to light in Fisher, C. R., Fitt, W. K. and Trench, R. K. (1985). Photosynthesis and respiration in Tridacna gigas as a function of irradiance and size. Biol. Bull. 169, 230-245. synchrony with the photosynthetic activity of its symbionts. Fitt, W. K. (1993). Nutrition of giant clams. In Biology and Mariculture of Giant Clams, ACIAR Proceedings no. 47 (ed. W. K. Fitt), pp. 31-40. Canberra: Australian Competing interests Centre for International Agricultural Research. The authors declare no competing or financial interests. Fitt, W. K. and Trench, R. K. (1981). Spawning, development, and acquisition of zooxanthellae by Tridacna squamosa (Mollusca: Bivalvia). Biol. Bull. 161, 213-235. ̀ Author contributions Furla, P., Allemand, D., Shick, J. M., Ferrier-Pages, C., Richier, S., Plantivaux, A., Merle, P. L. and Tambutté,S.(2005). The symbiotic anthozoan: a Conceptualization: Y.K.I.; Methodology: Y.K.I.; Validation: C.Y.L. Chan, K.C.H., physiological chimera between alga and animal. Integr. Comp. Biol. 45, 595-604. C.Y.L. Choo, M.V.B.; Formal analysis: C.Y.L. Chan, K.C.H., C.Y.L. Choo, M.V.B., Gorboulev, V. I., Schürmann, A., Vallon, V., Kipp, H., Jaschke, A., Klessen, D., S.F.C., Y.K.I.; Investigation: C.Y.L. Chan, K.C.H., C.Y.L. Choo, M.V.B.; Resources: Friedrich, A., Scherneck, S., Rieg, T., Cunard, R. et al. (2012). Na+-D-glucose W.P.W., S.F.C.; Data curation: C.Y.L. Chan, K.C.H., C.Y.L. Choo, M.V.B., W.P.W., cotransporter SGLT1 is pivotal for intestinal glucose absorption and glucose- Y.K.I.; Writing - original draft: C.Y.L. Chan, Y.K.I.; Writing - review & editing: dependent incretin secretion. Diabetes 61, 187-196. C.Y.L. Chan, K.C.H., C.Y.L. Choo, M.V.B., S.F.C., Y.K.I.; Visualization: C.Y. Chan, Griffiths, C. L. Klumpp, D. W. (1996). Relationships between size, mantle area and K.C.H., C.Y.L. Choo, M.V.B., S.F.C.; Supervision: W.P.W., S.F.C., Y.K.I.; Project zooxanthellae numbers in five species of giant clam (Tridacnidae). Mar. Ecol. administration: Y.K.I.; Funding acquisition: YK.I. Prog. Ser. 137, 139-147. Haas, A. F. and Wild, C. (2010). Composition analysis of organic matter released by Funding cosmopolitan coral reef-associated green algae. Aquatic. Biol. 10, 131-138. This study was supported by the Ministry of Education - Singapore through a grant Hanquet, A.-C., Jouaux, A., Heude, C., Mathieu, M. and Kellner, K. (2011). A (R-154-000-A37-114) to Y.K.I. sodium glucose co-transporter (SGLT) for glucose transport into Crassostrea gigas vesicular cells: impact of alimentation on its expression. Aquaculture 313, 123-128. References Hediger, M. A., Coady, M. J., Ikeda, T. S. and Wright, E. M. (1987). Expression + Ahearn, G. A. and Gomme, J. (1975). Transport of exogenous D-glucose by the cloning and cDNA sequencing of the Na /glucose co-transporter. Nature 330, integument of a polychaete worm (Nereis diversicolor Muller). J. Exp. Biol. 62, 379-381. Hediger, M. A., Budarf, M. L., Emanuel, B. S., Mohandas, T. K. and Wright, E. M. 243-264. + Baillie, B. K. and Yellowlees, D. (1998). Characterization and function of carbonic (1989). Assignment of the human intestinal Na /glucose cotransporter gene → anhydrase in the zooxanthellae–giant clam symbiosis. Proc. Biol. Sci. 265, 465-473. (SGLT1) to the q11.2 qter region of chromosome 22. Genomics 4, 297-300. Bamford, D. R. and Gingles, R. (1974). Absorption of sugar in the gill of the Hernawan, U. E. (2008). Symbiosis between the giant clams (Bivalvia: Cardiidae) and zooxanthallae (Dinophyceae). Biodiversitas 9, 53-58. Japanese oyster, Crassostrea gigas. Comp. Biochem. Physiol. A. 49, 637-646. Heslinga, G. A., Perron, F. E. and Orak, O. (1984). Mass culture of giant clams Bankir, L. and Yang, B. (2012). New insights into urea and glucose handling by the (f. Tridacnidae) in Palau. Aquaculture 39, 197-215. kidney, and the urine concentrating mechanism. Kidney Int. 81, 1179-1198. Hiong, K. C., Choo, C. Y. L., Boo, M. V., Ching, B., Wong, W. P., Chew, S. F. and Beauregard, A. Y. (2004). Biogeochemical cycling of carbon and nitrogen by the Ip, Y. K. (2017a). A light-dependent ammonia-assimilating mechanism in the coral–zooxanthellae symbiosis. PhD thesis, University of Delaware. ctenidia of a giant clam. Coral Reefs 36, 311-323. Berg, J. M., Tymoczko, J. L. and Stryer, L. (2002). Biochemistry. New York: W.H. Hiong, K. C., Cao-Pham, A. H., Choo, C. Y. L., Boo, M. V., Wong, W. P., Chew, Freeman and Company. S. F. and Ip, Y. K. (2017b). Light-dependent expression of a Na+/H+ exchanger Bergmeyer, H. U., Bernt, E., Schmidt, F. and Stork, H. (1974). D-Glucose. In 3-like transporter in the ctenidium of the giant clam, Tridacna squamosa, can be Methods of Enzymatic Analysis, Vol. 3 (ed. H. U. Bergmeyer and K. Gawehn), pp. related to increased H+ excretion during light-enhanced calcification. Physiol. 1196-1201. Weinheim: Verlag Chemie. Rep. 5, e13209. Boo, M. V., Hiong, K. C., Choo, C. Y. L., Cao-Pham, A. H., Wong, W. P., Chew, S. F. Hoer, D. R., Gibson, P. J., Tommerdahl, J. P., Lindquist, N. L. and Martens, C. S. and Ip, Y. K. (2017). The inner mantle of the giant clam, Tridacna squamosa, (2018). Consumption of dissolved organic carbon by Caribbean reef sponges. + + α expresses a basolateral Na /K -ATPase -subunit, which displays light-dependent Limnol. Oceanogr. 63, 337-351. gene and protein expression along the shell-facing epithelium. PLoS ONE 12, Huvet, A., Herpin, A., Dégremont, L., Labreuche, Y., Samain, J.-F. and e0186865. Cunningham, C. (2004). The identification of genes from the oyster Boo, M. V., Hiong, K. C., Goh, E. J. K., Choo, C. Y. L., Wong, W. P., Chew, S. F. Crassostrea gigas that are differentially expressed in progeny exhibiting and Ip, Y. K. (2018). The ctenidium of the giant clam, Tridacna squamosa, opposed susceptibility to summer mortality. Gene 343, 211-220. expresses an ammonium transporter 1 that displays light-suppressed gene and Ip, Y. K., Ching, B., Hiong, K. C., Choo, C. Y., Boo, M. V., Wong, W. P. and Chew, protein expression and may be involved in ammonia excretion. J. Comp. Physiol. S. F. (2015). Light induces changes in activities of Na+/K+-ATPase, H+/K+-ATPase B 188, 765-777. and glutamine synthetase in tissues involved directly or indirectly in light-enhanced Chan, C. Y. L., Hiong, K. C., Boo, M. V., Choo, C. Y. L., Wong, W. P., Chew, S. F. and calcification in the giant clam, Tridacna squamosa. Front. Physiol. 6,68. Ip, Y. K. (2018). Light exposure enhances urea absorption in the fluted giant clam, Ip, Y. K., Hiong, K. C., Goh, E. J. K., Boo, M. V., Choo, C. Y. L., Ching, B., Wong, Tridacna squamosa, and up-regulates the protein abundance of a light-dependent W. P. and Chew, S. F. (2017a). The whitish inner mantle of the giant clam, Tridacna urea active transporter, DUR3-like, in its ctenidium. J. Exp. Biol. 221, jeb176313. squamosa, expresses an apical plasma membrane Ca2+-ATPase (PMCA) which Chew, S. F., Koh, C. Z. Y., Hiong, K. C., Choo, C. Y. L., Wong, W. P., Neo, M. L. and displays light-dependent gene and protein expressions. Front. Physiol. 8,781. Ip, Y. K. (2019). Light-enhanced expression of Carbonic Anhydrase 4-like supports Ip, Y. K., Koh, C. Z. Y., Hiong, K. C., Choo, C. Y. L., Boo, M. V., Wong, W. P., Neo, shell formation in the fluted giant clam Tridacna squamosa. Gene 683, 101-112. M. L. and Chew, S. F. (2017b). Carbonic anhydrase 2-like in the giant clam, Clode, P. L. and Marshall, A. T. (2002). X-ray microanalysis of calcium in a Tridacna squamosa: characterization, localization, response to light, and possible scleractinian coral. J. Exp. Biol. 205, 3543-3553. role in the transport of inorganic carbon from the host to its symbionts. Physiol. Davis, J. P. and Stephens, G. C. (1984). Uptake of free amino acids by bacteria- Rep. 5, e13494. free larvae of the sand dollar Dendraster excentricus. Am J. Physiol. 247, Ip, Y. K., Hiong, K. C., Lim, L. J. Y., Choo, C. Y. L., Boo, M. V., Wong, W. P., Neo, R733-R739. M. L. and Chew, S. F. (2018). Molecular characterization, light-dependent Deane, E. M. and O’Brien, R. W. (1980). Composition of the hemolymph of expression, and cellular localization of a host vacuolar-type H+-ATPase (VHA)

Tridacna maxima (Mollusca: Bivalvia). Comp. Biochem. Physiol. 66A, 339-341. subunit A in the giant clam, Tridacna squamosa, indicate the involvement of the Journal of Experimental Biology

11 RESEARCH ARTICLE Journal of Experimental Biology (2019) 222, jeb195644. doi:10.1242/jeb.195644

host VHA in the uptake of inorganic carbon and its supply to the symbiotic Péquignat, E. (1973). A kinetic and autoradiographic study of the direct assimilation zooxanthellae. Gene 659, 137-148. of amino acids and glucose by organs of the mussel Mytilus edulis. Mar. Biol. 19, Ishikura, M., Adchi, K. and Maruyama, T. (1999). Zooxanthellae release glucose in 227-244. the tissue of a giant clam, Tridacna crocea. Mar. Biol. 133, 665-673. Putter, A. F. R. (1909). Die Ernährung der Wassertiere und der Stoffhaushaft der Ittekkot, V., Brockmann, U., Michaelis, W. and Degens, E. (1981). Dissolved free Gewasser. Jena: Fischer. and combined carbohydrates during a phytoplankton bloom in the North Sea. Mar Rees, T. A. V., Fitt, W. K., Baillie, B. and Yellowlees, D. (1993a). A method for Ecol. Prog. Ser. 4, 299-305. temporal measurement of hemolymph composition in the giant clam symbiosis Kimes, N. E., Van Nostrand, J. D., Weil, E., Zhou, J. Z. and Morris, P. J. (2010). and its application to glucose and glycerol levels during a diel cycle. Limnol. Microbial functional structure of Montastraea faveolata, an important Caribbean Oceanogr. 38, 213-217. reef-building coral, differs between healthy and yellow-band diseased colonies. Rees, T. A. V., Fitt, W. K. and Yellowlees, D. (1993b). The haemolymph and its Environ. Microbiol. 12, 541-556. temporal relationship with zooxanthellae metabolism in the giant clam symbiosis. Klumpp, D. W., Bayne, B. L. and Hawkins, A. J. S. (1992). Nutrition of the giant In Biology and Mariculture of Giant Clams (ed. W. K. Fitt), pp. 41-45. Canberra: clam Tridacna gigas (L.) I. Contribution of filter feeding and photosynthates to Pirie Printers. respiration and growth. J. Exp. Mar. Biol. Ecol. 155, 105-122. Reid, R. G. B., Fankboner, P. V. and Brand, D. G. (1984). Studies on the Koh, C. Z. Y., Hiong, K. C., Choo, C. Y. L., Boo, M. V., Wong, W. P., Chew, S. F., physiology of the giant clam Tridacna gigas Linné—I. Feeding and digestions. Neo, M. L. and Ip, Y. K. (2018). Molecular characterization of a Dual Domain Comp. Biochem. Physiol. 78, 95-101. Carbonic Anhydrase from the ctenidium of the giant clam, Tridacna squamosa, Rix, L., de Goeij, J. M., van Oevelen, D., Struck, U., Al-horani, F. A., Wild, C. and and its expression levels after light exposure, cellular localization, and possible Naumann, M. S. (2016). Differential recycling of coral and algal dissolved organic role in the uptake of exogenous inorganic carbon. Front. Physiol. 9, 281. matter via the sponge loop. Funct. Ecol. 31, 778-789. LaJeunesse, T. C., Parkinson, J. E., Gabrielson, P. W., Jeong, H. J., Reimer, Rosenberg, E., Koren, O., Reshef, L., Efrony, R. and Zilber-Rosenberg, I. (2007). J. D., Voolstra, C. R. and Santos, S. R. (2018). Systematic revision of Symbiodiniaceae highlights the antiquity and diversity of coral endosymbionts. The role of microorganisms in coral health, disease and evolution. Nature 5, 355-362. Curr. Biol. 28, 2570-2580. Rosenberg, E. and Loya, Y. (2004). Coral Health and Disease. New York: Leggat, W., Marendy, E. M., Baillie, B., Whitney, S. M., Ludwig, M., Badger, M. R. Springer-Verlag. and Yellowlees, D. (2002). Dinoflagellate symbioses: strategies and adaptations Sano, Y., Kobayashi, S., Shirai, K., Takahata, N., Matsumoto, K., Watanabe, T., for the acquisition and fixation of inorganic carbon. Funct. Plant Biol. 29, 309-322. Sowa, K. and Iwai, K. (2012). Past daily light cycle recorded in the strontium/ Leggat, W., Dixon, R., Saleh, S. and Yellowlees, D. (2005). A novel carbonic calcium ratios of giant clam shells. Nat. Commun. 3, 761. anhydrase from the giant clam Tridacna gigas contains two carbonic anhydrase Sigrist, C. J., Cerutti, L., Hulo, N., Gattiker, A., Falquet, L., Pagni, M., Bairoch, A. domains. FEBS J. 272, 3297-3305. and Bucher, P. (2002). PROSITE: a documented database using patterns and Leggat, W., Ainsworth, T., Bythell, J. C., Dove, S., Gates, R. D., Hoegh- profiles as motif descriptors. Brief. Bioinform. 3, 265-274. Guldberg, O., Iglesias-Prieto, R. and Yellowlees, D. (2007). The hologenome Stephens, G. C. (1960). Uptake of glucose from solution by the solitary coral, theory disregards the coral holobiont. Nat. Rev. Microbiol. 5, 826. Fungia. Science 131, 1532. Leung, D. W., Loo, D. D. F., Hirayama, B. A., Zeuthen, T. and Wright, E. M. (2000). Stephens, G. C. (1962). Uptake of organic material by aquatic invertebrates. I. Uptake Urea transport by cotransporters. J. Physiol. 528, 251-257. of glucose by the solitary coral, Fungia scutaria. Biol. Bull. 23, 648-660. Lewin, R. A. (1974). Biochemical taxonomy. In Algal Physiology and Biochemistry Stephens, G. C. and Schinske, R. A. (1961). Uptake of amino acids by marine (ed. D. W. P. Stewart), pp. 1-39. Oxford: Blackwell Scientific Publications. invertebrates. Limnol. Oceanogr. 6, 175-181. Loo, D. D. F., Jiang, X., Gorraitz, E., Hirayama, B. A. and Wright, E. M. (2013). Streamer, M., McNeil, Y. R. and Yellowlees, D. (1993). Photosynthetic carbon Functional identification and characterization of sodium binding sites in Na dioxide fixation in zooxanthellae. Mar. Biol. 115, 195-198. symporters. Proc. Natl. Acad. Sci. USA 110, 4557-4566. Takabayashi, M., Santos, S. R. and Cook, C. B. (2004). Mitochondrial DNA Lucas, J. S., Nash, W. J., Crawford, C. M. and Braley, R. D. (1989). Environmental phylogeny of the symbiotic dinoflagellates (Symbiodinium, Dinophyta). J. Phycol. influences on growth and survival during the ocean-nursery rearing of giant clams, 40, 160-164. Tridacna gigas. Aquaculture 80, 45-61. Tambutté, E., Allemand, D., Zoccola, D., Meibom, A., Lotto, S., Caminiti, N. and Manahan, D. T. (1989). Amino acid fluxes to and from seawater in axenic veliger Tambutté,S.(2007). Observations of the tissue-skeleton interface in the larvae of a bivalve (Crassostrea gigas). Mar. Ecol. Prog. Ser. 53, 247-255. scleractinian coral Stylophora pistillata. Coral Reefs 26, 517-529. Martınez-Quintana,́ J. A. and Yepiz-Plascencia, G. (2012). Glucose and other Trench, R. K. (1987). Dinoflagellates in non-parasitic symbiosis. In The Biology of hexoses transporters in marine invertebrates: a mini review. Electron Dinoflagellates (ed. F. J. R. Taylor), pp. 530-570. Oxford: Blackwell Scientific. J. Biotechnol. 15. Turk, E. and Wright, E. M. (1997). Membrane topology motifs in the SGLT Mies, M. and Sumida, P. Y. G. (2012). Giant clam aquaculture: a review on induced cotransporter family. J. Membr. Biol. 159, 1-20. spawning and larval rearing. Int. J. Mar. Sci. 2, 62-69. Turk, E., Kerner, C. J., Lostao, M. P. and Wright, E. M. (1996). Membrane topology Mopper, K., Dawson, R., Liebezeit, G. and Ittekkot, V. (1980). The of the human Na+/glucose cotransporter SGLT1. J. Biol. Chem. 271, 1925-1934. monosaccharide spectra of natural waters. Mar. Chem. 10, 55-66. Turk, E., Kim, O., le Coutre, J., Whitelegge, J. P., Eskandari, S., Lam, J. T., Morganti, T., Coma, R., Yahel, G. and Ribes, M. (2017). Trophic niche separation that Kreman, M., Zampighi, G., Faull, K. F. and Wright, E. M. (2000). Molecular facilitates co-existence of high and low microbial abundance sponges is revealed by characterization of Vibrio parahaemolyticus vSGLT: a model for sodium-coupled in situ study of carbon and nitrogen fluxes. Limnol. Oceanogr. 62, 1963-1983. sugar cotransporters. J. Biol. Chem. 275, 25711-25716. Nelson, C. E., Goldberg, S. J., Kelly, L. W., Haas, A. F., Smith, J. E., Rohwer, F. Vaccaro, R. F., Hicks, S. E., Jannasch, H. W. and Carey, F. G. (1968). The and Carlson, C. A. (2013). Coral and macroalgal exudates vary in neutral sugar occurrence and role of glucose in seawater. Limnol. Oceanogr. 13, 356-360. composition and differentially enrich reef bacterioplankton lineages. ISME J. 7, Wafar, M. V. M., Wafar, S. and Devassy, V. P. (1986). Nitrogenous nutrients and 962-979. primary production in a tropical oceanic environment. Bull. Mar. Sci. 38, 273-284. Neo, M. L., Wabnitz, C. C. C., Braley, R. D., Heslinga, G. A., Fauvelot, C., Welborn, J. R. and Manahan, D. T. (1990). Direct measurements of sugar uptake Wynsberge, S. V., Andrefouet, S., Waters, C., Tan, A. S. H., Gomez, E. et al. from seawater into molluscan larvae. Mar. Ecol. Prog. Ser. 65, 233-239. (2017). Giant clams (Bivalvia: Cardiidae: Tridacninae): a comprehensive update Wilkerson, F. P. and Trench, R. K. (1986). Uptake of dissolved inorganic nitrogen by of species and their distribution, current threats and conservation status. Oceanogr. Mar. Biol. 55, 87-387. the symbiotic clam Tridacna gigas and the coral Acropora sp. Mar. Biol. 93, 237-246. Norton, J. H. and Jones, G. W. (1992). The Giant Clam: an Anatomical and Wood, I. S., Dyer, J., Hofmann, R. R. and Shirazi-Beechey, S. P. (2000). + Histological Atlas. Canberra: Australian Centre for International Agricultural Expression of the Na /glucose co-transporter (SGLT1) in the intestine of domestic ̈ Research. and wild ruminants. Pflugers Arch. 441, 155-162. Norton, J. H., Shepherd, M. A., Long, H. M. and Fitt, W. K. (1992). The Wright, E. M., Loo, D. D. F. and Hirayama, B. A. (2011). Biology of human sodium zooxanthellal tubular system in the giant clam. Biol. Bull. 183, 503-506. glucose transporters. Physiol. Rev. 91, 733-794. Pajor, A. M., Moon, D. A. and Wright, S. H. (1989). Sodium D-glucose cotransport Wright, E. M. and Turk, E. (2004). The sodium glucose cotransport family SLC5. in the gill of marine mussels: studies with intact tissue and brush border Pflügers Arch. 447, 510-518. membrane vesicles. J. Membr. Biol. 107, 77-88. Yellowlees, D., Rees, T. A. V. and Leggat, W. (2008). Metabolic interactions Panayotova-Heiermann, M., Loo, D. D. F., Kong, C. T., Lever, J. E., and Wright, between algal symbionts and invertebrate hosts. Plant Cell Environ. 31, 679-694. E. M. (1996). Sugar binding to Na+/glucose cotransporters is determined by the Zeuthen, T., Meinild, A.-K., Loo, D. D. F., Wright, E. M. and Klaerke, D. A. (2001). carboxyl-terminal half of the protein. J. Biol. Chem. 271, 10029-10034. Isotonic transport by the Na+–glucose cotransporter SGLT1 from humans and Panayotova-Heiermann, M. and Wright, E. M. (2001). Mapping the urea channel rabbit. J. Physiol. 531, 631-644. through the rabbit Na+-glucose cotransporter SGLT1. J. Physiol. 535, 419-425. Zeuthen, T., Gorraitz, E., Her, K., Wright, E. M. and Loo, D. D. F. (2016). Structural Pedersen, H., Lomstein, B. A. and Blackburn, T. H. (1993). Evidence for bacterial and functional significance of water permeation through cotransporters. Proc. urea production in marine sediments. FEMS Microbiol. Ecol. 12, 51-59. Natl. Acad. Sci. USA 113, E6887-E6894. Journal of Experimental Biology