DOCSLIB.ORG

Association of Trypanosoma Vivax in Extracellular Sites with Central

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Association of Trypanosoma Vivax in Extracellular Sites with Central Batista et al. Veterinary Research 2011, 42:63 http://www.veterinaryresearch.org/content/42/1/63 VETERINARY RESEARCH RESEARCH Open Access Association of Trypanosoma vivax in extracellular sites with central nervous system lesions and changes in cerebrospinal fluid in experimentally infected goats Jael S Batista1*, Carla MF Rodrigues1, Herakles A García2, Francisco SB Bezerra1, Robério G Olinda1, Marta MG Teixeira2 and Benito Soto-Blanco1 Abstract Changes in cerebrospinal fluid (CSF) and anatomical and histopathological central nervous system (CNS) lesions were evaluated, and the presence of Trypanosoma vivax in CNS tissues was investigated through PCR. Twelve adult male goats were divided into three groups (G): G1, infected with T. vivax and evaluated during the acute phase; G2, infected goats evaluated during the chronic phase; and G3, consisting of non-infected goats. Each goat from G1 and G2 was infected with 1.25 × 105 trypomastigotes. Cerebrospinal fluid (CSF) analysis and investigation of T. vivax was performed at the 15th day post-infection (dpi) in G1 goats and on the fifth day after the manifestation of nervous system infection signs in G2 goats. All goats were necropsied, and CNS fragments from G1 and G2 goats were evaluated by PCR for the determination of T. vivax. Hyperthermia, anemia and parasitemia were observed from the fifth dpi for G1 and G2, with the highest parasitemia peak between the seventh and 21st dpi. Nervous system infection signs were observed in three G2 goats between the 30th and 35th dpi. CSF analysis revealed the presence of T. vivax for G2. Meningitis and meningoencephalitis were diagnosed in G2. PCR were positive for T. vivax in all the samples tested. In conclusion, T. vivax may reach the nervous tissue resulting in immune response from the host, which is the cause of progressive clinical and pathological manifestations of the CNS in experimentally infected goats. Introduction T. vivax that had not yet been reported in outbreaks in Trypanosomes belonging to the salivary group, repre- cattle in the Americas. Nervous signs and histological sented by species associated with sleeping sickness and CNS lesions have been described in naturally infected those responsible for causing a disease known as cattle in Northeastern regions of Brazil, contributing to “nagana” in ruminant livestock, cause severe economic the elucidation of some pathological aspects of the CNS losses in Africa, where parasite transmission occurs disease in cattle. The central neurological nature of the through the tsetse fly, a biological vector [1-3]. disease that occurs in Africa, which is caused by trypa- The clinico-pathological signs frequently reported in nosomosis that is triggered by salivary trypanosomes, most outbreaks are fever, anorexia, lethargy, anemia, must also be considered as an important manifestation progressive emaciation, a rapid decline in milk produc- of the disease in the Americas [5]. tion, stillborn offspring and return to estrus. Recently, ThepresenceofT. vivax in the CNS parenchyma, Batista et al. [4] described important clinico-pathological which is associated with changes and lesions in this site and epidemiological aspects of natural infection by as described in trypanosomosis for other trypanosomes found in saliva, has not been reported. Therefore, this study was aimed at evaluating the changes in CSF, * Correspondence: [email protected] 1Department of Animal Sciences, Universidade Federal Rural do Semi-árido describing the anatomical and histopathological CNS (UFERSA), BR 110 - Km 47, CEP: 59625-900, Mossoró-RN, Brazil lesions, and investigating the presence of the parasite in Full list of author information is available at the end of the article © 2011 Batista et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Batista et al. Veterinary Research 2011, 42:63 Page 2 of 7 http://www.veterinaryresearch.org/content/42/1/63 the brain of goats experimentally infected with T. vivax five days after the onset of nervous system infection at 15 and 30 days post-infection using polymerase chain signs. To compare the parameters, along with collec- reaction (PCR). tions in G1 and G2, the same procedures were carried out with the animals in G3. Materials and methods CSF collection was carried out with the aid of chemi- Experimental animals cal tranquilization using xylazine hydrochloride at a Twelve male goats of undefined breeds, aged approxi- dose of 0.1 mg/kg of body weight administered intra- mately one year, were used in the study, and the animals muscularly, followed by mechanical restraint of the ani- were housed in stalls at the Veterinary Hospital of the mals. Cerebrospinal fluid was obtained by puncture of Universidade Federal Rural do Semi-Árido. the cisterna magna with 25 × 8 needles and was later Ethical procedures were based on the Brazilian law 6638 transferred to glass flasks. Samples of CSF were analyzed (May 8, 1979) “Normas para Prática Didático-Científica da according to previously described methodology [6]. The Vivissecção de Animais” and “Ethical Principles for Use of appearance was evaluated by comparing the tube con- Experimental Animals” from Colégio Brasileiro de Experi- taining the sample with another tube filled with distilled mentação Animal (COBEA), Brazil, which are in accor- water against a white surface. Densities were obtained dance with the “European Convention for the Protection by refractometry. The total cell count or cellularity was of Vertebrate Animals used for Experimental and Other performed in a Neubauer chamber immediately after Scientific Purposes” (Strasbourg, March 18, 1986). obtaining the samples in order to avoid cellular degen- eration. Total protein and glucose values were deter- T. vivax infection mined using a commercial reagent set (Katal, Belo Before being inoculated with T. vivax, the animals were Horizonte, Brazil). The readings were performed via observed for two weeks, weighed, treated with anthel- spectrophotometry using the biochemical analyzer Bio- mintic drugs and subjected to clinical and hematological 2000 (Bioplus, Barueri, Brazil). In addition, an investiga- exams. The animals were randomly selected to make up tion of T. vivax was conducted in fresh CSF between a the three groups, characterized as the following: group 1 slide and coverslip by light microscopy. (G1),composedoffourgoats(nos.1,2,3and4) infected by T. vivax, evaluated during the acute phase of Pathological study the disease; group 2 (G2), made up of four infected To carry out the anatomical and histopathological goats (nos. 5, 6, 7 and 8) and evaluated during the exams, all goats from G1 and two goats from G3 were chronic phase; and group 3 (G3), consisting of four euthanized on the 15th dpi. Goats no. 5, 6, and 7 from goats (nos. 9, 10, 11 and 12) not infected by T. vivax. G2 died spontaneously between the 35th and 38th dpi. The T. vivax strain used in the experiment was The two remaining goats from G3, along with goat no. obtained from the blood of a parasitemic cow affected 8 from G2, which did not die spontaneously, were sacri- by natural infection during an outbreak in Paraíba state, ficed on the 38th dpi. northeastern Brazil [5]. The blood was collected in During necropsy, after the macroscopic exam, tissue tubes containing 1 mg/mL of ethylenediaminetetracetic fragments were collected from the CNS and were fixed acid (EDTA), mixed with 8% glycerol and frozen in in 10% buffered formalin. After fixation, the CNS was liquid nitrogen (-196°C). The isolate was thawed, and cross-sectioned at the telencephalon (frontal, parietal, each animal from G1 and G2 was inoculated intrave- occipital and temporal cortex regions), internal capsule nously with 1 mL of blood containing approximately and basal ganglia, thalamus, mesencephalon at the cor- 1.25 × 105 T.vivax trypomastigotes, estimated according pora quadrigemina, cerebelum, cerebellar peduncles, to the method described earlier [4]. pons, medulla oblongata and the cervical, thoracic and In the three groups, daily clinical exams were performed lumbar medullae. The fixed tissues were embedded in to evaluate rectal temperature, the appearance of the visi- paraffin, cut to 5 μm thickness and stained with hema- ble mucosa and the volume of lymph nodes measurable by toxylin and eosin (H&E). external palpation, as well as the behavior and general state of the animals. In G1 and G2, parasitemia was evalu- DNA analysis ated concurrently with each clinical examination using a Samples of approximately 1 cm3 from the cerebral cor- thick drop of blood spread on a slide and covered by a tex, internal capsule and cerebellar white matter from cover slip, according to the technique described earlier [4]. G1, G2 and G3 animals were collected and placed in Eppendorf tubes containing 70% alcohol. The DNA pre- Cerebrospinal fluid (CSF) collection and analysis parations were subjected to a highly sensitive PCR assay CSF collections in G1 goats were performed on the 15th specific for T. vivax standardized by Cortez et al. [7]. day post-infection (dpi). In G2 goats, CSF was collected This PCR method targets repeated gene sequences that Batista et al. Veterinary Research 2011, 42:63 Page 3 of 7 http://www.veterinaryresearch.org/content/42/1/63 encode cysteine proteases (Cathepsin L) and was carried dpi, there was a new peak of parasitemia (78.8 × 105 out using the oligonucleotides Tvi2 (forward: 5’ GCC Trypanosomes/mL), followed by another reduction in ATCGCCAAGTACCTCGCCGA3’)andDTO156 parasitemia, which remained low until the end of the (reverse:5’ TTAGAATTCCCAGGAGTTCTTGAT- experimental period. The G1 animals showed similar GATCCAGTA 3’) as primers. The diagnosis was con- parasitemia values to G2 animals from the first to the firmed via PCR by amplifying a DNA fragment of about fifteenth dpi (Figure 2). 177 bp (base pairs) that is also observed in the DNA of The goats from G2 showed markedly pale ocular, oral T.
Load more

Recommended publications
  • Autophagy in Trypanosomatids
    Cells 2012, 1, 346-371; doi:10.3390/cells1030346 OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Review Autophagy in Trypanosomatids Ana Brennand 1,†, Eva Rico 2,†,‡ and Paul A. M. Michels 1,* 1 Research Unit for Tropical Diseases, de Duve Institute, Université catholique de Louvain, Avenue Hippocrate 74, postal box B1.74.01, B-1200 Brussels, Belgium; E-Mail: [email protected] 2 Department of Biochemistry and Molecular Biology, University Campus, University of Alcalá, Alcalá de Henares, Madrid, 28871, Spain; E-Mail: [email protected] † These authors contributed equally to this work. ‡ Present Address: Centre for Immunity, Infection and Evolution, Institute of Immunology and Infection Research, School of Biological Sciences, King’s Buildings, University of Edinburgh, West Mains Road, Edinburgh EH9 3JT, UK. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +32-2-7647473; Fax: +32-2-7626853. Received: 28 June 2012; in revised form: 14 July 2012 / Accepted: 16 July 2012 / Published: 27 July 2012 Abstract: Autophagy is a ubiquitous eukaryotic process that also occurs in trypanosomatid parasites, protist organisms belonging to the supergroup Excavata, distinct from the supergroup Opistokontha that includes mammals and fungi. Half of the known yeast and mammalian AuTophaGy (ATG) proteins were detected in trypanosomatids, although with low sequence conservation. Trypanosomatids such as Trypanosoma brucei, Trypanosoma cruzi and Leishmania spp. are responsible for serious tropical diseases in humans. The parasites are transmitted by insects and, consequently, have a complicated life cycle during which they undergo dramatic morphological and metabolic transformations to adapt to the different environments.
    [Show full text]
  • COVID-19 Mrna Pfizer- Biontech Vaccine Analysis Print
    COVID-19 mRNA Pfizer- BioNTech Vaccine Analysis Print All UK spontaneous reports received between 9/12/20 and 22/09/21 for mRNA Pfizer/BioNTech vaccine. A report of a suspected ADR to the Yellow Card scheme does not necessarily mean that it was caused by the vaccine, only that the reporter has a suspicion it may have. Underlying or previously undiagnosed illness unrelated to vaccination can also be factors in such reports. The relative number and nature of reports should therefore not be used to compare the safety of the different vaccines. All reports are kept under continual review in order to identify possible new risks. Report Run Date: 24-Sep-2021, Page 1 Case Series Drug Analysis Print Name: COVID-19 mRNA Pfizer- BioNTech vaccine analysis print Report Run Date: 24-Sep-2021 Data Lock Date: 22-Sep-2021 18:30:09 MedDRA Version: MedDRA 24.0 Reaction Name Total Fatal Blood disorders Anaemia deficiencies Anaemia folate deficiency 1 0 Anaemia vitamin B12 deficiency 2 0 Deficiency anaemia 1 0 Iron deficiency anaemia 6 0 Anaemias NEC Anaemia 97 0 Anaemia macrocytic 1 0 Anaemia megaloblastic 1 0 Autoimmune anaemia 2 0 Blood loss anaemia 1 0 Microcytic anaemia 1 0 Anaemias haemolytic NEC Coombs negative haemolytic anaemia 1 0 Haemolytic anaemia 6 0 Anaemias haemolytic immune Autoimmune haemolytic anaemia 9 0 Anaemias haemolytic mechanical factor Microangiopathic haemolytic anaemia 1 0 Bleeding tendencies Haemorrhagic diathesis 1 0 Increased tendency to bruise 35 0 Spontaneous haematoma 2 0 Coagulation factor deficiencies Acquired haemophilia
    [Show full text]
  • Diseases of the Digestive System (KOO-K93)
    CHAPTER XI Diseases of the digestive system (KOO-K93) Diseases of oral cavity, salivary glands and jaws (KOO-K14) lijell Diseases of pulp and periapical tissues 1m Dentofacial anomalies [including malocclusion] Excludes: hemifacial atrophy or hypertrophy (Q67.4) K07 .0 Major anomalies of jaw size Hyperplasia, hypoplasia: • mandibular • maxillary Macrognathism (mandibular)(maxillary) Micrognathism (mandibular)( maxillary) Excludes: acromegaly (E22.0) Robin's syndrome (087.07) K07 .1 Anomalies of jaw-cranial base relationship Asymmetry of jaw Prognathism (mandibular)( maxillary) Retrognathism (mandibular)(maxillary) K07.2 Anomalies of dental arch relationship Cross bite (anterior)(posterior) Dis to-occlusion Mesio-occlusion Midline deviation of dental arch Openbite (anterior )(posterior) Overbite (excessive): • deep • horizontal • vertical Overjet Posterior lingual occlusion of mandibular teeth 289 ICO-N A K07.3 Anomalies of tooth position Crowding Diastema Displacement of tooth or teeth Rotation Spacing, abnormal Transposition Impacted or embedded teeth with abnormal position of such teeth or adjacent teeth K07.4 Malocclusion, unspecified K07.5 Dentofacial functional abnormalities Abnormal jaw closure Malocclusion due to: • abnormal swallowing • mouth breathing • tongue, lip or finger habits K07.6 Temporomandibular joint disorders Costen's complex or syndrome Derangement of temporomandibular joint Snapping jaw Temporomandibular joint-pain-dysfunction syndrome Excludes: current temporomandibular joint: • dislocation (S03.0) • strain (S03.4) K07.8 Other dentofacial anomalies K07.9 Dentofacial anomaly, unspecified 1m Stomatitis and related lesions K12.0 Recurrent oral aphthae Aphthous stomatitis (major)(minor) Bednar's aphthae Periadenitis mucosa necrotica recurrens Recurrent aphthous ulcer Stomatitis herpetiformis 290 DISEASES OF THE DIGESTIVE SYSTEM Diseases of oesophagus, stomach and duodenum (K20-K31) Ill Oesophagitis Abscess of oesophagus Oesophagitis: • NOS • chemical • peptic Use additional external cause code (Chapter XX), if desired, to identify cause.
    [Show full text]
  • The Battle Is Not Over Until It Is Won
    HUMAN AFRICAN TRYPANOSOMIASIS SLEEPING SICKNESS The battle is not over until it is won Sleeping sickness, or human African trypa- melarsoprol. The latter, however, is still the nosomiasis, threatens millions of people in first-line treatment for the less commonT.b. 36 countries across sub-Saharan Africa. The rhodesiense HAT. Democratic Republic of the Congo bears the To contribute to the WHO elimination goal, a brunt, accounting for 83% of all cases. In the ‘test and treat’ strategy that would be imple- 1960s there were less than 5,000 patients mented at the primary healthcare level is on suffering from the disease in the whole of the the horizon, with potential simple oral pills continent. However, the end of the 20th cen- for both the early and late stage as well as tury – with internal conflict, competing health both types of HAT, that are currently in devel- priorities, and decolonization – witnessed a opment, along with new rapid diagnostics, halt in the successful control methods, and which together would remove the need for the number of cases reported rose painful and dangerous lumbar punc- steeply, peaking in 1998 with tures. This would mean that rural over 37,000 cases reported in health centres, rather than hos- that year. Nowadays, thanks pitals, will play an increasingly to the combined efforts of important role, especially as the WHO, National Sleeping number of reported cases con- Sickness Control Pro- tinues to dwindle. grammes, NGOs and other partners, the disease has once more been brought under control, and since 2010 the number of reported cases has fallen below 8,000.
    [Show full text]
  • Program and Abstracts
    Seventy 2019 years of Soixante-dix AU/ISCTRC Années de 1949 l’UA / CSIRLT 35TH GENERAL CONFERENCE OF THE INTERNATIONAL SCIENTIFIC COUNCIL FOR TRYPANOSOMIASIS RESEARCH AND CONTROL (ISCTRC) AND 18TH PATTEC NATIONAL COORDINATORS MEETING PROGRAMME AND ABSTRACTS BOOK 35TH GENERAL CONFERENCE OF THE INTERNATIONAL SCIENTIFIC COUNCIL FOR TRYPANOSOMIASIS RESEARCH AND CONTROL (ISCTRC) AND 18TH PATTEC NATIONAL COORDINATORS MEETING PROGRAMME AND ABSTRACTS BOOK ABOUT THE CONFERENCE Theme of the Conference Impact of African Trypanosomiasis on Human and Animal Health, Sustainable Agriculture and Rural Development in the face of challenges to sustainable investment in AAT control and HAT elimination”Members of the Scientific Committee The members of the 35th ISCTRC Scientific Committee that were appointed by the Director of AU-IBAR were drawn from various institutions working on Tsetse and Trypanosomiasis. The committee received and considered 140 abstracts addressing the various sub- themes of the conference. Prof. Ahmed Elsawalhy, Director of AU-IBAR, Chairperson Dr. James Wabacha, ISCTRC Secretary, Member Dr. Gift Wanda, Member Dr. Daniel Masiga, Member Dr. Jose Ramon Franco Rapporteur and Moderators Rapporteur General Grace Mulira Deputy Rapporteur General Njelembo Mbewe Moderators and rapporteurs for the various thematic sessions are as per the programme Presentation guidelines Allocated time for presentations: Each presentation will be allocated 10 minutes and 5 minutes for discussion. Viewing of posters There will be continuous viewing of the posters. The presenters for the posters will be at the stands during the coffee/tea breaks. There will be general discussion on the posters in the plenary on Thursday, 26th September 2019. Uploading of presentations in the conference computer Presenters who will be making presentation during the first day are IV requested to upload their presentation during registration on Sunday.
    [Show full text]
  • Somnology-Jr-Book.Pdf
    1 To Grace Zamudio and Zoe Lee-Chiong. 2 Preface Carpe noctem. Teofilo Lee-Chiong MD Professor of Medicine Division of Sleep Medicine National Jewish Health Denver, Colorado University of Colorado Denver School of Medicine Denver, Colorado Chief Medical Liaison Philips Respironics Murrysville, Pennsylvania 3 Abbreviations AHI Apnea-hypopnea index BPAP Bi-level positive airway pressure CPAP Continuous positive airway pressure CSA Central sleep apnea ECG Electrocardiography EEG Electroencephalography EMG Electromyography EOG Electro-oculography FEV1 Forced expiratory volume in 1 second GABA Gamma-aminobutyric acid N1 NREM stage 1 sleep N2 NREM stage 2 sleep N3 NREM stages 3 (and 4) sleep NREM Non-rapid eye movement O2 Oxygen OSA Obstructive sleep apnea PaCO2 Partial pressure of arterial carbon dioxide PaO2 Partial pressure of arterial oxygen REM Rapid eye movement sleep SaO2 Oxygen saturation SOREMP Sleep onset REM period 4 Table of contents Introduction 15 Neurobiology of sleep 16 Neural systems generating wakefulness 16 Neural systems generating NREM sleep 16 Neural systems generating REM sleep 16 Main neurotransmitters 17 Acetylcholine 17 Adenosine 17 Dopamine 17 Gamma-aminobutyric acid 17 Glutamate 17 Glycine 17 Histamine 18 Hypocretin 18 Melatonin 18 Norepinephrine 18 Serotonin 18 Physiology during sleep 19 Autonomic nervous system 19 Respiratory system 19 Respiratory patterns 19 Cardiovascular system 19 Gastrointestinal system 20 Renal and genito-urinary systems 20 Endocrine system 20 Growth hormone 20 Thyroid stimulating hormone
    [Show full text]
  • Section B – Abstracts
    ISSN 0142-193X TSETSE AND TRYPANOSOMIASIS INFORMATION QUARTERLY Volume 22 Part 1, 1999 Numbers 10713–10823 DFID Cirad-emvt 1999 Tsetse and Trypanosomiasis Information Quarterly SECTION A – NEWS PROGRAMME AGAINST AFRICAN TRYPANOSOMIASIS Fourth Meeting of PAAT Programme Committee The fourth meeting of the PAAT Programme Committee was convened at IAEA Headquarters, Vienna, Austria, from 25 to 27 November 1998. The objective of meetings of the PAAT Committee is, on the basis of technical and scientific advice forwarded from the Advisory Group Co-ordinators and the Liaison Officers, to provide the focus for collaborative efforts to alleviate trypanosomiasis in Africa. Discussions at the current meeting were largely devoted to matters arising from the meeting of the PAAT Advisory Group Co-ordinators convened in Harare, Zimbabwe, October 1998 (see TTIQ, 21 (4)). Progress since the last meeting was reviewed. This included: ISCTRC representation on the Programme Committee and increased donor involvement; considerable progress on the development of the information systems for both animal and human trypanosomiasis (both the prototype PAAT-IS for animal trypanosomiasis and the CD-ROM-based information system developed by WHO for the human disease were demonstrated and the need for cross-linkages between the two was stressed); evaluation of the socio-economic impact of trypanosomiasis and the identification of priority control strategies; development of position papers on technical and policy aspects of the PAAT following open discussion via e-mail (that on drug resistance having been published as the first in the new PAAT Technical and Scientific Series); production and distribution of a glossy brochure announcing PAAT; and initiation of a quarterly PAAT Newsletter.
    [Show full text]
  • The Trypanosomiases
    SEMINAR Seminar The trypanosomiases Michael P Barrett, Richard J S Burchmore, August Stich, Julio O Lazzari, Alberto Carlos Frasch, Juan José Cazzulo, Sanjeev Krishna The trypanosomiases consist of a group of important animal and human diseases caused by parasitic protozoa of the genus Trypanosoma. In sub-Saharan Africa, the final decade of the 20th century witnessed an alarming resurgence in sleeping sickness (human African trypanosomiasis). In South and Central America, Chagas’ disease (American trypanosomiasis) remains one of the most prevalent infectious diseases. Arthropod vectors transmit African and American trypanosomiases, and disease containment through insect control programmes is an achievable goal. Chemotherapy is available for both diseases, but existing drugs are far from ideal. The trypanosomes are some of the earliest diverging members of the Eukaryotae and share several biochemical peculiarities that have stimulated research into new drug targets. However, differences in the ways in which trypanosome species interact with their hosts have frustrated efforts to design drugs effective against both species. Growth in recognition of these neglected diseases might result in progress towards control through increased funding for drug development and vector elimination. Parasitic protozoa infect hundreds of millions of people similarities and discrepancies in their biology, the diseases every year and are collectively some of the most important they cause, and approaches to their treatment and control. causes of human misery. The protozoan order Kineto- plastida includes the genus Trypanosoma, species that cause The parasites and their vectors some of the most neglected human diseases. Superficially, there are many similarities between There are many species of trypanosome, and the group trypanosome species and the diseases they cause (table).
    [Show full text]
  • African Trypanosomiasis (Sleeping Sickness)
    Human African Trypanosomiasis (sleeping sickness) Professor Peter GE Kennedy Glasgow University Department of Neurology, Institute of Neurological Sciences, Southern General Hospital, Glasgow, UK International Neuroinfectious Disease Conference Addis Ababa, Ethiopia, on February 27-28, 2010 Human African Trypanosomiasis (HAT)-Sleeping Sickness Trypanosoma brucei rhodesiense - East Africa Trypanosoma brucei gambiense - West Africa Estimated 60 million people at risk from HAT Approx. 100,000 existing cases of HAT in Africa Transmitted by tsetse fly of Glossina species Invasion of CNS leads to meningoencephalitis which is invariably fatal MelarsoprolInternational treatment Neuroinfectious is given Disease for CNS Conference disease. This treatmentAddis Ababa,kills about Ethiopia, 5% on February of patients 27-28, 2010from the PTRE FACTORS LEADING TO RE-EMERGENCE OF HAT • SOCIO-ECONOMIC INSTABILITY-AS DISRUPTS DISEASE SURVEILLANCE AND PUBLIC HEALTH SYSTEM (incl. War in Angola) • INADEQUATE FINANCIAL ALLOCATION OF CRITICAL RESOURCES TO DISEASE DURING PEACETIME • INCREASING PARASITE DRUG RESISTANCE • CHANGES IN CLIMATE AND VEGETATION • UNPREDICTED POPULATION MOVEMENTS OF ANIMAL RESEVOIRS International Neuroinfectious Disease Conference • CHANGESAddis IN Ababa, HOST Ethiopia, DISEASE on February SUSCEPTIBILITY 27-28, 2010 Stages of sleeping sickness Early haemolymphatic stage Late encephalitic stage-disease course is slower in gambiense ( many months- years) compared to rhodesiense ( weeks- few months) • The 2 stages may merge into eachother
    [Show full text]
  • Sleeping Sickness Disrupts the Sleep-Regulating Adenosine System 2 3 Short Title: Sleeping Sickness and Adenosine 4 5 Filipa Rijo-Ferreira*1,2, Theresa E
    Research Articles: Neurobiology of Disease Sleeping sickness disrupts the sleep- regulating adenosine system https://doi.org/10.1523/JNEUROSCI.1046-20.2020 Cite as: J. Neurosci 2020; 10.1523/JNEUROSCI.1046-20.2020 Received: 30 April 2020 Revised: 28 September 2020 Accepted: 11 October 2020 This Early Release article has been peer-reviewed and accepted, but has not been through the composition and copyediting processes. The final version may differ slightly in style or formatting and will contain links to any extended data. Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fully formatted version of this article is published. Copyright © 2020 the authors 1 Title: Sleeping sickness disrupts the sleep-regulating adenosine system 2 3 Short title: Sleeping sickness and adenosine 4 5 Filipa Rijo-Ferreira*1,2, Theresa E. Bjorness*3,4, Kimberly H. Cox1, Alex Sonneborn1,3, 6 Robert W. Greene1,3, and Joseph S. Takahashi1,2,# 7 8 1 Department of Neuroscience, Peter O’Donnell Jr. Brain Institute, University of Texas 9 Southwestern Medical Center, Dallas, TX 75390-9111, USA 10 2 Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, 11 Dallas, TX 75390-9111, USA 12 3 Department of Psychiatry, University of Texas Southwestern Medical Center, Dallas, 13 TX 75390-9111, USA 14 4Research Service, VA North Texas Health Care System, Dallas, TX 75126 15 16 * co-authors 17 18 # Correspondence: [email protected] 19 20 21 Number of pages: 32 22 23 Number of figures: 7 24 25 Number of tables: 1 26 27 Number of words for abstract: 130 28 29 Number of words for introduction: 588 30 31 Number of words for discussion: 1259 32 33 Conflict of Interest Statement: The authors have nothing to declare.
    [Show full text]
  • Wake up Australia: the Value of Healthy Sleep
    WAKE UP AUSTRALIA: THE VALUE OF HEALTHY SLEEP REPORT BY ACCESS ECONOMICS PTY LIMITED FOR SLEEP HEALTH AUSTRALIA, OCTOBER 2004 WAKE UP AUSTRALIA: THE VALUE OF HEALTHY SLEEP Acknowledgements & Disclaimer This report was prepared by Access Dr Mark Howard Economics for the steering committee of Department of Respiratory Medicine, Sleep Health Australia, a nascent national Austin Health, Victoria sleep health organisation. It was funded by Professor Colin Sullivan an unrestricted grant from the ResMed Department of Medicine, Foundation Limited who had no part in the University of Sydney direction or findings contained in this report. A/Prof John Wheatley Access Economics would like to acknowledge Director, Department of Respiratory with appreciation the comments, prior Medicine, Westmead Hospital research and expert input from: Mr John Goss Dr Ral Antic Head, Summary Measures Unit, Director of Thoracic Medicine, Australian Institute of Health and Welfare Royal Adelaide Hospital Information in Section 3.2 of this report has Dr David Hillman been drawn from data collected by the Head, Department of Pulmonary Physiology, General Practice Statistics and Classification Sir Charles Gairdner Hospital, Perth Unit, Department of General Practice, Additional assistance was provided by: University of Sydney in collaboration with the Australian Institute of Health and Welfare. A/Prof Peter Cistulli, Director, Department of Respiratory and Sleep Medicine, St George Hospital, Kogarah, NSW While every effort has been made to ensure the accuracy of this document, the uncertain nature of economic data, forecasting and analysis means that Access Economics Pty Limited is unable to make any warranties in relation to the information contained herein. Access Economics Pty Limited, its employees and agents disclaim liability for any loss or damage which may arise as a consequence of any person relying on the information contained in this document.
    [Show full text]
  • Sleeping Sickness)
    NEUROLOGICAL PROGRESS The Continuing Problem of Human African Trypanosomiasis (Sleeping Sickness) Peter G. E. Kennedy, MD, PhD, DSc Human African trypanosomiasis, also known as sleeping sickness, is a neglected disease, and it continues to pose a major threat to 60 million people in 36 countries in sub-Saharan Africa. Transmitted by the bite of the tsetse fly, the disease is caused by protozoan parasites of the genus Trypanosoma and comes in two types: East African human African trypanosomiasis caused by Trypanosoma brucei rhodesiense and the West African form caused by Trypanosoma brucei gambiense. There is an early or hemo- lymphatic stage and a late or encephalitic stage, when the parasites cross the blood–brain barrier to invade the central nervous system. Two critical current issues are disease staging and drug therapy, especially for late-stage disease. Lumbar puncture to analyze cerebrospinal fluid will remain the only method of disease staging until reliable noninvasive methods are developed, but there is no widespread consensus as to what exactly defines biologically central nervous system disease or what specific cerebro- spinal fluid findings should justify drug therapy for late-stage involvement. All four main drugs used for human African trypano- somiasis are toxic, and melarsoprol, the only drug that is effective for both types of central nervous system disease, is so toxic that it kills 5% of patients who receive it. Eflornithine, alone or combined with nifurtimox, is being used increasingly as first-line therapy for gambiense disease. There is a pressing need for an effective, safe oral drug for both stages of the disease, but this will require a significant increase in investment for new drug discovery from Western governments and the pharmaceutical industry.
    [Show full text]