Sleeping Sickness Disrupts the Sleep-Regulating Adenosine System 2 3 Short Title: Sleeping Sickness and Adenosine 4 5 Filipa Rijo-Ferreira*1,2, Theresa E

Home , African trypanosomiasis, Narcolepsy

Research Articles: Neurobiology of Disease Sleeping sickness disrupts the sleep- regulating adenosine system https://doi.org/10.1523/JNEUROSCI.1046-20.2020

Cite as: J. Neurosci 2020; 10.1523/JNEUROSCI.1046-20.2020 Received: 30 April 2020 Revised: 28 September 2020 Accepted: 11 October 2020

This Early Release article has been peer-reviewed and accepted, but has not been through the composition and copyediting processes. The final version may differ slightly in style or formatting and will contain links to any extended data.

Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fully formatted version of this article is published.

1 Title: Sleeping sickness disrupts the sleep-regulating adenosine system 2 3 Short title: Sleeping sickness and adenosine 4 5 Filipa Rijo-Ferreira*1,2, Theresa E. Bjorness*3,4, Kimberly H. Cox1, Alex Sonneborn1,3, 6 Robert W. Greene1,3, and Joseph S. Takahashi1,2,# 7 8 1 Department of Neuroscience, Peter O’Donnell Jr. Brain Institute, University of Texas 9 Southwestern Medical Center, Dallas, TX 75390-9111, USA 10 2 Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, 11 Dallas, TX 75390-9111, USA 12 3 Department of Psychiatry, University of Texas Southwestern Medical Center, Dallas, 13 TX 75390-9111, USA 14 4Research Service, VA North Texas Health Care System, Dallas, TX 75126 15 16 * co-authors 17 18 # Correspondence: [email protected] 19 20 21 Number of pages: 32 22 23 Number of figures: 7 24 25 Number of tables: 1 26 27 Number of words for abstract: 130 28 29 Number of words for introduction: 588 30 31 Number of words for discussion: 1259 32 33 Conflict of Interest Statement: The authors have nothing to declare. 34 35 Acknowledgements: We would like to thank Nelly Garduño and Iza Kornblum for their 36 technical assistance and Fernando Augusto for artwork. J.S.T. is an Investigator and 37 F.R-F. is a Postdoctoral Research Associate in the Howard Hughes Medical Institute. 38 This research was supported by NIH grant NIGMS K99GM132557 to F.R-F., VA 39 BLR&D CDA grant IK2BX002531 to T.E.B., NIH grant R01MH080297 and WPI program 40 for IIIS to R.W.G., as well as funding from Howard Hughes Medical Institute to J.S.T. 41 The contents of this manuscript do not represent the views of the U.S. Department of 42 Veterans Affairs or the United States Government. 43

44 ABSTRACT 45 46 Patients with sleeping sickness, caused by the parasite, Trypanosoma brucei, have

47 disruptions in both sleep timing and sleep architecture. However, the underlying cause

48 of these sleep disturbances is not well understood. Here we assessed the sleep

49 architecture of male mice infected with T. brucei and found that infected mice had

50 drastically altered sleep patterns. Interestingly, T. brucei infected mice also had a

51 reduced homeostatic sleep response to sleep deprivation, a response modulated by the

52 adenosine system. We found that infected mice had a reduced electrophysiological

53 response to an adenosine receptor antagonist and increased adenosine receptor gene

54 expression. Although the mechanism by which T. brucei infection causes these changes

55 remains to be determined, our findings suggest that the symptoms of sleeping sickness

56 may be due to alterations in homeostatic adenosine signaling.

58 59 SIGNIFICANCE STATEMENT 60 61 Sleeping sickness is a fatal disease that disrupts the circadian clock, causes disordered

62 temperature regulation, and induces sleep disturbance. To examine the neurological

63 effects of infection in the absence of other symptoms, in this study we used a mouse

64 model of sleeping sickness in which the acute infection was treated but brain infection

65 remained. Using this model, we evaluated the effects of the sleeping sickness parasite,

66 T. brucei, on sleep patterns in mice, under both normal and sleep-deprived conditions.

67 Our findings suggest that signaling of adenosine, a neuromodulator involved in

68 mediating homeostatic sleep drive, may be reduced in infected mice.

69 INTRODUCTION

70 Sleeping sickness (human African trypanosomiasis) is a disease endemic to sub-

71 Saharan Africa. It is caused by the parasite Trypanosoma brucei, which is transmitted to

72 humans by the tsetse fly (Franco et al., 2014). Sleeping sickness occurs in two phases.

73 In the first, hemolymphatic phase, T. brucei parasites are primarily found in the

74 bloodstream, interstitial spaces of peripheral organs, and lymphatic system (Caljon et

75 al., 2016; Capewell et al., 2016; Trindade et al., 2016). The main symptoms during this

76 first phase of the disease include fever, fatigue, and pain. In the second, meninge-

77 encephalitic stage, the parasites invade the central nervous system and cause

78 psychiatric symptoms as well as the progressive disruption of circadian rhythms,

79 including altered hormonal secretion, body temperature rhythms, daytime somnolence,

80 and nighttime insomnia (Buguet et al., 2001; Blum et al., 2006; Tesoriero et al., 2019).

81 In humans, sleep can be divided into 4 stages (3 sub-stages of non-rapid eye

82 movement [NREM] sleep (stage 3-4 also called Slow Wave Sleep [SWS]) and Rapid

83 Eye Movement [REM] sleep. These stages can be delineated by differences in brain

84 activity as measured by electroencephalography (EEG) and other physiological

85 parameters, such as muscle and eye movements (Jafari and Mohsenin, 2010). In

86 addition to changes in sleep timing, sleeping sickness patients have altered sleep

87 architecture, with REM episodes occurring immediately after sleep onset (SOREM)

88 instead of after NREM (Buguet et al., 2001; Buguet et al., 2005). This change in sleep

89 structure is similar to what is seen with narcolepsy (Nishino and Mignot, 1997; Fujiki et

90 al., 2009). Interestingly, while neither sleeping sickness nor narcolepsy causes

91 increased total sleep across the 24 h period (Dantz et al., 1994; Buguet et al., 2001),

92 narcoleptic patients do not have altered circadian rhythms (Dantz et al., 1994). T. brucei

93 is also distinct from other infections, which tend to increase sleep (Krueger and Opp,

94 2016; Tesoriero et al., 2019). How the T. brucei parasite produces these specific

95 alterations to the sleep system remains an open question (Lundkvist et al., 2004).

96 Sleep is regulated by interactions of the circadian system with a complex

97 homeostatic network that balances sleep need with arousal (Borbely et al., 2016).

98 Although there are many signals involved in maintaining arousal, an increase in

99 extracellular adenosine during wakefulness is thought to be a primary driver of both

100 homeostatic sleep need (Porkka-Heiskanen et al., 1997; Saper et al., 2005; Bjorness et

101 al., 2016; Bringmann, 2018) and motivation-related arousal (Lazarus et al., 2019). In

102 addition, allostatic mechanisms, such as the production of somnogens during infection,

103 also promote sleep (Bringmann, 2018; Toda et al., 2019). We previously showed that T.

104 brucei infection shortens the period of circadian behavioral activity in mice and disrupts

105 the molecular circadian clock within the suprachiasmatic nucleus (SCN) of the

106 hypothalamus (Rijo-Ferreira et al., 2018). However, the effects of T. brucei on

107 homeostatic drivers of sleep are unclear.

108 The purpose of the present study was to examine the effects of T. brucei

109 infection on sleep architecture in a mouse model of sleeping sickness. We found that,

110 similarly to the human infection, T. brucei infected mice had altered sleep architecture.

111 Interestingly, infection reduced the ability of mice to achieve or maintain REM sleep. In

112 addition, infected mice lacked a response to sleep deprivation, which may indicate a

113 change in their ability to achieve sleep or reduced sleep drive in the face of homeostatic

114 challenge. Electrophysiological experiments and quantification of gene expression

115 suggested that these behavioral changes were not due solely to inflammation induced

116 by infection, but rather may be caused by altered homeostatic adenosine signaling.

117

118 MATERIALS AND METHODS

119 Ethics statement

120 All animal care and experimental procedures were performed in accordance with

121 University of Texas Southwestern Medical Center (UTSW) IACUC guidelines, approved

122 by the Ethical Review Committee at the University of Southwestern Medical Center.

123 Housing and Surgical Procedures

124 Adult (8-12-week-old) male C57BL/6J mice from the UT Southwestern Medical

125 Center Mouse Breeding Core Facility were housed in standard mouse cages with food

126 and water provided ad libitum. Cages were in a temperature-controlled environment in a

127 T24 (12:12) LD cycle. To determine sleep/waking activity, EEG and EMG electrodes

128 were surgically implanted as described previously (Bjorness et al., 2009). Briefly, mice

129 were anesthetized with isoflurane and the scalp was sheared and cleaned. Mice were

130 then placed in a stereotax (Kopf, Tujunga, CA) and four holes were drilled in the skull.

131 Two EEG electrodes (Plastics One, Roanoke, VA) were placed bilaterally over the

132 frontal cortex (AP +1.7 mm, ML +/-1.77mm) and two electrodes were placed bilaterally

133 over the parietal cortex (AP -1.7 mm, ML +/-2mm). Two EMG electrodes (Plastics One,

134 Roanoke, VA) were placed bilaterally into the nuchal musculature. Electrode pins were

135 threaded into a 6-pin pedestal and affixed to the skull with dental adhesive (Fisher,

136 Pittsburgh, PA). After the surgery, the implant base was coated with antibiotic and

137 animals were given Buprenex (0.1 ml, IP) for analgesia. Animals were given 14 days to

138 recover from surgery prior to tether adaption and were housed singly following surgery.

139 Infection and Suramin Treatment

140 Infections were performed by intraperitoneal (i.p.) injection of 2000 Trypanosoma

141 brucei brucei AnTat 1.1E parasites between ZT9-12 (Zeitgeber time, ZT, 3-hour interval

142 before lights are off) (Rijo-Ferreira et al., 2018). This is a T. brucei AnTat 1.1E 90-13,

143 pleomorphic clone, from a transgenic cell-line encoding the tetracycline repressor and

144 T7 RNA polymerase (Engstler and Boshart, 2004). For all injections, the parasite

145 cryostabilates used were obtained from a previous 5-day infection. Prior to infection, T.

146 brucei cryostabilates were thawed and parasite viability and numbers were assessed by

147 mobility under a microscope. Dilutions of parasite densities were performed in HMI-11

148 medium to an inoculum of 100 μL. Parasitemia was assessed by tail vein blood

149 collected into HMI-11 medium and assessed with a Neubauer chamber under the

150 microscope. On day 21 post-infection at ZT9–12, suramin (20 mg/kg, in 100 μL) was

151 administered i.p. to both infected and uninfected control mice.

152 Experimental Groups

153 Three cohorts of controls and Trypanosome infected mice were used (Figure 1A,

154 Groups 1-3). The first cohort (n=4/group) underwent undisturbed (baseline) EEG/EMG

155 recording prior to and following infection [details for this design under ‘EEG/EMG

156 recording’ section’]. The second cohort (n=6/group) underwent baseline recording prior

157 to infection, a second baseline following infection, and a recording after sleep

158 deprivation [details for this design under ‘Sleep Deprivation Protocol’]. The third cohort

159 (n=12 controls, n=15 Trypanosome infected) underwent infection followed by tissue

160 collection for in vitro electrophysiology [details for this design under ‘Hippocampal field

161 recordings (Paired-pulse facilitation)’] or gene expression measurement [details for this

162 design under ‘Quantitative Real-Time PCR’].

163 EEG/EMG Recordings

164 One cohort of control (n=4) and Trypanosome infected (n=4) mice were

165 monitored continuously for 48 hours both pre-infection (baseline) and 85 days post-

166 infection (Figure 1A, Group 1). For recordings, cages were placed in custom wooden

167 boxes and a cable tether was secured to the implant and a commutator (Plastics One,

168 Roanoke, VA) located on the lid of the box. Animals were given at least 7 days to

169 acclimate to the cable prior to baseline recordings. Animals were disconnected from the

170 tether between recordings and returned to the colony room.

171 EEG and EMG activity were recorded using a Grass model 15LT amplifier

172 system (Grass Technologies) with a sampling frequency of 256 Hz and filtered between

173 0.1 and 300 Hz. Data were analyzed using a custom Matlab-based sleep scorer

174 program. EEG and EMG signals were autosorted in 10 sec epochs followed by manual

175 check of state assignment and flagging of artifacts. Epochs with artifacts were excluded

176 from all power analyses (15,679 out of 681,070 epochs were excluded, or 2.3%).

177 Standard state criteria were used: waking was characterized by low amplitude, high

178 frequency EEG activity and high EMG activity, slow wave sleep (SWS) by high

179 amplitude, low frequency EEG activity with negligible EMG modulation, and rapid eye

180 movement (REM) sleep by low amplitude EEG activity with occasional muscle twitches

181 and low overall EMG activity. As is typical for rodent models, SWS was not

182 distinguished from NREM. Delta power was defined as EEG slow wave activity (SWA)

183 power within a bandwidth 0.5-4.5 Hz and normalized to average gamma power (30-

184 50Hz) in which gamma was averaged across all artifact-free epochs across states and

185 across the entire baseline period, unless otherwise noted. Episodes began with 30

186 consecutive seconds of a single state and ended with 30 consecutive seconds of a

187 single different state. State transitions shorter than 3 epochs (30 sec) were ignored.

188 Sleep Deprivation Protocol

189 A second cohort of animals (n=6/group) underwent surgery, baseline recording,

190 infection, and suramin treatment followed by sleep deprivation (Figure 1A, Group 2)

191 Mice were placed into bottomless cages suspended above a treadmill, with the cable

192 tether attached to a counterbalanced lever arm (Instech Laboratories, Plymouth

193 Meeting, PA) to facilitate free movement. Animals were given 7 days to acclimate to the

194 recording tether and treadmill environment before the initial recordings. Following

195 infection, mice underwent 24-hour baseline recording, followed by sleep deprivation with

196 baseline occurring between one time, 76-83 days post-infection. The sleep deprivation

197 protocol varied across animals since the infected mice were unable to maintain the

198 necessary constant motion of the planned chronic, partial sleep deprivation protocol

199 previously used to assess sleep homeostasis in adenosine-modulated animals

200 (Bjorness et al., 2016). Two control and two infected mice underwent 4-hour sleep

201 deprivation followed by 2 hours recovery sleep repeated eight consecutive times; both

202 controls survived while both infected mice died. Next, one control and one infected

203 mouse underwent 4-hour sleep deprivation with 2 hours of recovery during the light

204 phase only (i.e. 8 total hours of sleep deprivation per day); again, the control mouse

205 survived, and the infected mouse died.

206 For the remaining mice (n=3 control, n=3 infected), sleep deprivation occurred

207 via a combination of gentle handling and treadmill movement. For control mice, the

208 experimenter would turn on the treadmill for short periods when a mouse would appear

209 to fall asleep. Infected mice were placed into a cage during periods of constant treadmill

210 movement and waking was enforced by gentle handling procedures such as tapping the

211 side of the cage or swirling the bedding within the cage. Mice underwent two bouts of 4-

212 hour sleep deprivation followed by 2 hour of recovery sleep repeated twice during the

213 light phase of one day. All mice survived this sleep deprivation procedure; however, one

214 infected mouse was excluded from analysis due to poor signal quality (high percentage

215 of epochs with artifact). With gentle handling, a high degree of sleep deprivation was

216 maintained (>97% waking), though a small amount of total sleep was achieved (4

217 minutes and 1 minute in two controls and 2.83 minutes and 3.17 minutes in two infected

218 mice).

219 Hippocampal field recordings (Paired-pulse facilitation)

220 Infected and control mice (n=8/group; Figure 1A, Group 3) were treated with

221 suramin on day 21 post-infection, and 85 days post-injection mice were anaesthetized

222 under 1.5–2% isoflurane, and the brains removed and blocked following rapid

223 decapitation. Coronal slices (300 μm thick) containing the hippocampus were prepared

224 using a vibratome (VT 1000S, Leica Microsystems) in ice cold N-methyl-D-Glucosamine

225 (NMDG) ringer solution then transferred to artificial cerebrospinal fluid (aCSF) as

226 described previously (Takeuchi et al., 2016). One slice per animal was used for ex

227 vivo field recordings. Slices were transferred to a submersion chamber and were

228 perfused with aCSF at a rate of ~2 ml min−1 at 29–31 °C. Field recordings from the

229 stratum radiatum of dorsal CA1 were acquired using a borosilicate glass electrode (1–

230 3 MΩ) filled with aCSF. A bipolar stimulating electrode was also placed in the stratum

231 radiatum of CA1 within 100–200 μm of the recording electrode and stimulation (one

232 stimulus every 30 s) was set to elicit a field EPSP (fEPSP) slope that was ~50% of the

233 maximum value. A stable 15 min baseline was obtained, followed by paired pulse

234 electrical stimulation using inter-pulse interval times of 10, 20, 50, and 100 milliseconds,

235 with 6 recordings per interval, averaged. An adenosine A1 receptor antagonist, 8-

236 Cyclopentyltheophylline (CPT) was then applied to the bath (10 uM) for 15 minutes and

237 the recording procedure was repeated. Data were acquired using P-Clamp 10.

238 Quantitative Real-Time PCR

239 Infected and control mice were treated with suramin (Figure 1A, Group 3). 85

240 days post-injection, at ZT5-ZT6, mice were euthanized with CO2. Blood (200 μL) was

241 collected via cardiac puncture and brain regions were dissected. Total RNA was

242 extracted using TRIzol (tissue) and TRIzol LS (blood) following manufacturer’s protocol

243 (Thermo Fisher Scientific). cDNA was prepared using TaqMan™ Reverse Transcription

244 Reagents (Thermo Fisher Scientific) with random hexamers. qRT-PCR was performed

245 with Sybr Green in an Applied Biosystems® 7500 Real-Time PCR System

246 (RRID:SCR_018051) and normalized to Gapdh as a housekeeping gene. Primer

247 sequences are listed in Table 1.

248 Experimental Design and Statistical Analyses

249 Statistical analyses were performed using Graphpad Prism version 7.01 for

250 Windows or 8.0.0 for Mac (GraphPad Software, San Diego, California USA,

251 RRID:SCR_002798). For time in state comparisons, data from cohorts 1 and 2 were

252 averaged in 2-hour bins and compared using two-way ANOVA (time x group) and then

253 averaged within light and dark phases and compared using one-way ANOVA with

254 Sidak’s multiple comparisons test (within phase across group), or Brown-Forsythe tests

255 when standard deviations were different between groups. REM was divided by total

256 sleep (%REM+%NREM) in each 2-hour bin and then averaged within light and dark

257 phases and compared using one-way ANOVA with Sidak’s multiple comparisons test.

258 For episode number and duration, data were averaged within the light and dark phases

259 and compared using one-way ANOVA with Sidak’s multiple comparison test. Data were

260 then divided into bins based on duration (histogram) and compared using a two-way

261 ANOVA with Sidak’s multiple comparisons test (cumulative histogram for SWS duration)

262 or Tukey’s multiple comparisons test (histogram for REM duration). For REM histogram

263 analysis, the episode duration criteria (30 sec) were relaxed such that the distribution of

264 shorter REM bouts (10-20 sec) could be seen. State transitions were compared by

265 calculating the number of sleep episodes that preceded different sleep episodes (SWS

266 to REM and REM to SWS) and dividing by the total number of sleep specific episodes

267 (i.e. [SWS to REM]/total SWS; [REM to SWS]/total REM). SWS transitions and REM

268 transitions were compared between groups using a t-test.

269 Normalized SWS SWA power was averaged in 2-hour bins and compared using

270 two-way ANOVA (time by group), while average rebound was calculated by the percent

271 change in SWS-SWA from baseline conditions to recovery conditions using time-

272 matched circadian bins (i.e. ZT4-6, ZT 10-12, ZT 14-16, ZT 22-24) and compared using

273 a t-test. Area-under-the-curve was calculated and compared between groups using a t-

274 test.

275 SWA decrease across the light phase was calculated based on previously

276 described methods (Nelson et al., 2013). For each baseline day, raw SWA in each

277 epoch was normalized to the 24 hr average SWA and the percentage change between

278 the first and last consolidated 1 hr sleep period, defined as a high proportion of sleep

279 epochs within a 1h bin, around the start and end of the light phase was calculated, after

280 which the percent change was averaged across baseline days and compared via one-

281 way ANOVA with Sidak’s multiple comparison test (across group and time) and a Mann-

282 Whitney t-test (between groups post-injection). Spectral density was determined during

283 baseline conditions; individual 10s epochs were separated by state (waking, SWS,

284 REM) after which raw spectral power in each 1 Hz bin up to 100 Hz was normalized by

285 the total power for that same state; the slowest 1 Hz bin was excluded from the total

286 power calculation. Fractional power was then averaged across epochs within each 1 Hz

287 bin to get an average spectral distribution from 2 to 100 Hz by state and compared

288 across conditions using a two-way ANOVA (group by frequency). For clarity, Figures 2

289 C, F, & I are truncated at 15 Hz; there were no significant differences above 15 Hz.

290 Sleep latency under sleep deprived conditions was calculated as the waking

291 duration from the beginning of sleep deprivation to the initial SWS episode during

292 recovery (for gentle handling, first sleep occurred towards the end of the deprivation

293 period) and was averaged across deprivations so that each mouse contributed one

294 average sleep latency. A t-test was used for group comparisons. Sleep-onset REMs

295 (SOREMs) are defined as direct transitions from waking to REM. All scored files were

296 analyzed for transitions from waking episodes to REM episodes, but no such SOREMs

297 were found. We also looked for epochs with continuous waking activity of at least 30

298 sec followed by REM (Chen et al., 2006; Seke Etet et al., 2012), but again no SOREMs

299 were identified.

300 For electrophysiological recordings, calculated paired-pulse ratios were

301 compared via two-way repeated-measures ANOVA. qRT-PCR data were analyzed

302 using the DDCT method and compared using unpaired t-tests with Welch’s correction.

303

304 RESULTS

305 Altered Sleep Architecture in a Mouse Model of Sleeping Sickness

306 To model the second, meninge-encephalitic stage of the human sleeping

307 sickness infection (when sleep disturbances occur in the absence of acute

308 symptomology), mice were infected with T. brucei then treated 21d post-infection with

309 suramin (20 mg/kg), which kills the parasite in peripheral tissues while allowing it to

310 survive in neural tissues (Rijo-Ferreira et al., 2018). EEG and EMG recordings were

311 used to assess sleep behavior (divided into 3 stages: waking, slow-wave sleep (SWS)

312 and REM sleep ) in mice pre-infection and 85d post-infection (Figure 1A). Uninfected,

313 suramin-treated controls were also assessed at the same timepoints. Prior to infection

314 there were no differences between groups in the % of total time spent waking, in SWS,

315 or in REM (Figure 1B, E, & H). However, post-infection, mice spent significantly more

316 time waking (Figure 1C; two-way ANOVA; main effects of time F(11,187)=17.78,

317 p<0.0001; and group F(1,17)=6.128, p=0.0241), and less time in REM sleep (Figure 1I;

318 two-way ANOVA; main effects of time F(11,187)=21.00, p<0.0001; and group

319 F(1,17)=11.32, p=0.0037; and an interaction F(11, 187)=4.340 , p<0.0001). When

320 activity was averaged over the light or dark, it was apparent that infected mice spent

321 significantly more time in waking (Figure 1D; one-way ANOVA; F(3,34)=2.137, **

322 p=0.0054), and less time in SWS (Figure 1G; one-way ANOVA; F(3,34)=2.106, *

323 p=0.0162) or REM (Figure 1J; Brown-Forsythe ANOVA; F(3,15.7)= 25.60, ***

324 p=0.0061) during the light phase. There was also a significant decrease in the REM to

325 total sleep (REM+SWS) ratio during the light phase post-infection (Brown-Forsythe

326 ANOVA; F(3,34)=3.878, *p=0.0173). These findings are consistent with our previous

327 report of infected mice shifting their daily activity profiles to become more diurnal,

328 showing increased activity during the light (daytime), when nocturnal mice are usually

329 resting (Rijo-Ferreira et al., 2018).

330 In order to assess whether sleep architecture was similar between infected and

331 control mice, we also compared the distribution of sleep episodes (number and

332 duration). While there were no differences in the number or duration of SWS episodes

333 between groups prior to T. brucei infection, there was a leftward shift in the distribution

334 of episode duration following infection (Figure 2A, B); two-way ANOVA; main effects of

335 time F(65,1105)=802.6, p<0.0001; and group F(1,17)=9.697, p=0.0063; and an

336 interaction F(65,1105)=11.35, p<0.0001), indicative of more SWS episodes of shorter

337 duration. These findings are consistent with sleep episode fragmentation that is

338 associated with a loss of adenosine signaling (Bjorness et al., 2016). As with SWS,

339 there were no differences in the number or duration of REM episodes prior to infection.

340 However, post-infection, mice had fewer 10, 20, 60, and 90 second REM episodes as

341 compared to controls (Figure 2 C, D); two-way ANOVA; main effects of time

342 F(11,187)=29.06, p<0.0001; and group F(1,17)=15.93, p=0.0009; and an interaction

343 F(11,187)=3.512), while total REM duration was unchanged. Example hypnograms of

344 sleep/waking state across a 24 hour period (starting at lights off) are shown in Figure

345 2E, F). In addition to changes in sleep state composition between groups, T. brucei

346 also influenced transitions between sleep/waking states with a lower percentage of

347 SWS episodes followed by REM episodes (t-test; t(17)=4.021; p=0.0009) and REM

348 bouts followed by SWS bouts in infected mice (t-test; t(17)=2.076; p=0.0534; examples

349 of REM to waking transitions and REM to SWS transitions are indicated in Figure 2E,

350 F). This higher percentage of SWS and REM episodes preceding waking indicates

351 sleep fragmentation following infection. Taken together, these results indicate that T.

352 brucei infection not only alters the circadian system (i.e. when animals are sleeping), but

353 also likely affects the other systems regulating sleep homeostasis (Borbely et al., 2016).

354 To investigate the changes to sleep patterns further, we focused on the light

355 phase, the predominant sleep period of mice where there were differences in the time

356 spent in each phase of sleep (Figure 1, D, G, & J). There were no differences between

357 groups in the total number of waking episodes or waking duration (Figure 3A, B).

358 However, following infection, mice showed a shift towards slower spectral frequency

359 activity during waking (Figure 3C; two-way ANOVA; interaction of time and group F(98,

360 882)=3.188, p<0.0001), consistent with the idea that infected mice spend more time in

361 quiet wakefulness during the light phase. Infection also decreased the average duration

362 of SWS episodes (Figure 3E; one-way ANOVA, F(3,34)=4.119) with a shift towards

363 higher spectral frequency in SWS (Figure 3F; two-way ANOVA; interaction of time and

364 group F(98, 882)=3.322, p<0.0001). The average number of REM episodes was also

365 decreased (Figure 3G; one-way ANOVA, F(3, 34)=18.43) with a shift towards lower

366 spectral frequency activity during REM (Figure 3I; interaction of time and group F(98,

367 882)=3.912, p<0.0001), suggesting a reduced ability to enter REM. Together, the

368 decrease in the number of REM episodes and the reduction in SWS duration after

369 infection suggested that T. brucei infection may impede REM generation. Although the

370 disruption of sleep architecture is similar to what has been described for sleeping

371 sickness patients, we were not able to detect direct transitions from waking to REM

372 (SOREM) episodes in T. brucei infected mice, which is different from what has been

373 shown in T. brucei gambiense or T. brucei rhodesiense infected humans (Buguet et al.,

374 1993) and T. brucei brucei infected rats (Laperchia et al., 2016).

375

376 T. brucei Infection Reduces Homeostatic Sleep Rebound in Mice

377 In order to evaluate the quality of SWS after T. brucei infection, we quantified

378 slow wave activity (SWA) during SWS across the entire measurement period. High

379 frequency EEG waves present during wakefulness (i.e., gamma power) did not differ

380 between groups (Figure 4A), therefore this parameter was used to normalize SWS

381 SWA power (Bjorness et al., 2016). As expected, prior to infection all mice had peak

382 SWA during the dark phase, indicative of increasing sleep drive which develops with

383 extended periods of wakefulness (in nocturnal animals at night). However, after

384 infection, the peak of SWA during SWS was flattened over the circadian cycle, hinting at

385 overall circadian disruption and a reduction in sleep drive in infected mice (Figure 5A,

386 B). Area under the curve (AUC) analysis for SWS SWA indeed showed that the infected

387 group had a reduced SWS SWA area as compared to controls (Figure 5C; t-test;

388 t(192)=2.003; p=0.0466).

389 A decrease in SWA during SWS is an indicator of an overall decrease in sleep

390 drive as the animal rests. Examples of SWA decreases across the light phase are

391 shown for a control (Figure 5D) and infected (Figure 5E) mouse. When we calculated

392 the percent decrease in SWA from a consolidated sleep period near the beginning of

393 the light phase to a consolidated sleep period near the end of the light phase, the

394 infected mice had less of a decrease than controls (Figure 5F; t-test; t(18)=1.962; #

395 p=0.0654; examples shown in Figure 3 D & E show 25.5 and 12% decrease,

396 respectively). These findings may indicate that infected mice do not have a normal

397 accumulation of sleep need during wakefulness, i.e., they start out with a decreased

398 drive, either because of a change in rate of sleep need accumulation (Franken et al.,

399 2001), or they are unable to respond to sleep pressure. Either way, these results reveal

400 that, in addition to changes in sleep architecture, T. brucei infected mice have a

401 baseline reduction in homeostatic sleep response.

402 Next, we evaluated sleep patterns in infected mice after sleep deprivation

403 (Figure 1A). Initially, we utilized a treadmill sleep deprivation protocol previously shown

404 to prolong the duration of SWS episodes (SWS consolidation) and increase the SWS

405 above baseline levels at the same circadian time (SWA rebound). Both of these

406 parameters are indicative of increased sleep need (Bjorness et al., 2009). However, the

407 infected mice subjected to this protocol were unable to maintain the necessary walking

408 pace and died during the deprivation period; therefore, for the remainder of the infected

409 mice we switched to a sleep deprivation protocol using gentle handling instead. As

410 expected, control mice subjected to sleep deprivation showed SWS consolidation as

411 determined by an increase in the duration of SWS episodes as a consequence of sleep

412 need (Figure 5G; two-way ANOVA; interaction of time and group F(65, 650)=6.989,

413 p<0.0001). However, similar SWS consolidation was not seen in infected mice after

414 sleep deprivation (Figure 5H; no differences between conditions), and there was no

415 difference in sleep achieved during the deprivation period [1.67 min in controls, 2 min in

416 infected mice, p=0.46, t-test]. In addition, after sleep deprivation, controls had the

417 expected SWA rebound over the light phase compared to baseline conditions, while

418 SWA rebound was reduced in infected mice (Figure 5I; t-test, t(6)=2.363, #p=0.0560).

419 Despite these findings, there was no effect of infection on the latency to fall asleep after

420 sleep deprivation, suggesting that there is still some sleep control, but homeostatic

421 control is compromised (Figure 4B). Taken together, our results suggested that mice

422 with sleeping sickness have altered sleep homeostasis. Because the adenosine system

423 is thought to mediate the homeostatic sleep response (Bjorness and Greene, 2009), we

424 hypothesized that T. brucei infection may alter adenosine signaling.

425

426 T. brucei Infection Alters Adenosine Signaling

427 Activation of adenosine A1 receptors (ADORA1) is required for SWA rebound in

428 response to loss of sleep (Bjorness et al., 2009). To investigate if infected mice had

429 altered adenosine signaling, we performed paired-pulse facilitation (PPF) experiments

430 using hippocampal CA1 field recordings from control and infected mice (n=8

431 animals/group), and compared PPF before and after treatment with an ADORA1

432 antagonist, 8-Cyclopentyltheophylline (CPT) (Brundege and Dunwiddie, 1996; Dumas

433 and Foster, 1998). Under normal conditions, extracellular adenosine acts via ADORA1

434 to decrease the probability of vesicular glutamate release at hippocampal Schaffer

435 collateral synapses (pre-synaptic inhibition), leading to stronger PPF. Therefore,

436 blocking these receptors with CPT should lead to attenuated PPF in mice with a

437 functional adenosine system.

438 Accordingly, slices from control mice demonstrated this expected decrease in

439 PPF after CPT treatment, indicative of basal adenosine tone (Figure 6A, C; 2-way

440 ANOVA; main effect of treatment F(1,56)= 14.41; p=0.0004)). However, PPF in infected

441 mice was not changed after ADORA1 antagonist exposure (Figure 6B, C; 2-way

442 ANOVA; F(1,56)= 0.3043; p=0.5834). Direct comparisons between control and infected

443 groups shows that infected mice exhibit a reduced baseline PPF resembling the PPF

444 reduction seen in controls after blockade. (Figure 6D; 2-way ANOVA; main effect of

445 treatment F(1,56)= 11.40; p=0.0013). These findings suggest a possible reduction in

446 tonic basal pre-synaptic inhibition mediated by reduced adenosine tone in infected

447 animals.

448 When adenosine kinase (AdK) is overexpressed in glial cells, mice have

449 decreased sleep drive due to decreased adenosine signaling (Palchykova et al., 2010).

450 T. brucei infection causes activation of astrocytes (Tesoriero et al., 2018), which is also

451 associated with increased AdK activity (Boison, 2008). Therefore, we hypothesized that

452 infected mice may have increased expression of AdK. Alternatively, it was also possible

453 that infected mice could have decreased adenosine tone due to decreased ADORA1

454 expression (Bjorness et al., 2009; Bjorness et al., 2016). To address these possibilities,

455 we performed qRT-PCR on multiple tissues in control and infected mice. As shown in

456 Figure 7A, there were no significant increases in Adk expression, although there was a

457 trend for increased expression in infected animals in frontal cortex (t-test; t(6.02)=2.131;

458 # p=0.0769). There was also a tendency for infected mice to have increased Adora1

459 mRNA expressed in frontal cortex (t-test; t(6)=2.008; # p=0.0914) and hypothalamus (t-

460 test; t(5.039)=2.081; # p=0.0915). Importantly, although infection increased the

461 expression of inflammatory cytokines in multiple tissues, control mice with implanted

462 EEG electrodes also had elevated expression of these same immune genes as

463 compared to non-surgical controls and there were no statistical differences between

464 groups, indicating that immune activation alone is not enough to explain the behavioral

465 changes in infected mice (Figure 7B). Together with the electrophysiological results,

466 these findings suggest that T. brucei infection may alter adenosine signaling, thereby

467 providing a possible mechanism for altered homeostatic sleep control.

468

469 DISCUSSION

470 Here we report significant alterations in sleep architecture in a mouse model of

471 chronic sleeping sickness. Our findings recapitulate many aspects of the human

472 sleeping sickness phenotype and provide further validation for this murine disease

473 model. T. brucei invades the brain through the circumventricular organs (Schultzberg et

474 al., 1988; Laperchia et al., 2016). However, treatment with suramin (Keita et al., 1997),

475 a drug commonly used in the field to treat the first, hemolymphatic stage of this

476 infection, is unable to penetrate the blood brain barrier. Thus, suramin treatment allows

477 infected mice to survive systemic infection and creates a model of the second, meninge-

478 encephalitic stage of the disease. We believe that this model of sleeping sickness

479 mimics the human infection, with parasites rarely visible in the blood circulation while

480 completely infiltrating the central nervous system (Masocha and Kristensson, 2019;

481 Tesoriero et al., 2019). Using this model, we previously found that T. brucei disrupted

482 the circadian clock of the host, shortening the circadian behavioral period and altering

483 clock gene expression in both central and peripheral tissues (Rijo-Ferreira et al., 2018).

484 In the rat, T. brucei infection alters melatonin receptor binding and neuronal

485 activity in the master circadian pacemaker, the suprachiasmatic nucleus (SCN)

486 (Kristensson et al., 1998; Lundkvist et al., 2002), and also changes clock gene

487 expression in peripheral tissues (Lundkvist et al., 2010). Our behavioral findings are

488 largely consistent with findings of sleep disturbances in T. brucei infected rats (Darsaud

489 et al., 2004; Seke Etet et al., 2012; Laperchia et al., 2017). However, our analysis was

490 unable to detect any sleep onset REM (SOREM) episodes, even when using relatively

491 lax scoring criteria (Seke Etet et al., 2012). This may be due to differences in study

492 conditions. Rats were typically assessed for up to 20 days post-infection, and therefore

493 had systemic T. brucei parasitemia during EEG/EMG recordings, which may cause

494 more drastic sleep alterations. In contrast, our mice received suramin treatment at 21d

495 post-infection and were recorded at 85d post-infection. It is also possible that there are

496 species differences in SOREM episodes following infection, although SOREM has been

497 reported in mouse models of narcolepsy (Fujiki et al., 2009). Of note, the alterations we

498 see in sleep behavior are distinct from the direct wake to REM transitions seen with

499 narcolepsy that are mediated by the orexin system. While there is some indication that

500 T. brucei infection causes orexin and MCH neuronal death in rats (Palomba et al., 2015)

501 of which orexin loss would be expected to result in SOREMs, other studies have shown

502 that only T.b. gambiense induces significant damage to orexin and MCH neurons

503 (Laperchia et al., 2018) as well as the SCN (Tesoriero et al., 2018) in susceptible

504 organisms. However, these models may not fully recapitulate human sleeping sickness

505 pathophysiology, as post-mortem studies do not indicate significant neuronal damage

506 (Kennedy, 2004).

507 Our findings that sleep deprivation by forced (slow) locomotion resulted in death

508 in infected animals are intriguing. They suggest that these mice, although not enduring

509 systemic infection at the time of testing, have either 1) decreased ability to achieve a

510 constant level of physical activity even with slow locomotion or 2) long-lasting negative

511 health impacts that are not otherwise apparent. In fact, studies in humans suggest that

512 HPA axis activity may be impacted in patients even after suramin treatment (Reincke et

513 al., 1994). It is worth noting that the results from the modified sleep deprivation protocol

514 used for the remaining infected animals are not straight-forward to interpret. However,

515 this method produced similar total waking time as that of controls, and there was a

516 similar achievement of sleep during the deprivation period with the gentle handling

517 method as with the treadmill method, suggesting that the mice were adequately and

518 similarly sleep deprived across groups. Nonetheless, further studies using optimized

519 sleep deprivation procedures, possibly with cage changes and novel objects to facilitate

520 arousal maintance, would be beneficial. It may also be useful to log the number of

521 interventions needed to maintain wakefulness as an additional index for sleep drive.

522 Additionally, examining the stress response in infected animals may give insights into

523 the pervasive neuropsychiatric and clinical aspects of the meninge-encephalitic stage of

524 sleeping sickness.

525 In addition to altered sleep patterns, we found that T. brucei infected mice had

526 altered homeostatic sleep drive, both before and after sleep deprivation, suggesting the

527 involvement of the adenosine system. Adenosine inhibits synaptic transmission in the

528 hippocampus and basal forebrain (Arrigoni et al., 2006; Arrigoni and Rosenberg, 2006),

529 but has been shown to activate Ventrolateral preoptic (VLPO) sleep-active neurons

530 (Morairty et al., 2004; Bjorness and Greene, 2009). Adenosine signaling mediated

531 through the adenosine A1 receptor (ADORA1) is necessary for SWA rebound after

532 sleep deprivation (Bjorness et al., 2009), and increasing adenosine tone increases

533 homeostatic sleep need (Bjorness et al., 2016). Our results suggest that T. brucei

534 infection causes a decrease in baseline adenosine signaling, thereby reducing slow

535 wave sleep SWA, indicative of the need to sleep. This may be due to decoupling of

536 ADORA1 from intracellular signaling pathways, a hypothesis supported by the increase

537 in Adora1 mRNA in the brain, but reduced response to ADORA1 antagonism shown

538 with in vitro electrophysiology (PPF). It would be interesting in future studies to examine

539 ADORA1 signaling pathways in neurons from infected mice.

540 Interestingly, adenosine release from astrocytes, as well as neurons, modulates

541 sleep pressure (Halassa et al., 2009), and lipopolysaccharide (LPS) injections have

542 been shown to increase the astrocytic release of adenosine to increase sleep drive

543 (Nadjar et al., 2013). T. brucei has also been shown to activate astrocytes in mice

544 (Hunter et al., 1992), but it is unclear whether T. brucei infection directly induces

545 adenosine release. We used an indirect measure of adenosine metabolism (i.e.

546 quantifying adenosine kinase mRNA) and did not detect a significant increase across

547 tissues. However, these findings from bulk tissues are by no means conclusive and may

548 warrant further investigation using single-cell resolution to identify the genes that are

549 activated and suppressed by T. brucei infection.

550 T. brucei secrete prostaglandins (Kubata et al., 2000; Kristensson et al., 2010),

551 which causes the release of inflammatory cytokines, many of which act as somnogens

552 (Krueger et al., 2001; Bryant et al., 2004; Imeri and Opp, 2009). More specifically,

553 systemic infections, LPS injection, or administration of the cytokines TNF-a or IL-1B all

554 increase SWS while reducing REM sleep (Morrow and Opp, 2005; Krueger et al., 2011;

555 Tesoriero et al., 2019), particularly with severe inflammation (Majde and Krueger, 2005).

556 In contrast with these studies, we show that T. brucei infected mice do not sleep more.

557 Our in-depth analysis of sleep architecture suggests that, although infected mice

558 attempt to enter deep sleep, disruption of SWS may decrease the number of successful

559 REM episodes. Moreover, although infected mice show an increase in the expression of

560 inflammatory cytokines, this is not above the levels of controls receiving surgery. Thus,

561 we speculate that the main influence of T. brucei on sleep, at least in this advanced

562 stage of infection, is not merely via cytokine signaling. Alternatively, it is possible that T.

563 brucei can both promote and combat cytokine signaling (Lundkvist et al., 2004),

564 including regulating the expression of suppressors of cytokine signaling (SOCS)

565 (Alexander, 2002). Finally, it is possible that the reduced homeostatic sleep drive seen

566 here is a consequence of a decrease in ability to achieve sleep. It would be informative

567 for future studies to determine whether T. brucei infection prevents increased sleep

568 following pharmacological or environmental interventions (for example, the dual orexin

569 receptor antagonist suvorexant (Winrow et al., 2011) or a mild temperature increase

570 (Szymusiak and Satinoff, 1981; Roussel et al., 1984).

571 REFERENCES 572 573 Alexander WS (2002) Suppressors of cytokine signalling (SOCS) in the immune 574 system. Nat Rev Immunol 2:410-416. 575 Arrigoni E, Rosenberg PA (2006) Nitric oxide-induced adenosine inhibition of 576 hippocampal synaptic transmission depends on adenosine kinase inhibition and 577 is cyclic GMP independent. Eur J Neurosci 24:2471-2480. 578 Arrigoni E, Chamberlin NL, Saper CB, McCarley RW (2006) Adenosine inhibits basal 579 forebrain cholinergic and noncholinergic neurons in vitro. Neuroscience 140:403- 580 413. 581 Bjorness TE, Greene RW (2009) Adenosine and sleep. Curr Neuropharmacol 7:238- 582 245. 583 Bjorness TE, Kelly CL, Gao T, Poffenberger V, Greene RW (2009) Control and function 584 of the homeostatic sleep response by adenosine A1 receptors. J Neurosci 585 29:1267-1276. 586 Bjorness TE, Dale N, Mettlach G, Sonneborn A, Sahin B, Fienberg AA, Yanagisawa M, 587 Bibb JA, Greene RW (2016) An Adenosine-Mediated Glial-Neuronal Circuit for 588 Homeostatic Sleep. J Neurosci 36:3709-3721. 589 Blum J, Schmid C, Burri C (2006) Clinical aspects of 2541 patients with second stage 590 human African trypanosomiasis. Acta Trop 97:55-64. 591 Boison D (2008) The adenosine kinase hypothesis of epileptogenesis. Prog Neurobiol 592 84:249-262. 593 Borbely AA, Daan S, Wirz-Justice A, Deboer T (2016) The two-process model of sleep 594 regulation: a reappraisal. J Sleep Res 25:131-143. 595 Bringmann H (2018) Sleep-Active Neurons: Conserved Motors of Sleep. Genetics 596 208:1279-1289. 597 Brundege JM, Dunwiddie TV (1996) Modulation of excitatory synaptic transmission by 598 adenosine released from single hippocampal pyramidal neurons. J Neurosci 599 16:5603-5612. 600 Bryant PA, Trinder J, Curtis N (2004) Sick and tired: Does sleep have a vital role in the 601 immune system? Nat Rev Immunol 4:457-467. 602 Buguet A, Bisser S, Josenando T, Chapotot F, Cespuglio R (2005) Sleep structure: a 603 new diagnostic tool for stage determination in sleeping sickness. Acta Trop 604 93:107-117. 605 Buguet A, Bourdon L, Bouteille B, Cespuglio R, Vincendeau P, Radomski MW, Dumas 606 M (2001) The duality of sleeping sickness: focusing on sleep. Sleep Med Rev 607 5:139-153. 608 Buguet A, Bert J, Tapie P, Tabaraud F, Doua F, Lonsdorfer J, Bogui P, Dumas M 609 (1993) Sleep-wake cycle in human African trypanosomiasis. J Clin Neurophysiol 610 10:190-196. 611 Caljon G, Van Reet N, De Trez C, Vermeersch M, Perez-Morga D, Van Den Abbeele J 612 (2016) The Dermis as a Delivery Site of Trypanosoma brucei for Tsetse Flies. 613 PLoS Pathog 12:e1005744. 614 Capewell P et al. (2016) The skin is a significant but overlooked anatomical reservoir for 615 vector-borne African trypanosomes. Elife 5.

616 Chen L, Thakkar MM, Winston S, Bolortuya Y, Basheer R, McCarley RW (2006) REM 617 sleep changes in rats induced by siRNA-mediated orexin knockdown. Eur J 618 Neurosci 24:2039-2048. 619 Dantz B, Edgar DM, Dement WC (1994) Circadian rhythms in narcolepsy: studies on a 620 90 minute day. Electroencephalogr Clin Neurophysiol 90:24-35. 621 Darsaud A, Bourdon L, Mercier S, Chapotot F, Bouteille B, Cespuglio R, Buguet A 622 (2004) Twenty-four-hour disruption of the sleep-wake cycle and sleep-onset 623 REM-like episodes in a rat model of African trypanosomiasis. Sleep 27:42-46. 624 Dumas TC, Foster TC (1998) Late developmental changes in the ability of adenosine 625 A1 receptors to regulate synaptic transmission in the hippocampus. Brain Res 626 Dev Brain Res 105:137-139. 627 Engstler M, Boshart M (2004) Cold shock and regulation of surface protein trafficking 628 convey sensitization to inducers of stage differentiation in Trypanosoma brucei. 629 Genes Dev 18:2798-2811. 630 Franco JR, Simarro PP, Diarra A, Jannin JG (2014) Epidemiology of human African 631 trypanosomiasis. Clin Epidemiol 6:257-275. 632 Franken P, Chollet D, Tafti M (2001) The homeostatic regulation of sleep need is under 633 genetic control. J Neurosci 21:2610-2621. 634 Fujiki N, Cheng T, Yoshino F, Nishino S (2009) Specificity of direct transition from wake 635 to REM sleep in orexin/ataxin-3 transgenic narcoleptic mice. Exp Neurol 217:46- 636 54. 637 Halassa MM, Florian C, Fellin T, Munoz JR, Lee SY, Abel T, Haydon PG, Frank MG 638 (2009) Astrocytic modulation of sleep homeostasis and cognitive consequences 639 of sleep loss. Neuron 61:213-219. 640 Hunter CA, Jennings FW, Kennedy PG, Murray M (1992) Astrocyte activation correlates 641 with cytokine production in central nervous system of Trypanosoma brucei 642 brucei-infected mice. Lab Invest 67:635-642. 643 Imeri L, Opp MR (2009) How (and why) the immune system makes us sleep. Nat Rev 644 Neurosci 10:199-210. 645 Jafari B, Mohsenin V (2010) Polysomnography. Clin Chest Med 31:287-297. 646 Keita M, Bouteille B, Enanga B, Vallat JM, Dumas M (1997) Trypanosoma brucei 647 brucei: a long-term model of human African trypanosomiasis in mice, meningo- 648 encephalitis, astrocytosis, and neurological disorders. Exp Parasitol 85:183-192. 649 Kennedy PG (2004) Human African trypanosomiasis of the CNS: current issues and 650 challenges. J Clin Invest 113:496-504. 651 Kristensson K, Claustrat B, Mhlanga JD, Moller M (1998) African trypanosomiasis in the 652 rat alters melatonin secretion and melatonin receptor binding in the 653 suprachiasmatic nucleus. Brain Res Bull 47:265-269. 654 Kristensson K, Nygard M, Bertini G, Bentivoglio M (2010) African trypanosome 655 infections of the nervous system: parasite entry and effects on sleep and 656 synaptic functions. Prog Neurobiol 91:152-171. 657 Krueger JM, Opp MR (2016) Sleep and Microbes. Int Rev Neurobiol 131:207-225. 658 Krueger JM, Obal FJ, Fang J, Kubota T, Taishi P (2001) The role of cytokines in 659 physiological sleep regulation. Ann N Y Acad Sci 933:211-221. 660 Krueger JM, Clinton JM, Winters BD, Zielinski MR, Taishi P, Jewett KA, Davis CJ 661 (2011) Involvement of cytokines in slow wave sleep. Prog Brain Res 193:39-47.

662 Kubata BK, Duszenko M, Kabututu Z, Rawer M, Szallies A, Fujimori K, Inui T, Nozaki T, 663 Yamashita K, Horii T, Urade Y, Hayaishi O (2000) Identification of a novel 664 prostaglandin f(2alpha) synthase in Trypanosoma brucei. J Exp Med 192:1327- 665 1338. 666 Laperchia C, Xu YZ, Mumba Ngoyi D, Cotrufo T, Bentivoglio M (2018) Neural Damage 667 in Experimental Trypanosoma brucei gambiense Infection: Hypothalamic 668 Peptidergic Sleep and Wake-Regulatory Neurons. Front Neuroanat 12:13. 669 Laperchia C, Palomba M, Seke Etet PF, Rodgers J, Bradley B, Montague P, Grassi- 670 Zucconi G, Kennedy PG, Bentivoglio M (2016) Trypanosoma brucei Invasion and 671 T-Cell Infiltration of the Brain Parenchyma in Experimental Sleeping Sickness: 672 Timing and Correlation with Functional Changes. PLoS Negl Trop Dis 673 10:e0005242. 674 Laperchia C, Tesoriero C, Seke-Etet PF, La Verde V, Colavito V, Grassi-Zucconi G, 675 Rodgers J, Montague P, Kennedy PGE, Bentivoglio M (2017) Expression of 676 interferon-inducible chemokines and sleep/wake changes during early 677 encephalitis in experimental African trypanosomiasis. PLoS Negl Trop Dis 678 11:e0005854. 679 Lazarus M, Oishi Y, Bjorness TE, Greene RW (2019) Gating and the Need for Sleep: 680 Dissociable Effects of Adenosine A1 and A2A Receptors. Front Neurosci 13:740. 681 Lundkvist GB, Hill RH, Kristensson K (2002) Disruption of circadian rhythms in synaptic 682 activity of the suprachiasmatic nuclei by African trypanosomes and cytokines. 683 Neurobiol Dis 11:20-27. 684 Lundkvist GB, Kristensson K, Bentivoglio M (2004) Why trypanosomes cause sleeping 685 sickness. Physiology (Bethesda) 19:198-206. 686 Lundkvist GB, Sellix MT, Nygard M, Davis E, Straume M, Kristensson K, Block GD 687 (2010) Clock gene expression during chronic inflammation induced by infection 688 with Trypanosoma brucei brucei in rats. J Biol Rhythms 25:92-102. 689 Majde JA, Krueger JM (2005) Links between the innate immune system and sleep. J 690 Allergy Clin Immunol 116:1188-1198. 691 Masocha W, Kristensson K (2019) Human African trypanosomiasis: How do the 692 parasites enter and cause dysfunctions of the nervous system in murine models? 693 Brain Res Bull 145:18-29. 694 Morairty S, Rainnie D, McCarley R, Greene R (2004) Disinhibition of ventrolateral 695 preoptic area sleep-active neurons by adenosine: a new mechanism for sleep 696 promotion. Neuroscience 123:451-457. 697 Morrow JD, Opp MR (2005) Diurnal variation of lipopolysaccharide-induced alterations 698 in sleep and body temperature of interleukin-6-deficient mice. Brain Behav 699 Immun 19:40-51. 700 Nadjar A, Blutstein T, Aubert A, Laye S, Haydon PG (2013) Astrocyte-derived 701 adenosine modulates increased sleep pressure during inflammatory response. 702 Glia 61:724-731. 703 Nelson AB, Faraguna U, Zoltan JT, Tononi G, Cirelli C (2013) Sleep patterns and 704 homeostatic mechanisms in adolescent mice. Brain Sci 3:318-343. 705 Nishino S, Mignot E (1997) Pharmacological aspects of human and canine narcolepsy. 706 Prog Neurobiol 52:27-78.

707 Palchykova S, Winsky-Sommerer R, Shen HY, Boison D, Gerling A, Tobler I (2010) 708 Manipulation of adenosine kinase affects sleep regulation in mice. J Neurosci 709 30:13157-13165. 710 Palomba M, Seke-Etet PF, Laperchia C, Tiberio L, Xu YZ, Colavito V, Grassi-Zucconi 711 G, Bentivoglio M (2015) Alterations of orexinergic and melanin-concentrating 712 hormone neurons in experimental sleeping sickness. Neuroscience 290:185-195. 713 Porkka-Heiskanen T, Strecker RE, Thakkar M, Bjorkum AA, Greene RW, McCarley RW 714 (1997) Adenosine: a mediator of the sleep-inducing effects of prolonged 715 wakefulness. Science 276:1265-1268. 716 Reincke M, Heppner C, Petzke F, Allolio B, Arlt W, Mbulamberi D, Siekmann L, Vollmer 717 D, Winkelmann W, Chrousos GP (1994) Impairment of adrenocortical function 718 associated with increased plasma tumor necrosis factor-alpha and interleukin-6 719 concentrations in African trypanosomiasis. Neuroimmunomodulation 1:14-22. 720 Rijo-Ferreira F, Carvalho T, Afonso C, Sanches-Vaz M, Costa RM, Figueiredo LM, 721 Takahashi JS (2018) Sleeping sickness is a circadian disorder. Nat Commun 722 9:62. 723 Roussel B, Turrillot P, Kitahama K (1984) Effect of ambient temperature on the sleep- 724 waking cycle in two strains of mice. Brain Res 294:67-73. 725 Saper CB, Scammell TE, Lu J (2005) Hypothalamic regulation of sleep and circadian 726 rhythms. Nature 437:1257-1263. 727 Schultzberg M, Ambatsis M, Samuelsson EB, Kristensson K, van Meirvenne N (1988) 728 Spread of Trypanosoma brucei to the nervous system: early attack on 729 circumventricular organs and sensory ganglia. J Neurosci Res 21:56-61. 730 Seke Etet PF, Palomba M, Colavito V, Grassi-Zucconi G, Bentivoglio M, Bertini G 731 (2012) Sleep and rhythm changes at the time of Trypanosoma brucei invasion of 732 the brain parenchyma in the rat. Chronobiol Int 29:469-481. 733 Szymusiak R, Satinoff E (1981) Maximal REM sleep time defines a narrower 734 thermoneutral zone than does minimal metabolic rate. Physiol Behav 26:687- 735 690. 736 Takeuchi T, Duszkiewicz AJ, Sonneborn A, Spooner PA, Yamasaki M, Watanabe M, 737 Smith CC, Fernandez G, Deisseroth K, Greene RW, Morris RG (2016) Locus 738 coeruleus and dopaminergic consolidation of everyday memory. Nature 537:357- 739 362. 740 Tesoriero C, Del Gallo F, Bentivoglio M (2019) Sleep and brain infections. Brain Res 741 Bull 145:59-74. 742 Tesoriero C, Xu YZ, Mumba Ngoyi D, Bentivoglio M (2018) Neural Damage in 743 Experimental Trypanosoma brucei gambiense Infection: The Suprachiasmatic 744 Nucleus. Front Neuroanat 12:6. 745 Toda H, Williams JA, Gulledge M, Sehgal A (2019) A sleep-inducing gene, nemuri, links 746 sleep and immune function in Drosophila. Science 363:509-515. 747 Trindade S, Rijo-Ferreira F, Carvalho T, Pinto-Neves D, Guegan F, Aresta-Branco F, 748 Bento F, Young SA, Pinto A, Van Den Abbeele J, Ribeiro RM, Dias S, Smith TK, 749 Figueiredo LM (2016) Trypanosoma brucei Parasites Occupy and Functionally 750 Adapt to the Adipose Tissue in Mice. Cell Host Microbe 19:837-848. 751 Winrow CJ, Gotter AL, Cox CD, Doran SM, Tannenbaum PL, Breslin MJ, Garson SL, 752 Fox SV, Harrell CM, Stevens J, Reiss DR, Cui D, Coleman PJ, Renger JJ (2011)

753 Promotion of sleep by suvorexant-a novel dual orexin receptor antagonist. J 754 Neurogenet 25:52-61. 755 756

757 FIGURE LEGENDS 758 759 Figure 1: T. brucei infection changes sleep architecture in mice. (A) Timeline of 760 methods for all experiments. In the first experiment, mice (n=4/group) were evaluated 761 via EEG and EMG pre-infection and 85d post-infection with T. brucei. In the second 762 experiment, mice (n=6/group) were evaluated via EEG and EMG pre-infection and 763 starting at 76-83d post-infection (baseline and SD). (B) Prior to infection there were no 764 differences between groups in the % of total time spent waking. (C) Post-infection, mice 765 spent significantly more time waking (two-way ANOVA; main effects of time 766 F(11,187)=17.78, p<0.0001; and group F(1,17)=6.128, p=0.0241; * denotes group 767 difference after multiple corrections). (D) When % time waking was averaged over the 768 dark and light periods, infected animals spent significantly more time waking in the light 769 phase (one-way ANOVA; F(3,34)=2.137, ** p=0.0054). (E) Prior to infection there were 770 no differences between groups in the % of total time spent in slow wave sleep (SWS). 771 (F) Post-infection, mice tended to spend less time in SWS. (G) However, this difference 772 was only statistically significant when averaged over the dark and light periods (one-way 773 ANOVA; F(3,34)=2.106, * p=0.0162). (H) Prior to infection there were no differences 774 between groups in the % total time spent in rapid eye movement (REM) sleep. (I) Post- 775 infection, mice spent significantly less time in REM sleep (two-way ANOVA; main 776 effects of time F(11,187)=21.00, p<0.0001; and group F(1,17)=11.32, p=0.0037; and an 777 interaction F(11, 187)=4.340 , p<0.0001; * denotes group differences after multiple 778 corrections). (J) When % time in REM sleep was averaged over the dark and light 779 periods, infected animals spent significantly more time in REM sleep in the light 780 (daytime; Brown-Forsythe ANOVA; F(3,15.7)= 25.60, *** p=0.0061). 781 782 Figure 2: T. brucei infection reduces the duration of SWS and REM Episodes. 783 (A) When SWS episodes were calculated by cumulative duration across both the dark 784 and light stages, there were no differences between groups pre-infection. (B) In 785 contrast, post-infection mice clearly had more SWS episodes of short duration than the 786 controls (two-way ANOVA; main effects of time F(65,1105)=802.6, p<0.0001; and group 787 F(1,17)=9.697, p=0.0063; and an interaction F(65,1105)=11.35, p<0.0001. 788 (C) When REM episodes were binned by duration (10 second epochs) across both the 789 dark and light phases, there were no differences between groups pre-infection. (D) 790 However, post-infection, mice had fewer 10, 20, 60, and 90 second REM episodes (two- 791 way ANOVA; main effects of time F(11,187)=29.06, p<0.0001; and group 792 F(1,17)=15.93, p=0.0009; and an interaction F(11,187)=3.512 , p=0.0002; * denotes 793 group differences after multiple corrections). E, F) Example hynograms showing the 794 time course of wake, SWS, and REM across a 24 hour period for control (E) and 795 infected (F) mice. The yellow bar indicates lights on. Open circles indicate REM to 796 waking transitions, closed circles indicate REM to SWS transitions. 797 798 Figure 3: T. brucei infection reduces the number of Rapid Eye Movement (REM) 799 episodes and the duration of Slow Wave Sleep (SWS). In the light phase, there were 800 no effects of infection on the total number (A) or duration (B) of waking episodes. (C) 801 Following infection, mice showed a shift towards lower frequency activity during waking 802 (two-way ANOVA; interaction of time and group F(98, 882)=3.188, p<0.0001). (D) There

803 was also no effect of infection on the total number of SWS episodes, (E) but infection 804 reduced the duration of SWS (one-way ANOVA, F(3,34)=4.119, * p=0.0088) and (F) 805 shifted activity towards higher frequencies during SWS (two-way ANOVA; interaction of 806 time and group F(98, 882)=3.322, p<0.0001). (G) Infected mice also displayed a 807 reduced number of REM episodes (one-way ANOVA, F(3, 34)=18.43, *** p<0.0001), but 808 (H) there were no effects of infection on total REM duration, while in infected animals 809 activity was shifted to lower lower frequency during REM (interaction of time and group 810 F(98, 882)=3.912, p<0.0001). There were no effects of infection on any of these 811 measures in the dark. * denotes group differences after multiple corrections. 812 813 Figure 4: T. brucei Infection had no effect on gamma power or sleep latency. 814 (A)There were no differences in gamma power (30-50 Hz) pre- or post-infection. (B) 815 There were no differences between control and infected animals in their sleep latency 816 under sleep deprivation conditions. The dashed line indicates the end of the 4h 817 deprivation period in which the treadmill belt stopped or gentle handling ceased. A 818 subset of animals in each group achieved sleep during the deprivation period under the 819 gentle handling method. 820 821 Figure 5: T. brucei infection reduces sleep need. (A) Before infection, all animals 822 had peak SWA during SWS in the dark phase. (B) After infection, the peak of SWA 823 during SWS was flattened, resulting in (C) an overall decrease in the area under the 824 curve for SWS SWA (t-test; t(192)=2.003; * p=0.0466). (D) A control mouse shows a 825 decrease in SWA from near the beginning to the end of the light phase (25.5%), 826 whereas (E) an infected mouse shows an attenuated SWA decrease (12%). Blue bars 827 indicate when measures were taken to quantify percent decrease. (F) Group averages 828 of the percent decrease in SWA over the light phase show a non-significant trend 829 towards less SWA decrease in infected mice (t-test; t(18)=1.962; # p=0.0654). (G) 830 When mice were exposed to a sleep deprivation protocol, control mice had a reduction 831 in the duration of SWS episodes, indicative of consolidation (two-way ANOVA; F(65, 832 650)=6.989; p<0.0001). (H) SWS consolidation was not seen in infected animals after 833 sleep deprivation, as the distribution of SWS episodes was not altered. (I) Controls also 834 had a larger rebound in the light phase than infected animals (t-test; t(6)=2.363; 835 #p=0.0560) as determined by percent increase in SWS SWA from baseline. 836 837 838 Figure 6: Hippocampal neurons from T. brucei infected animals fail to respond to 839 adenosine receptor antagonism. (A, B) Paired-pulse ratios from hippocampal CA1 of 840 control (n=8) and infected (n=8) animals (one slice per animal) before and after 841 treatment with an adenosine A1 receptor antagonist, 8-Cyclopentyltheophylline (CPT). 842 (A) Controls demonstrate a decrease in paired-pulse facilitation after CPT treatment (2- 843 way ANOVA; * main effect of treatment F(1,56)= 14.41; p=0.0004; * above data points 844 indicate significant differences [p<0.05] after multiple comparisons (Sidak)). (B) Infected 845 mice show no response to CPT treatment (2-way ANOVA; F(1,56)= 0.3043; p=0.5834). 846 (C) Representative traces from control and infected mice in A and B. (D) Pre-CPT 847 comparison between control and treated animals also reached statistical significance (2- 848 way ANOVA; * main effect of treatment F(1,56)= 11.40; p=0.0013), suggesting that

849 infected mice have reduced adenosine signaling. All data points are represented at 850 mean ± SEM. 851 852 Figure 7: T. brucei infection alters adenosine A1 receptor mRNA expression in 853 brain tissues. mRNA expression was quantified with qRT-PCR, and data are 854 presented for infected (n=7) animals as fold-change relative to control (n=3) expression. 855 (A) There was a trend for increased Adk expression in the frontal cortex (t-test; 856 t(6.02)=2.131; # p=0.0769). There were also trends for increased adenosine A1 857 receptor (ADORA1)expression in infected animals in the blood (t-test; t(6.043)=2.196; # 858 p=0.0702), frontal cortex (t-test; t(6)=2.008; # p=0.0914), and hypothalamus (t-test; 859 t(5.039)=2.081; # p=0.0915). (B) mRNA expression of inflammatory cytokines revealed 860 no significant differences in mice with or without surgical implantation of electrodes 861 (n=3-7/group). Data are presented as relative to controls without surgery. 862

863 TABLES 864 865 Table 1: Primer sequences for qRT-PCR 866 Adk F: AATTTGGAAGCGTGTGTGTG R: CCCCAAGTCCATCAGATGTC Adora1 F: AGAACCACCTCCACCCTTCT R: TACTCTGGGTGGTGGTCACA Ifng F: CACACTGCATCTTGGCTTTG R: TCTGGCTCTGCAGGATTTTC Il10 F: CTCATGGGTCTTGGGAAGAG R: CATTCCCAGAGGAATTGCAT Il1b F: GCCCATCCTCTGTGACTCAT R: AGGCCACAGGTATTTTGTCG Tnfa F: AATGGCCTCCCTCTCATCAGTT R: CCACTTGGTGGTTTGCTACGA 867 868

32 A

c ment eat MG Surgery

EEG/E T. brucei Infection Suramin Tr Sleep Deprivation Week 02 5 11

Baseline EEG/EMG Group 1: Post-Infection EEG/EMG Group 2: Post-Infection (plus SD) EEG/EMG Group 3: Tissue Collection Hemolymphatic Meninge-encephalitic stage stage

Control Pre-infection Control Post-infection BCTryp Pre-infection Tryp Post-infection D 100 100 80 80 80 ** * 60 60 60 40

40 40 20

20 20 % Waking Avg 0 % Time Waking % Time Dark Light 0 0 12 24 10 12 24 10 EF G 100 100 80 * 80 80 60

60 60 40

40 40 20 Avg % SWS 20 20 0 % Time in % Time SWS Dark Light 0 0 12 24 10 12 24 10 HI J 15 15 10 *** * 8 10 10 * * * * 6 4 5 5 2 Avg % REM

% Time in REM Time % 0 0 0 Dark Light 12 24 10 12 24 10 Time of Day Time of Day A B 100 100 * *** ** * * Control Pre-Infection * Control Post-Infection 50 Tryp Pre-Infection 50 * Tryp Post-Infection

0 0 Cummulative % of Episodes

Cummulative % of Episodes 0102030 0102030 SWS Duration (min) SWS Duration (min) CD 40 40 Control Pre-Infection Control Post-Infection 30 Tryp Pre-Infection 30 Tryp Post-Infection

20 20 * * 10 * 10 *

0 0 Number of REM Episodes 12369121518212427 Number of REM Episodes 1 2 3 6 9 12 15 18 21 24 27 Bin (10 sec Epochs) Bin (10 sec Epochs) E Control Post-infection WAKE SWS REM

6pm 7pm 8pm 9pm 10pm 11pm 12am 1am 2am 3am 4am 5am 6am 7am 8am 9am 10am 11am 12pm 1pm 2pm 3pm 4pm 5pm F Tryp Post-infection WAKE SWS REM

6pm 7pm 8pm 9pm 10pm 11pm 12am 1am 2am 3am 4am 5am 6am 7am 8am 9am 10am 11am 12pm 1pm 2pm 3pm 4pm 5pm Control Pre-infection Tryp Pre-infection Control Post-infection Tryp Post-infection AB C 100 8 20

80 6 15 60 10 * 4 * * * * 40 Power * 5 *

2 (fraction of total) 20 0 0 5 10 15 Total Waking Episodes

Waking Duration (min) 0 0 Hz DE F 100 8 20 * 80 6 15 * * * 60 10 4 * *

Power * 40 5

20 2 (fraction of total) 0 Total SWS Episodes SWS Duration (min) 0 0 5 10 15 0 Hz G HI 100 8 20

80 6 15 * * 60 10 *** 4 * * 40 Power 5

2 (fraction of total) 20 0 REM Duration (min) Total REM Episodes 051015 0 0 Hz Control Pre-infection Control Post-infection Tryp Pre-infection Tryp Post-infection

AB0.03 300 /epoch) 2

V 0.02 200 μ

0.01 100

0.00 Sleep latency (min) 0 Avg Gamma ( ABC Control Pre-infection Control Post-infection 400 Tryp Pre-infection Tryp Post-infection 120 120 300 110 110 200 * 100 100

90 90 100

80 80 0 Normalized SWS SWA Normalized SWS SWA 12 24 10 Area Under the Curve (AUC) 12 24 10 Control Tryp Time of Day Time of Day D 5 Control Post-infection 4 3 F Control Tryp 2 20 1 SWA/avg SWA SWA/avg 0 0 024681012 E 5 -20 Tryp Post-infection 4 -40

3 % Decrease SWA # 2 -60 1 SWA/avg SWA SWA/avg 0 024681012 Zeitgeber Time (ZT)

GHControl Tryp I60 100 100 *** ** ** 40 ** * * 50 * 50 # * Baseline Baseline 20 * Sleep Deprivation Sleep Deprivation % of SWS episodes % of SWS episodes 0 0 % Increase in SWS SWA (baseline to SD recovery) 0 0 102030 0102030 Control Tryp Time in min Time in min ABControl before CPT Tryp before CPT Control after CPT Tryp after CPT

1.8 1.8 * 1.6 1.6 * * 1.4 1.4 (S2/S1) (S2/S1) 1.2 1.2 Paired Pulse Ratio Paired Pulse Ratio 1.0 1.0 050100 0 50 100 Interstimulus Interval (ms) Interstimulus Interval (ms) CD1.8

1.6 * 1.4 (S2/S1) 1.2 Paired Pulse Ratio 1.0 0 50 100 Interstimulus Interval (ms) A B Relative Expression Relative Expression 0.5 1.5 2.5 1e−02 1e+01 1e+04 0 1 2 Infected (NoSurgery) IFNg Adk Blood

Adora1 # Brainstem Adk

IL10 Adora1 Control (Surgery) # Frontal Adk Cortex

Adora1 # IL1b Hypothal Adk # Infected (Surgery) Adora1 TNFa Control Tryp