ABSTRACT WALTER, KATHLEEN ROSE. Enhancement of Porcine

ABSTRACT

WALTER, KATHLEEN ROSE. Enhancement of Porcine Alveolar Macrophage Response to Respiratory Pathogens by Dietary Supplementation of Long-chain PUFA. (Under the direction of Dr. Jack Odle and Dr. Debora Esposito).

Despite common medicinal treatments, respiratory infections are one of the most reported health problems afflicting the swine industry. Leading causes of respiratory-related diseases and deaths in the swine industry are attributed to gram-negative bacteria and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). Novel approaches involving the use of dietary nutrients as alternative methods or used in conjunction with vaccines to alleviate the severity of respiratory infections in swine are sparse. Dietary long-chain polyunsaturated fatty acids (LC

PUFA), such as arachidonic acid (ARA; n-6) and eicosapentaenoic acid (EPA; n-3), demonstrate immunomodulatory effects on host immune response to infection. A key link between immune cell function and long-chain PUFA is the production of lipid mediators, specifically eicosanoids.

Arachidonic acid synthesizes potent eicosanoids, such as prostaglandin E2 (PGE2), which promotes pro-inflammatory and antiviral signaling at the onset of an acute challenge, and subsequently hinders its initial response to promote anti-inflammatory and pro-resolving cascades (termed lipid-mediator class switching). Previous studies geared toward assessing benefits and potential negative impacts of long-chain PUFA supplementation during infection are reviewed in Chapter I. This research assessed the utilization of dietary pre-formed ARA or

EPA to enrich the long-chain PUFA content of piglet alveolar macrophages (PAM), and their ability to modify eicosanoid and cytokine production following LPS or PRRSV challenge.

In Chapter II, we evaluated if feeding milk-replacer supplemented with LC n-6 PUFA to neonatal pigs could provide a heighted but balanced innate immune response following in situ

LPS stimulation. Day-old pigs were allotted to one of three dietary groups for 21 days (n = 20/diet), and received either a control diet (CON, arachidonate = 0.5% of total fatty acids), an arachidonate (ARA)-enriched diet (LC n-6, ARA = 2.2%), or an eicosapentaenoic (EPA)- enriched diet (LC n-3, EPA = 3.0%). Results demonstrated a 2-fold increase of ARA enrichment in PAM from LC n-6 fed pigs compared to CON and LC n-3. A similar enrichment was observed in EPA enrichment from LC n-3 fed pigs, while the concentration of ARA decreased 2-fold.

Abundance of COX-2 and TNF-α mRNA (P < 0.0001), and PGE2 secretion (P <0. 01) were higher in LC n-6 PAM vs CON after 24 hours of LPS stimulation, although abundance of

ALOX5 was 1.6-fold lower than CON. Abundance of ALOX12/15 was 4-fold higher in abundance (P < 0.0001) in CON and LC n-6 PAM compared to LC n-3. A dietary interaction for oxidative burst was not observed. These findings suggest LC n-6 supplementation in neonatal pig diets can enrich the ARA content in PAM, which results in increased mRNA abundance of pro- inflammatory cytokines and eicosanoid production, while initiating early signaling for lipid- mediator class switching within a 24-hour period.

In Chapter III, PUFA-enriched PAM were utilized to determine if ARA-enrichment could improve the innate immune response of PAM and dampen some of the immunosuppressive effects elicited when challenged with PRRSV in situ. By 12 hours post infection (hpi), LC n-6

PAM displayed a 73% increase in mRNA abundance of antiviral cytokines, while having 67% less transcription of viral nucleocapsid compared to LC n-3. Additionally, by 12hpi pro- inflammatory cytokine mRNA abundance was upregulated while anti-inflammatory (IL-10) mRNA was downregulated. These results suggest ARA-enriched PAM can dampen immunosuppressive effects of PRRSV by upregulating antiviral and pro-inflammatory cytokine mRNA abundance and downregulating viral replication. In conclusion, dietary LC n-6 PUFA demonstrates an effective means to enhance a stronger, well-balanced innate immune response to respiratory challenges in neonatal pigs, and could provide an alternative therapeutic agent to promote a quicker return to a stable herd-health status, and lessen the overall economic impact of respiratory diseases in the swine industry.

by Kathleen Rose Walter

A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Animal Science & Poultry Science

Raleigh, North Carolina 2019

APPROVED BY:

______Dr. Jack Odle Dr. Debora Esposito Committee Co-Chair Committee Co-Chair

______Dr. Lin Xi Dr. Matthew Koci

DEDICATION

My work is dedicated to my dad Michael A. Walter and in loving memory of my mom

Clara A. Walter. Thank you for your endless and unconditional love, support and encouragement to pursue my dreams. My accomplishments would have never been possible without the both of you. Everything I am is because of the amazing parents you are. I could not be more blessed.

Thank you. I love you!

BIOGRAPHY

Kathleen Rose Walter was born in Falls Church, Virginia. Her and her family relocated to

Charlotte, NC when she was six years old. After high school, Kathleen moved to Raleigh, NC for her undergraduate degree at North Carolina State University. She received a Bachelor’s of

Science in Animal Science and minor in Genetics. In 2015, she did a PhD curriculum transfer to the Animal Science department at North Carolina State University where she joined Dr. Jack

Odle’s lab. From her previous experiences in Dr. Sunny Liu and Dr. Chad Stahl’s labs, Kathleen was able to merge her previous training and knowledge with the work accomplished in Dr.

Odle’s lab. In 2016, Kathleen was introduced to Dr. Debora Esposito who is stationed at NC

State’s satellite location in Kannapolis, NC at the North Carolina Research Campus. At the end of 2016, Dr. Esposito became Kathleen’s co-PI and invited her to finish her research at the Plants for Human Health Institute on the NC Research Campus. Kathleen graciously accepted and has been building a strong network with other research groups in Kannapolis since. From Kathleen’s unconventional path through the PhD program, she was able to design and develop her project which merges her knowledge and experience of all labs. Her work focuses on the use of dietary lipids to improve the response of respiratory immune cells to common pathogens that afflict the swine industry. Kathleen’s passion centers around the desire to improve the quality of life in humans and animals. As such, she is dedicated to continuing her career in the field of nutritional immunology.

iii

ACKNOWLEDGMENTS

I would like to give a special thanks to my advisor, Dr. Jack Odle, for his continuous guidance, support and encouragement. I am extremely honored to have been given the opportunity to work with him. I would also like to give a special thanks to my co-advisor, Dr.

Debora Esposito, for graciously welcoming me into her lab, as well as her guidance and support throughout the remainder of my degree. Additionally, I would like to extend my most sincere gratitude to the rest of my committee, Dr. Lin Xi and Dr. Matthew Koci for all of their assistance, invaluable feedback and contributions throughout my project. Thank you to all of you for recognizing my potential and motivating me to overcome all the obstacles I have faced throughout my graduate school career.

Special appreciation is extended to Dr. Tobias Käser and his lab at NC State’s Veterinary

School for their time, resources, training and collaboration on my research project. This project would not have been made possible without the mentoring and training I received in previous labs before joining Dr. Odle and Dr. Esposito. A huge thank you to Dr. Sunny Liu for her advising throughout my undergraduate degree and giving me my first opportunity in graduate school. Dr. Liu’s teaching and training helped me to realize that my true passion lies in research.

I am forever grateful. I would also like to thank Dr. Julie Hicks from Dr. Liu’s lab for all of her training, assistance and friendship over the years. A big thank you to Dr. Chad Stahl, the training received in his lab gave me my appreciation and interest of nutrition’s role in regulating gene expression. The brief time in his lab, also gave me to opportunity to be introduced and welcomed into Dr. Odle’s lab. My education, training and experience in Dr. Liu’s and Dr. Stahl’s labs made the conceptualization and execution of my research project possible.

Special thanks are given to Dr. Jia Xiong and Sierra Boney in the Esposito lab for their help and support since coming to the NC Research Campus. A huge thank you to Dr. Slavko

Komarnytsky and Mickey Wilson for their assistance, training and allowing use of equipment that was vital for my research. Appreciation is extended to the faculty and staff in the Animal

Science department, thank you for the wonderful opportunities and support I have received over the years.

My academic journey would not have been made possible without the love and support of family and friends. To my parents Michael and Clara Walter, thank you for your unconditional love, encouragement and support. Thank you for giving me an amazing childhood filled with love and laughter. Thank you for always guiding me to aim for my dreams and be the best person

I can be. For teaching me to put everything in God’s hands, and that “what is meant to be, will be”. Thank you, Mom for always giving me one of my favorite pieces of advice that I could never hear enough, “When someone tells you that you can’t, you show them how you can!”. I always keep that advice in my heart and mind, no matter what obstacle I face. To my siblings

Kim, Jessica, Annie, Kristin, and Brian thank you for always encouraging me. To my friends, especially Candace Little, thank you for all of your support. I love all of you and am forever grateful.

TABLE OF CONTENTS

LIST OF TABLES ...... vii LIST OF FIGURES ...... viii Chapter I: Literature Review ...... 1 Introduction ...... 2 Polyunsaturated Fatty ...... 2 Current Intake Trends and Growing Health Concerns ...... 3 Dietary PUFA Impact on Immunity and Infectious Disease ...... 5 Incorporation of PUFA into Immune Cells ...... 5 Effect of Immune Cell Function by Eicosanoid Production ...... 6 Dual Nature of Prostaglandin E2 ...... 7 Infectious Disease and the Role PUFA Plays ...... 10 Current Infectious Diseases in the Swine Industry ...... 15 Respiratory Diseases ...... 15 Porcine Reproductive and Respiratory Syndrome Virus ...... 16 Current Methods for Control of Respiratory Infectious Diseases ...... 18 Conclusion ...... 21 Proposed Research ...... 22 Literature Cited ...... 23

Chapter II: Dietary arachidonate in milk replacer triggers dual benefits of PGE2 signaling in LPS-challenged piglet alveolar macrophages ...... 44 Abstract ...... 45 Introduction ...... 47 Materials and Methods ...... 49 Results ...... 55 Discussion ...... 58 Conclusion ...... 63 Literature Cited ...... 65

Chapter III: Immunosuppressive effects of porcine reproductive and respiratory syndrome virus are dampened in porcine alveolar macrophages from arachidonate-fed piglets ...... 85 Abstract ...... 86 Introduction ...... 87 Materials and Methods ...... 89 Results ...... 92 Discussion ...... 97 Conclusion ...... 103 Literature Cited ...... 104

Chapter IV: Conclusions and Future Perspectives ...... 121 Conclusions ...... 122 Future Perspectives ...... 125 Literature Cited ...... 128

Appendices ...... 130 Appendix A ...... 131 Appendix B ...... 134

vii

LIST OF TABLES

Chapter I

Table 1 Functions and characteristics of PRRSV genome ...... 36

Chapter II

Table 1 Composition of milk replacer diet fed to piglets ...... 74

Table 2 Analyzed fatty acid composition of milk replacer fed to piglets ...... 75

Table 3 Staining reagents used in flow cytometry of immune cells isolated from lungs of milk replacer-fed pigs ...... 76

Table 4 Sense and anti-sense primer sequences (5’-3’) used in qRT-PCR analysis ...... 77

Table 5 Serum metabolite and enzyme concentrations and whole-blood cell from milk replacer-fed pigs ...... 78

Table 6 Fatty acid composition of lung parenchymal tissue and porcine alveolar macrophages (PAM) ...... 79

Chapter III

Table 1 Forward and reverse primer sequences for qRT-PCR analysis ...... 112

Appendices

Appendix A

Supplemental Table 1 Fatty acid composition brain tissue from pigs fed formulas varying in fatty acid composition ...... 131

Supplemental Table 2 Fatty acid compostion of liver tissue from pigs fed formulas varying in fatty acid composition ...... 132

Supplemental Table 3 Fatty acid compostion of spleen tissue from pigs fed formulas varying in fatty acid composition ...... 133

Appendix B

Supplemental Table 1 Fatty acid composition of porcine alveolar macrophages (PAM) from sow reared piglets ...... 134

viii

LIST OF FIGURES

Chapter I

Figure 1 n-6 and n-3 Biosynthesis ...... 37

Figure 2 Eicosanoid synthesis from arachidonic acid ...... 38

Figure 3 Eicosanoid synthesis from eicosapentaenoic acid ...... 39

Figure 4 Arachidonic acid promotes lipid-mediator class switching via PGE2 production ... 40

Figure 5 Eicosanoid synthesis from docosahexaenoic acid ...... 42

Figure 6 Genome structure and imagining of porcine reproductive and respiratory syndrome virus ...... 43

Chapter II

Figure 1 Validation of PAM isolation procedure ...... 80

Figure 2 Dietary LC n-6 PUFA increases COX-2 mRNA abundance and eicosanoid production in porcine alveolar macrophages ...... 81

Figure 3 Dietary LC n-6 modifies lipoxygenase and cytokine mRNA abundance associated with a pro-inflammatory response in porcine alveolar macrophages ..... 82

Figure 4 Long chain n-6 supplementation initiates initial stages of lipid-mediator class switching in porcine alveolar macrophages ...... 83

Figure 5 LPS stimulation in porcine alveolar macrophages alters oxidative burst and cellular stress regardless of long chain PUFA enrichment ...... 84

Chapter III

Figure 1 Long chain n-6 enrichment in PAM increases COX-2 mRNA abundance and maintains elevated concentrations of PGE2 following PRRSV infection ...... 113

Figure 2 Supplementing diet with LC n-6 enhances antiviral interferon response leading to decreased viral replication in PRRSV-infected PAM ...... 114

Figure 3 Dietary long-chain PUFA alters key genes involved in innate antiviral immune signaling in PAM ...... 115

Figure 4 Dietary arachidonate enhances pro-inflammatory cytokine response in PRRSV-infected PAM ...... 118

Figure 5 Dietary LC n-6 PUFA reverses PRRSV upregulation of anti-inflammatory cytokines in PAM ...... 120

CHAPTER I

Literature Review

Introduction

Polyunsaturated Fatty Acids

Essential fatty acids are required for normal mammalian growth, development and cellular function. However, animals lack the necessary enzymes for synthesis and they must be provided in the diet. Essential fatty acids α-linolenic acid (18:3, n-3) and linoleic acid (18:2, n-6) are precursors to other long-chain omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids

(PUFA) that are required for cell membrane structure, cellular function, eicosanoid and docosanoid production, as well as general growth and development (Murphy, 1990; Gropper et al., 2005; Pond et al., 2005; Abedi and Sahari, 2014; Hadley et al., 2016). Arachidonic acid

(ARA; 20:4n-6), eicosapentaenoic acid (EPA; 20:5n-3) and docosahexaenoic acid (DHA; 22:6n-

3) are generated from the same series of tightly regulated desaturation and elongation steps

(McAlexander et al., 2004; Guillou et al., 2010). Utilization of the same enzymatic pathway results in competition for biosynthesis between n-3 and n-6 PUFA, which can be manipulated by the diet (Figure 1).

Excess supplementation of one essential fatty acid can lead to decreased conversion of the opposing fatty acid (Schmitz and Ecker, 2008). The conversion rate of α-linolenic acid and linoleic acid to long-chain PUFA is inefficient. In humans, conversion rates from α-linolenic acid to EPA and DHA are estimated at 8% and < 0.05% respectively (Burdge, 2004; Burdge and

Calder, 2005). Conversion rates of linoleic acid to ARA in human and rodent peripheral blood leucocytes have been reported to be as low as 2% (Cunnane et al., 1984). The known importance and low conversion rates of long-chain PUFA has driven the increasing interest in supplementing diets with preformed long-chain PUFA (Huang and Craig-Schmidt, 1996; Hussein et al., 2005;

Brenna et al., 2009; Huang et al., 2016; Hadley et al., 2016).

Current Intake Trends and Growing Health Concerns

The changes in n-3 and n-6 PUFA consumption in Western diets has been a topic of discussion for quite some time, where the ratio of n-6 to n-3 PUFA have been reported to be as high as 30:1 (Blasbalg et al., 2011). The drastic imbalance is thought to be a result of agricultural and industrial development, particularly from increased consumption of vegetable oils rich in n-6

PUFA, animal products raised on concentrated feed versus pasture (Cordain et al., 2005) and decreased oil-rich fish consumption (n-3 PUFA) (Simopoulos, 2002). Currently, the United

States Department of Agriculture (USDA) and Department of Health and Human Services

(DHHS), recommend 27g/day (DHHS and USDA, 2015) or ~7% of total energy intake (Kris-

Etherton et al., 2000) for a 2,000-calorie diet should be from PUFA-containing oils. There is not a recommended healthy n-6:n-3 ratio. Although the American Heart Association recommends consuming oil-rich fish twice per week to provide roughly 1g/day of EPA and DHA to reduce heart disease risk (American Heart Association, 2014).

Health problems and chronic diseases are at a record high, and dietary PUFA intake is thought to be a major contributor. Previous work has demonstrated the pro-inflammatory properties of n-6 long-chain PUFA and anti-inflammatory effects of n-3 long-chain PUFA

(Calder, 2011; Raphael and Sordillo, 2013).The high imbalance of n-6:n-3 ratio in the diet is thought to be a contributor to obesity (Naughton et al., 2016), cardiovascular disease, chronic inflammatory diseases (Saini and Keum, 2018), and cancer (Whelan, 2008). This has led to further studies regarding the impact of long-chain PUFA nutrition on chronic inflammatory diseases and infections, with emphasis on chronic human health diseases including but not limited to rheumatoid arthritis, asthma, chronic obstructive pulmonary disease, Crohn’s disease, and ulcerative colitis (Calder, 2006b). For instance, the use of oils in diets, such as fish oil

supplements as a source of long-chain n-3 PUFA, has been reported to improve rheumatoid arthritis (RA) symptoms. In clinical trials, some RA patients receiving fish oil reported a decrease in clinical symptoms (e.g. joint tenderness, morning stiffness) and nonsteroidal anti- inflammatory drug (NSAID) use (Kremer et al., 1995; Galarraga et al., 2008). Additional studies extensively reviewed by Calder support the beneficial claims of n-3 long-chain PUFA supplementation in RA patients (Calder, 2006a). In rats, the use of dietary n-3 long-chain PUFA improved intestinal damage from induced ulcerative colitis (Nieto et al., 2002). However, in ulcerative colitis and Crohn’s disease patients, there are conflicting and inconsistent findings for the proposed beneficial effects of fish oil supplementation (Calder, 2006a; Sijben and Calder,

2007).

Although the evidence for improved chronic inflammatory conditions are conflicting, there still seems to be a general consensus (taking into account other reported health benefits), that it is beneficial to increase n-3 long-chain PUFA intake. This has led to an increased demand for n-3 PUFA consumer products. Sources of n-3 long-chain PUFA for humans comes from fish and fish oil supplements. With the growing concern of unsustainable fishery, we have turned to alternative sources and a growing trend in n-3 enriched animal products, i.e. meat, milk and eggs

(Ian Givens and Gibbs, 2008; Butler, 2014a; Ma et al., 2016).

Today the majority of n-3 and n-6 long-chain PUFA research focuses on the benefits of their dietary supplementation and subsequent effects on chronic inflammatory diseases. The beneficial role of n-6 in diets with acute inflammation and infection are rarely a point of focus in human research. There are even fewer studies on the effects in livestock. The first portion of this review examines the mechanisms by which long-chain PUFA modulate inflammatory responses with emphasis on ARA and EPA; as well as clinical applications stemming from PUFA

supplementation, particularly in swine as pork is one of the most highly consumed meat products in the world (National Pork Board, 2018).

Dietary PUFA impact on immunity and infectious disease

Incorporation of PUFA into immune cells

The relationship between dietary PUFA and its effects on immunity to infectious disease is in large part due to the incorporation of PUFA into the phospholipid membrane of immune cells. The proportion of long-chain PUFA is contingent on the cell type, and can be manipulated by the diet (Yaqoob and Calder, 1995; Fritsche, 2007). Human monocytes and lymphocytes contain 15-25% ARA (Calder and Grimble, 2002), ~1% EPA, and 2.5% DHA (Calder, 2008b).

Treatment of Jurkat T cells with 50µM of EPA (20:5n-3) for 48 hours significantly altered the lipid content of both leaflets in lipid rafts (subdomains of plasma membranes). Average EPA

(13.45 ± 4.79 mol %) and DHA (0.87 ± 0.39) concentrations were increased in rafts compared to control cells (0.58 ±0.19 and 0.31 ± 0.14; P < 0.001 respectively), while the concentration of

ARA (20:4n-6) decreased (6.25 ± 0.61 mol% to 2.50 ± 0.17) (Li et al., 2006). Similar findings were found when Jurkat cells were treated with half the amount of ARA, EPA and DHA over the same time course (Stulnig et al., 1998).

In murine macrophages supplementation with long-chain PUFA has led to higher incorporation in the phospholipid membrane than the neutral lipid fractions. In culture, the concentration of ARA in phospholipids increased from 15% to 28% after 48 hours when cells were treated with 33µM of 20:4n-6. When the same concentration of 20:5n-3 or 22:6n-3 were added, the concentration of EPA increased from 2% to 31%, or 22% DHA. In n-3 treated cells, the concentration of ARA was lowered to less than 10%. In the neutral lipid pool, concentrations of ARA and EPA increased 10% and 5% of total fatty acids following corresponding PUFA

treatment while the remaining were saturated and unsaturated fatty acids (Calder et al., 1990;

Chapkin et al., 1991). Huang and Craig-Schmidt observed similar effects in phospholipid pools of lung tissue. Phosphatidylethanolamine (PE) and phosphatidylcholine (PC) are major reservoirs for dietary long-chain PUFA in tissue and immune cells involved in inflammatory processes (Triggiani et al., 2004; Raphael and Sordillo, 2013). Day-old piglets fed milk-replacer containing 0.9g/100g ARA of total fatty acids for 25 days, resulted in a 30-60% increase in

20:4n-6 in PE and PC lipid pools of lung tissue. Piglets receiving 0.7g/100g DHA of total fatty acids exhibited a 3.5-fold increase in PE-DHA and a 4.7-fold increase in PC-DHA concentrations. Interestingly, pigs receiving milk-replacer containing both 1.0g ARA and 0.8g

DHA resulted in lower PC and PE-ARA pools, further demonstrating the antagonistic nature of n-6 and n-3 long-chain PUFA (Huang and Craig-Schmidt, 1996).

Effect on immune cell function by eicosanoid production

Altering the long-chain PUFA composition of immune cells can lead to changes in fluidity, protein structure, second messengers, lipid mediator and cell signaling pathways leading to altered gene expression, which in turn effects the cell’s metabolic function and general physiological response (Stulnig, 2003). A key link between immune cell function and long-chain

PUFA is the production of lipid mediators, specifically eicosanoids, which will be the focus of this section. Particularly those eicosanoids derived from the metabolism of ARA and EPA.

Eicosanoids are predominantly synthesized from the mobilization and oxidation of 20 carbon

PUFA from the phospholipid membrane, and can elicit a downstream effect on intracellular signaling and gene expression by controlling the intensity and duration of immune responses, chiefly inflammation (Calder and Grimble, 2002).

Immune cells contain high levels of ARA in their cell membrane compared to EPA and

DHA (Innes and Calder, 2018). Release of ARA and other PUFA is catalyzed by phospholipase

A2 (PLA2), which mobilizes it from the sn-2 position of the phospholipid (Leslie, 2004). The released PUFA is metabolized by cyclooxygenase (COX), lipoxygenase (LOX) and/or epoxygenase (EOX) enzymes to generate eicosanoids. Arachidonate is the most abundant PUFA and is the dominant substrate for eicosanoid synthesis generating 2-series prostaglandins (PG), thromboxanes (TX), and 4-series leukotrienes (LT) to act as mediators and regulators of inflammation (Figure 2). In a Ca2+-dependent manner, ARA is metabolized by 5-LOX to synthesize 4-series leukotrienes (LT), leading to a pro-inflammatory response (Luo et al., 2003;

Gijon et al., 2007). For example, leukotrienes such as LTB4 found in macrophages and neutrophils, generate pro-inflammatory effects. Leukotriene B4 increases vascular permeability, produces pro- inflammatory cytokines, as well as enhances natural killer cell activity, lymphoid cell proliferation, and leukocyte chemotaxis (Calder, 2006b; Botham and Mayes, 2009). Leukotriene C4 (LTC4),

LTD4 and LTE4 are produced by eosinophils, basophils, and mast cells. They enhance mucus secretion, vascular permeability, hypersensitivity (Innes and Calder, 2018) and are involved in causing anaphylaxis (Gropper et al., 2005).

Dual nature of prostaglandin E2

Prostaglandin E2, is a potent regulator of immune cell function produced by monocytes, macrophages and neutrophils, with monocytes and macrophages having the highest production

(Calder, 2006b). Early stages of immune cell stimulation promote increased COX-2 for the synthesis of PGE2. In early stages of infection, PGE2 increases vascular permeability, induces fever and promotes the production of pro-inflammatory cytokines. Murine macrophages treated with arachidonic acid exhibited a 3-fold increase in PGE2 synthesis and interleukin (IL)-6

secretion compared to EPA-treated cells (Bagga et al., 2003a). However, dietary intake of EPA becomes incorporated in the cell membrane at the expense of ARA, which decreases the substrate availability for ARA derived eicosanoids, and the generation of less potent 3-series PG,

TX, 5-series LT, and E-series resolvins (Calder, 2006b) (Figure 3). In neutrophils and monocytes, supplementation with n-3 PUFA enriched the phospholipid membrane while decreasing the amount of ARA present. The change in membrane composition resulted in a change in eicosanoid production and inhibition of LTB4 (Lee et al., 1985). Macrophages treated with EPA and stimulated with lipopolysaccharide (LPS) displayed a 97% decrease in PGE2 production (Babcock et al., 2002). Furthermore, Fritsche and colleagues demonstrated that feeding gestating sow diets supplemented with fish oil decreased ARA-derived eicosanoids in suckling pigs. Sows were fed 7% fish oil or lard starting at day 107 until farrowing. After 28 days, alveolar macrophages were isolated from piglets to evaluate production of ARA-derived eicosanoids. The basal release of PGE2, TXB2, and LTB4 were 63%, 83%, and 75% lower respectively, in the fish oil fed group compared to the control group (Fritsche and Cassity, 1996).

Upon stimulation with endotoxin, there was a 70% decrease in PGE2 in the fish oil fed group compared to control (Fritsche et al., 1993).

A balanced immune response is partially linked to the dual nature of PGE2. Prostaglandin

E2 can stimulate both pro- and anti-inflammatory signaling cascades, which are ushered by the ability of PGE2 to regulate lipoxygenase (LOX) enzymes (Serhan et al., 2008). This dual nature is regulated by timing and concentration of lipid mediators, and target sensitivity. During acute inflammation, PGE2 is able to switch roles by inhibiting the activity of 5-LOX and enhancing the activity of 12/15-LOX thus decreasing the production of 4-series LT and enhancing the production of lipoxins (LX), which have anti-inflammatory and pro-resolving capabilities (Calder, 2006b;

Serhan, 2014; Levy and Serhan, 2014). This in part is mediated through the G-protein coupled receptor EP4, and regulation of COX-2 expression (Kawahara et al., 2015; Tang et al., 2017). In an autocrine or paracrine manner, PGE2 binds to EP4 (a Gαs-linked protein coupled receptor) which increases intracellular cAMP. Elevated cAMP increases expression of dual specificity phosphatase 1, which dephosphorylates MAPK p38 and activates the binding of tristetraprolin and deadenylase enzymes to the 3’ untranslated region (UTR) of COX-2 (Tang et al., 2017). Binding on the 3’ UTR results in degradation of COX-2 mRNA and dissolution of a pro-inflammatory response (Tang et al., 2017). Concurrently, activation of LOX and resolvins, are initiated leading to lipid-mediator class switching from the predominant enzymatic activity of 5-LOX to 12/15-

LOX (Serhan, 2007; Buckley et al., 2014; Levy and Serhan, 2014) and subsequent conversion of

LTA4 (a LTB4 precursor) to LX (Serhan and Sheppard, 1990; Norris et al., 2014) (Figure 4).

Inflammation is ceased and resolution allows the challenged tissue to return back to a state of homeostasis.

Lipid-mediator class switching yields lipoxins, resolvins, protectins, and maresins (Serhan et al., 2014). Lipoxins are derived from the metabolism of ARA via the 12/15-LOX enzyme and serve anti-inflammatory and pro-resolving roles (Freire and Van Dyke, 2013). Lipoxin A4 inhibits further recruitment and activation of granulocytes to the site of infection, decreases vascular permeability, and inhibits pro-inflammatory cytokine release. In a pro-resolving response, LXA4 stimulates monocyte chemotaxis to promote phagocytosis of cellular debris and efferocytosis.

Additionally, LXA4 aids in the reconstruction of damaged epithelia (Serhan and Chiang, 2004;

Serhan et al., 2008; Levy and Serhan, 2014). Resolvins, protectins, and maresins are metabolized from DHA (Figure 5) to inhibit neutrophil recruitment and infiltration to the site of infection, decrease pro-inflammatory cytokine production, inhibits pain signals, and further decrease PG and

LT levels, which aid in the return of homeostasis to the afflicted tissue (Serhan et al., 2008; Freire and Van Dyke, 2013).

Numerous studies demonstrate the immunosuppressive capabilities of PGE2 in innate and adaptive immune cells. PGE2 can alter the activation and function of natural kill cells, granulocytes, macrophages, mast cells (Kalinski, 2012), dendritic cells, B-cells, T-cells as well as

T-cell differentiation (Sreeramkumar et al., 2012). It has the ability to suppress acute inflammatory mediators, lymphoid cell proliferation, and specific cytokine production (Gropper et al., 2005;

Calder, 2006b; Nagamachi et al., 2007; Kalinski, 2012; Harizi, 2013). In alveolar macrophages, increased production of PGE2 lead to an increase in IL-1R-associated kinase-M (IRAK-M), an inhibitor of toll-like receptor (TLR) and interleukin receptor (IL-1R) signaling, which ultimately resulted in decreased phagocytosis, bacterial killing, and TNF-α production (Hubbard et al., 2010).

Studies focused on the dual nature of PGE2 and lipid-mediator class switching have been thoroughly reviewed by Serhan and colleagues (Levy et al., 2001; Serhan, 2007).

Infectious disease and the role PUFA plays

Infectious diseases are a result of opportunistic pathogens stimulating the host’s immune system and disturbing its homeostatic process. The immune system consists of innate and adaptive immunity that are distinct and separate responses however, both interact with each other to generate an efficient defense against invading pathogens. The innate immune response is the host’s first line of defense against pathogens consisting of a series of anatomical barriers, humoral and cellular components to destroy the infectious agent. In the event the innate immune response is not sufficient, an adaptive immune response will be stimulated for pathogen clearance and immunological memory (Murphy, 2012).

Fatty acids, particularly long-chain PUFA, exert immunomodulatory effects which has led to the increasing trend of using feed components, with these known properties, to manipulate the immune response, cleverly termed nutritional immunomodulation (Korver, 2012;

Swiatkiewicz et al., 2015). With increases in chronic inflammatory disease and imbalanced n-

6:n-3 ratio in western diets (Simopoulos, 2002; Mills et al., 2005; Calder, 2008a), higher n-3 long-chain PUFA intake in humans and animals for improved overall health has increased

(Givens, 2009). While the multiple health benefits of n-3 PUFA supplementation are well accepted, EPA and DHA are known for their immunosuppressive properties (Shaikh and Edidin,

2008). There have been several studies suggesting the negative impact that long-chain n-3 PUFA can have on the production of pro-inflammatory cytokines. In vitro studies with EPA treated macrophages reported significant decreases in the production of IL-1β, TNF-α, and IL-6 after

LPS stimulation (Weldon et al., 2007; Skuladottir et al., 2007). Fish oil supplementation in rodents decreased the production of IL-1β, TNF-α and IL-6 after LPS stimulation (Billar et al.,

1988; Renier et al., 1993; Yaqoob and Calder, 1995; Calder, 2010). In human studies, patients receiving fish oil supplements demonstrated decreased secretion of IL-1, TNF- α and IL-6

(Endres et al., 1989; Trebble et al., 2003). While regulation of inflammation is imperative for overall health, it is necessary for the control and elimination of opportunistic pathogens. This continues to beg the question of the impact dietary long-chain n-3 PUFA has on infectious disease resistance.

In guinea pigs, diets supplemented with fish oil had deleterious effects on immune control and clearance of Mycobacterium tuberculosis (TB). Guinea pigs were fed diets supplemented with 4% (by weight) corn oil (n-6) or fish oil (n-3) for three weeks then infected with TB. At three- and six-weeks post infection, animals fed the n-6 diet had decreased bacterial

load in the lungs (5.19 ± 0.15 and 4.4 ± 0.16 cfu, respectively) compared to the n-3 treatment group (5.73 ±0.11 and 5.7 ± 0.25 cfu, respectively). T-cell function and proliferative abilities in the spleen were also examined after a mitogen-induced stimulation with concanavalin A (ConA).

Guinea pigs fed the n-3 enriched diet displayed decreased T-cell proliferation (223 ± 27 SI, stimulation index) at 3 weeks post infection compared to the n-6 group (374 ± 41 SI) (McFarland et al., 2008). Previous work by Mayatepek et. al (Mayatepek et al., 1994) and Paul et. al (Paul et al., 1997) support these findings and suggest that n-3 supplementation can increase susceptibility to TB. In pigs, dietary supplementation of n-3 resulted in decreased immune cell function when challenged with LPS. Møller and colleagues (2006) evaluated the effects of n-6 and n-3 long- chain PUFA on ex vivo cytokine and eicosanoid production in PAM. Weaned pigs were fed diets containing 5% sunflower oil (n-6), fish oil (n-3), or a control diet containing animal fat for 28 days. Alveolar macrophages were cultured and stimulated with LPS for 18 hours. Cells from the n-3 treatment group had decreased concentration (mg/g) of ARA by 60% and 53% in the control group. Positive correlations between n-6 content, PGE2, TNF-α, and IL-8 production were observed. Conversely, negative correlations between n-6 content, PGE2, TNF-α, and IL-8 production were observed in n-3 fed pigs. Dietary supplementation with n-3 decreased the production of the eicosanoid PGE2 by 42% and 46% compared to control and n-6 treatment groups respectively. Expression of LTB4 was decreased in the n-3 group by 62% and 67% compared to control and n-6 treatments. A significant decrease in TNF-α (P < 0.01) and a noticeable decrease in IL-8 (P < 0.05) were observed in the n-3 treatment group compared to other treatments. However, there was no significant difference in the production on IL-6 between treatment groups (Møller and Lauridsen, 2006).

Alternatively, fish oil supplementation has demonstrated to enhance intestinal integrity during bacterial challenge (Liu et al., 2012). Weaned pigs were fed diets containing either 5% corn or fish oil for 21 days and subsequently challenged with LPS. Expression of PGE2, TNFα, heat shock protein 70 and caspase-3 mRNA were downregulated in jejunum and ileum mucosa of n-3 fed pigs compared to control 4h post-injection. mRNA expression of TLR4, MyD88,

IRAK1, TRAF6 (key components of TLR4 signaling pathway), NOD1/2, RIPK2 and NFκB (key components of NOD2 signaling pathway) were assessed. Pigs receiving fish oil demonstrated decreased mRNA expression of TLR4 (1.07 vs 1.87 ± 0.25), NOD2 (1.88 vs 3.60 ± 0.49) and

RIPK2 (1.96 vs 2.74 ± 0.24) in the jejunum and decreased expression of NOD2 (1.25 vs 2.11

±0.26) in the ileum 4h post-injection compared to corn oil fed pigs. Other markers displayed an

LPS interaction but not a diet x LPS interaction. Furthermore, intestinal morphology, indicated by villus height, villus height:crypt (VCR) depth ratio, and diamine oxidase activity (DOA) were improved in n-3 fed pigs following LPS injection. While a LPS x diet interaction was not observed, n-3 fed pigs had increased villus height (p <0.05) and VCR in the jejunum and ileum

(p <0.05) compared to control. Pigs receiving the n-3 diet had increased mucosal DOA activity

(p <0.05) and decreased activity in the plasma (p <0.04) 4h post-injection, although no interaction was observed. The authors conclude that fish oil supplementation can decrease TLR4 and NOD2 signaling pathways and improve intestinal integrity in weaned pigs following LPS challenge (Liu et al., 2012). These studies suggest that long-chain PUFA supplementation, particularly n-3, can be both beneficial and detrimental depending on the pathogen and site of infection.

In mice, Schwerbrock et al. evaluated the effects of fish oil supplementation on susceptibility to influenza. Mice were fed diets containing 4% of fish oil: 1% corn oil (n-3: n-6)

or a control diet with 5% corn oil for 2 weeks, then infected with Influenza A via intranasal administration. Samples were collected every 3 to 6 days post infection (d0, 3, 7, 10, 15, and

21dpi). While lung pathology was reduced in the n-3 treatment group infected with influenza compared to the control group, immune cell function was lowered. At 3dpi, the amount of NK cells in the lungs were decreased more than 50% in the n-3 group compared to control. By days 7 and 10pi mice receiving n-3 had a significant decrease in CD 8+ T cells and pro-inflammatory cytokine mRNA (TNF-α, IL-6 and macrophage inflammatory protein (MIP)-1α compared to control-fed mice (P < 0.5). Furthermore, viral load was 70% higher in n-3 fed mice 7dpi and displayed a significantly higher mortality rate at 57% compared to the control group at 10%

(Schwerbrock et al., 2009). This work is consistent with the previous work of Byleveld and colleagues (Byleveld et al., 1999; Byleveld et al., 2000).

Interestingly in pigs, feeding formula containing both ARA and DHA demonstrated similar immunosuppressive effects when inoculated with an inactivated Influenza vaccine

(Bassaganya-Riera et al., 2007). Neonatal pigs were fed milk-replacer containing 0.63% ARA and 0.34% DHA of total fatty acids, a control formula, or sow milk for 30 days. Pigs were vaccinated on day 9 and T cell proliferation was evaluated on day 0, 9, 16, 23, and 30. At day 23, proliferation of CD4+, CD8+ T cells, and peripheral blood mononuclear cells (PBMC) were higher in the control group following inoculation compared to AA/DHA and sow-reared pigs (p

< 0.01). On day 30, mRNA expression of the anti-inflammatory cytokine IL-10 was greater in

AA/DHA and sow-reared pigs compared to control following inoculation (p < 0.05), and differences in pro-inflammatory and antiviral markers (TGF-β1, IL-2, IL-4, IL-13 and INF-γ) were undetectable among treatment groups following inoculation. Authors conclude that the immunosuppressive effects of DHA may neutralize the pro-inflammatory and antiviral abilities

of ARA when fed in combination to neonatal pigs, which they claim to conflict with studies reported in human infants fed formulas containing both ARA and DHA (Bassaganya-Riera et al.,

2007a).

Taken together these studies suggest that dietary n-3 and n-6 long-chain PUFA have immunomodulatory effects to infectious diseases, albeit responses can be pathogen and species specific. As such, further investigation is warranted for the effects of dietary long-chain PUFA and infectious disease resistance, particularly in swine.

Current infectious diseases in the swine industry

Respiratory diseases

The USDA regulates the National Animal Health Monitory System (NAHMS) which surveys farms from around the country to identify changes and trends in livestock health and management. According to the most recent report for the swine industry the majority of reported health problems across all stages of production (breeding herds, preweaning, nursery, and grower/finisher) are respiratory problems, which account for 4.4 -75.1% of deaths in preweaning to grower/finisher phases (USDA, 2015a).

Across production stages the top three respiratory diseases reported are caused by gram- negative bacteria and viruses specifically, Mycoplasma pneumonia, Influenza virus, and Porcine

Reproductive and Respiratory Syndrome Virus (USDA, 2015b). Over the past 47 years, swine production has increased leading to larger heard sizes, overcrowding and improper ventilation in some cases, which could contribute to the high reports of respiratory diseases (Brockmeier et al.,

2002). Infection of gram-negative bacteria occurs via air borne droplets, body secretions or direct contact from other infected pigs. Infected pigs can experience; coughing, difficulty breathing,

poor circulation, discoloration (bluing) of the skin, fever, decreased appetite, decreased growth, lameness, and depression.

Porcine Reproductive and Respiratory Syndrome Virus

Porcine reproductive and respiratory syndrome virus (PRRSV) is a unique virus in that it can infect and cause disease in multiple organs regardless of age or gender in swine. As previously stated, it is one of the most prevalent viruses impacting the swine industry worldwide.

In the United States, the swine industry estimates a loss of over 9 million market pigs a year totaling over $664 million in losses (Holtkamp et al., 2013). PRRSV is highly infectious, where only a small amount of the virus is required to infect an entire herd. There are numerous routes of transmission including: airborne transmission, nasal secretions, feces, urine, semen, placental transfer, sow’s milk, carrier pigs, and contaminated clothing or farm equipment (Muirhead and

Alexander, 2013; Dee, 2014).

Porcine reproductive and respiratory syndrome virus causes serious clinical symptoms across all life stages of swine and maintains a life-long subclinical infection (Chand et al., 2012).

In all life stages, pigs can experience loss of appetite, weight loss, lethargy, fever, and respiratory complications such as labored breathing and secondary bacterial or viral infections. In sows,

PRRSV can cause late term abortion, reduced litter size, early farrowing, still births, piglet mummification, and decreased milk production. In boars, PRRSV infections can result in lowered sperm count and fertility. In breeding herds, 44.5% of disease problems are caused by

PRRSV (USDA, 2015b). In preweaning, nursery and grower/finisher pigs, there is a significant decrease in growth rate and performance. Respiratory complications and mortality are particularly high in these phases (Holtkamp et al., 2013; Muirhead and Alexander, 2013; Dee,

2014). From preweaning to nursery phases, respiratory disease-related deaths rise from 4.4 to

47.3% (USDA, 2015a) with PRRSV constituting 33-46.6% of disease problems (USDA, 2015b).

In the grower/finisher phase, 75.1% of deaths are respiratory related (USDA, 2015a) with

PRRSV contributing to 53% of reported disease problems (USDA, 2015b).

Porcine reproductive and respiratory syndrome virus is a positive-sense, single-stranded, enveloped RNA virus from the Arteriviridae family. It has a 15kb genome consisting of eleven open reading frames (ORF) (Figure 6). The first two ORFs encode the non-structural proteins

(NSP) and the remaining ORF encode the structural proteins (Meulenberg, 2000). The virus has a high mutation rate which has led to various strains of the virus. Currently, there are two genotypes of PRRSV, the European (Type I) and the North American (Type II). However, new stains have arisen from these genotypes. For instance, in 2006 a new strain mutated from Type II emerged in China referred to as highly pathogenic PRRSV (HP-PRRSV) (Sun et al., 2012b;

Butler et al., 2014b).

In the respiratory tract, PRRSV primarily targets alveolar macrophages (PAM), although monocyte-derived dendritic cells are targets as well (Flores-Mendoza et al., 2008; Park et al.,

2008). PRRSV subverts host immune responses by interfering with the production and signaling of cytokines and interferons, apoptotic responses, and adaptive immune responses. In the early

(acute) phase of infection, PRRSV interferes with the host’s initial antiviral response via NSP causing a weak innate immune response (Table 1). This leads to a weakened and delayed adaptive response, which allows the virus to replicate at a high level, persist in the pig for more than 200 days (Chand et al., 2012; Butler et al., 2014b; Lunney et al., 2016) and establish a persistent infection (García-Nicolás et al., 2014). Because the swine industry maintains pigs for an average of 180 days, PRRSV is considered a “life-long” infection. As such, continuous

research of PRRSV is vital to decreasing the severity and economic impact it has on the swine industry.

Current methods for control of respiratory infectious diseases

More than half of nursery and grower/finisher production farms vaccinate against gram- negative bacteria and more than 80% administer antibiotic treatment. Less than 50% of vaccines administered to breeding females are for gram-negative bacteria (USDA, 2015b). Antibodies can be passed through the colostrum, however maternal antibodies for some gram-negative bacteria are lost within 1 to 4 weeks of life in preweaning piglets (Varley and Wiseman, 2001; Carr,

2014). With the waning effectiveness of maternal antibodies, piglets can become more susceptible to infection which can help explain the increased mortality rate from respiratory diseases between the preweaning and nursery phases.

Vaccination with modified-live attenuated PRRSV is standard practice in the swine industry. On average, vaccination rates against PRRSV for all production phases ranges from

8.8– 46.4%, with administration to breeding females being the highest (USDA, 2015b). Despite vaccination and other preventative practices to reduce the risk and spread of PRRSV, it is still one of the leading causes of respiratory-related diseases in the swine industry. A portion of this is due to low vaccine efficacy; these vaccines do not provide complete protection against the virus

(Renukaradhya et al., 2015). The high genomic variability between strains and complex ability to modulate host’s immune response provides major obstacles to generating effective vaccines against all strains of PRRSV (Vu et al., 2016). Additionally, antibodies from vaccinated sows decline as early as 3 weeks in piglets (Halbur, 2016).

Novel approaches involving the use of dietary nutrients as alternative methods or used in conjunction with vaccines to alleviate the severity of PRRSV have been proposed. However,

these studies are sparse. Liu and colleagues studied the effects of supplementing diets with plant extracts on immune responses and growth performance in weaned pigs infected with PRRSV.

Treatments were designed in a 2 x 4 factorial with or without PRRSV infection of a high virulence strain and given 1 of 4 diets: control diet, garlic botanical (GAR) supplement, turmeric oleoresin (TUR) supplement, or capsicum oleoresin (CAP) supplement for 28 days. Pigs fed dietary supplements experienced lower rectal temperature, lower viral serum load, decreased levels of TNF- and IL-1β and increased numbers of adaptive immune cells in all supplemented diets compared to the control diet (Liu et al., 2013). These results suggest that supplementation with plant extracts improve immune response in pigs infected with highly virulent type II strains.

Another study investigated the effect of conjugated linoleic acid (CLA) on the immune responses of weaned pigs challenged with a type II highly virulent strain of PRRSV. Conjugated linoleic acid is a family of linoleic acid isomers that has been proven to improve growth in swine and have differing effects on immune responses (Pinelli-Saavedra et al., 2015). In vivo studies reported an increase in TNF- production in pigs challenged with PRRSV receiving CLA. In vitro studies reported no effect on cytokine production in pigs receiving CLA supplementation, but reported a decrease in the proliferation of peripheral blood mononuclear cells (PBMCs).

These results suggested the CLA does not improve pig immune response to PRRSV (Pinelli-

Saavedra et al., 2015). However, CLA has been reported to decrease ARA content and PGE2 production (Liu and Belury, 1998) which would decrease a pro-inflammatory response and subsequently downstream LX production. These effects of dietary metabolites on immune response to PRRSV infection have not been studied in non-highly virulent strains. It is important to inspect the effects of dietary supplementation in multiple strains at different ages of swine as responses could vary.

In the past two years, knockout pigs for receptors involved in PRRSV infectivity in alveolar macrophages have been successfully bred as an alternative to reduce the impact that

PRRSV has on the swine industry. The receptors sialoadhesin (CD169; Siglec-1) and CD163 are recognized as the primary PRRSV receptors on alveolar macrophages (Van Breedam et al.,

2010a; Zhang and Yoo, 2015). The surface receptor CD169 is known to bind to PRRSV envelope proteins for attachment and internalization into PAM (Van Breedam et al., 2010b;

Jiang et al., 2013). However, CD169-/- pigs did not experience changes in infectivity or replication with type I PRRSV compared to wild-type pigs (Prather et al., 2013). This suggests

CD169 is not necessary for PRRSV attachment and internalization. The receptor CD163 is known to aid in the internalization and uncoating of PRRSV (Zhang and Yoo, 2015). CD163-/- pigs demonstrate no viremia, antibody, lung pathology or general clinical signs of PRRSV upon infection with a highly virulent type II strain (Whitworth et al., 2016) and various type I strains

(Wells et al., 2017) compared to control pigs. Maternal CD163-/- has even demonstrated to completely protect fetuses from PRRSV infection in utero (Prather et al., 2017). The positive results of CD163-/- pigs and PRRSV susceptibility is ground-breaking for the swine industry, however CD163 does serve other essential roles aside from PRRSV entry. It is known for its binding and internalizing of hemoglobin and haptoglobin complexes (Hb-Hp) to protect against oxidative damage (Graversen et al., 2002) and aids in stimulating the release of the anti- inflammatory cytokine IL-10 (Philippidis et al., 2004). Additionally, CD163 functions as a receptor for bacteria and pro-inflammatory cytokine production (Fabriek et al., 2009). Potential consequences and long-term side effects of this knockout have yet to be determined. Knockout of this receptor could lead to susceptibility and lack of clearance of other respiratory pathogens.

It could also affect monocyte differentiation and return of the respiratory environment to

homeostasis after an infection. Further studies on the effects of CD163-/- pigs are warranted.

Wells et. al further addressed these concerns by replacing the scavenger receptor cysteine-rich

(SRCR) domain 5 with a synthesized CD-163 like homolog in pigs. In culture, alveolar macrophages from pigs possessing the homolog domain, expressed CD163 and supported

PRRSV type II replication but not type I (Wells et al., 2017). The potential consequences of

CD163-/- pigs and the time it would take to implement this new genetic line (if deemed feasible) are still unknown. In the meantime, it is important to explore less invasive alternative approaches to improving the deleterious effects of PRRSV.

Conclusion

The use of dietary long-chain PUFA can be beneficial or detrimental depending on the health status, type of infectious disease and amount supplemented. It is evident that n-3 PUFA can be beneficial to individuals with chronic inflammatory illnesses. However, in the case of a healthy individual where the initiation and resolution of acute inflammation is well regulated, increased n-3 supplementation could be to their disadvantage (Møller and Lauridsen, 2006;

McFarland et al., 2008; Schwerbrock et al., 2009). The supplementation of n-6 PUFA could be beneficial in eliciting a stronger defense against opportunistic pathogens; particularly in the swine industry, where chronic inflammatory diseases are not a large concern. The duality of

PGE2 synthesized from arachidonic acid could improve response and recovery to infections; however, there are some limitations. The efficacy of supplementing n-3 or n-6 PUFA can be dose and time dependent, as well as pathogen-specific. Proper dosage and time to allow sufficient enrichment into the tissues and immune cells are crucial to elicit an enhanced corresponding eicosanoid signaling cascade. Depending on the pathogen of concern, supplementing long-chain PUFA could have alternate effects. Thus, to ensure supplementation is

effective health status, proper dosage and duration, and intended infectious disease targets need to be well established prior to administration.

Proposed research

The majority of long-chain PUFA research focuses on the anti-inflammatory benefits of dietary n-3 in chronic inflammatory diseases. Although its use has been proven to alleviate some inflammatory symptoms, the ability of PGE2, metabolized from ARA, to initiate acute inflammation to control infection and subsequently elicit an anti-inflammatory response to initiate return to homeostasis is not a point of focus in livestock. Currently, economic loss from respiratory diseases despite common medicinal products is a major problem in the swine industry, making it all the more pertinent to explore the use of n-6 PUFA to improve the health status of swine with respiratory infections.

The long-term goal is to determine if dietary enrichment of long-chain PUFA enhances eicosanoid targeted inflammatory and resolution markers. Accordingly, the presented research assesses the ability of dietary pre-formed ARA or EPA to enrich the long-chain PUFA content of porcine alveolar macrophages and modify eicosanoid and cytokine production for a more robust and balanced response to LPS or PRRSV challenge.

The described studies establish a new approach to enhance swine immunological responses to respiratory pathogens. Dietary supplementation and immune cell enrichment with long-chain PUFA provide a prospective nutritional intervention that may help swine producers mitigate the production and economic impacts of respiratory infections.

Literature Cited

Abedi, E., and M. A. Sahari. 2014. Long-chain polyunsaturated fatty acid sources and evaluation of their nutritional and functional properties. Food Science & Nutrition. 2(5): 443-463. doi: 10.1002/fsn3.121

American Heart Association. 2014. Vitamin Supplements: Hype or Help for Healthy Eating. https://www.heart.org/en/healthy-living/healthy-eating/eat-smart/nutrition-basics/vitamin- supplements-hype-or-help-for-healthy-eating (Accessed 2019.)

Anes, E., M. P. Kuhnel, E. Bos, J. Moniz-Pereira, A. Habermann, and G. Griffiths. 2003. Selected lipids activate phagosome actin assembly and maturation resulting in killing of pathogenic mycobacteria. Nat. Cell Biol. 5(9): 793-802. doi: 10.1038/ncb1036

Babcock, T. A., T. Novak, E. Ong, D. H. Jho, W. S. Helton, and N. J. Espat. 2002. Modulation of lipopolysaccharide-stimulated macrophage tumor necrosis factor-α production by ω-3 fatty acid is associated with differential cyclooxygenase-2 protein expression and is independent of interleukin-10. J. Surg. Res. 107(1): 135-139. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1006/jsre.2002.6498

Bagga, D., L. Wang, R. Farias-Eisner, J. A. Glaspy, and S. T. Reddy. 2003a. Differential effects of prostaglandin derived from ω-6 and ω-3 polyunsaturated fatty acids on COX-2 expression and IL-6 secretion. Proceedings of the National Academy of Sciences. 100(4): 1751-1756. doi: 10.1073/pnas.0334211100

Bassaganya-Riera, J., A. J. Guri, A. M. Noble, K. A. Reynolds, J. King, C. M. Wood, M. Ashby, D. Rai, and R. Hontecillas. 2007a. Arachidonic acid-and docosahexaenoic acid-enriched formulas modulate antigen-specific T cell responses to influenza virus in neonatal piglets. Am. J. Clin. Nutr. 85(3): 824-836. doi: 85/3/824

Billar, T. R., P. E. Bankey, B. A. Svingen, R. D. Curran, M. A. West, R. T. Holman, R. L. Simmons, and F. B. Cerra. 1988. Fatty acid intake and kupffer cell function: Fish oil alters eicosanoid and monokine production to endotoxin stimulation. Surgery. 104(2): 343-349.

Blasbalg, T. L., J. R. Hibbeln, C. E. Ramsden, S. F. Majchrzak, and R. R. Rawlings. 2011. Changes in consumption of omega-3 and omega-6 fatty acids in the united states during the 20th century. Am. J. Clin. Nutr. 93(5): 950-962. doi: 10.3945/ajcn.110.006643

Botham, K. M., and P. A. Mayes. 2009. Biosynthesis of Fatty Acids & Eicosanoids. Pages 193- 204 in Harper's Illustrated Biochemistry. Murray, R. K., V. W. Rodwell, and D. Bender, eds. 28th ed. McGraw-Hill Professional Publishing, New York, NY, USA.

Brenna, J. T., N. Salem Jr, A. J. Sinclair, S. C. Cunnane, and International Society for the Study of Fatty Acids and Lipids, ISSFAL. 2009. Alpha-linolenic acid supplementation and conversion to n-3 long-chain polyunsaturated fatty acids in humans. Prostaglandins Leukot. Essent. Fatty Acids. 80(2-3): 85-91. doi: 10.1016/j.plefa.2009.01.004

Brockmeier, S., P. Halbur, and E. Thacker. 2002. Porcine Respiratory Disease Complex. Pages Chapter 13 in Polymicrobial Diseases. Brogden KA, and Guthmiller JM, eds. ASM Press, Washington (DC).

Buckley, C., D. Gilroy, and C. Serhan. 2014. Proresolving lipid mediators and mechanisms in the resolution of acute inflammation. Immunity. 40(3): 315-327. doi: http://dx.doi.org/10.1016/j.immuni.2014.02.009

Burdge, G. 2004. Alpha-linolenic acid metabolism in men and women: Nutritional and biological implications. Curr. Opin. Clin. Nutr. Metab. Care. 7(2): 137-144. doi: 00075197- 200403000-00006

Burdge, G. C., and P. C. Calder. 2005. Conversion of alpha-linolenic acid to longer-chain polyunsaturated fatty acids in human adults. Reprod. Nutr. Dev. 45(5): 581-597. doi: 10.1051/rnd:2005047

Butler, G. 2014a. Manipulating dietary PUFA in animal feed: Implications for human health. Proc. Nutr. Soc. 73(1): 87-95. doi: 10.1017/S0029665113003790

Butler, J. E., K. M. Lager, W. Golde, K. S. Faaberg, M. Sinkora, C. Loving, and Y. I. Zhang. 2014b. Porcine reproductive and respiratory syndrome (PRRS): An immune dysregulatory pandemic. Immunol. Res. 59(1-3): 81-108. doi: 10.1007/s12026-014-8549-5

Byleveld, M., G. T. Pang, R. L. Clancy, and D. C. Roberts. 2000. Fish oil feeding enhances lymphocyte proliferation but impairs virus-specific T lymphocyte cytotoxicity in mice following challenge with influenza virus. Clin. Exp. Immunol. 119(2): 287-292. doi: cei1135

Byleveld, P. M., G. T. Pang, R. L. Clancy, and D. C. Roberts. 1999. Fish oil feeding delays influenza virus clearance and impairs production of interferon-gamma and virus-specific immunoglobulin A in the lungs of mice. J. Nutr. 129(2): 328-335. doi: 10.1093/jn/129.2.328

Calder, P. C. 2010. Omega-3 fatty acids and inflammatory processes. Nutrients. 2(3): 355-374. doi: 10.3390/nu2030355

Calder, P. C. 2006a. N-3 polyunsaturated fatty acids, inflammation, and inflammatory diseases. Am. J. Clin. Nutr. 83(6 Suppl): 1505S-1519S. doi: 10.1093/ajcn/83.6.1505S

Calder, P. C., J. A. Bond, D. J. Harvey, S. Gordon, and E. A. Newsholme. 1990. Uptake and incorporation of saturated and unsaturated fatty acids into macrophage lipids and their effect upon macrophage adhesion and phagocytosis. Biochem. J. 269(3): 807-814.

Calder, P. C., and R. F. Grimble. 2002. Polyunsaturated fatty acids, inflammation and immunity. Eur. J. Clin. Nutr. 56 Suppl 3: S14-9. doi: 10.1038/sj.ejcn.1601478

Calder, P. C. 2011. Fatty acids and inflammation: The cutting edge between food and pharma. Eur. J. Pharmacol. 668, Supplement 1: S50-S58. doi: http://dx.doi.org/10.1016/j.ejphar.2011.05.085

Calder, P. C. 2008a. Polyunsaturated fatty acids, inflammatory processes and inflammatory bowel diseases. Molecular Nutrition & Food Research. 52(8): 885-897. doi: 10.1002/mnfr.200700289

Calder, P. C. 2008b. The relationship between the fatty acid composition of immune cells and their function. Prostaglandins, Leukotrienes and Essential Fatty Acids. 79(3–5): 101-108. doi: http://dx.doi.org/10.1016/j.plefa.2008.09.016

Calder, P. C. 2006b. Polyunsaturated fatty acids and inflammation. Prostaglandins, Leukotrienes and Essential Fatty Acids. 75(3): 197-202. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.plefa.2006.05.012

Carr, J. 2014. Stockmanship Standards: Loss of maternal antibody. http://www.thepigsite.com/stockstds/13/loss-of-maternal-antibody/ (Accessed 5 2017.)

Chand, R. J., B. R. Trible, and R. R. Rowland. 2012. Pathogenesis of porcine reproductive and respiratory syndrome virus. Current Opinion in Virology. 2(3): 256-263. doi: http://dx.doi.org/10.1016/j.coviro.2012.02.002

Chapkin, R. S., C. C. Akoh, and C. C. Miller. 1991. Influence of dietary n-3 fatty acids on macrophage glycerophospholipid molecular species and peptidoleukotriene synthesis. J. Lipid Res. 32(7): 1205-1213.

Cordain, L., S. B. Eaton, A. Sebastian, N. Mann, S. Lindeberg, B. A. Watkins, J. H. O'Keefe, and J. Brand-Miller. 2005. Origins and evolution of the western diet: Health implications for the 21st century. Am. J. Clin. Nutr. 81(2): 341-354. doi: 81/2/341

Cunnane, S. C., P. W. Keeling, R. P. Thompson, and M. A. Crawford. 1984. Linoleic acid and arachidonic acid metabolism in human peripheral blood leucocytes: Comparison with the rat. Br. J. Nutr. 51(2): 209-217. doi: S000711458400026X

Dee, S. A. 2014. The Merck Veterinary Manual: Overview of Porcine Reproductive and Respiratory Syndrome. http://www.merckvetmanual.com/mvm/generalized_conditions/porcine_reproductive_and_r espiratory_syndrome/overview_of_porcine_reproductive_and_respiratory_syndrome.html (Accessed 01 2016.)

DHHS, and USDA. 2015. 2015 – 2020 dietary guidelines for americans. (8)

Dokland, T. 2010. The structural biology of PRRSV. Virus Res. 154(1-2): 86-97. doi: 10.1016/j.virusres.2010.07.029

Endres, S., R. Ghorbani, V. E. Kelley, K. Georgilis, G. Lonnemann, d. M. van, J. G. Cannon, T. S. Rogers, M. S. Klempner, P. C. Weber, E. J. Schaefer, S. M. Wolff, and C. A. Dinarello. 1989. The effect of dietary supplementation with n—3 polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells. N. Engl. J. Med. 320(5): 265-271. doi: 10.1056/NEJM198902023200501 http://dx.doi.org/10.1056/NEJM198902023200501

Fabriek, B. O., R. van Bruggen, D. M. Deng, A. J. Ligtenberg, K. Nazmi, K. Schornagel, R. P. Vloet, C. D. Dijkstra, and T. K. van den Berg. 2009. The macrophage scavenger receptor CD163 functions as an innate immune sensor for bacteria. Blood. 113(4): 887-892. doi: 10.1182/blood-2008-07-167064

Flores-Mendoza, L., E. Silva-Campa, M. Resendiz, F. A. Osorio, and J. Hernandez. 2008. Porcine reproductive and respiratory syndrome virus infects mature porcine dendritic cells and up-regulates interleukin-10 production. Clin. Vaccine Immunol. 15(4): 720-725. doi: 10.1128/CVI.00224-07

Freire, M. O., and T. E. Van Dyke. 2013. Natural resolution of inflammation. Periodontol. 2000. 63(1): 149-164. doi: 10.1111/prd.12034

Fritsche, K. 2007. Important differences exist in the dose-response relationship between diet and immune cell fatty acids in humans and rodents. Lipids. 42(11): 961-979. doi: 10.1007/s11745-007-3106-9

Fritsche, K. L., D. W. Alexander, N. A. Cassity, and S. Huang. 1993. Maternally-supplied fish oil alters piglet immune cell fatty acid profile and eicosanoid production. Lipids. 28(2): 677- 682.

Fritsche, K. L., and N. A. Cassity. 1996. Metabolism of [3H] arachidonic acid by n-3 polyunsaturated fatty acid-enriched piglet alveolar macrophages. Prostaglandins, Leukotrienes and Essential Fatty Acids. 55(5): 315-323. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/S0952-3278(96)90037-X

Galarraga, B., M. Ho, H. M. Youssef, A. Hill, H. McMahon, C. Hall, S. Ogston, G. Nuki, and J. J. F. Belch. 2008. Cod liver oil (n-3 fatty acids) as a non-steroidal anti-inflammatory drug sparing agent in rheumatoid arthritis. Rheumatology. 47(5): 665-669. doi: 10.1093/rheumatology/ken024

García-Nicolás, O., J. J. Quereda, J. Gómez-Laguna, F. J. Salguero, L. Carrasco, G. Ramis, and F. J. Pallarés. 2014. Cytokines transcript levels in lung and lymphoid organs during genotype 1 porcine reproductive and respiratory syndrome virus (PRRSV) infection. Vet. Immunol. Immunopathol. 160(1–2): 26-40. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.vetimm.2014.03.008

Gijon, M. A., S. Zarini, and R. C. Murphy. 2007. Biosynthesis of eicosanoids and transcellular metabolism of leukotrienes in murine bone marrow cells. J. Lipid Res. 48(3): 716-725. doi: M600508-JLR200

Givens, I. 2009. Animal nutrition and lipids in animal products and their contribution to human intake and health. Nutrients. 1(1): 71-82. doi: 10.3390/nu1010071

Graversen, J. H., M. Madsen, and S. K. Moestrup. 2002. CD163: A signal receptor scavenging haptoglobin–hemoglobin complexes from plasma. Int. J. Biochem. Cell Biol. 34(4): 309- 314. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/S1357-2725(01)00144-3

Gropper, S. S., J. L. Smith, and J. L. Groff. 2005. Lipids. Pages 128-171 in Advanced Nutrition and Human Metabolism. Howe, E., ed. 4th ed.

Guillou, H., D. Zadravec, P. G. P. Martin, and A. Jacobsson. 2010. The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice. Prog. Lipid Res. 49(2): 186-199. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.plipres.2009.12.002

Hadley, K. B., A. S. Ryan, S. Forsyth, S. Gautier, and N. Salem Jr. 2016. The essentiality of arachidonic acid in infant development. Nutrients. 8(4): 216. doi: 10.3390/nu8040216

Halbur, P. 2016. Porcine Respiratory Disease Complex. https://projects.ncsu.edu/project/swine_extension/healthyhogs/book1997/halbur2.htm (Accessed 4 2017.)

Harizi, H. 2013. The immunobiology of prostanoid receptor signaling in connecting innate and adaptive immunity. Biomed. Res. Int. 2013: 683405. doi: 10.1155/2013/683405 [doi]

Holtkamp, D. J., J. B. Kliebenstein, E. J. Neumann, J. J. Zimmerman, H. F. Rotto, T. K. Yoder, C. Wang, P. E. Yeske, C. L. Mowrer, and C. A. Haley. 2013. Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on united states pork producers . J Swine Health Prod. 21(2): 72-84.

Huang, C. W., Y. S. Chien, Y. J. Chen, K. M. Ajuwon, H. M. Mersmann, and S. T. Ding. 2016. Role of n-3 polyunsaturated fatty acids in ameliorating the obesity-induced metabolic syndrome in animal models and humans. Int. J. Mol. Sci. 17(10): 10.3390/ijms17101689. doi: E1689

Huang, M., and M. C. Craig-Schmidt. 1996. Arachidonate and docosahexaenoate added to infant formula influence fatty acid composition and subsequent eicosanoid production in neonatal pigs. J. Nutr. 126(9): 2199-208. http://search.proquest.com.prox.lib.ncsu.edu/docview/197429146?accountid=12725

Hubbard, L. L., M. N. Ballinger, P. E. Thomas, C. A. Wilke, T. J. Standiford, K. S. Kobayashi, R. A. Flavell, and B. B. Moore. 2010. A role for IL-1 receptor-associated kinase-M in

prostaglandin E2-induced immunosuppression post-bone marrow transplantation. J. Immunol. 184(11): 6299-6308. doi: 10.4049/jimmunol.0902828

Hussein, N., E. Ah-Sing, P. Wilkinson, C. Leach, B. A. Griffin, and D. J. Millward. 2005. Long- chain conversion of [13C] linoleic acid and a-linolenic acid in response to marked changes in their dietary intake in men. Journal of Lipid Research. 46(2): 269-280. doi: 10.1194/jlr.M400225-JLR200

Ian Givens, D., and R. A. Gibbs. 2008. Current intakes of EPA and DHA in european populations and the potential of animal-derived foods to increase them. Proc. Nutr. Soc. 67(3): 273-280. doi: 10.1017/S0029665108007167

Innes, J. K., and P. C. Calder. 2018. Omega-6 fatty acids and inflammation. Prostaglandins Leukot. Essent. Fatty Acids. 132: 41-48. doi: S0952-3278(18)30074-7

Jiang, Y., F. A. Khan, N. S. Pandupuspitasari, I. Kadariya, Z. Cheng, Y. Ren, X. Chen, A. Zhou, L. Yang, D. Kong, and S. Zhang. 2013. Analysis of the binding sites of porcine sialoadhesin receptor with PRRSV. Int. J. Mol. Sci. 14(12): 23955-23979. doi: 10.3390/ijms141223955

Kalinski, P. 2012. Regulation of immune responses by prostaglandin E2. The Journal of Immunology. 188(1): 21-28. doi: 10.4049/jimmunol.1101029

Kawahara, K., H. Hohjoh, T. Inazumi, S. Tsuchiya, and Y. Sugimoto. 2015. Prostaglandin E2- induced inflammation: Relevance of prostaglandin E receptors. Biochim. Biophys. Acta. 1851(4): 414-421. doi: 10.1016/j.bbalip.2014.07.008

Kim, O., Y. Sun, F. W. Lai, C. Song, and D. Yoo. 2010. Modulation of type I interferon induction by porcine reproductive and respiratory syndrome virus and degradation of CREB-binding protein by non-structural protein 1 in MARC-145 and HeLa cells. Virology. 402(2): 315-326. doi: http://dx.doi.org/10.1016/j.virol.2010.03.039

Kohanawa, Y., and M. Kohanawa. 2006. A regulatory effect of the balance between TNF-α and IL-6 in the granulomatous and inflammatory response to rhodococcus aurantiacus infection in mice. J. Immunol. 177: 642-650. doi: 10.4049/jimmunol.177.1.642

Korver, D. R. 2012. Implications of changing immune function through nutrition in poultry. Animal Feed Science and Technology. 173(1): 54-64. doi: https://doi- org.prox.lib.ncsu.edu/10.1016/j.anifeedsci.2011.12.019

Kremer, J. M., D. A. Lawrence, G. F. Petrillo, L. L. Litts, P. M. Mullaly, R. I. Rynes, R. P. Stocker, N. Parhami, N. S. Greenstein, B. R. Fuchs, A. Mathur, D. R. Robinson, R. I. Sperling, and J. Bigaouette. 1995. Effects of high-dose fish oil on rheumatoid arthritis after stopping nonsteroidal antiinflammatory drugs clinical and immune correlates. Arthritis & Rheumatism. 38(8): 1107-1114. doi: 10.1002/art.1780380813

Kris-Etherton, P. M., D. S. Taylor, S. Yu-Poth, P. Huth, K. Moriarty, V. Fishell, R. L. Hargrove, G. Zhao, and T. D. Etherton. 2000. Polyunsaturated fatty acids in the food chain in the united states. Am. J. Clin. Nutr. 71(1 Suppl): 179S-88S. doi: 10.1093/ajcn/71.1.179S

Lee, T. H., R. L. Hoover, J. D. Williams, R. I. Sperling, J. Ravalese, B. W. Spur, D. R. Robinson, E. J. Corey, R. A. Lewis, and K. F. Austen. 1985. Effect of dietary enrichment with eicosapentaenoic and docosahexaenoic acids on in vitro neutrophil and monocyte leukotriene generation and neutrophil function. N. Engl. J. Med. 312(19): 1217-1224. doi: 10.1056/NEJM198505093121903 http://dx.doi.org/10.1056/NEJM198505093121903

Leslie, C. C. 2004. Regulation of the specific release of arachidonic acid by cytosolic phospholipase A2. Prostaglandins Leukot. Essent. Fatty Acids. 70(4): 373-376. doi: 10.1016/j.plefa.2003.12.012

Levy, B. D., C. B. Clish, B. Schmidt, K. Gronert, and C. N. Serhan. 2001. Lipid mediator class switching during acute inflammation: Signals in resolution. Nat. Immunol. 2(7): 612-619. doi: 10.1038/89759

Levy, B. D., and C. N. Serhan. 2014. Resolution of acute inflammation in the lung. Annu. Rev. Physiol. 76: 467-492. doi: 10.1146/annurev-physiol-021113-170408

Li, Q., L. Tan, C. Wang, N. Li, Y. Li, G. Xu, and J. Li. 2006. Polyunsaturated eicosapentaenoic acid changes lipid composition in lipid rafts. Eur. J. Nutr. 45(3): 144-151. doi: 10.1007/s00394-005-0574-7

Liu, K. L., and M. A. Belury. 1998. Conjugated linoleic acid reduces arachidonic acid content and PGE2 synthesis in murine keratinocytes. Cancer Lett. 127(1-2): 15-22. doi: S0304- 3835(97)00479-5

Liu, Y., T. M. Che, M. Song, J. J. Lee, J. A. Almeida, D. Bravo, W. G. Van Alstine, and J. E. Pettigrew. 2013. Dietary plant extracts improve immune responses and growth efficiency of pigs experimentally infected with porcine reproductive and respiratory syndrome virus. J. Anim. Sci. 91(12): 5668-5679. doi: 10.2527/jas.2013-6495

Liu, Y., F. Chen, J. Odle, X. Lin, S. K. Jacobi, H. Zhu, Z. Wu, and Y. Hou. 2012. Fish oil enhances intestinal integrity and inhibits TLR4 and NOD2 signaling pathways in weaned pigs after LPS challenge. The Journal of Nutrition. 142(11): 2017-2024. doi: 10.3945/jn.112.164947

Lunney, J. K., Y. Fang, A. Ladinig, N. Chen, Y. Li, B. Rowland, and G. J. Renukaradhya. 2016. Porcine reproductive and respiratory syndrome virus (PRRSV): Pathogenesis and interaction with the immune system. Annu. Rev. Anim. Biosci. 4: 129-154. doi: 10.1146/annurev-animal-022114-111025

Luo, M., S. M. Jones, M. Peters-Golden, and T. G. Brock. 2003. Nuclear localization of 5- lipoxygenase as a determinant of leukotriene B4 synthetic capacity. Proc. Natl. Acad. Sci. U. S. A. 100(21): 12165-12170. doi: 10.1073/pnas.2133253100

Ma, X., Z. Jiang, and C. Lai. 2016. Significance of increasing n-3 PUFA content in pork on human health. Crit. Rev. Food Sci. Nutr. 56(5): 858-870. doi: 10.1080/10408398.2013.850059

Mayatepek, E., K. Paul, M. Leichsenring, M. Pfisterer, D. Wagner, M. Domann, H. G. Sonntag, and H. J. Bremer. 1994. Influence of dietary (n-3)-polyunsaturated fatty acids on leukotriene B4 and prostaglandin E2 synthesis and course of experimental tuberculosis in guinea pigs. Infection. 22(2): 106-112.

McAlexander, A. M., B. J. Barham, M. Johnson, and A. N. Fonteh. 2004. Control of Long Chain Polyunsaturated Fatty Acid Levels and the Role of Inhibitors of Incorporation an Remodeling on the Biosynthesis of Lipid Mediators. Pages 89-113 in Arachidonate Remodeling and Inflammation. Fonteh, A. N., and R. L. Wykle, eds. Birkhäuser Verlag,

McFarland, C. T., Y. Y. Fan, R. S. Chapkin, B. R. Weeks, and D. N. McMurray. 2008. Dietary polyunsaturated fatty acids modulate resistance to mycobacterium tuberculosis in guinea pigs. J. Nutr. 138(11): 2123-2128. doi: 10.3945/jn.108.093740

Meulenberg, J. J. 2000. PRRSV, the virus. Vet. Res. 31(1): 11-21.

Miles, E. A., and P. C. Calder. 1998. Modulation of immune function by dietary fatty acids. Proc. Nutr. Soc. 57(2): 277-292. doi: 10.1079/PNS19980042

Mills, S. C., A. C. Windsor, and S. C. Knight. 2005. The potential interactions between polyunsaturated fatty acids and colonic inflammatory processes. Clinical & Experimental Immunology. 142(2): 216-228. doi: 10.1111/j.1365-2249.2005.02851.x

Møller, S., and C. Lauridsen. 2006. Dietary fatty acid composition rather than vitamin E supplementation influence ex vivo cytokine and eicosanoid response of porcine alveolar macrophages. Cytokine. 35(1-2): 6-12. doi: S1043-4666(06)00206-7

Muirhead, M., and T. Alexander. 2013. Porcine Reproductive and Respiratory Syndrome (PRRS). http://www.thepigsite.com/pighealth/article/142/porcine-reproductive-and- respiratory-syndrome-prrs/ (Accessed 12 2015.)

Murphy, K. 2012. Janeway's immunobiology. Lawrence E., ed. 8th ed. New York, NY, Garland Science.

Murphy, M. G. 1990. Dietary fatty acids and membrane protein function. J. Nutr. Biochem. 1(2): 68-79. doi: http://dx.doi.org/10.1016/0955-2863(90)90052-M

Nagamachi, M., D. Sakata, K. Kabashima, T. Furuyashiki, T. Murata, E. Segi-Nishida, K. Soontrapa, T. Matsuoka, Y. Miyachi, and S. Narumiya. 2007. Facilitation of Th1-mediated immune response by prostaglandin E receptor EP1. J. Exp. Med. 204(12): 2865-2874. doi: jem.20070773

National Pork Board. 2018. World Per Capita Pork Consumption. https://www.pork.org/facts/stats/u-s-pork-exports/world-per-capita-pork-consumption/ (Accessed 2019.)

Naughton, S. S., M. L. Mathai, D. H. Hryciw, and A. J. McAinch. 2016. Linoleic acid and the pathogenesis of obesity. Prostaglandins Other Lipid Mediat. 125: 90-99. doi: 10.1016/j.prostaglandins.2016.06.003

Nieto, N., M. I. Torres, A. Rios, and A. Gil. 2002. Dietary polyunsaturated fatty acids improve histological and biochemical alterations in rats with experimental ulcerative colitis. J. Nutr. 132(1): 11-19.

Norris, P. C., D. Gosselin, D. Reichart, C. K. Glass, and E. A. Dennis. 2014. Phospholipase A2 regulates eicosanoid class switching during inflammasome activation. Proc. Natl. Acad. Sci. U. S. A. 111(35): 12746-12751. doi: 10.1073/pnas.1404372111

Park, J. Y., H. S. Kim, and S. H. Seo. 2008. Characterization of interaction between porcine reproductive and respiratory syndrome virus and porcine dendritic cells. J. Microbiol. Biotechnol. 18(10): 1709-1716. doi: 8109

Paul, K. P., M. Leichsenring, M. Pfisterer, E. Mayatepek, D. Wagner, M. Domann, H. G. Sonntag, and H. J. Bremer. 1997. Influence of n-6 and n-3 polyunsaturated fatty acids on the resistance to experimental tuberculosis. Metabolism. 46(6): 619-624. doi: S0026- 0495(97)90003-2

Philippidis, P., J. C. Mason, B. J. Evans, I. Nadra, K. M. Taylor, D. O. Haskard, and R. C. Landis. 2004. Hemoglobin scavenger receptor CD163 mediates interleukin-10 release and heme oxygenase-1 synthesis: Antiinflammatory monocyte-macrophage responses in vitro, in resolving skin blisters in vivo, and after cardiopulmonary bypass surgery. Circ. Res. 94(1): 119-126. doi: 10.1161/01.RES.0000109414.78907.F9

Pinelli-Saavedra, A., J. R. Peralta-Quintana, J. Sosa-Castañeda, S. Y. Moya-Camarena, A. Burgara-Estrella, and J. Hernández. 2015. Dietary conjugated linoleic acid and its effect on immune response in pigs infected with the porcine reproductive and respiratory syndrome virus. Res. Vet. Sci. 98: 30-38. doi: http://dx.doi.org/10.1016/j.rvsc.2014.12.007

Pond, W., D. Church, K. Pond, and P. Schoknecht. 2005. Lipids. Pages 91-111 in Basic Animal Nutrition and Feeding. Hope, R., ed. 5th ed.

Prather, R. S., K. D. Wells, K. M. Whitworth, M. A. Kerrigan, M. S. Samuel, A. Mileham, L. N. Popescu, and R. R. R. Rowland. 2017. Knockout of maternal CD163 protects fetuses from

infection with porcine reproductive and respiratory syndrome virus (PRRSV). Sci. Rep. 7(1): 13371-017-13794-2. doi: 10.1038/s41598-017-13794-2

Prather, R. S., R. R. R. Rowland, C. Ewen, B. Trible, M. Kerrigan, B. Bawa, J. M. Teson, J. Mao, K. Lee, M. S. Samuel, K. M. Whitworth, C. N. Murphy, T. Egen, and J. A. Green. 2013. An intact sialoadhesin (sn/SIGLEC1/CD169) is not required for attachment/internalization of the porcine reproductive and respiratory syndrome virus. Journal of Virology. 87(17): 9538-9546. doi: 10.1128/JVI.00177-13

Ramachandran, H., J. Laux, I. Moldovan, R. Caspell, P. V. Lehmann, and R. A. Subbramanian. 2012. Optimal thawing of cryopreserved peripheral blood mononuclear cells for use in high- throughput human immune monitoring studies. Cells. 1(3): 313-324. doi: 10.3390/cells1030313

Raphael, W., and L. M. Sordillo. 2013. Dietary polyunsaturated fatty acids and inflammation: The role of phospholipid biosynthesis. Int. J. Mol. Sci. 14(10): 21167-21188. doi: 10.3390/ijms141021167

Renier, G., E. Skamene, J. DeSanctis, and D. Radzioch. 1993. Dietary n-3 polyunsaturated fatty acids prevent the development of atherosclerotic lesions in mice. modulation of macrophage secretory activities. Arterioscler. Thomb. 13(10): 1515-1524. doi: 10.1161/01.ATV.13.10.1515

Renukaradhya, G. J., X. J. Meng, J. G. Calvert, M. Roof, and K. M. Lager. 2015. Inactivated and subunit vaccines against porcine reproductive and respiratory syndrome: Current status and future direction. Vaccine. 33(27): 3065-3072. doi: 10.1016/j.vaccine.2015.04.102

Saini, R. K., and Y. S. Keum. 2018. Omega-3 and omega-6 polyunsaturated fatty acids: Dietary sources, metabolism, and significance - A review. Life Sci. 203: 255-267. doi: S0024- 3205(18)30230-3

Schmitz, G., and J. Ecker. 2008. The opposing effects of n-3 and n-6 fatty acids. Prog. Lipid Res. 47(2): 147-155. doi: 10.1016/j.plipres.2007.12.004

Schwerbrock, N. M., E. A. Karlsson, Q. Shi, P. A. Sheridan, and M. A. Beck. 2009. Fish oil-fed mice have impaired resistance to influenza infection. J. Nutr. 139(8): 1588-1594. doi: 10.3945/jn.109.108027

Serhan, C. N., and N. Chiang. 2004. Lipoxins and Resolvins: Local Mediators in Endogenous Anti-Inflammatory and Resolution. Pages 169-201 in Arachidonate Remodeling and Inflammation. Fonteh, A. N., and R. L. Wykle, eds. Birkhäuser Verlag,

Serhan, C. N. 2014. Pro-resolving lipid mediators are leads for resolution physiology. Nature. 510(7503): 92-101. doi: 10.1038/nature13479

Serhan, C. N., N. Chiang, J. Dalli, and B. D. Levy. 2014. Lipid mediators in the resolution of inflammation. Cold Spring Harb Perspect. Biol. 7(2): a016311. doi: 10.1101/cshperspect.a016311

Serhan, C. N., N. Chiang, and T. E. Van Dyke. 2008. Resolving inflammation: Dual anti- inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol. 8(5): 349-361. doi: 10.1038/nri2294

Serhan, C. N., and K. A. Sheppard. 1990. Lipoxin formation during human neutrophil-platelet interactions. evidence for the transformation of leukotriene A4 by platelet 12-lipoxygenase in vitro. J. Clin. Invest. 85(3): 772-780. doi: 10.1172/JCI114503

Serhan, C. N. 2007. Resolution phase of inflammation: Novel endogenous anti-inflammatory and proresolving lipid mediators and pathways. Annu. Rev. Immunol. 25(1): 101-137. doi: 10.1146/annurev.immunol.25.022106.141647 https://doi- org.prox.lib.ncsu.edu/10.1146/annurev.immunol.25.022106.141647

Shaikh, S. R., and M. Edidin. 2008. Polyunsaturated fatty acids and membrane organization: Elucidating mechanisms to balance immunotherapy and susceptibility to infection. Chem. Phys. Lipids. 153(1): 24-33. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.chemphyslip.2008.02.008

Sijben, J. W., and P. C. Calder. 2007. Differential immunomodulation with long-chain n-3 PUFA in health and chronic disease. Proc. Nutr. Soc. 66(2): 237-259. doi: S0029665107005472

Simopoulos, A. P. 2002. The importance of the ratio of omega-6/omega-3 essential fatty acids. Biomedicine & Pharmacotherapy. 56(8): 365-379. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/S0753-3322(02)00253-6

Skuladottir, I. H., D. H. Petursdottir, and I. Hardardottir. 2007. The effects of omega-3 polyunsaturated fatty acids on TNF-alpha and IL-10 secretion by murine peritoneal cells in vitro. Lipids. 42(8): 699-706. doi: 10.1007/s11745-007-3081-1

Sreeramkumar, V., M. Fresno, and N. Cuesta. 2012. Prostaglandin E2 and T cells: Friends or foes? Immunol. Cell Biol. 90(6): 579-586. doi: 10.1038/icb.2011.75

Stulnig, T. M. 2003. Immunomodulation by polyunsaturated fatty acids: Mechanisms and effects. Int Arch Allergy Immunol. 132(4): 310-321. doi: 10.1159/000074898

Stulnig, T. M., M. Berger, T. Sigmund, D. Raederstorff, H. Stockinger, and W. Waldhausl. 1998. Polyunsaturated fatty acids inhibit T cell signal transduction by modification of detergent- insoluble membrane domains. J. Cell Biol. 143(3): 637-644.

Sun, Y., M. Han, C. Kim, J. G. Calvert, and D. Yoo. 2012. Interplay between interferon- mediated innate immunity and porcine reproductive and respiratory syndrome virus. Viruses. 4(4): 424-446. doi: 10.3390/v4040424

Swiatkiewicz, S., A. Arczewska-Wlosek, and D. Jozefiak. 2015. The relationship between dietary fat sources and immune response in poultry and pigs: An updated review. Livestock Science. 180: 237-246. doi: https://doi.org/10.1016/j.livsci.2015.07.017

Tang, T., T. E. Scambler, T. Smallie, H. E. Cunliffe, E. A. Ross, D. R. Rosner, J. D. O'Neil, and A. R. Clark. 2017. Macrophage responses to lipopolysaccharide are modulated by a feedback loop involving prostaglandin E2, dual specificity phosphatase 1 and tristetraprolin. Sci. Rep. 7(1): 4350-017-04100-1. doi: 10.1038/s41598-017-04100-1

Trebble, T., N. K. Arden, M. A. Stroud, S. A. Wootton, G. C. Burdge, E. A. Miles, A. B. Ballinger, R. L. Thompson, and P. C. Calder. 2003. Inhibition of tumour necrosis factor- alpha and interleukin 6 production by mononuclear cells following dietary fish-oil supplementation in healthy men and response to antioxidant co-supplementation. Br. J. Nutr. 90(2): 405-412. doi: S0007114503001405

Triggiani, M., G. Giannataasio, F. Granata, S. Loffredo, F. W. Rossi, S. Salzano, and G. Marone. 2004. Remodeling of Arachidonic Acid in Inflammatory Cells of the Human Lung. Pages 115-130 in Arachidonate Remodeling and Inflammation. Fonteh, A. N., and R. L. Wykle, eds. Birkhäuser Verlag, . http://www2.lib.ncsu.edu/catalog/record/NCSU1683680

USDA. 2015a. Part I: Baseline reference of swine health and management in the united states, 2012. NAHMS Swine 2012. Retrieved March 8, 2018.

USDA. 2015b. Part II: Reference of swine health and health management in the united states, 2012. NAHMS Swine 2012. Retrieved March 8, 2018.

Van Breedam, W., P. L. Delputte, H. Van Gorp, G. Misinzo, N. Vanderheijden, X. Duan, and H. J. Nauwynck. 2010a. Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage. J. Gen. Virol. 91(Pt 7): 1659-1667. doi: 10.1099/vir.0.020503-0

Van Breedam, W., H. Van Gorp, J. Q. Zhang, P. R. Crocker, P. L. Delputte, and H. J. Nauwynck. 2010b. The M/GP(5) glycoprotein complex of porcine reproductive and respiratory syndrome virus binds the sialoadhesin receptor in a sialic acid-dependent manner. PLoS Pathog. 6(1): e1000730. doi: 10.1371/journal.ppat.1000730

Varley, M. A., and J. Wiseman eds. 2001. The Weaner Pig: Nutrition and Management. CABI Publishing. New York.

Vu, H. L. X., A. K. Pattnaik, and F. A. Osorio. 2016. Strategies to broaden the cross-protective efficacy of vaccines against porcine reproductive and respiratory syndrome virus. Vet. Microbiol. doi: http://dx.doi.org/10.1016/j.vetmic.2016.09.014

Weldon, S. M., A. C. Mullen, C. E. Loscher, L. A. Hurley, and H. M. Roche. 2007. Docosahexaenoic acid induces an anti-inflammatory profile in lipopolysaccharide- stimulated human THP-1 macrophages more effectively than eicosapentaenoic acid. J. Nutr.

Biochem. 18(4): 250-258. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.jnutbio.2006.04.003

Wells, K. D., R. Bardot, K. M. Whitworth, B. R. Trible, Y. Fang, A. Mileham, M. A. Kerrigan, M. S. Samuel, R. S. Prather, and R. R. Rowland. 2017. Replacement of porcine CD163 scavenger receptor cysteine-rich domain 5 with a CD163-like homolog confers resistance of pigs to genotype 1 but not genotype 2 porcine reproductive and respiratory syndrome virus. J. Virol. 91(2): 10.1128/JVI.01521-16. Print 2017 Jan 15. doi: e01521-16

Whelan, J. 2008. The health implications of changing linoleic acid intakes. Prostaglandins Leukot. Essent. Fatty Acids. 79(3-5): 165-167. doi: 10.1016/j.plefa.2008.09.013

Whitworth, K. M., R. R. Rowland, C. L. Ewen, B. R. Trible, M. A. Kerrigan, A. G. Cino-Ozuna, M. S. Samuel, J. E. Lightner, D. G. McLaren, A. J. Mileham, K. D. Wells, and R. S. Prather. 2016. Gene-edited pigs are protected from porcine reproductive and respiratory syndrome virus. Nat. Biotechnol. 34(1): 20-22. doi: 10.1038/nbt.3434

Yaqoob, P., and P. Calder. 1995. Effects of dietary lipid manipulation upon inflammatory mediator production by murine macrophages. Cell. Immunol. 163(1): 120-128. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1006/cimm.1995.1106

Zhang, Q., and D. Yoo. 2015. PRRS virus receptors and their role for pathogenesis. Vet. Microbiol. 177(3–4): 229-241. doi: http://dx.doi.org/10.1016/j.vetmic.2015.04.002

Table 1. Functions and characteristics of PRRSV genome. Adapted from (Lunney et al., 2016)

Gene Protein General Function Mode of Immune Dysregulation ORF1a nsp1α Protease Inhibits the phosphorylation of IκB and IRF3, degrades CBP nsp1β Protease Degrades CBP, Inhibits NFκB binding nsp2 Protease, modifies Inhibits membrane for ubiquitination of replication complex RIG-1, IκB, IRF3 nsp4 Protease, induces Potentially inhibit apoptosis INF production ORF1b nsp9 RNA-dependent Unknown RNA polymerase nsp10 Helicase Unknown

ORF1b nsp11 Endoribonuclease Inhibits NFκB and ERK signaling ORF2a GP2 Viral attachment, Unknown incorporates with GP3 and 4 ORF2b E Ion-channel like Activate properties, essential inflammasome for viral infectivity ORF3 GP3 Incorporates with Unknown GP2 and 4, essential for viral infectivity ORF4 GP4 Key GP for GP2a-3-4 Unknown complex, viral attachment ORF5 GP5 Viral entry Unknown

ORF6 M Heterodimerizes with Unknown GP5, viral assembly and budding, critical for infectivity ORF7 N Viral nucleocapsid Inhibits IRF-3 activation

Figure 1. n-6 and n-3 Biosynthesis Desaturation and elongation of essential fatty acids; linoleic acid and -linolenic acid to generate the long-chain n-6 and n-3 polyunsaturated fatty acids. Synthesis of arachidonic acid, eicosapentaenoic acid and docosahexaenoic acid utilize the same enzymatic pathways putting them in competition with each other. Adapted from Guillou, H. et al. 2010.

Figure 2. Eicosanoid synthesis from arachidonic acid Arachidonic acid release from membrane phospholipids is catalyzed by phospholipase A2 (PLA2). Free arachidonic acid is metabolized by lipoxygenase and cyclooxygenase enzymes to generate 4-series leukotrienes (LT), lipoxins (LX), and 2-series prostaglandins (PG) and thromboxanes (TX) to act as mediators and regulators of inflammation.

Figure 3. Eicosanoid synthesis from eicosapentaenoic acid Eicosapentaenoic acid release from membrane phospholipids is catalyzed by phospholipase A2 (PLA2). Dietary eicosapentaenoic acid becomes incorporated in the cell membrane at the expense of arachidonic acid, which decreases the substrate availability for n-6 derived eicosanoids, and the generation of less potent 3-series prostaglandins (PG), thromboxanes (TX), 5-series leukotrienes (LT), as well as E-series resolvins (RvE), all of which act as mediators and regulators of inflammation, eliciting an anti-inflammatory response.

Figure 4: Arachidoic acid promotes lipid-mediator class switching via PGE2 production Arachidonic acid is mobilized from the phospholipid membrane by cPLA2. Release of ARA results in an increased expression of COX-2, which enables the oxidation of ARA to PGE2. Additionally, ARA is metabolized by the 5-LOX enzyme for synthesis of 4-series LT. Prostaglandin E2 and LT promote the transcription of pro-inflammatory cytokines and production of ROS and RNS (as indicated by black arrows). The dual nature of PGE2 places it at the midline between a cellular pro-inflammatory response and an anti-inflammatory response. Not long after PGE2 is synthesized it can be released from the cell and bind to the G-protein coulped receptor EP4 in an autocrine or paracrine fashion. Binding of PGE2 to EP4 increases intracellular cAMP which inhibits further transcription and expression of COX-2 and subsequently PGE2. As a result, the negative feedback loop of PGE2 promotes transcription of 12/15-LOX and hinderance of 5-LOX activity. Increased expression of 12/15-LOX leads to the synthesis of 4-series lipoxins (LXA4) and conversion of LTA4 to LXA4 which promotes the transcription of anti-inflammatory cytokines. The switching of eicosanoid synthesis from a 5-LOX pathway to a 12/15-LOX pathway and subsequent conversion of LTA4 to LXA4 is termed “lipid-mediator class switching”. The switch in lipid-mediated eicosanoid production allows inflammation to be terminated and the challenged tissue to return back to a state of homeostasis. The duality of PGE2 makes it a potent regulator of immunological responses. ARA, arachidonic acid; COX-2, cyclooxygenase-2; cPLA2, cytosolic phospholipase A2; 5-HETE, hydroxyeicosatetraenoic acid; 12/15-HETE 12/15-hydroxyeicosatetraenoic acid;5-LOX, 5-lipoxygenase; 12/15-LOX, 12/15- lipoxygenase; LXA4- lipoxin A4; LTA4/B4, leukotriene A/B4; RNS, reactive nitrogen species; ROS, reactive oxygen species.

Figure 5. Eicosanoid synthesis from docosahexaenoic acid Docosahexaenoic acid (DHA) release from membrane phospholipids is catalyzed by phospholipase A2 (PLA2). Dietary DHA becomes incorporated in the cell membrane at the expense of arachidonic acid, which decreases the substrate availability for n-6 derived eicosanoids, and the generation of D-series resolvins (RvD), protectins, and maresins (MaR). All of which play a critical role in repairing collateral damage from inflammation and returning afflicted tissue back to homeostasis.

Figure 6. Genome structure and imagining of porcine reproductive and respiratory syndrome virus A) Genomic organization of PRRSV. B) Electron microscope imaging of PRRSV virion with inset picture showing defined dimensions of envelope and viral structure (Dokland, 2010). PRRSV; porcine reproductive and respiratory syndrome virus.

Chapter II

Dietary arachidonate in milk replacer triggers dual benefits of PGE2 signaling in LPS-

challenged piglet alveolar macrophages

Published in the Journal of Animal Science and Biotechnology:

Walter, K.R., Lin, X., Jacobi, S.K., Käser, T., Esposito, D., Odle, J. 2019. Dietary arachidonate in milk replacer triggers dual benefits of PGE2 signaling in LPS-challenged piglet alveolar macrophages. J. Anim. Sci. Biotechnol. 10:13. doi: 10.1186/s40104-019-0321-1

Abstract

Respiratory infections challenge the swine industry, despite common medicinal practices.

The dual signaling nature of PGE2 (supporting both inflammation and resolution) makes it a potent regulator of immune cell function. Therefore, the use of dietary long chain n-6 PUFA to enhance PGE2 effects merits investigation. Day-old pigs (n = 60) were allotted to one of three dietary groups for 21 d (n = 20/diet), and received either a control diet (CON, arachidonate =

0.5% of total fatty acids), an arachidonate (ARA)-enriched diet (LC n-6, ARA = 2.2%), or an eicosapentaenoic (EPA)-enriched diet (LC n-3, EPA = 3.0%). Alveolar macrophages and lung parenchymal tissue were collected for fatty acid analysis. Isolated alveolar macrophages were stimulated with LPS in situ for 24 h, and mRNA was isolated to assess markers associated with inflammation and eicosanoid production. Culture media were collected to assess PGE2 secretion.

Oxidative burst in macrophages was measured by: 1) oxygen consumption and extracellular acidification (via Seahorse), 2) cytoplasmic oxidation and 3) nitric oxide production following 4,

18, and 24 h of LPS stimulation. Concentration of ARA (% of fatty acids, w/w) in macrophages from pigs fed LC n-6 was 86% higher than CON and 18% lower in pigs fed LC n-3 (P < 0.01).

Following LPS stimulation, abundance of COX-2 and TNF-α mRNA (P < 0.0001), and PGE2 secretion (P < 0. 01) were higher in LC n-6 PAM vs. CON. However, ALOX5 abundance was

1.6-fold lower than CON. Macrophages from CON and LC n-6 groups were 4-fold higher in

ALOX12/15 abundance (P < 0.0001) compared to LC n-3. Oxygen consumption and extracellular acidification rates increased over 4 h following LPS stimulation (P < 0.05) regardless of treatment. Similarly, increases in cytoplasmic oxidation (P < 0.001) and nitric oxide production (P < 0.002) were observed after 18 h of LPS stimulation but were unaffected by diet.

We infer that enriching diets with arachidonic acid may be an effective means to enhance a

stronger innate immunologic response to respiratory challenges in neonatal pigs. However, further work is needed to examine long-term safety, clinical efficacy and economic viability.

Keywords

Arachidonic acid, Cyclooxygenase, Eicosanoid, Eicosapentaenoic acid, Inflammation, Lipid mediator class switch, LPS, Lipoxin, Porcine alveolar macrophage

Introduction

Respiratory infections in swine result in severe economic loss despite the wide spread use of vaccines and antibiotics (Brockmeier et al., 2002). Gram-negative bacteria are some of the common bacterial agents that afflict swine herds as either the primary infectious agent or as an opportunistic secondary infectious agent (Chang et al., 2002; Brockmeier et al., 2002). Vaccines and antibiotics are routine practice however, the type of bacteria and timing of treatment can impact use and efficacy (Brockmeier et al., 2002; Haesebrouck et al., 2004). In neonates, early life protection stems partially from passive immunity through the sow’s colostrum although the transfer of maternal antibodies can be limiting. Antibodies against certain gram-negative bacteria can deplete in piglets within 1 to 4 weeks of life (Kelly and Coutts, 2000; Haesebrouck et al.,

2004). The other stem of early life protection is the neonate’s innate immune system, as its adaptive immune system has not fully matured (Kelly and Coutts, 2000). As such, neonates are at a much higher risk for infection. During this critical time, it is imperative to explore alternative means to enhance a stronger, well-balanced immunological response to respiratory infections.

Nutritional status, especially early in life, is a key component in immune system development, proper defenses, and susceptibility to infections. Dietary long-chain polyunsaturated fatty acids (LC-PUFA), like arachidonic acid (ARA, n-6) and eicosapentaenoic acid (EPA, n-3), can modify the fatty acid composition of immune cells and their function directly through incorporation in to the phospholipid membrane and as free fatty acids acting indirectly as secondary messengers (Oliveros et al., 2004; Martins de Lima et al., 2007; Calder,

2008b). These LC-PUFA have immunomodulatory effects which can alter eicosanoid production and subsequent inflammatory responses in immune cells (Lee et al., 1985; Babcock et al., 2002;

Bagga et al., 2003b). Arachidonic acid serves as a precursor for potent eicosanoids, like PGE2,

which has the ability to promote pro-inflammatory signaling at the onset of an acute challenge. A lesser explored function of PGE2 is its ability to hinder initial pro-inflammatory signaling and promote anti-inflammatory and pro-resolving cascades, a mechanism referred to as “lipid mediator class switching” (Serhan et al., 2008; Botham and Mayes, 2009). The pro-inflammatory roles of ARA and anti-inflammatory roles of EPA have been extensively reviewed by Calder

(Calder, 2006c). The involvement of PGE2 in lipid mediator class switching has been evaluated

(Brezinski and Serhan, 1990; Kawahara et al., 2015; Tang et al., 2017) and thoroughly reviewed by Serhan and colleagues (Serhan and Sheppard, 1990; Serhan, 2007; Norris et al., 2014; Levy and Serhan, 2014; Buckley et al., 2014). Few studies focus on the dual role of PGE2, derived from ARA, and the potential benefits stemmed from this eicosanoid during acute health challenges. Studies are particularly sparse in swine.

Dietary supplementation with EPA is best known for its anti-inflammatory benefits.

However, in instances where inflammation is essential for controlling and eradicating invading pathogens, increasing supplementation with EPA or other long-chain n-3 PUFA could dampen an appropriate immunological response to respiratory pathogens. Macrophages enriched with n-3

PUFA demonstrate decreased phagocytosis (Calder et al., 1990), production of reactive oxygen species (Luostarinen and Saldeen, 1996), ARA-derived eicosanoids (Fritsche et al., 1993;

Babcock et al., 2002; Babcock et al., 2003; Bagga et al., 2003b), and pro-inflammatory cytokine production (Renier et al., 1993; Babcock et al., 2003; Novak et al., 2003). There have been some studies regarding the effects of n-3 and n-6 PUFA modulating the immune response of respiratory pathogens in rodents. For instance, supplementation with long chain n-3 PUFA results in decreased bacterial clearance and survival to Listeria monocytogenes (Fritsche et al.,

1997; Puertollano et al., 2004) and Mycobacterium tuberculosis (McFarland et al., 2008).

There are few studies regarding the effects of PUFA supplementation and respiratory health in swine, particularly involving the use of dietary long chain n-6 PUFA. Studies evaluating dietary n-6 PUFA predominantly involve dietary sources containing the precursor for

ARA, linoleic acid. Studies have demonstrated the conversion of ARA, EPA, and DHA from their precursors linoleic acid and alpha-linolenic acid are low and supplementation with preformed LC-PUFA can be beneficial (Huang and Craig-Schmidt, 1996; Hussein et al., 2005;

Brenna et al., 2009; Huang et al., 2016; Hadley et al., 2016). Very few studies, particularly for the swine industry, utilize preformed ARA sources. This study is the first to evaluate the effects of preformed long chain n-6 PUFA supplementation on the innate immune response to respiratory pathogens in neonatal pigs. Our aim was to determine if supplemental long chain n-6

PUFA in milk replacer-fed pigs could improve the innate immune response of alveolar macrophages (PAM) following ex vivo LPS stimulation. Given the duality of PGE2 signaling of both pro- and anti-inflammatory mechanisms, we hypothesized that a heightened but balanced immune response would dampen untoward cellular damage.

Materials and Methods

Piglets and experimental dietary treatments

All animal protocols were approved by the Institutional Animal Care and Use Committee of North Carolina State University. Animals were managed as previously described (Hess et al.,

2008; Jacobi et al., 2012). Briefly, colostrum-fed piglets were acquired 24 h after birth and housed individually. Piglets (n = 60) were allotted to dietary treatment groups (n = 20/treatment) completely at random without regard to litter of origin, body weight or gender. The pigs used per litter ranged from 2-8. Pigs were allotted to a milk replacer diet (Table 1) supplemented with

LC-PUFA containing either 0.5% ARA (ARASCO Oil, DSM Nutritional Products, Inc. Product

# 5015002044) of total fatty acids (control (CON)), 2.2% ARA (LC n-6, ARASCO Oil) or 3.0%

EPA (LC n-3) of total fatty acids (Table 2) for 21 days. The 0.5% ARA supplementation in CON diet satisfies the recommended level for infant formula (Odle et al., 2014). The LC n-6 and n-3

PUFA diets were patterned after previous work in our laboratory (Hess et al., 2008; Jacobi et al.,

2012). The LC n-6 diet was supplied with a higher concentration of ARA (2.2% of total fatty acids) to prophylactically enrich the fatty acid content of PAM with ARA. The LC n-3 diet was our negative control, and was supplemented to be isocaloric to the LC n-6 and CON diets with

EPA-enriched fish oil (MegOil, DSM Nutritional Products, Inc. Product # 5015261). This provided 3.0% EPA of total fatty acids to the diet. The MegOil used for the LC n-3 diet contained a higher level of DHA and therefore was not further supplemented with the DHASCO oil (DSM Nutrition Products, Inc. Product # 5013658044). Vitamin E fortification was uniform across diets (155 IU/kg), and an antioxidant (TBHQ) was added at 0.1 g/kg. At the end of the trial, pigs were humanely euthanized by exsanguination under isoflurane anesthesia.

Sample collection

Whole blood was collected via jugular venipuncture prior to anesthesia. Whole blood was collected in EDTA-treated tubes and blood for serum was collected into untreated tubes. Whole blood and serum were prepared and utilized the same day for clinical analyses of blood chemistry panels and complete blood cell counts by a commercial auto analyzer (Veterinary

SuperChem/CBC, Antech Diagnostics) to assess general, clinical health status of the pigs.

Alveolar macrophages were isolated via bronchoalveolar lavage using Hanks’ Balanced Salt

Solution as previously reported (Harmsen et al., 1979; Ganter and Hensel, 1997). Cells were centrifuged and pellets were re-suspended in freezing medium containing 70% RPMI-1640

media, 20% heat-inactivated fetal bovine serum (HI-FBS), and 10% dimethyl sulfoxide at concentrations of 2× 107 cells/mL. Cells were frozen in liquid nitrogen for subsequent cell culture. Lung tissue samples were obtained following bronchoalveolar lavage, snap-frozen in liquid nitrogen and stored at -80 °C for subsequent fatty acid analysis.

Validation and characterization of PAM isolation procedure

Cells isolated from lungs were characterized by flow cytometry. Lung cells were stained in 96-well round bottom plates (Thermo Fisher). To confirm the isolation of PAM, cells were stained for CD14, CD163 and CD172A. For the characterization of co-isolated lymphocytes, lung cells were stained for the T-cell marker CD3, CD8α to identify CD3–CD8α+ NK cells, and the pan-B cell marker CD21a (Table 3). Live/Dead discrimination (LIVE/DEAD® Fixable

NearIR Dead Cell Stain Kit, ThermoFisher) confirmed that for all analyzed samples, over 97% of cells were alive in the PAM gate and over 95% in the lymphocyte gate (data not shown). Cells were analyzed on a BD LSR II (BD Biosciences).

Fatty acid analysis

Composition of total fatty acids were determined in lung tissue, PAM, and milk sample composites collected throughout the duration of the trial. Porcine alveolar macrophages were thawed on ice, and fatty acids were subjected to direct-methylation (Wang et al., 2000) with some modification. Cells were washed in 1X PBS and centrifuged at 180 x g at room temperature for 5 min. Supernatant was removed and 100 mg of cells were transferred to a 20 mL Teflon-lined, screw-capped tube. One mL of methanol and 3 mL of 3 N methanolic-HCl were added. Tubes were capped tightly and refluxed in a 95 °C-water bath for 1h. Eight mL of

0.88% NaCl (wt : vol) and 3 mL of hexane were added to each sample, vortexed, and centrifuged at 1,330 × g for 15 min at 4 °C. After centrifugation, the top layer was transferred to a 1.5 mL

vial and evaporated to dry under N2. Fatty acids from milk and tissue samples were extracted and saponified as previously described (Lin et al., 2011), with some modification. One hundred mg of tissue sample was homogenized in 1 mL sterile water. Samples were centrifuged at 1,330 × g at 4 °C. Fatty acid methyl esters were dissolved in 25 µL hexane and analyzed on a weight percent basis of total fatty acids using gas chromatography-mass spectrometry (GC-MS) as previously described (Lin et al., 2011).

Cell Culture and mRNA analysis

Porcine alveolar macrophages from all dietary treatment groups were cultured in RPMI

1640 media supplemented with L-glutamine, penicillin (100 U/mL), streptomycin (100 µg/mL), fungizone (4 µg/mL), gentamycin (50 µg/mL), and 10% HI-FBS. Cells were thawed in a 37 °C water bath, washed with warmed culture media and centrifuged at 180 × g at room temperature for 10 min (Ramachandran et al., 2012). Supernatant was removed, cells were re-suspended in warmed media and seeded as a composite of six pigs per dietary treatment on 6-well plates at a density of 3×106 cells/mL in triplicate. Cells were either stimulated with 10 ng/mL of LPS

(Escherichia coli O111:B4) or not stimulated (basal), and maintained at a 37 °C humidified incubator with 5% CO2 for 24 h. Selection of dosage and timeline for LPS stimulation were based on a preliminary study that examined the dose and time dependence of PGE2 production at

0, 3, 6, 12, 24, and 48 h following stimulation with 10, 100, and 1,000 ng/mL LPS from the ARA treatment group (data not shown). Cells were collected in TRIzol Reagent (Ambion) and triplicate wells were pooled. Total RNA was purified according to manufacturer’s instructions with the modification that RNA precipitation occurred overnight at -80 °C. Complementary

DNA synthesis was carried out using a High Capacity cDNA Reverse Transcription kit (Applied

Biosystems) following manufacturer’s instructions. Primers for pig ribosomal proteins L4

(RPL4) and L9 (RPL9), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide (YWHAZ), succinate dehydrogenase complex subunit A (SDHA), toll- like receptor 4 (TLR-4), COX-1, COX-2, lipoxygenase 5 (ALOX5) and 12/15 (ALOX12/15), tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6) and 10 (IL-10) (Table 4) were designed using primer-BLAST from the national center for biotechnology information (NCBI) database. Primers were designed to span exon-exon junctions. Melt curve analysis was performed on all primers and samples to confirm the absence of primer dimers and existence of gene-specific peaks. Genes of interest were normalized to the geometric mean of the housekeeping genes RPL4, RPL9, YWHAZ, and SDHA. Measurement of mRNA abundance was performed by qRT-PCR and the 2-ΔΔCt method as previously described (Jacobi et al., 2011; Cinar et al., 2012; Esposito et al., 2014). All samples were run in duplicate. Relative expression was normalized to the basal CON treatment.

PGE2 ELISA assay

Tissue culture media from all PAM were collected at time of RNA isolation. Media from triplicate wells were pooled and used to determine the concentration of PGE2. A competitive enzyme-linked immunosorbent assay (ELISA) kit specified for porcine PGE2 (Pierce) was utilized following manufacturer’s instructions. The assay range was 39.1 - 2,500 pg/mL, with a minimum detectable dose of 13.4 pg/mL. Samples that did not fall within detectable range of this

ELISA were diluted 50X in the same type of media in which they were cultured, as suggested by the manufacturer. All samples were assayed in duplicate. Inter- and intra-assay coefficient of variation were assessed to validate precision. The inter-assay was 3.25% and determined using a composite of 19 pigs from the CON group stimulated with 10 ng/mL LPS. The intra-assay was

2.62% and determined using values from the median point of the standard curve for each plate.

Respiratory Burst analysis

Occurrence of respiratory burst in PAM was determined via three independent assays following LPS stimulation. First, oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) upon LPS stimulation were determined using an Extracellular Flux XF Analyzer

(Seahorse Bioscience) as previously described using RAW 264.7 macrophages with low n-values by Grace et al (Bae et al., 2014; Grace et al., 2016). Second, PAM were cultured and stimulated with 10 ng/mL LPS for 18 and 24 h, and oxidative stress was determined using a commercially available CellROX Orange Reagent following manufacturer’s instructions. Briefly, cells were seeded at a density of 3×105 cells per well in a 96 well plate. Cells were cultured and stimulated with LPS following the same protocol as previously stated, with the exception of different time points. NucBlue Live ReadyProbes Reagent and CellROX Orange Reagent (Invitrogen) was added to tissue culture medium of plated cells at 1 drop/mL and a final concentration of 5

µmol/L respectively following LPS stimulation. Cells were incubated at 37 °C for 30 min. Media was removed and cells were washed three times with 1X PBS. Cells were imaged using an

EVOS FL Auto Cell Imagining System (Life Technologies). Quantification of oxidative stress was measured at an excitation/emission of 545/565 nm using a BioTek Synergy H1 Multi-mode microplate reader (BioTek Instruments). Third, tissue culture media from all cultured PAM were collected at 18 and 24 h post LPS stimulation for measurement of nitrite concentration as an indication of nitric oxide (NO) production using the Greiss Reagent System (Promega) according to manufacturer’s instructions. Quantification for NO production was measured on a BioTek

Synergy H1 Multi-mode microplate reader at an absorbance of 540 nm.

Statistical analysis

Concentrations of fatty acids, serum metabolite, and blood cell count data were analyzed by a one-way ANOVA using the general linear model procedure of SAS (version 9.4) and the least significant differences multiple comparison test (SAS Institute). Data from gene expression,

PGE2 concentration, oxidative stress and respiratory burst analysis were analyzed according to a two-way ANOVA for a 3 × 2 factorial design (diets +/- LPS) with the Tukey multiple comparison test. Residual analysis confirmed that ANOVA assumptions of normality and homogeneity of error variance were met. Data reported are least square means ± SEM. Statistical significance was declared when P < 0.05 and trends were noted when 0.05 < P < 0.1.

Results

Dietary supplementation and pig performance

Pigs averaged 1.87 ± 0.07 kg at the beginning of the trial and 6.64 ± 0.07 kg at end of the trial (data not shown). Diets were formulated to be isocaloric (Table 1) and total fatty acid composition was confirmed via GC-MS (Table 2). Feed intake and growth rates were unaffected by dietary treatments (P > 0.1; data not shown). All serum metabolites and blood cell counts

(Table 5) fell within normal clinical ranges. Serum concentrations of urea nitrogen, cholesterol and mean corpuscular volume were lower in LC n-3 fed pigs (P < 0.05), while albumin was elevated (P < 0.001) compared to CON and LC n-6 fed pigs. Other serum enzymes, metabolites and blood cell counts did not differ between dietary treatment groups (P > 0.1).

Phenotyping of isolated lung cells from bronchoalveolar lavage

Cells isolated via bronchoalveolar lavage could be distinguished into three subsets based on their forward and side scatter properties (FSC/SSC): dead cells (on average: 15.5%), PAM

(on average: 76.4%), and lymphocytes (on average: 8.0%). Within the PAM scatter gate, cells isolated from all pigs demonstrated the characteristic expression pattern of PAM:

CD14lowCD163+CD172A+. Within the lymphocyte scatter gate, 18.3% were CD3+ T cells,

34.3% were CD21a+ B cells, and 1.8% were CD8α+ NK cells (Figure 1).

Lung and PAM fatty acid composition

Arachidonic acid (20:4n-6) concentration in lung parenchymal tissue was 1.4-fold higher

(P < 0.0001) in pigs receiving the LC n-6 diet compared to pigs receiving CON diet for 21 days

(Table 6). A similar enrichment pattern was observed in PAM (Table 6). Concentration of ARA was 2-fold higher in PAM from pigs receiving the LC n-6 diet compared to pigs receiving CON and LC n-3 diets (P < 0.01). The concentration of ARA was also higher in PAM than in lung parenchyma (P < 0.01). As the concentration of ARA increased, the concentrations of oleic acid

(18:1) and linoleic acid (18:2n-6) tended to lower in both lung tissue and PAM. The proportions of 18:1, 18:2n-6 and 18:3n-3 (P < 0.01) were higher on average in parenchymal lung tissue than in PAM, while PAM were more highly enriched in 22:6n-3 by at least 90% (P < 0.04).

Pigs receiving the LC n-3 diet were more than 2-fold lower in 20:4n-6 content and 1.5- fold higher in 20:5n-3 enrichment in lung tissue (P <0.0001) and PAM (P < 0.0001) compared to pigs receiving CON and LC n-6 diets. In PAM, pigs receiving the LC n-3 diet were 2-fold higher in 22:6n-3 (P < 0.04) compared to CON and LC n-6 groups.

COX-2 mRNA abundance and PGE2 secretion

Following 24-hour LPS stimulation, the relative mRNA abundance of COX-2 was 4-fold higher in PAM for the LC n-6 dietary treatment group compared to the basal CON dietary group

(P < 0.05). No detectable difference in COX-2 mRNA abundance between the LC n-3 and CON groups were observed following LPS stimulation, however abundance was higher in LC n-3 basal compared to CON basal (Figure 2A). Consistent with elevated COX-2 mRNA abundance and ARA concentration, PGE2 concentration in PAM from the LC n-6 dietary treatment group was 2-fold higher following LPS stimulation was compared to the basal CON dietary group (P <

0.0001). No detectable difference in PGE2 concentration was observed in PAM from the LC n-3 dietary group (Figure 2B).

Pro-inflammatory lipoxygenase and cytokine mRNA abundance

In all dietary groups, differences in the relative mRNA abundance of Toll-like receptor 4

(TLR-4) and COX-1 were not detected (data not shown). Treatment with LPS increased the abundance of ALOX-5 mRNA in PAM from all dietary treatment groups by an average of 27% however, abundance in PAM from the LC n-6 fed pigs was 1.6-fold lower compared to CON and

2-fold lower compared to the LC n-3 treatment group (Figure 3A). Additionally, TNF-α mRNA abundance was on average 4-fold higher following LPS-stimulation of PAM from the LC n-6 treatment group compared to CON and LC n-3 enriched alveolar macrophages (Figure 3B).

Differences in IL-6 mRNA abundance were undetectable between the LC n-6 and LC n-3 groups, however CON alveolar macrophages were 47% lower following LPS stimulation (Figure

3C).

Anti-inflammatory lipoxygenase and cytokine mRNA abundance

Compared to CON basal and following LPS induction, alveolar macrophages from the

CON and LC n-6 dietary treatment groups were 4-fold higher in ALOX12/15 mRNA abundance, while no detectable difference was observed in macrophages from the LC n-3 treatment group

(Figure 4A). A significant difference in IL-10 abundance between CON basal and other dietary treatment groups prior to LPS stimulation was observed but not after (Figure 4B).

Oxidative burst and nitric oxide production

To evaluate oxidative burst in PAM, oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were evaluated. OCR and ECAR are reported as the average from basal reading (0 to 40 min) compared to hourly measurements taken post LPS stimulation over the course of 4.5 h, which was the maximum cells could withstand being outside of a humidified

CO2 incubator. Oxygen consumption rate increased over time following LPS stimulation (Figure

5A). Consistent with an increase in OCR, an LPS effect was observed in the ECAR (Figure 5B) among all dietary treatments. Changes in NO production and cytoplasmic oxidation, which are indicators of oxidative stress, increased after 18 h then declined after 24 h of LPS stimulation although no dietary effect was detected (Figure 5 C & D).

Discussion

For the past 40 years, fatty acids have been known to play a role in the immune system and a great deal of research has been conducted to explore their mechanisms of action (Meade and Mertin, 1978; Hwang, 1989; Leslie, 2004; Calder, 2008b; Raphael and Sordillo, 2013).

With the increasing awareness of chronic inflammatory diseases dietary LC-PUFA as modulators for inflammation, particularly the n-3 class, has been an area of research (Hwang,

1989; Miles and Calder, 1998; Kelley, 2001; Fritsche, 2006; Calder, 2012; Rocha et al., 2017).

Supplementation with EPA has proven beneficial (Nieto et al., 2002; Sijben and Calder, 2007;

Galarraga et al., 2008; Njoroge et al., 2012), although it has been reported to hinder proper immunological responses against respiratory pathogens (Fritsche et al., 1997; Puertollano et al.,

2004; McFarland et al., 2008; Schwerbrock et al., 2009), suggesting its supplementation could be detrimental in cases where acute inflammation is vital (Anderson and Fritsche, 2002; Calder,

2010). Accordingly, it is important to explore the potential benefits of LC n-6 PUFA supplementation, especially in piglets where the immune system is not fully matured. The aim of our research was to determine if the duality of ARA-derived eicosanoid roles in both inflammatory responses and initiation of resolution could be observed in acute LPS-stimulated

PAM.

Previous studies have indicated that supplementation with LC-PUFA can enrich PUFA content in immune cells, thus altering immune cell function (Calder et al., 1990; Anes et al.,

2003; Novak et al., 2003; Oliveros et al., 2004; Moller and Lauridsen, 2006; McMurray et al.,

2011). Additionally, maternal PUFA supplementation was demonstrated to alter immune cell

PUFA content and eicosanoid production in offspring (Fritsche et al., 1993; Fritsche and Cassity,

1996; Lauridsen et al., 2007). Our results demonstrate that 21 days is a sufficient duration to effectively enrich the fatty acid content of alveolar macrophages in milk formula-fed neonates.

Increasing dietary long-chain n-6 PUFA resulted in ARA enrichment being 2-fold higher in

PAM compared to CON. However, higher EPA concentrations from LC n-3 fed pigs abated

ARA enrichment in PAM by more than 50% (Table 1). In macrophages, supplementation with

LC-PUFA leads to incorporation in both the phospholipid membrane and neutral lipid fractions with the highest incorporation found in the phospholipid membrane (Calder et al., 1990; Chapkin

et al., 1991). This is important because stimulation of toll-like receptor 4 (TLR-4) from LPS activates cytosolic phospholipase A2 (cPLA2) for the release of ARA from the phospholipid membrane, which is associated with increased COX-2 and PGE2 expression (Gijon et al., 2007;

Sobolewski et al., 2010; Matsui et al., 2013; Raphael and Sordillo, 2013; Norris et al., 2014). As such, we expected increased cellular ARA content to increase COX-2 mRNA abundance and subsequently PGE2 production upon LPS stimulation. Long-chain n-6 enriched PAM had higher abundance of COX-2 mRNA and were 2-fold higher in PGE2 secretion upon LPS stimulation

(Figure 2). These findings are consistent with previous work from Fritsche et al. (Fritsche et al.,

1993) and Møller et al. (Moller and Lauridsen, 2006) in which alveolar macrophages from pigs receiving fish oil for 28 days either maternally-supplied or supplemented demonstrated decreased ARA content and PGE2 production in PAM following LPS stimulation.

Early stages of immune cell stimulation promote endogenous 5-LOX to oxidize ARA for

LT synthesis leading to the transcription and production of pro-inflammatory cytokines (Luo et al., 2003). In this study, the abundance of ALOX5 (gene for 5-LOX) was significantly lower following LPS stimulation in LC n-6 PAM compared to CON and LC n-3 PAM. Alveolar macrophages from the LC n-3 treatment group displayed the highest level of ALOX5 mRNA abundance (Figure 3A), although TNF-α abundance was highest in PAM from the LC n-6 treatment group post-LPS induction (Figure 3B). Long-chain n-3 PUFA, such as EPA, can be metabolized by 5-LOX to produce less potent pro-inflammatory mediators (Calder, 2013). This in part could explain why higher levels of ALOX5 mRNA is observed in the LC n-3 group, but

TNF-α mRNA is not. Previous studies have demonstrated that supplementation with EPA significantly lowers TNF-α mRNA abundance in macrophages (Renier et al., 1993; Anderson and Fritsche, 2002); although other studies indicate mRNA abundance to be unaltered and

secretion to be lowered with EPA treatment (Verlengia et al., 2004). Macrophages from mice fed diets containing fish oil more than 7% higher than our study demonstrated lowered TNF-α mRNA abundance and secretion at 6 wk of age when stimulated with 5 μg/mL LPS for 12 h and lowered even further after 15 wk of supplementation (Renier et al., 1993). It is possible that

TNF-α is regulated post-transcriptionally in a time and dose dependent manner. While secretion of TNF-α was not evaluated in this study, our results do demonstrate a positive effect on TNF-α mRNA abundance of LC-PUFA enriched PAM, with LC n-6 enrichment having the strongest effect. While the mRNA abundance of IL-6 was lower in CON macrophages post LPS- stimulation, no detectable difference was observed in PAM from the LC n-6 or n-3 groups

(Figure 3C). In alveolar macrophages from weaned pigs fed high n-6 (5% sunflower oil) or n-3

(5% fish oil) diets, no detectable difference in IL-6 production was observed between the groups following LPS stimulation (Møller and Lauridsen, 2006). Studies have suggested that TNF-α and

IL-6 negatively regulate one another during innate immune responses. In human peripheral blood mononuclear cells (PBMC), IL-6 suppressed TNF-α abundance and production (Schindler et al.,

1990). Similar effects were observed following gram-positive infection in mice. In TNF-α-/- mice, increased levels of IL-6 were observed after inoculation with Rhodococcus aurantiacus, but was decreased following TNF-α administration (Kohanawa and Kohanawa, 2006).

Enrichment from a LC n-6 diet may provide an opposite effect in which high dietary levels of

ARA promote elevated TNF-α abundance and subsequently downregulate the abundance of IL-6 similar to effects observed in LC n-3 dietary treatments.

Several studies have demonstrated the immunosuppressive capabilities of PGE2 in varying innate and adaptive immune cells attributed to lipid-mediator class switching (Serhan et al., 2008; Sreeramkumar et al., 2012; Kalinski, 2012; Levy and Serhan, 2014). While the

abundance of IL-10 was not elevated following LPS stimulation (Figure 4B) in our study, this could be because the abundance of TNF-α, a very potent pro-inflammatory cytokine, is still elevated and elevation in IL-10 occurs downstream of the initial lipid-mediator class switch. It is important to note that there were lower ALOX5 abundance and higher ALOX12/15 mRNA abundance in LC n-6 PAM compared to CON and LC n-3 PAM after LPS stimulation (Figure

3A and 4A). This suggests that the initial stages of a lipid-mediator class switch have occurred within a 24-hour time period post macrophage stimulation. This assumption is supported by the work of Levy et al. in which human polymorphonuclear neutrophils (PMN) exposed to PGE2 in vitro then challenged with fMLP (N-formylmethionine-leucyl-phenylalanine) switched from

99% 5-LOX activity to 87% 15-LOX activity within 5 h (Levy et al., 2001). Mice injected with

TNF-α had rapid increases in leukotriene B4 within an hour of injection, then a drastic decrease back to baseline as Lipoxin A4 levels spiked after 4 h (Levy et al., 2001).

As expected, an increase in OCR and ECAR were observed upon LPS stimulation, however a dietary effect was not observed (Figure 4 A & B). Immune cells stimulated with LPS, should enhance the nuclear translocation of the transcription factor NFκB, thus activating genes for the generation of reactive oxygen (ROS) and nitrogen species (RNS). Excessive RNS and

ROS production can be deleterious (Martins de Lima et al., 2007). While an LPS effect on OCR and ECAR were observed up to 4.5 h post LPS stimulation, we further investigated if dietary long-chain n-6 PUFA had an effect on oxidative burst at later time points within a 24 h period.

As such, we evaluated the production of NO and cytoplasmic oxidation at 18 and 24 h post LPS stimulation. Despite the increase in OCR and ECAR, we observed a transient increase in NO production and cytoplasmic oxidation following LPS treatment after 18 h, however a dietary effect was not detected. By 24 h post LPS stimulation a decline in NO production from all

dietary treatments were observed. Both n-6 and n-3 PUFA supplementation have been reported to both enhance and suppress NO production in macrophages (Chaet et al., 1994; Babu et al.,

1997; Bonatto et al., 2004). In vitro studies with murine macrophages have demonstrated the same conflicting results. In J774 cells, lower concentrations of both ARA and EPA (5 μmol/L) increased NO production 48 h post LPS stimulation (2.5 μg/mL) compared to higher doses of

ARA and EPA (100 μmol/L) (de Lima et al., 2006). Contrary to these findings, RAW264 cells stimulated with 50-100 μmol/L EPA reduced NO production 24 h post LPS stimulation (0.15

μg/mL) compared to ARA stimulated cells (Ohata et al., 1997). In neutrophil-like cells (HL-60) increased oxidative burst activity was observed with both ARA and EPA treatment in a dose and time dependent manner (Healy et al., 2003). It is evident that ARA and EPA effects on the generation of ROS and RNS species can be dose and time dependent, but they can also be cell dependent. The mechanism behind these discrepancies requires further evaluation. Additional measures of oxidative stress merit further investigation. It remains to be determined if sow milk can be sufficiently enriched in LC n-6 PUFA to benefit the offspring. There is conflicting evidence on the potential benefits and side effects of LC n-3 PUFA supplementation in pigs

(Rossi et al., 2010; Tanghe and De Smet, 2013). Equally, increased LC n-6 PUFA supplementation could impact litter size, feed intake, growth rate and survivability. As such, further work to investigate the impact on overall health in pigs when fed increased LC n-6 PUFA is warranted.

Conclusions

Taken together, these data suggest that supplementing neonatal pig diet with LC n-6

PUFA, preformed ARA, can enrich 20:4n-6 content in PAM and lead to higher COX-2 mRNA

abundance, PGE2 production, and pro-inflammatory cytokine expression upon LPS stimulation.

Furthermore, macrophage activation with LPS increases ALOX12/15 mRNA and lowers ALOX5 abundance in LC n-6 enriched PAM signifying that within a 24 h period, the initial stages of a lipid-mediator class switching has ensued. Increased dietary long-chain n-6 PUFA could be an effective means for enhancing a stronger, well-balanced response to respiratory challenges in neonatal pigs. We recognize the inherent limitations of in situ studies, and further investigation is warranted to further assess the benefits of the dual nature of PGE2 signaling within the host.

Further work also is needed to examine long-term safety, clinical efficacy and economic viability.

Literature Cited

Anderson, M., and K. L. Fritsche. 2002. (N-3) fatty acids and infectious disease resistance. The Journal of Nutrition. 132(12): 3566-3576.

Babcock, T. A., A. Kurland, W. S. Helton, A. Rahman, K. N. Anwar, and N. J. Espat. 2003. Inhibition of activator protein-1 transcription factor activation by omega-3 fatty acid modulation of mitogen-activated protein kinase signaling kinases. JPEN J. Parenter. Enteral Nutr. 27(3): 176-80; discussion 181.

Babu, U. S., V. K. Bunning, P. Wiesenfeld, R. B. Raybourne, and M. O'Donnell. 1997. Effect of dietary flaxseed on fatty acid composition, superoxide, nitric oxide generation and antilisterial activity of peritoneal macrophages from female sprague-dawley rats. Life Sciences. 60(8): 545-554. doi: http://dx.doi.org/10.1016/S0024-3205(96)00638-8

Bae, J., C. J. Ricciardi, D. Esposito, S. Komarnytsky, P. Hu, B. J. Curry, P. L. Brown, Z. Gao, J. P. Biggerstaff, J. Chen, and L. Zhao. 2014. Activation of pattern recognition receptors in brown adipocytes induces inflammation and suppresses uncoupling protein 1 expression and mitochondrial respiration. Am. J. Physiol. Cell. Physiol. 306(10): C918-30. doi: 10.1152/ajpcell.00249.2013

Bagga, D., L. Wang, R. Farias-Eisner, J. A. Glaspy, and S. T. Reddy. 2003. Differential effects of prostaglandin derived from ω-6 and ω-3 polyunsaturated fatty acids on COX-2 expression and IL-6 secretion. Proceedings of the National Academy of Sciences. 100(4): 1751-1756. doi: 10.1073/pnas.0334211100

Bonatto, S. J. R., A. Folador, J. Aikawa, R. K. Yamazaki, N. Pizatto, H. H. P. Oliveira, R. Vecchi, R. Curi, P. C. Calder, and L. C. Fernandes. 2004. Lifelong exposure to dietary fish oil alters macrophage responses in walker 256 tumor-bearing rats. Cellular Immunology. 231(1): 56-62. doi: http://dx.doi.org/10.1016/j.cellimm.2004.12.001

Brezinski, M. E., and C. N. Serhan. 1990. Selective incorporation of (15S)- hydroxyeicosatetraenoic acid in phosphatidylinositol of human neutrophils: Agonist- induced deacylation and transformation of stored hydroxyeicosanoids. Proc. Natl. Acad. Sci. U. S. A. 87(16): 6248-6252.

Brockmeier, S., P. Halbur, and E. Thacker. 2002. Porcine Respiratory Disease Complex. Pages Chapter 13 in Polymicrobial Diseases. Brogden KA, and Guthmiller JM, eds. ASM Press, Washington (DC).

Calder, P. C. 2012. Long-chain fatty acids and inflammation. Proc. Nutr. Soc. 71(2): 284-289. doi: 10.1017/S0029665112000067

Calder, P. C. 2010. Omega-3 fatty acids and inflammatory processes. Nutrients. 2(3): 355-374. doi: 10.3390/nu2030355

Calder, P. C. 2013. Omega-3 polyunsaturated fatty acids and inflammatory processes: Nutrition or pharmacology? Br. J. Clin. Pharmacol. 75(3): 645-662. doi: 10.1111/j.1365- 2125.2012.04374.x

Calder, P. C. 2008. The relationship between the fatty acid composition of immune cells and their function. Prostaglandins, Leukotrienes and Essential Fatty Acids. 79(3–5): 101-108. doi: http://dx.doi.org/10.1016/j.plefa.2008.09.016

Calder, P. C. 2006. Polyunsaturated fatty acids and inflammation. Prostaglandins, Leukotrienes and Essential Fatty Acids. 75(3): 197-202. doi: http://dx.doi.org/10.1016/j.plefa.2006.05.012

Chaet, M. S., V. F. Garcia, G. Arya, and M. M. Ziegler. 1994. Dietary fish oil enhances macrophage production of nitric oxide. J. Surg. Res. 57(1): 65-68. doi: S0022- 4804(84)71111-5

Chang, C., L. Chang, Y. Chang, M. Chen, and T. Chiang. 2002. Antimicrobial susceptibility of actinobacillus pleuropneumoniae, escherichia coli, and salmonella choleraesuis recovered from taiwanese swine. Journal of Veterinary Diagnostic Investigation. 14(2): 153-157. doi: 10.1177/104063870201400210

Cinar, M. U., M. A. Islam, M. J. Uddin, E. Tholen, D. Tesfaye, C. Looft, and K. Schellander. 2012. Evaluation of suitable reference genes for gene expression studies in porcine alveolar macrophages in response to LPS and LTA. BMC Res. Notes. 5: 107-0500-5-107. doi: 10.1186/1756-0500-5-107 de Lima, T. M., L. de Sa Lima, C. Scavone, and R. Curi. 2006. Fatty acid control of nitric oxide production by macrophages. FEBS Lett. 580(13): 3287-3295. doi: 10.1016/j.febslet.2006.04.091

Esposito, D., A. Chen, M. H. Grace, S. Komarnytsky, and M. A. Lila. 2014. Inhibitory effects of wild blueberry anthocyanins and other flavonoids on biomarkers of acute and chronic inflammation in vitro. J. Agric. Food Chem. 62(29): 7022-7028. doi: 10.1021/jf4051599

Fritsche, K. 2006. Fatty acids as modulators of the immune response. Annu. Rev. Nutr. 26: 45- 73. doi: 10.1146/annurev.nutr.25.050304.092610

Fritsche, K. L., D. W. Alexander, N. A. Cassity, and S. Huang. 1993. Maternally-supplied fish oil alters piglet immune cell fatty acid profile and eicosanoid production. Lipids. 28(2): 677- 682.

Fritsche, K. L., L. M. Shahbazian, C. Feng, and J. N. Berg. 1997. Dietary fish oil reduces survival and impairs bacterial clearance in C3H/hen mice challenged with listeria monocytogenes. Clin. Sci. (Lond). 92(1): 95-101.

Ganter, M., and A. Hensel. 1997. Cellular variables in bronchoalveolar lavage fluids (BALF) in selected healthy pigs. Res. Vet. Sci. 63(3): 215-217.

Grace, M. H., D. Esposito, M. A. Timmers, J. Xiong, G. Yousef, S. Komarnytsky, and M. A. Lila. 2016. In vitro lipolytic, antioxidant and anti-inflammatory activities of roasted pistachio kernel and skin constituents. Food Funct. 7(10): 4285-4298. doi: 10.1039/c6fo00867d

Hadley, K. B., A. S. Ryan, S. Forsyth, S. Gautier, and N. Salem Jr. 2016. The essentiality of arachidonic acid in infant development. Nutrients. 8(4): 216. doi: 10.3390/nu8040216

Haesebrouck, F., F. Pasmans, K. Chiers, D. Maes, R. Ducatelle, and A. Decostere. 2004. Efficacy of vaccines against bacterial diseases in swine: What can we expect? Vet. Microbiol. 100(3–4): 255-268. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.vetmic.2004.03.002

Harmsen, A. G., J. R. Birmingham, R. L. Engen, and E. L. Jeska. 1979. A method for obtaining swine alveolar macrophages by segmental pulmonary lavage. J. Immunol. Methods. 27(2): 199-202. doi: 0022-1759(79)90265-5

Healy, D. A., R. W. G. Watson, and P. Newsholme. 2003. Polyunsaturated and monounsaturated fatty acids increase neutral lipid accumulation, caspase activation and apoptosis in a neutrophil-like, differentiated HL-60 cell line. Clin. Sci. 104(2): 171-179. doi: 10.1042/cs1040171

Hess, H. A., B. A. Corl, X. Lin, S. K. Jacobi, R. J. Harrell, A. T. Blikslager, and J. Odle. 2008. Enrichment of intestinal mucosal phospholipids with arachidonic and eicosapentaenoic acids fed to suckling piglets is dose and time dependent. J. Nutr. 138(11): 2164-2171. doi: 10.3945/jn.108.094136

Hwang, D. 1989. Essential fatty acids and immune response. Faseb J. 3(9): 2052-2061.

Jacobi, S. K., X. Lin, B. A. Corl, H. A. Hess, R. J. Harrell, and J. Odle. 2011. Dietary arachidonate differentially alters desaturase-elongase pathway flux and gene expression in liver and intestine of suckling pigs. J. Nutr. 141(4): 548-553. doi: 10.3945/jn.110.127118

Jacobi, S. K., A. J. Moeser, B. A. Corl, R. J. Harrell, A. T. Blikslager, and J. Odle. 2012. Dietary long-chain PUFA enhance acute repair of ischemia-injured intestine of suckling pigs. J. Nutr. 142(7): 1266-1271. doi: 10.3945/jn.111.150995

Kalinski, P. 2012. Regulation of immune responses by prostaglandin E2. The Journal of Immunology. 188(1): 21-28. doi: 10.4049/jimmunol.1101029

Kelley, D. S. 2001. Modulation of human immune and inflammatory responses by dietary fatty acids. Nutrition. 17(7): 669-673. doi: https://doi-org.prox.lib.ncsu.edu/10.1016/S0899- 9007(01)00576-7

Kelly, D., and A. G. P. Coutts. 2000. Early nutrition and the development of immune function in the neonate. Proc. Nutr. Soc. 59(2): 177-185. doi: 10.1017/S0029665100000197

Lauridsen, C., J. Stagsted, and S. K. Jensen. 2007. N − 6 and n − 3 fatty acids ratio and vitamin E in porcine maternal diet influence the antioxidant status and immune cell eicosanoid response in the progeny. Prostaglandins Other Lipid Mediat. 84(1–2): 66-78. doi: http://dx.doi.org/10.1016/j.prostaglandins.2007.04.003

Leslie, C. C. 2004. Regulation of the specific release of arachidonic acid by cytosolic phospholipase A2. Prostaglandins Leukot. Essent. Fatty Acids. 70(4): 373-376. doi: 10.1016/j.plefa.2003.12.012

Levy, B. D., and C. N. Serhan. 2014. Resolution of acute inflammation in the lung. Annu. Rev. Physiol. 76: 467-492. doi: 10.1146/annurev-physiol-021113-170408

Lin, X., J. Bo, S. A. M. Oliver, B. A. Corl, S. K. Jacobi, W. T. Oliver, R. J. Harrell, and J. Odle. 2011. Dietary conjugated linoleic acid alters long chain polyunsaturated fatty acid metabolism in brain and liver of neonatal pigs. J. Nutr. Biochem. 22(11): 1047-1054. doi: http://dx.doi.org/10.1016/j.jnutbio.2010.09.002

Lopez-Ubeda, R., F. A. Garcia-Vazquez, R. Romar, J. Gadea, M. Munoz, R. H. Hunter, and P. Coy. 2015. Oviductal transcriptome is modified after insemination during spontaneous ovulation in the sow. PLoS One. 10(6): e0130128. doi: 10.1371/journal.pone.0130128

Luostarinen, R., and T. Saldeen. 1996. Dietary fish oil decreases superoxide generation by human neutrophils: Relation to cyclooxygenase pathway and lysosomal enzyme release. Prostaglandins, Leukotrienes and Essential Fatty Acids. 55(3): 167-172. doi: http://dx.doi.org/10.1016/S0952-3278(96)90093-9

Martins de Lima, T., R. Gorjão, E. Hatanaka, M. Cury-Boaventura, E. Portioli Silva, J. Procopio, and R. Curi. 2007. Mechanisms by which fatty acids regulate leucocyte function. J. Clin Sci. 113(2): 65-77. doi: 10.1042/CS20070006

Matsui, M., Y. Chu, H. Zhang, K. T. Gagnon, S. Shaikh, S. Kuchimanchi, M. Manoharan, D. R. Corey, and B. A. Janowski. 2013. Promoter RNA links transcriptional regulation of inflammatory pathway genes. Nucleic Acids Res. 41(22): 10086-10109. doi: 10.1093/nar/gkt777

McMurray, D. N., D. L. Bonilla, and R. S. Chapkin. 2011. N−3 fatty acids uniquely affect antimicrobial resistance and immune cell plasma membrane organization. Chem. Phys. Lipids. 164(7): 626-635. doi: http://dx.doi.org/10.1016/j.chemphyslip.2011.07.003

Meade, C. J., and J. Mertin. 1978. Fatty acids and immunity. J. Adv. Lipid Res. 16: 127-165. doi: https://doi.org/10.1016/B978-0-12-024916-9.50008-1

Miles, E. A., and P. C. Calder. 1998. Modulation of immune function by dietary fatty acids. Proc. Nutr. Soc. 57(2): 277-292. doi: 10.1079/PNS19980042

Njoroge, S. W., M. Laposata, W. Katrangi, and A. C. Seegmiller. 2012. DHA and EPA reverse cystic fibrosis-related FA abnormalities by suppressing FA desaturase expression and activity. J. Lipid Res. 53(2): 257-265. doi: 10.1194/jlr.M018101

Novak, T. E., T. A. Babcock, D. H. Jho, W. S. Helton, and N. J. Espat. 2003. NF-κB inhibition by ω-3 fatty acids modulates LPS-stimulated macrophage TNF-α transcription. Am. J. Physiol. 284(1): L84-L89. doi: 10.1152/ajplung.00077.2002

Odle, J., X. Lin, S. K. Jacobi, S. W. Kim, and C. H. Stahl. 2014. The suckling piglet as an agrimedical model for the study of pediatric nutrition and metabolism. Annu. Rev. Anim. Biosci. 2(1): 419-444. doi: 10.1146/annurev-animal-022513-114158 https://doi.org/10.1146/annurev-animal-022513-114158

Ohata, T., K. Fukuda, M. Takahashi, T. Sugimura, and K. Wakabayashi. 1997. Suppression of nitric oxide production in lipopolysaccharide-stimulated macrophage cells by ω3 polyunsaturated fatty acids. Jap. J. Cancer Res. 88(3): 234-237. doi: 10.1111/j.1349- 7006.1997.tb00372.x

Oliveros, L. B., A. M. Videla, and M. S. Gimenez. 2004. Effect of dietary fat saturation on lipid metabolism, arachidonic acid turnover and peritoneal macrophage oxidative stress in mice. Braz. J. Med. Biol. Res. 37(3): 311-320. doi: S0100-879X2004000300004

Puertollano, M. A., E. Puertollano, A. Ruiz-Bravo, M. Jimenez-Valera, M. A. De Pablo, and G. A. De Cienfuegos. 2004. Changes in the immune functions and susceptibility to listeria monocytogenes infection in mice fed dietary lipids. Immunol. Cell Biol. 82(4): 370-376. doi: 10.1111/j.0818-9641.2004.01262.x

Raphael, W., and L. M. Sordillo. 2013. Dietary polyunsaturated fatty acids and inflammation: The role of phospholipid biosynthesis. Int. J. Mol. Sci. 14(10): 21167-21188. doi: 10.3390/ijms141021167

Rocha, D. M., J. Bressan, and H. H. Hermsdorff. 2017. The role of dietary fatty acid intake in inflammatory gene expression: A critical review. Sao Paulo Med. J. 135(2): 157-168. doi: S1516-31802017000200157

Rossi, R., G. Pastorelli, S. Cannata, and C. Corino. 2010. Recent advances in the use of fatty acids as supplements in pig diets: A review. Animal Feed Science and Technology. 162(1): 1-11. doi: https://doi-org.prox.lib.ncsu.edu/10.1016/j.anifeedsci.2010.08.013

Schindler, R., J. Mancilla, S. Endres, R. Ghorbani, S. C. Clark, and C. A. Dinarello. 1990. Correlations and interactions in the production of interleukin-6 (IL-6), IL-1, and tumor necrosis factor (TNF) in human blood mononuclear cells: IL-6 suppresses IL-1 and TNF. Blood. 75(1): 40-47.

Serhan, C. N., N. Chiang, and T. E. Van Dyke. 2008. Resolving inflammation: Dual anti- inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol. 8(5): 349-361. doi: 10.1038/nri2294

Sijben, J. W., and P. C. Calder. 2007. Differential immunomodulation with long-chain n-3 PUFA in health and chronic disease. Proc. Nutr. Soc. 66(2): 237-259. doi: S0029665107005472

Sobolewski, C., C. Cerella, M. Dicato, L. Ghibelli, and M. Diederich. 2010. The role of cyclooxygenase-2 in cell proliferation and cell death in human malignancies. Int. J. Cell. Biol. 2010: 215158. doi: 10.1155/2010/215158

Sreeramkumar, V., M. Fresno, and N. Cuesta. 2012. Prostaglandin E2 and T cells: Friends or foes? Immunol. Cell Biol. 90(6): 579-586. doi: 10.1038/icb.2011.75

Suradhat, S., and R. Thanawongnuwech. 2003. Upregulation of interleukin-10 gene expression in the leukocytes of pigs infected with porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 84(Pt 10): 2755-2760. doi: 10.1099/vir.0.19230-0

Tanghe, S., and S. De Smet. 2013. Does sow reproduction and piglet performance benefit from the addition of n-3 polyunsaturated fatty acids to the maternal diet? The Veterinary Journal. 197(3): 560-569. doi: https://doi-org.prox.lib.ncsu.edu/10.1016/j.tvjl.2013.03.051

Verlengia, R., R. Gorjao, C. C. Kanunfre, S. Bordin, T. M. de Lima, E. F. Martins, P. Newsholme, and R. Curi. 2004. Effects of EPA and DHA on proliferation, cytokine production, and gene expression in raji cells. Lipids. 39(9): 857-864.

Wang, Y., H. Sunwoo, G. Cherian, and J. S. Sim. 2000. Fatty acid determination in chicken egg yolk: A comparison of different methods. Poultry Science. 79(8): 1168-1171. doi: 10.1093/ps/79.8.1168

Table 1. Composition of milk replacer diet fed to piglets.

Ingredient, g/kg CON LC n-6 LC n-3

Whey 444.6 444.6 444.6

Edible Lard 44.0 44.0 44.0

Whey Protein Concentrate 101.4 101.4 101.4

Delactosed Whey 51.4 51.4 51.4

Na Casienate 112.5 112.5 112.5

Dicalcium Phosphate 22.1 22.1 22.1

Other* 24.1 24.1 24.1

Fat Blend Supplement

ARASCO1 3.0 14.8 0.0

DHASCO1 1.8 1.8 0.0

Coconut (Hydrogenated) 54.3 54.3 54.3

Soy Oil 65.5 64.2 65.0

Sunflower, high oleic 65.3 54.8 55.8

EPA MegOil1 0.0 0.0 14.8

Tween80 10.0 10.0 10.0

TBHQ 0.1 0.1 0.1

Total 1000.0 1000.0 1000.0

Calculated Composition

Energy, kcal/g 5.2 5.2 5.2

Crude Protein, % 25.0 25.0 25.0

Crude Fat, % 26.0 26.0 26.0

Lactose, % 34.5 34.5 34.5

1Courtesy of DSM Nutritional Products. *Other, g/kg diet: mineral premix, 6.3; D/L methionine, 6.2; potassium sorbate, 5.6; L-lysine HCl, 4.5; calcium chloride, 4.1; vitamin premix, 1.4; flavor additive, 0.6; emulsifier, 0.6; flow agent, 0.5; tetrasodium pyrophosphate, 0.3; antioxidant 0.01; Milk Specialties, Eden Prairie, MN 55344.

Table 2. Analyzed fatty acid composition of milk replacer fed to piglets. 1

Diet CON LC n-6 LC n-3

g/100g, fatty acid1

Fatty acid 6:0 0.01 0.03 0.02 8:0 0.45 0.52 0.89 10:0 1.24 1.42 1.63 12:0 10.91 12.03 13.67 14:0 5.36 5.54 5.68 15:0 0.09 0.06 0.07 16:0 13.78 14.25 11.83 16:1 0.20 0.06 0.09 17:1 0.00 0.00 0.10 18:0 4.52 7.08 6.26 18:1 37.76 33.92 32.70 18:2 (n-6) 20.55 19.00 19.44 18:3 (n-6) 0.25 0.20 0.07 18:3 (n-3) 3.01 2.54 2.83 20:0 0.24 0.17 0.19 20:1 0.17 0.23 0.31 20:2 0.14 0.12 0.10 20:4 (n-6) 0.53 2.22 0.20 20:3 (n-3) 0.08 0.15 0.04 20:5 (n-3) 0.00 0.00 3.03 22:0 0.22 0.20 0.29 22:6 (n-3) 0.21 0.18 0.00 24:0 0.08 0.08 0.41 Total 100 100 100 SFA 37.10 41.55 40.80 MUFA 38.12 34.21 33.21 PUFA 24.78 24.42 26.13 n-3 FA 3.30 2.87 6.31 n-6 FA 21.48 21.54 19.82 n-3 : n-6 0.15 0.13 0.32 1Data are expressed as weight % of total identified fatty acids. These fats represented 26% of the milk replacer dry matter as described in table 1. MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid.

Table 3. Staining reagents used in flow cytometry of immune cells isolated from lungs of milk replacer-fed pigs.

Labeling Primary Antibody 2nd Antibody Antigen Clone Isotype Fluorochrome strategy source source

Immunotyping of myeloid cells Directly CD14 TüK4 IgG2a FITC conjugated ThermoFisher --- Directly CD163 2A10/11 IgG1 PE conjugated ThermoFisher --- 74-22- Secondary Southern CD172A 15A IgG2b Alexa 647 antibody BEI Resources Biotech

Immunotyping of lymphocytes Secondary Southern CD3 PPT3 IgG1 Alexa 488 antibody* BIO RAD Biotech Secondary Southern CD8α 76-2-11 IgG2a Alexa 647 antibody BEI Resources Biotech BB6- Streptavidin- Southern CD21a 11C9.6 IgG1 PE-Cy5.5 biotin Novus Biologicals Biotech *Free binding sites of secondary antibody were blocked by ChromePure Mouse IgG (Jackson Immuno Research, West Grove, PA) prior to anti-CD21a staining.

Table 4. Sense and anti-sense primer sequences (5’-3’) used in qRT-PCR analysis.

Target Gene Bank accession Amplicon Primer sequence Size (bp) F: TTCAAGGCTCCCATTCGACC

RPL4 XM_005659862.3 110 R: GCACTGGTTTGATGACCTGC

F: GGGTTGACAAATGGTGGGGA

RPL9 XM_013978597.2 106 R: TTGTAACGGAAGCCCAGTGT

F: TTGCGAACGGAACCATAAGGA

SDHA XM_021076931.1 106 R: CAGCCTTCCTGTAACACGCT

F: AAGAAGGGGATTGTGGATCAGTC

YWHAZ XM_001927228.7 105 R: AAGGGCCAGACCCAATCTGA

F: CGTGCAGGTGGTTCCTAACA

TLR-4 NM_001113039.2 112 R: CAGGTAGTTAAAGCTCAGGTCCA

F: ACACGGCACACGACTACATC

COX-1 XM_001926129.6 116 R: CTTCTTCCCTTTGGTCCCCAT

F: ATGGGTGTGAAAGGGAGGAAAG

COX-2 NM_214321.1 90 R: CTGGGGATCAGGGATGAACTT

F: ATGCCAAATGCCACAGGGAT

5-LOX XM_021072736.1 103 R: ATGAACAGGTTCTCCATCGCTT

F: CAGGCTTGGTGTCGAGAGTT

12/15-LOX1 NM_213931 97 R: AGTGGCAGAGCTGTTCCTTG

F: CCCCAGAAGGAAGAGTTTCCA

TNF-α NM_214022.1 94 R: CGACGGGCTTATCTGAGGTTT

F: GACCCTGAGGCAAAAGGGAA

IL-6 NM_001252429.1 101 R: TCCACTCGTTCTGTGACTGC

F: GACGTAATGCCGAAGGCAGA NM_214041.1 IL-102 101 R: AGGGCAGAAATTGATGACAGCG 1(Lopez-Ubeda et al., 2015) 2(Suradhat and Thanawongnuwech, 2003)

Table 5. Serum metabolite and enzyme concentrations and whole-blood cell from milk replacer-fed pigs.1,2

Diet CON LC n-6 LC n-3 SEM P-value Blood Chemistry Panel Total protein, g/dL 5.25 4.7 5 0.3 0.45 Albumin, g/dL 2.75a 2.63a 3.03b 0.05 0.002 Globulin, g/dL 2.5 2.08 1.98 0.28 0.40 Albumin/Globulin Ratio 1.2 1.3 1.56 0.16 0.29 Aspartate Transaminase, U/L 24.25 20.25 32 6.68 0.48 Alanine Transaminase, U/L 27.75 21.75 23 3.85 0.53 Alkaline Phosphatase, U/L 636 750 702 69.32 0.53 Gama-Glutamyl Transpeptidase, U/L 37.75 31.75 24.25 8.47 0.55 Total Bilirubin, mg/dL 0.1 0.1 0.13 0.01 0.41 Urea Nitrogen, mg/dL 3a 2.25b 2bc 0.14 0.002 Creatinine, mg/dL 0.73 0.73 0.7 0.06 0.95 Blood Urea Nitrogen/Creatinine Ratio 4.25 3 3 0.36 0.06 Phosphorus, mg/dL 11.7 11.45 11.5 0.31 0.83 Glucose, mg/dL 137 156 137 7.37 0.18 Calcium, mg/dL 12.55 12.38 12.33 0.16 0.59 Magnesium, mEq/L 2.2 2.2 2.13 0.12 0.88 Sodium, mEq/L 139 136 137 1.08 0.29 Potassium, mEq/L 7.125 7.5 7.33 0.45 0.84 Sodium/Potassium Ratio 19.75 18 19 1.32 0.66 Chloride, mEq/L 101 101 101 0.91 0.93 Cholesterol, mg/dL 107a 105a 87.25b 5.21 0.05 Triglycerides, mg/dL 148 114 88.75 20.78 0.18 Amylase, U/L 1781 1648.25 5030 1889 0.40 Creatine Phosphokinase, U/L 515 366 333 96.32 0.40

Complete Blood Count White Blood Cells, 103/μL 11.75 9.4 8.43 1.43 0.29 Red Blood Cells, 106/μL 5.55 5.6 6.15 0.18 0.08 Hemoglobin, g/dL 10.1 9.95 10.8 0.34 0.22 Hematocrit, % 36.5 33.75 36.25 1.23 0.27 Mean Corpuscular Volume, fL 66.25a 60.25b 59bc 1.63 0.03 Mean Corpuscular Hemoglobin, pg 18.25 17.78 17.58 0.45 0.57 Mean Corpuscular Hemoglobin 27.65 29.63 29.75 0.74 0.14 Concentration, g/dL Platelet Count, 103/μL 578 486.25 360.25 124.27 0.49 Neutrophils, % 34.75 37.5 39.35 6.02 0.87 Bands, μL 0 0 0 0 - Lymphocytes, % 58.5 52.5 52.5 5.48 0.68 Monocytes, % 5.50 5.75 5.00 0.91 0.84 Eosinophils, % 1.25 4.25 3.25 1.65 0.46 Basophils, % 0 0 0 0 - 1 Diets contained 0.5% ARA (CON), 2.2% ARA (LC n-6) or 3.0% EPA (LC n-3) of total fatty acids. 2Values are least-square means and SEM, n = 4. a,b,cMeans within a row lacking a common letter differ (P < 0.05).

Table 6. Fatty acid composition of lung parenchymal tissue and porcine alveolar macrophages (PAM).1-2

Tissue Lung PAM Diet CON LC n-6 LC n-3 P - Value CON LC n-6 LC n-3 P - Value

Fatty acid, g/100g FA

14:0 1.62 ± 0.44 1.81 ± 0.38 2.04 ± 0.24 0.68 1.66 ± 0.19 1.53 ± 0.22 1.93 ± 0.22 0.45 16:0 31.38 ± 1.20 33.13 ± 1.04 33.45 ± 0.66 0.33 38.48 ± 3.31 33.62 ± 3.82 32.71 ± 3.82 0.47 16:1 0.66 ± 0.04 a 0.50 ± 0.04 b 0.50 ± 0.02 b 0.01 0.82 ± 0.13 0.46 ± 0.15 0.74 ± 0.15 0.22 18:0 20.56 ± 1.29 19.01 ±1.12 20.23 ±0.71 0.59 24.31 ± 1.65 25.44 ± 1.90 21.38 ± 1.90 0.32 18:1 22.94 ± 1.02 21.85 ± 0.88 22.82 ± 0.56 0.61 14.43 ± 1.18 13.02 ± 1.34 17.71 ± 1.34 0.06 18:2 10.06 ± 0.54 a 8.21 ± 0.47 b 10.83 ± 0.30 a 0.0002 5.76 ± 0.73xy 5.22 ± 0.84x 8.11 ± 0.84y 0.06 18:3 (n-6) 0.12 ± 0.03 a 0.02 ± 0.03 b 0.00 ± 0.02 b 0.01 1.25 ± 0.19 1.48 ± 0.22 1.23 ± 0.22 0.67 18:3 (n-3) 0.22 ± 0.07 0.17 ± 0.06 0.16 ± 0.04 0.76 0.03 ± 0.04x 0.00 ± 0.04x 0.17 ± 0.04y 0.02 20:0 0.40 ± 0.09 0.45 ± 0.07 0.45 ± 0.05 0.86 0.58 ± 0.08 0.38 ± 0.09 0.55 ± 0.09 0.27 20:1 0.43 ± 0.05 a 0.28 ± 0.04 b 0.30 ± 0.03 b 0.03 0.47 ± .09 0.23 ± 0.10 0.47 ± 0.10 0.16 20:2 0.7 ± 0.053a 0.56 ± 0.04 b 0.50 ±0.03 b 0.001 0.73 ± 0.12 0.58 ± 0.14 0.34 ± 0.14 0.15 20:4 (n-6) 8.26 ± 0.60 a 11.55 ± 0.52 b 4.56 ± 0.33 c < 0.0001 7.66 ± 1.40x 14.22 ± 1.62y 6.27 ± 1.62x 0.01 20:3 (n-3) 0.62 ± 0.08 0.43 ± 0.07 0.60 ± 0.04 0.10 0.70 ± 0.11 0.67 ± 0.12 0.57 ± 0.12 0.74 20:5 (n-3) 0.00 ± 0.15a 0.00 ± 0.13a 1.53 ± 0.08b < 0.0001 0.02 ± 0.28x 0.00 ± 0.33 x 3.44 ± 0.33y < 0.0001 22:0 0.68 ± 0.19 0.69 ± 0.16 0.85 ± 0.10 0.60 1.90 ± 0.18 1.81 ± 0.21 1.88 ± 0.20 0.95 22:1 0.60 ± 0.22 0.73 ± 0.19 0.56 ± 0.12 0.74 0.02 ± 0.05x 0.00 ± 0.06x 0.23 ± 0.06y 0.03 22:6 (n-3) 0.63 ± 0.11 0.63 ± 0.10 0.62 ± 0.06 0.99 1.19 ± 0.26x 1.34 ± 0.30x 2.27 ± 0.30y 0.04 Total 100 100 100 100 100 100 MUFA 24.63 ± 1.11 23.36 ± 0.96 24.18 ± 0.61 0.67 15.73 ± 1.32 13.72 ± 1.50 19.15 ± 1.50 0.06 PUFA 20.65 ± 1.17 21.57 ± 1.02 18.80 ± 0.64 0.07 17.34 ± 2.23 23.50 ± 2.76 22.41 ± 2.76 0.21 n-3 FA 1.47 ± 0.31a 1.23 ± 0.27a 2.91 ± 0.17b < 0.0001 1.94 ± 0.63x 2.01 ± 0.57x 6.45 ± 0.57y < 0.0001 n-6 FA 19.18 ± 0.94a 20.34 ± 0.82a 15.89 ± 0.52b <0.0001 15.40 ± 2.02 21.48 ± 2.30 15.96 ± 2.30 0.13 n-3: n-6 0.08 ± 0.01a 0.06 ± 0.02a 0.18 ± 0.01b <0.0001 0.13 ± 0.01x 0.09 ± 0.02x 0.40 ± 0.02y < 0.0001

1 Values are least square means ± SEM. FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid. 2 Values represent weight % of total fatty acids. a,b,c; x,y,z Means within a row lacking a common letter differ (P < 0.05).

Figure 1: Validation of PAM isolation procedure. The phenotype and survival of cells isolated by alveolar lavage was analyzed via flow cytometry. A) Left: FSC/SSC characteristics were used to distinguish dead cells, PAM cells and lymphocytes. Right: Percentage of cells in the different FSC/SSC gates. In order to exclude debris from the analysis, 100% represents the sum of frequencies in all three gates (Dead cells + PAMs + Lymphocytes). B) Within the PAM FSC/SSC gate, all cells exhibited the characteristic CD14lowCD163+CD172A+ expression pattern of PAM. Grey dashed lines represent isotype controls, red solid lines represent staining of cells isolated from six animals. C) T cells, B cells and NK cells were distinguished via CD3, CD21a, and CD8α expression analysis within the Lymphocytes gate. On average 18.3% were T cells, 34.3% B cells and 1.8% NK cells.

Figure 2. Dietary LC n-6 PUFA increases COX-2 mRNA abundance and eicosanoid production in porcine alveolar macrophages. Relative expression level of (a) COX-2 mRNA and (b) PGE2production in alveolar macrophages isolated from piglets fed milk replacer with varying fatty acid composition. Measurements were made after 24 h of culture in absence (Basal) or presence of LPS. RNA values are mean fold changes relative to basal CON alveolar macrophages. Fatty acid effect, LPS effect and fatty acid-LPS interaction were evaluated. Values are represented as least square means ± SEM, (a) n = 12; (b) n = 20. Bars lacking a common letter differ.

Figure 3. Dietary LC n-6 modifies lipoxygenase and cytokine mRNA abundance associated with a pro-inflammatory response in porcine alveolar macrophages. Relative mRNA abundance of (A) ALOX-5, (B) TNF-α, and (C) IL-6 in alveolar macrophages from piglets fed milk replacer with varying fatty acid composition. Measurements were made after 24 h of culture in absence (Basal) or presence of LPS. Values are mean fold changes relative to basal CON alveolar macrophages. Fatty acid effect, LPS effect and fatty acid-LPS interaction were assessed. Values are represented as least square means ± SEM, n = 12. Bars lacking a common letter differ.

Figure 4. Long chain n-6 supplementation initiates initial stages of lipid-mediator class switching in porcine alveolar macrophages. Relative mRNA abundance of (A) ALOX-12/15 and (B) IL-10 in alveolar macrophages from piglets fed milk replacer with varying fatty acid composition. Measurements were made after 24 h of culture in absence (Basal) or presence of LPS. Values are mean fold changes relative to basal CON alveolar macrophages. Fatty acid effect, LPS effect and fatty acid-LPS interaction were assessed. Values represented as least square means ± SEM, n = 12. Bars lacking a common letter differ.

Figure 5. LPS stimulation in porcine alveolar macrophages alters oxidative burst and cellular stress regardless of long chain PUFA enrichment. Representative trace of oxidative burst by measurements of (A) OCR, (B) ECAR and cellular stress by measurement of (C) NO and (D) cytoplasmic oxidation in PAM isolated from piglets fed milk replacer with varying fatty acid composition. Measurements were made during culture in absence (Basal) or presence of LPS at varying time points over the course of 24 h. Fatty acid effect, LPS effect and fatty acid- LPS interaction were assessed. Values are least square means ± SEM, n = 5. ECAR, extracellular acidification rate; NO, nitric oxide; OCR, oxygen consumption rate.

Chapter III

Immunosuppressive effects of porcine reproductive and respiratory syndrome virus are

dampened in porcine alveolar macrophages from arachidonate-fed piglets

Abstract

Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) is one the most prevalent viruses economically impacting the swine industry. Currently, vaccination is standard practice although it provides limited protection. Additional use of therapeutic agents to decrease the severity and spread of PRRSV is lacking. Dietary long-chain polyunsaturated fatty acids

(LC-PUFA), arachidonic acid (ARA; n-6) and eicosapentaenoic acid (EPA; n-3), have immunomodulatory effects. Arachidonic acid exhibits increased synthesis of potent eicosanoids which leads to enhanced antiviral inflammatory cytokine production. In this study, LC n-6 and n-

3 enriched porcine alveolar macrophages (PAM) from dietary long-chain PUFA supplementation were infected with PRRSV (MOI of 0.5) and studied up to 48 hours post infection (hpi) to evaluate if PUFA enrichment could reverse the immunosuppressive effects that PRRSV elicits on antiviral and pro-inflammatory cytokine transcription. By 12hpi, mRNA abundance of INF-α increased 73% in LC n-6 PAM, while viral nucleocapsid transcripts (N) was 67% lower compared to LC n-3 PAM (P < 0.0001). By 24hpi, N mRNA abundance was 66% lower in LC n-

6 and n-3 PAM compared to CON. At 6hpi, abundance of ALOX5 and IL-6 were 2.5-fold higher, and TNF- α was 2-fold higher in LC n-6 PAM compared to CON (P < 0.0001). Abundance of

TNF- α declined at 12hpi and maintained low levels throughout the remaining 48hpi in LC n-6 and LC n-3 PAM. Abundance of IL-6 decreased 31% in LC n-6 PAM between 12 and 24hpi. A transient increase in IL-10 was observed 6hpi in LC n-6 PAM, after which abundance diminished

85%. These results suggest dietary LC n-6 PUFA can dampen some of the immunosuppressive effects of PRRSV by enhancing antiviral and pro-inflammatory responses, thus decreasing viral replication within 24hpi in PRRSV-infected PAM.

Introduction

Porcine Reproductive and Respiratory syndrome virus (PRRSV) is one of the most prevalent viruses impacting the swine industry, costing the United States over 664 million dollars annually in losses (Holtkamp et al., 2013). In preweaning (neonatal) and nursery pigs, 33-46.6% of disease cases reported are PRRSV related (USDA, 2015b). Infection with PRRSV causes immune dysregulation in the pig leading to suppressed innate and adaptive immune responses, allowing for enhanced viral replication and establishment of a persistent infection (Chand et al.,

2012; García-Nicolás et al., 2014). The high mutation rate of this virus has led to two genotypes, the European (Type I) and the North American (Type II) strains which have varying levels of pathogenicity. Currently, modified-live attenuated vaccination is the most prevalent method for

PRRSV control; however high genomic variability poses constant challenges in developing effective vaccines against all viral strains (Renukaradhya et al., 2015). Additionally, colostrum antibodies from vaccinated sows decline as early as 3 weeks in neonates (Halbur, 2016).

Continuous research on additional effective means to control PRRSV infection is vital to decreasing the severity and economic impact it has on the swine industry.

Dietary long-chain polyunsaturated fatty acids (PUFA), such as arachidonic acid (ARA) and eicosapentaenoic acid (EPA), have immunomodulatory effects which aid in controlling the intensity and duration of immune responses to infection (Calder and Grimble, 2002).

Arachidonic acid is metabolized by lipoxygenase-5 (5-LOX) for pro-inflammatory and antiviral cytokine production; as well as be metabolized by cyclooxygenase-2 (COX-2) for prostaglandin

E2 (PGE2) synthesis. Prostaglandin E2 promotes pro-inflammatory and antiviral signaling at the onset of an acute challenge. In a negative feed-back loop, PGE2 hinders its initial response to promote anti-inflammatory and pro-resolving cascades (Botham and Mayes, 2009). Calder,

Fritsche, and Serhan have extensively reviewed the immunomodulatory roles of ARA and EPA

(Calder, 2006c; Calder, 2012; Serhan et al., 2014). Initiating a well-controlled acute inflammatory and antiviral response is vital for the control and elimination of viruses; thus, it is a main target of PRRSV as virus survival is contingent on immune dysregulation (Butler et al.,

2014). Enhancing host immune response could strengthen defense against PRRSV and provide another management tool to reduce the deleterious effects of the virus on swine heard health.

There are a few studies geared toward novel approaches involving the use of dietary agents as alternative methods or used in conjunction with vaccines to reduce the severity of

PRRSV. Dietary bioactive compounds from plants extracts; polyphenols (Yang et al., 2013;

Zhang et al., 2018b) and plant root extracts (Sun et al., 2012a; Duan et al., 2015; Zhang et al.,

2018a) have elicited antiviral activities against PRRSV. Synthetic drug compounds have also demonstrated to have antiviral capabilities towards PRSSV (Opriessnig et al., 2011; Wang et al.,

2014). Alternatively, conjugated linoleic acid did not improve antiviral response to PRRSV

(Pinelli-Saavedra et al., 2015). Linoleic acid is a pre-cursor for ARA synthesis, however conversion rate is low (Cunnane et al., 1984) and the use of pre-formed ARA could have beneficial effects against PRRSV, as supplementation with its antagonist EPA and DHA have demonstrated immunosuppressive effects against other viruses (Bassaganya-Riera et al., 2007;

Schwerbrock et al., 2009).

Few studies focus on the potential benefits resulting from the ability of PGE2 to initiate both pro-inflammatory, antiviral and resolving signals during infection, particularly in swine

(Serhan et al., 2008). Porcine Reproductive and Respiratory Syndrome virus displays immunosuppressive effects by high-jacking alveolar macrophage (PAM) function and inhibiting type I interferon production, upregulating anti-inflammatory cytokine production, and

downregulating pro-inflammatory cytokine production (Huang et al., 2015). Secretion of both pro-inflammatory and antiviral cytokines are necessary for eliminating the virus and reducing further infection and damage. While pro-inflammatory cytokines can cause collateral damage or lung tissue pathology (Bruder et al., 2006), it is essential for viral clearance (Schwerbrock et al.,

2009). The dual nature of PGE2 from the metabolism of ARA offers the possibility for decreased collateral damage and a more balanced innate immune response. Therefore, the aim of this study was to determine if supplemental ARA in milk-replacer-fed pigs could improve the innate immune response of PAM when challenged with PRRSV in situ. Given the duality of

PGE2 signaling of both pro- and anti-inflammatory mechanisms, we hypothesized that a heightened but balanced antiviral response would dampen some of PRRSV’s immunosuppressive effects in alveolar macrophages. In the present study, long-chain PUFA enrichment in PAM from dietary ARA increased antiviral response to PRRSV and decreased viral replication. This may provide an alternate therapeutic agent to dampen the deleterious effects of PRRSV infection.

Materials and Methods

Piglets and experimental dietary treatments

Animal protocols for this trial were approved by North Carolina State University’s

Institutional Animal Care and Use Committee. Animals were managed as previously described

(Hess et al., 2008; Jacobi et al., 2012). Design of feeding trial is described in detail by Walter et al. (Walter et al., 2019). In brief, 24h after birth colostrum-fed piglets (n = 60) were obtained.

Piglets were randomly allocated to a milk replacer diet (n = 20/treatment) supplemented with

0.5% ARA of total fatty acids (control, (CON)), 2.2% ARA of total fatty acids (LC n-6) or 3.0%

EPA of total fatty acids (LC n-3) of total fatty acids for 21days (d). After 21d of feeding, all pigs were placed under isoflurane anesthesia and humanely euthanized by exsanguination.

Cells and virus

A composite of PAM from 6 pigs of each dietary treatment group were cultured using

RPMI 1640 media plus L-glutamine. Culture media was supplemented with penicillin

(100U/mL), streptomycin (100µg/mL), fungizone (4µg/mL), gentamycin (50µg/mL), and 10% heat inactivated-fetal bovine serum (FBS). Alveolar macrophages were previously characterized and fatty acid enrichment from diets were determined (Walter et al., 2019). Briefly, long-chain

PUFA composition of cells increased with the corresponding diet that the pigs received.

Macrophages from LC n-6 fed pigs had a 2-fold enrichment in ARA concentration, and PAM from pigs receiving the LC n-3 diet had a 1.5-fold increase in EPA and a 2-fold increase in DHA.

Macrophages were seeded on a 6-well plate at a density of 3 × 106 cells/mL in triplicate.

Cells were infected with the PRRSV strain VR-2332 (ATCC) at a multiplicity of infection (MOI) of 0.5 and maintained at 4°C for 4h to allow for synchronization. An additional 2mL of warmed culture media was added to each well. Cells were maintained at a 37°C humidified incubator with 5% CO2 for 6, 12, 24 and 48 hours post infection (hpi).

RNA extraction and quantitative real-time PCR

Alveolar macrophages were collected in TRIzol Reagent (Ambion) following manufacturer’s instructions. Total RNA was purified according to manufacturer’s instructions with the exception that RNA precipitation occurred overnight at -80°C. Complementary DNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions. Primers for pig housekeeping genes ribosomal proteins

L4 (RPL4) and L9 (RPL9), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation

protein zeta polypeptide (YWHAZ), and succinate dehydrogenase complex subunit A (SDHA)

(Cinar et al., 2012), as well as genes of interest COX-2, lipoxygenase 5 (ALOX5) and 12/15

(ALOX12/15), tumor necrosis factor alpha (TNF-α), interferon alpha (INF-α), interleukin 10 (IL-

10) and 6 (IL-6), and PRRSV nucleocapsid (N) were designed using primer-BLAST from the

National Center for Biotechnology Information (NCBI) database (Table 1). Primers were designed to span exon-exon junctions. The absences of dimers and existence of gene-specific peaks for all primers were confirmed by melt curve analysis. Measurement of mRNA abundance was performed by qRT-PCR. Genes of interest were normalized to the geometric mean of the 4 housekeeping genes and the 2-ΔΔCt method was used to determine mRNA abundance as previously described (Jacobi et al., 2011; Cinar et al., 2012; Esposito et al., 2014). Samples were run in duplicate with relative mRNA expression normalized to CON at each time point.

Eicosanoid Production

Tissue culture media from all cultured PAM were collected at time of RNA isolation.

Media from triplicate wells were pooled and used to determine the concentration of PGE2 and

TNF-α at 6, 12, and 24hpi as determined by relative mRNA abundance of COX-2. A competitive

ELISA kit specific for porcine PGE2 (Pierce) was utilized following manufacturer’s instructions.

All samples were assayed in duplicate. Quantification was determined using a BioTek Synergy

H1 Multi-mode microplate reader (BioTek Instruments). qRT-PCR array profiling

Based on relative mRNA expression data for INF-α and PRRSV N protein, swine specific

PCR arrays were used to further evaluate the dietary effects of these major pathways in PAM following PRRSV infection. Profiling of 84 genes related to an antiviral response were performed using the RT2 Profiler PCR Array Pig Antiviral Response (PASS-122Z Qiagen)

following manufacturer’s protocol. cDNA samples from all dietary groups were used from 12hpi and 24hpi. qRT-PCRs were performed per manufacturer’s instructions with relative mRNA abundance levels normalized to the geometric mean of 5 housekeeping genes (beta-actin, beta-2- microglobulin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1, and ribosomal protein L13a (RPL13a)). All arrays were compared to CON for each time point. Identification of possible co-regulated genes from all treatments are depicted in a cluster gram, generated by RT2 Profiler PCR Array Web-based Data Analysis

Portal (Qiagen).

Statistical Analysis

Results for gene expression, eicosanoid and cytokine production were analyzed by a two- way ANOVA for a 3 × 2 factorial design (diets +/- PRRSV) for each time point using GraphPad

Prism 8. Post hoc analysis was conducted using a Tukey multiple comparison test. Data are reported as mean ± SEM. Statistical significance between groups was declared when P < 0.05.

Trends were noted when 0.05 < P < 0.1.

Results

Long-chain n-6 enrichment of PAM alters COX-2 expression and PGE2 production following

PRRSV infection

To determine whether long-chain PUFA enrichment altered COX-2 expression and PGE2 secretion in PRRSV infected PAM, relative mRNA abundance of COX-2 was evaluated over the course of 48hpi. The relative mRNA abundance of COX-2 increased almost 20-fold in LC n-6

PAM compared to CON 6hpi, although no detectable difference between LC-6 and LC-3 enriched PAM were observed. By 12hpi, the abundance of COX-2 decreased by 81% in LC n-6

PAM and 75% in long-chain n-3 PAM. However, relative mRNA abundance was 3-fold higher

in LC n-6 PAM compared to CON (Figure 1A; P < 0.0001). Throughout the remaining 48 hours, no detectable difference in COX-2 mRNA abundance was observed between dietary treatment groups. The apparent difference in COX-2 abundance at 6hpi between CON and other treatment groups, then the steady decline and plateau throughout the remaining time course, warranted the investigation of PGE2 concentration over the first 24hpi. Consistent with an increase in COX-2 mRNA abundance, concentration of PGE2 increased following PRRSV infection. Although no detectable differences were observed between LC n-6 and LC n-3 PAM for COX-2 mRNA abundance, differences in PGE2 production were observed between all dietary treatment groups.

Between 6 and 12hpi, the concentration of PGE2 from LC n-6 enriched PAM exceeded that from

CON by an average of 22% and from LC n-3 enriched PAM by an average of 84%. On average, the concentration of PGE2 production from LC n-3 PAM decreased 34% compared to CON between 6 and 12hpi (Figure 1B; P < 0.0001). Between 12 and 24hpi, PGE2 concentration in

CON and LC n-6 PAM increased 24% and 17% respectively. Between CON and LC n-6 concentration increased 22%. The concentration in LC n-3 remained constant throughout 24 hours with no detectable differences, however concentration was 2-fold higher in LC n-6 than

LC n-3 PAM 24hpi. Thus, dietary LC n-6 PUFA alters COX-2 and PGE2 upon PRRSV infection.

Dietary long-chain n-6 PUFA modifies antiviral response and decreases replication in PRRSV infected PAM

The finding that long-chain PUFA enrichment in PAM increases COX-2 and PGE2 following PRRSV infection, suggests type I interferon response could be altered as it is classified as a pro-inflammatory response. To determine if long-chain PUFA enrichment in PAM altered an antiviral response to PRRSV, mRNA abundance of INF-α and the PRRSV nucleocapsid (N) were evaluated. Abundance of INF-α mRNA increased steadily in LC n-6 PAM at 6 and 12hpi,

by 12hpi abundance was 3.3-fold higher compared to CON. At 12hpi, INF-α abundance was

52% higher in LC n-3 PAM compared to CON, but 42% lower than that of the LC n-6 treatment group. Between 24 and 48hpi, a steady decline in mRNA abundance was detected in both treatment groups compared to CON, although the level of mRNA transcript was lowest in LC n-

3 PAM (Figure 2A; P <0.0001). Inhibition of viral replication ensues from antiviral responses; as such, mRNA abundance of N was evaluated. At 6hpi, no detectable difference in mRNA abundance was observed between groups. Abundance of N increased in both LC n-6 and n-3

PAM 12hpi, with LC n-3 being 2.75-fold higher than CON and 67% higher than LC n-6 PAM.

By 24 and 48hpi, a decline in mRNA abundance of N was observed in both treatment groups compared to CON (Figure 2B; P < 0.0001). As such, LC n-6 enrichment provided a more robust antiviral response to PRRSV than LC n-3 PAM.

To further elucidate the effect LC PUFA enrichment can cause on an antiviral response to

PRRSV, Pig Antiviral Response RT2 Profiler PCR Arrays were used to evaluate additional genes involved in an innate antiviral immune response in PAM. Arrays were conducted using cDNA from CON, LC n-6 and n-3 treatment groups at 12 and 24hpi time points. The cluster gram demonstrated moderate changes in antiviral response to PRRSV across all treatment groups with clusters of possible co-regulated genes between all samples (Figure 3A and D). Compared to

CON 12hpi, PAM from LC n-6 displayed an upregulation of three genes; FOS proto-Oncogene/ an AP-1 Transcription Factor Subunit (FOS), Apoptosis-associated speck-like protein containing

CARD-like (ASC/LOC100522011), and IL-23A. Additionally, at 12hpi LC n-6 PAM displayed almost a 3-fold downregulation of autophagy related gene 5 (ATG5) and Colony stimulating factor 2/ granulocyte-macrophage (CSF2) (Figure 3B). In LC n-3 PAM at 12hpi, no detectable genes were upregulated relative to CON 12hpi. However, 2 genes displayed more than a 2-fold

downregulation; INF-B1 and CSF2 (Figure 3C). By 24hpi, an additional two genes were upregulated almost 3-fold in LC n-6 PAM, IL-12A and IL-12B while ATG5 was no longer downregulated. Downregulation of CSF2 was 4-fold compared to CON 24hpi (Figure 3E). In LC n-3 PAM, no detectable genes were upregulated compared to CON 24hpi. The downregulation of CSF2 was almost 5-fold relative, while INF-B1 maintained a 2-fold downregulation.

Additional genes C-JUN protein/ an AP-1 Transcription Factor Subunit (JUN) and Nucleotide- inding oligomerization domain (NOD2) were downregulated 2 and 3-fold respectively compared to CON 24hpi (Figure 3F). Thus, dietary enrichment of PAM by long-chain PUFA did alter mRNA abundance of genes associated with an innate antiviral response following PRRSV infection.

Long-chain PUFA enrichment in PAM contributes to changes in pro-inflammatory cytokine response to PRRSV

With an increase in an antiviral response following PRRSV infection, it suggests that transcription of additional pro-inflammatory cytokines could be affected. Accordingly, mRNA abundance of ALOX5, IL-6 and TNF-α were determined via qRT-PCR following PRRSV infection in long-chain PUFA enriched PAM. In contrast to CON and LC n-3 enriched PAM, enrichment with LC n-6 resulted in a 2.6-fold increase in ALOX5 abundance at 6 and 24hpi relative to CON (Figure 4A; P < 0.0001), while a transient decline was observed at 12hpi and again at 48hpi. Metabolism of ARA from 5-LOX (ALOX5 gene) promotes transcription of pro- inflammatory cytokines during early stages of infection. At 6hpi, a 2-fold increase in TNF-α was detected in LC n-6 and n-3 PAM relative to CON at 6hpi. Between 12 and 24hpi, mRNA abundance decreased an average of 59% in LC n-6 PAM. No detectable difference was observed between dietary treatment groups at 12 and 24hpi, although a significant decline in LC n-6 and

LC n-3 PAM were observed at 48hpi (Figure 4B; P < 0.0001). Similarly, a 2.5-fold increase in

IL-6 mRNA abundance from LC n-6 PAM was observed compared to CON and LC n-3.

Between 12 and 24hpi, abundance of IL-6 in the LC- n-6 group decreased an average of 31%

(Figure 4C; P < 0.0001). By 48hpi, a similar decline as seen in TNF-α abundance was observed in LC n-6 and LC n-3 PAM. No detectable difference was observed between CON and LC n-3

PAM the first 24hpi. Therefore, enrichment of PAM by dietary LC n-6 PUFA increases transcription of potent pro-inflammatory cytokines in the early stages of PRRSV infection, specifically within the first 24hpi.

Dietary long-chain PUFA alters enhanced anti-inflammatory response associated with

PRRSV

The increase in pro-inflammatory and antiviral cytokine activity suggested that the typical anti-inflammatory response elicited by PRRSV would be decreased. To evaluate these effects, mRNA abundance of ALOX12/15 and IL-10 were determined. A detectable difference in

ALOX12/15 could not be determined 6 and 12hpi between groups. At 24hpi, LC n-3 PAM displayed a 4-fold increase in ALOX12/15 abundance compared to CON and a 2-fold increase compared to LC n-6 PAM (Figure 5A; P < 0.0032). By 48hpi, no detectable difference was observed. At 6hpi, abundance of IL-10 in LC n-6 PAM was 2-fold higher compared to CON and

LC n-3. By 12hpi, abundance diminished 85% in LC n-6 PAM and slightly increased to that of

CON by 24hpi. Between 12 and 24hpi, abundance in LC n-3 PAM remained lower than CON and LC n-6 (Figure 5B; P <0.0001). By 48hpi, abundance in LC n-6 and n-3 PAM were 23% lower than CON. Production of IL-10 was evaluated by a sandwich ELISA to further assess the anti-inflammatory response to PRRV, however detection fell below the lowest detectable range

(data not shown). Thus, enrichment of PAM with long-chain PUFA does alter an anti- inflammatory response to PRRSV.

Discussion

Porcine Reproductive and Respiratory Syndrome Virus is one of the most detrimental viruses afflicting the swine industry. Common medicinal practices are being implemented, however PRRSV still claims more than 50% of respiratory related deaths in swine (USDA,

2015b). An effective nutritional intervention to help mitigate loss has yet to be determined.

Supplementing diet with pre-formed long-chain PUFA to enrich its content in immune cells presents a nutritional immunomodulatory approach to decreasing the inhibitory effects PRRSV has on the innate immune response of PAM.

Porcine Reproductive and Respiratory Syndrome Virus subverts the innate immune response in PAM by inhibiting pro-inflammatory cytokine and type I interferon production

(Rascon-Castelo et al., 2015; Huang et al., 2015). In this study, we evaluated the mRNA abundance of COX-2, INF-α, N, ALOX 5, TNF-α, IL-6, as well as the production of PGE2 to determine if LC PUFA can help amend the response typically observed in PRRSV-infected

PAM. Dietary long-chain PUFA has been demonstrated to increase the PUFA content of immune cells and modulate eicosanoid production and inflammatory responses upon infection (Oliveros et al., 2004; Calder, 2012; Raphael and Sordillo, 2013; Walter et al., 2019). In the present study, the enrichment of arachidonic acid by LC n-6 supplementation led to increased COX-2 abundance and PGE2 production, which are associated with a pro-inflammatory response during the early stages of infection. In murine macrophages, treatment with ARA led to increased PGE2 production (Bagga et al., 2003b), while treatment with EPA decreased production (Babcock et al., 2002). In pigs, feeding fish oil decreased ARA content and PGE2 production in alveolar

macrophages (Møller and Lauridsen, 2006). Production of PGE2 in PAM was previously reported to increase between 2 and 6hpi, then declined by 36hpi compared to control groups.

Declines were observed at 18, 36 and 72hpi with a transient increase at 24hpi (Chiou et al.,

2000). These finding are consistent with the current study. Alveolar macrophages infected with different Type 2 PPRSV strains at a MOI of 2 or a highly-pathogenic Type 2 PRRSV strain, displayed a rapid increase in PGE2 over 36hpi in ng/mL concentrations (Bi et al., 2014). The

PGE2 concentrations in this study are reported in pg/mL and PAM were not infected with a highly-virulent strain which have been reported to elicit different and more robust pro- inflammatory responses (Liu et al., 2010). Increased production of PGE2 should provoke a heightened antiviral response during the early stages of infection. Enrichment of PAM from dietary LC n-6 upregulated mRNA abundance of genes associated with an antiviral and pro- inflammatory response. Porcine reproductive and respiratory syndrome virus is sensitive to type

I INF responses and inhibits synthesis, thus altering innate and adaptive immune responses

(Brockmeier et al., 2012; Butler et al., 2014). Infection with PRRSV reduces INF-α production significantly compared to other swine-specific respiratory viruses (Albina et al., 1998), while treatment of PRRSV with INF-α decreased viral replication (Brockmeier et al., 2009). This implicates Type I interferon, like INF-α, is detrimental to PRRSV, and therefore downregulates its production in PAM for survival. Studies have demonstrated the virus’ non-structural proteins inhibit nuclear translocation of interferon regulatory factors (IRF) (Kim et al., 2010; Han et al.,

2013), thus terminating transcription of the Type I interferons (Rascon-Castelo et al., 2015;

Huang et al., 2015). In this study, enrichment of LC n-6 in PAM resulted in increased transcription of INF-α and decreased transcription of N compared to CON and LC n-3 enriched

PAM.

Further confirmation of increased antiviral activity in LC PUFA enriched PAM was validated with Pig Antiviral Response RT2 Profiler PCR Arrays. The genes FOS, JUN, and

NOD2 lead to activation of transcription factors (AP-1 and NFκB) associated with transcription of pro-inflammatory and antiviral genes (Dawson et al., 2017). While ASC is an adaptor protein for inflammasome activation. All of which are necessary for Type I interferon production.

Alveolar macrophages infected with PRRSV (Jiang et al., 2013) or influenza (Park et al., 2018) have demonstrated to downregulated these genes to suppress an antiviral response. Suppression of INF-β1 and other antiviral and pro-inflammatory cytokines is accomplished through downregulation and inhibition of the transcription factors NFκB and AP-1 (Beura et al., 2010;

Huang et al., 2014). Studies with recombinant IL-12 and INF-α have demonstrated to reverse antiviral inhibition in PRRSV-infected PAM (Meier et al., 2004). In this study, at 12hpi LC n-6

PAM displayed an upregulation in FOS, ASC, and IL-23A compared to CON and LC n-3 PAM.

By 24hpi, LC n-6 PAM no longer demonstrated an upregulation in IL-23A however, there was an upregulation of both subunits of IL-12, IL-12A and IL-12B. Additionally, LC n-6 PAM displayed a downregulation of ATG5 at 12hpi but not 24hpi. Deletion of this gene leads to increased innate immune inflammation and influenza resistance in lung tissue and macrophages

(Lu et al., 2016). It is possible that this could be another PRRSV-targeted gene to further elicit its immunosuppressive effects and enrichment of PAM with LC n-6 dampens this effect at 12hpi, which would be consistent with the upregulated pro-inflammatory and antiviral genes observed at 12hpi in LC n-6 PAM. A consistent downregulation of CSF2 was observed in both LC n-6 and n-3 PAM compared to CON at 12 and 24hpi. Colony-stimulating factor 2 is associated with monocyte recruitment and maturation (Murphy, 2012). It is plausible that suppression of this gene could be another mechanism by which PRRSV evades an innate host immune response.

The additional markers identified from the antiviral arrays suggest additional genes that could be targeted by PRRSV and subsequently modified by LC PUFA enrichment. Further investigation is warranted to determin these pathways. However, the increase in pro-inflammatory and antiviral markers in LC n-6 PAM following PRRSV infection compared to the downregulation observed in LC n-3 PAM observed from these antiviral arrays, increased INF-α abundance and decreased N mRNA abundance does suggest that LC n-6 enrichment in PAM is an effective means to enhancing an antiviral response in PRRSV-infected PAM.

Early stages of infection promote the oxidation are ARA by 5-LOX, which further leads to eicosanoid synthesis for production of pro-inflammatory cytokines (Luo et al., 2003). In the early stages of infection, PRRSV elicits a very weak innate immune response in PAM (Lunney et al., 2016). Previous studies have demonstrated downregulated TNF-α following PRRSV infection (Beura et al., 2010; He et al., 2015). Transcription levels of TNF-α mRNA in PRRSV- infected PAM have demonstrated to decrease 6hpi, while production of TNF-α has been reported to be decreased by 65% 48hpi (López-Fuertes et al., 2000), while other studies have reported to enhance TNF-α production by 26% when reported on a viable cell basis versus total activity

(Chiou et al., 2000). Zhang and colleagues reported PRRSV enhances transcription of TNF-α and

IL-6 in PAM with in 24hpi (Zhang et al., 2018b). Although it is important to note, that studies where transcription of TNF-α and IL-6 were upregulated by PRRSV, again were in PAM infected with highly pathogenic strains which can have an opposite effect on pro-inflammatory cytokine production (Liu et al., 2010; Renson et al., 2017). In the current study, enrichment of

PAM with long-chain PUFA increased the mRNA abundance of TNF-α 6hpi compared to CON but steadily declined during the remaining 48 hours. It is interesting that mRNA abundance of

IL-6 remained elevated 12 and 24hpi, before significantly declining in LC n-6 PAM compared to

100

the other treatment groups. Studies involving bacterial infections have demonstrated IL-6 and

TNF-α to have opposing effects on each other (Schindler et al., 1990; Kohanawa and Kohanawa,

2006), which our previous study with LPS demonstrated (Walter et al., 2019). This could explain the significant decline in TNF-α by 12hpi with PRRSV. Overall, LC n-6 enrichment in PAM appears to be an effective means of enhancing an antiviral and pro-inflammatory response in

PRRSV-infected PAM.

Several studies have reported dietary supplementation with EPA to have immunosuppressive effects by decreasing pro-inflammatory cytokine production (Renier et al.,

1993; Fritsche and Cassity, 1996; Stulnig, 2003; Moller and Lauridsen, 2006), antigen presenting abilities (Fujikawa et al., 1992; Zhang et al., 2006), lymphocyte proliferation, activation and signaling (Sanderson and Calder, 1998; Zhang et al., 2006; Kong et al., 2011), and overall viral prosperity (Anderson and Fritsche, 2002). Furthermore, fish-oil fed mice infected with influenza demonstrated increased viral load and decreased pro-inflammatory cytokine production

(Schwerbrock et al., 2009). These findings are consistent with ours in that, LC n-3 PAM had a lower antiviral response to PRRSV than LC n-6 PAM. Production of PGE2, can lead to lipid- mediator class switching at later stages of infection were metabolism of ARA switches from a predominantly 5-LOX pathway to a 12/15-LOX pathway to cease inflammation and allow the challenged tissue to return to a homeostatic state (Levy and Serhan, 2014). The mRNA abundance was consistent between CON and LC n-6 PAM throughout the entire time course. A transient upregulation at 24hpi was observed in LC n-3 PAM, although no differences were detected between treatment groups for the other time points. Given the significant decline in

ALOX5, antiviral and pro-inflammatory cytokine abundance in LC n-6 PAM by 48hpi, a decrease in ALOX 12/15 abundance was expected. With the drastic immune dysregulation

101

typically caused by PRRSV and the altered effects demonstrated within the first 24hpi in LC n-6

PAM, it is possible that lipid-mediator class switching could take longer to occur or may not occur, although in previous work, we demonstrated lipid-mediator class switching to be initiated within 24h following LPS-stimulation (Walter et al., 2019). As such, further investigation is warranted. Porcine Reproductive and Respiratory Syndrome Virus can evade host immunity through the upregulation of IL-10, which has antagonistic effects against innate immune responses and allows for uninhibited viral propagation (Lunney et al., 2016). Previous studies have demonstrated the significant upregulation of expression and production of IL-10 following

PRRSV infection (Suradhat and Thanawongnuwech, 2003; Wongyanin et al., 2012; Song et al.,

2013). Interestingly in this study, there was a transient increase in IL-10 from LC n-6 PAM compared to the other dietary treatment groups. By 12hpi, mRNA abundance declined almost 7- fold in LC n-6 PAM. The drastic decline at 12hpi is logical as antiviral cytokines were upregulated at 12hpi and these cytokines are antagonistic of each other. These results demonstrate dietary enrichment of PAM with long-chain PUFA modified IL-10 abundance, the enhanced anti-inflammatory response typically associated with PRRSV.

In 1999, van Reeth et al demonstrated PRSSV infection diminished innate immune response in PAM (Van Reeth et al., 1999). However, innate immune responses in PAM can vary in antiviral, pro-inflammatory responses, and clinical symptoms depending on the virus strain

(Lee et al., 2004; Liu et al., 2010; Renson et al., 2017). Our data demonstrate that LC n-6 enrichment in PAM is an effective means of dampening some of the deleterious effects PRRSV inflicts on the innate immune response in PAM. We acknowledge inherent limitations of in situ studies. Future analyses are needed to determine overall immune response and health impact of dietary long-chain PUFA with PRRSV.

102

Conclusions

Overall, ARA enrichment in PAM from dietary LC n-6 PUFA dampened the inhibitory nature of PRRSV to cease antiviral and pro-inflammatory cytokine production. Enhanced antiviral and pro-inflammatory cytokine mRNA abundance was associated with decreased transcription of the PRRSV nucleocapsid, an indicator of viral replication. This study could provide an alternate therapeutic agent to dampen the deleterious effects of PRRSV infection, as current medicinal practices are not 100% effective. Overall, a combination of dietary PUFA supplementation and vaccination might promote a quicker return to a stable herd-health status, and lessen the overall economic impact of PRRSV.

103

Literature Cited

Albina, E., C. Carrat, and B. Charley. 1998. Interferon-alpha response to swine arterivirus (PoAV), the porcine reproductive and respiratory syndrome virus. J. Interferon Cytokine Res. 18(7): 485-490. doi: 10.1089/jir.1998.18.485

Anderson, M., and K. L. Fritsche. 2002. (N-3) fatty acids and infectious disease resistance. The Journal of Nutrition. 132(12): 3566-3576.

Bassaganya-Riera, J., A. J. Guri, A. M. Noble, K. A. Reynolds, J. King, C. M. Wood, M. Ashby, D. Rai, and R. Hontecillas. 2007. Arachidonic acid-and docosahexaenoic acid-enriched formulas modulate antigen-specific T cell responses to influenza virus in neonatal piglets. Am. J. Clin. Nutr. 85(3): 824-836. doi: 85/3/824 [pii]

Beura, L. K., S. N. Sarkar, B. Kwon, S. Subramaniam, C. Jones, A. K. Pattnaik, and F. A. Osorio. 2010. Porcine reproductive and respiratory syndrome virus nonstructural protein 1β modulates host innate immune response by antagonizing IRF3 activation. Journal of Virology. 84(3): 1574-1584. doi: 10.1128/JVI.01326-09

Bi, Y., X. K. Guo, H. Zhao, L. Gao, L. Wang, J. Tang, and W. H. Feng. 2014. Highly pathogenic porcine reproductive and respiratory syndrome virus induces prostaglandin E2 production through cyclooxygenase 1, which is dependent on the ERK1/2-p-C/EBP-beta pathway. J. Virol. 88(5): 2810-2820. doi: 10.1128/JVI.03205-13

Brockmeier, S. L., K. M. Lager, M. J. Grubman, D. E. Brough, D. Ettyreddy, R. E. Sacco, P. C. Gauger, C. L. Loving, A. C. Vorwald, M. E. Kehrli Jr, and H. D. Lehmkuhl. 2009. Adenovirus-mediated expression of interferon-alpha delays viral replication and reduces disease signs in swine challenged with porcine reproductive and respiratory syndrome virus. Viral Immunol. 22(3): 173-180. doi: 10.1089/vim.2008.0075

104

Brockmeier, S. L., C. L. Loving, E. A. Nelson, L. C. Miller, T. L. Nicholson, K. B. Register, M. J. Grubman, D. E. Brough, and M. E. Kehrli Jr. 2012. The presence of alpha interferon at the time of infection alters the innate and adaptive immune responses to porcine reproductive and respiratory syndrome virus. Clin. Vaccine Immunol. 19(4): 508-514. doi: 10.1128/CVI.05490-11

Bruder, D., A. Srikiatkhachorn, and R. I. Enelow. 2006. Cellular immunity and lung injury in respiratory virus infection. Viral Immunol. 19(2): 147-155. doi: 10.1089/vim.2006.19.147

Butler, J. E., K. M. Lager, W. Golde, K. S. Faaberg, M. Sinkora, C. Loving, and Y. I. Zhang. 2014. Porcine reproductive and respiratory syndrome (PRRS): An immune dysregulatory pandemic. Immunol. Res. 59(1-3): 81-108. doi: 10.1007/s12026-014-8549-5

Calder, P. C. 2012. Long-chain fatty acids and inflammation. Proc. Nutr. Soc. 71(2): 284-289. doi: 10.1017/S0029665112000067

Calder, P. C., and R. F. Grimble. 2002. Polyunsaturated fatty acids, inflammation and immunity. Eur. J. Clin. Nutr. 56 Suppl 3: S14-9. doi: 10.1038/sj.ejcn.1601478

Calder, P. C. 2006. Polyunsaturated fatty acids and inflammation. Prostaglandins, Leukotrienes and Essential Fatty Acids. 75(3): 197-202. doi: http://dx.doi.org/10.1016/j.plefa.2006.05.012

Chaung, H. C., C. W. Chen, B. L. Hsieh, and W. B. Chung. 2010. Toll-like receptor expressions in porcine alveolar macrophages and dendritic cells in responding to poly IC stimulation and porcine reproductive and respiratory syndrome virus (PRRSV) infection. Comp. Immunol. Microbiol. Infect. Dis. 33(3): 197-213. doi: 10.1016/j.cimid.2008.10.001

Chiou, M., C. Jeng, L. Chueh, C. Cheng, and V. F. Pang. 2000. Effects of porcine reproductive and respiratory syndrome virus (isolate tw91) on porcine alveolar macrophages in vitro. Veterinary Microbiology. 71(1): 9-25. doi: https://doi.org/10.1016/S0378-1135(99)00159-5

105

Dawson, H.D., Smith, A.D., Chen, C., Urban, J.F. 2017. An in-depth comparison of the porcine, murine and human inflammasomes; lessons from the forcine genome and transcriptome. Veterinary Microbiology. 202: 2-15. doi: https://doi.org/10.1016/j.vetmic.2016.05.013.

Duan, E., D. Wang, L. Fang, J. Ma, J. Luo, H. Chen, K. Li, and S. Xiao. 2015. Suppression of porcine reproductive and respiratory syndrome virus proliferation by glycyrrhizin. Antiviral Research. 120: 122-125. doi: https://doi.org/10.1016/j.antiviral.2015.06.001

Fujikawa, M., N. Yamashita, K. Yamazaki, E. Sugiyama, H. Suzuki, and T. Hamazaki. 1992. Eicosapentaenoic acid inhibits antigen-presenting cell function of murine splenocytes. Immunology. 75(2): 330-335.

Ganter, M., and A. Hensel. 1997. Cellular variables in bronchoalveolar lavage fluids (BALF) in selected healthy pigs. Res. Vet. Sci. 63(3): 215-217.

Halbur, P. 2016. Porcine Respiratory Disease Complex. https://projects.ncsu.edu/project/swine_extension/healthyhogs/book1997/halbur2.htm (Accessed 4 2017.)

Han, M., Y. Du, C. Song, and D. Yoo. 2013. Degradation of CREB-binding protein and modulation of type I interferon induction by the zinc finger motif of the porcine reproductive and respiratory syndrome virus nsp1α subunit. Virus Res. 172(1–2): 54-65. doi: http://dx.doi.org/10.1016/j.virusres.2012.12.012

He, Q., Y. Li, L. Zhou, X. Ge, X. Guo, and H. Yang. 2015. Both Nsp1β and Nsp11 are responsible for differential TNF-α production induced by porcine reproductive and

106

respiratory syndrome virus strains with different pathogenicity in vitro. Virus Res. 201: 32- 40. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.virusres.2015.02.014

Huang, C., Q. Zhang, and W. H. Feng. 2015. Regulation and evasion of antiviral immune responses by porcine reproductive and respiratory syndrome virus. Virus Res. 202: 101-111. doi: 10.1016/j.virusres.2014.12.014

Huang, C., Q. Zhang, X. Guo, Z. Yu, A. Xu, J. Tang, and W. Feng. 2014. Porcine reproductive and respiratory syndrome virus nonstructural protein 4 antagonizes beta interferon expression by targeting the NF-κB essential modulator. Journal of Virology. 88(18): 10934- 10945. doi: 10.1128/JVI.01396-14

Jiang, Z., Zhou, X., Michal, J.J., Wu, X-L., Zhang, L., Zhang, M., et al. 2013. Reactomes of porcine alveolar macrophages infected with Porcine Reproductive and Respiratory Syndrome Virus. PLoS ONE. 8 (3): e59229. doi: https://doi.org/10.1371/journal.pone.0059229

Kong, W., J. H. Yen, and D. Ganea. 2011. Docosahexaenoic acid prevents dendritic cell maturation, inhibits antigen-specific Th1/Th17 differentiation and suppresses experimental

107

autoimmune encephalomyelitis. Brain Behav. Immun. 25(5): 872-882. doi: 10.1016/j.bbi.2010.09.012

Lee, S. M., S. K. Schommer, and S. B. Kleiboeker. 2004. Porcine reproductive and respiratory syndrome virus field isolates differ in in vitro interferon phenotypes. Vet. Immunol. Immunopathol. 102(3): 217-231. doi: S0165-2427(04)00255-7

Lee, S., and S. B. Kleiboeker. 2007. Porcine reproductive and respiratory syndrome virus induces apoptosis through a mitochondria-mediated pathway. Virology. 365(2): 419-434. doi: https://doi.org/10.1016/j.virol.2007.04.001

Levy, B. D., and C. N. Serhan. 2014. Resolution of acute inflammation in the lung. Annu. Rev. Physiol. 76: 467-492. doi: 10.1146/annurev-physiol-021113-170408 [doi]

Liu, Y., W. Shi, E. Zhou, S. Wang, S. Hu, X. Cai, F. Rong, J. Wu, M. Xu, M. Xu, and L. Li. 2010. Dynamic changes in inflammatory cytokines in pigs infected with highly pathogenic porcine reproductive and respiratory syndrome virus. Clin. Vaccine Immunol. 17(9): 1439- 1445. doi: 10.1128/CVI.00517-09

López-Fuertes, L., E. Campos, N. Doménech, A. Ezquerra, J. M. Castro, J. Domı́nguez, and F. Alonso. 2000. Porcine reproductive and respiratory syndrome (PRRS) virus down- modulates TNF-α production in infected macrophages. Virus Research. 69(1): 41-46. doi: https://doi.org/10.1016/S0168-1702(00)00172-6

Lu, Q., Yokoyama, C.C., Williams, J.W., Baldridge, M.T., Jin, X., DesRochers, B. 2016. Homeostatic control of innate lung inflammation by vici syndrome gene Epg5 and additional autophagy genes promotes influenza pathogensis. Cell Host Microbe. 19 (1): 102- 113. doi:10.1016/j.chom.2015.12.011

Meier, W. A., R. J. Husmann, W. M. Schnitzlein, F. A. Osorio, J. K. Lunney, and F. A. Zuckermann. 2004. Cytokines and synthetic double-stranded RNA augment the T helper 1 immune response of swine to porcine reproductive and respiratory syndrome virus.

108

Veterinary Immunology and Immunopathology. 102(3): 299-314. doi: https://doi.org/10.1016/j.vetimm.2004.09.012

Murphy, K. 2012. Janeway's immunobiology. Lawrence E., ed. 8th ed. New York, NY, Garland Science.

Opriessnig, T., D. Patel, R. Wang, P. G. Halbur, X. Meng, D. A. Stein, and Y. Zhang. 2011. Inhibition of porcine reproductive and respiratory syndrome virus infection in piglets by a peptide-conjugated morpholino oligomer. Antiviral Research. 91(1): 36-42. doi: https://doi.org/10.1016/j.antiviral.2011.04.012

Park, H-S., Liu, G., Thulasi Raman, S.N., Landreth, S.L., Liu, Q., Zhou, Y. 2018. NS1 protein of 200 pandemic influenza A virus inhibits procine NLRP3 inflammasome-mediated interleukin-1 beta production by suppressing ASC ubiquitination. J. Virology. 92 (8): e00022-18. doi: 10.1128/JVI.00022-18

Raphael, W., and L. M. Sordillo. 2013. Dietary polyunsaturated fatty acids and inflammation: The role of phospholipid biosynthesis. Int. J. Mol. Sci. 14(10): 21167-21188. doi: 10.3390/ijms141021167

Rascon-Castelo, E., A. Burgara-Estrella, E. Mateu, and J. Hernandez. 2015. Immunological features of the non-structural proteins of porcine reproductive and respiratory syndrome virus. Viruses. 7(3): 873-886. doi: 10.3390/v7030873

Renson, P., N. Rose, M. Le Dimna, S. Mahe, A. Keranflec'h, F. Paboeuf, C. Belloc, M. F. Le Potier, and O. Bourry. 2017. Dynamic changes in bronchoalveolar macrophages and cytokines during infection of pigs with a highly or low pathogenic genotype 1 PRRSV strain. Vet. Res. 48(1): 15-017-0420-y. doi: 10.1186/s13567-017-0420-y

109

Sanderson, P., and P. C. Calder. 1998. Dietary fish oil diminishes lymphocyte adhesion to macrophage and endothelial cell monolayers. Immunology. 94(1): 79-87.

Serhan, C. N., N. Chiang, J. Dalli, and B. D. Levy. 2014. Lipid mediators in the resolution of inflammation. Cold Spring Harb Perspect. Biol. 7(2): a016311. doi: 10.1101/cshperspect.a016311

Serhan, C. N., N. Chiang, and T. E. Van Dyke. 2008. Resolving inflammation: Dual anti- inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol. 8(5): 349-361. doi: 10.1038/nri2294

Song, S., J. Bi, D. Wang, L. Fang, L. Zhang, F. Li, H. Chen, and S. Xiao. 2013. Porcine reproductive and respiratory syndrome virus infection activates IL-10 production through NF-κB and p38 MAPK pathways in porcine alveolar macrophages. Developmental & Comparative Immunology. 39(3): 265-272. doi: http://dx.doi.org.prox.lib.ncsu.edu/10.1016/j.dci.2012.10.001

Stulnig, T. M. 2003. Immunomodulation by polyunsaturated fatty acids: Mechanisms and effects. Int Arch Allergy Immunol. 132(4): 310-321. doi: 10.1159/000074898

Sun, N., X. Zhao, X. Bai, L. Niu, M. Song, Y. Sun, J. Jiang, and H. Li. 2012a. Anti-PRRSV effect and mechanism of sodium tanshinone IIA sulfonate in vitro. J. Asian Nat. Prod. Res. 14(8): 721-728. doi: 10.1080/10286020.2012.685727 https://doi.org/10.1080/10286020.2012.685727

USDA. 2015. Part II: Reference of swine health and health management in the united states, 2012. NAHMS Swine 2012. Retrieved March 8, 2018.

110

Van Reeth, K., G. Labarque, H. Nauwynck, and M. Pensaert. 1999. Differential production of proinflammatory cytokines in the pig lung during different respiratory virus infections: Correlations with pathogenicity. Res. Vet. Sci. 67(1): 47-52. doi: 10.1053/rvsc.1998.0277

Walter, K. R., L. Xi, S. K. Jacobi, T. Kaser, D. Esposito, and J. Odle. 2019. Dietary arachidonate in milk replacer triggers dual benefits of PGE2 signaling in LPS-challenged piglet alveolar macrophages. J. Anim. Sci. Biotechnol. 10(13) doi: 10.1186/s40104-019-0321-1 https://doi.org/10.1186/s40104-019-0321-1

Wang, L., S. Xiao, J. Gao, M. Liu, X. Zhang, M. Li, G. Zhao, D. Mo, X. Liu, and Y. Chen. 2014. Inhibition of replication of porcine reproductive and respiratory syndrome virus by hemin is highly dependent on heme oxygenase-1, but independent of iron in MARC-145 cells. Antiviral Research. 105: 39-46. doi: https://doi.org/10.1016/j.antiviral.2014.02.010

Wongyanin, P., S. Buranapraditkul, D. Yoo, R. Thanawongnuwech, J. A. Roth, and S. Suradhat. 2012. Role of porcine reproductive and respiratory syndrome virus nucleocapsid protein in induction of interleukin-10 and regulatory T-lymphocytes (treg). J. Gen. Virol. 93(Pt 6): 1236-1246. doi: 10.1099/vir.0.040287-0

Yang, Q., L. Gao, J. Si, Y. Sun, J. Liu, L. Cao, and W. Feng. 2013. Inhibition of porcine reproductive and respiratory syndrome virus replication by flavaspidic acid AB. Antiviral Research. 97(1): 66-73. doi: https://doi.org/10.1016/j.antiviral.2012.11.004

Zhang, M., T. Du, F. Long, X. Yang, Y. Sun, M. Duan, G. Zhang, Y. Liu, E. M. Zhou, W. Chen, and J. Chen. 2018a. Platycodin D suppresses type 2 porcine reproductive and respiratory syndrome virus in primary and established cell lines. Viruses. 10(11): 10.3390/v10110657. doi: E657

Zhang, M., Q. Wu, Y. Chen, M. Duan, G. Tian, X. Deng, Y. Sun, T. Zhou, G. Zhang, W. Chen, and J. Chen. 2018b. Inhibition of proanthocyanidin A2 on porcine reproductive and respiratory syndrome virus replication in vitro. PLoS One. 13(2): e0193309. doi: 10.1371/journal.pone.0193309

Zhang, P., W. Kim, L. Zhou, N. Wang, L. H. Ly, D. N. McMurray, and R. S. Chapkin. 2006. Dietary fish oil inhibits antigen-specific murine Th1 cell development by suppression of clonal expansion. J. Nutr. 136(9): 2391-2398. doi: 136/9/2391

111

Table 1. Sense and anti-sense primer sequences (5’-3’) used in qRT-PCR analysis Target Gene Bank accession Amplicon Primer sequence Size (bp) F: TTCAAGGCTCCCATTCGACC

RPL4 XM_005659862.3 110 R: GCACTGGTTTGATGACCTGC

F: GGGTTGACAAATGGTGGGGA

RPL9 XM_013978597.2 106 R: TTGTAACGGAAGCCCAGTGT

F: TTGCGAACGGAACCATAAGGA

SDHA XM_021076931.1 106 R: CAGCCTTCCTGTAACACGCT

F: AAGAAGGGGATTGTGGATCAGTC

YWHAZ XM_001927228.7 105 R: AAGGGCCAGACCCAATCTGA

JQ839262.1 F: TCTCTTCCTCCAGAAACCTGCAA INF-α 95 R: GGGCTTGTTAGTCTGTGAGAAGCA F: TTAATCAAGGCGCTGGGACT Nucleocapsid U87392.3 116 (N) R: GGATCAGGCGCACAGTATGA

F: ATGGGTGTGAAAGGGAGGAAAG

COX-2 NM_214321.1 90 R: CTGGGGATCAGGGATGAACTT

F: ATGCCAAATGCCACAGGGAT

5-LOX XM_021072736.1 103 R: ATGAACAGGTTCTCCATCGCTT

F: CAGGCTTGGTGTCGAGAGTT

12/15-LOX1 NM_213931 97 R: AGTGGCAGAGCTGTTCCTTG

F: CCCCAGAAGGAAGAGTTTCCA

TNF-α NM_214022.1 94 R: CGACGGGCTTATCTGAGGTTT

F: GACCCTGAGGCAAAAGGGAA

IL-6 NM_001252429.1 101 R: TCCACTCGTTCTGTGACTGC

F: GACGTAATGCCGAAGGCAGA NM_214041.1 IL-102 101 R: AGGGCAGAAATTGATGACAGCG 1(Lopez-Ubeda et al., 2015) 2(Suradhat and Thanawongnuwech, 2003)

112

Figure 1: Long-chain n-6 enrichment in PAM increases COX-2 mRNA abundance and maintains elevated concentrations of PGE2 following PRRSV infection. Alveolar macrophages from pigs fed CON, LC n-6 or LC n-3 diets were infected with PRRSV strain VR- 2332 over the course of 48h. Relative abundance of COX-2 mRNA was evaluated by qRT-PCR and PGE2 concentration was evaluated up to 24hpi by ELISA. Supplementation with a LC n-6 enriched diet enhanced the mRNA abundance of COX-2 (A) 6hpi and maintained an increased concentration of PGE2 (B) up to 24hpi. Results are relative to CON diet at each time point, and demonstrative of a composite of n=6 per treatment group with a diet and infection time point interaction of P < 0.0001. Values are mean ± SEM. Bars lacking a common letter differ. CON, control diet; COX-2, cyclooxygenase 2; hpi, hours post infection; LC n-6/ LC n-3, long chain n-6 /long chain n-3 polyunsaturated fatty acid; PAM, porcine alveolar macrophages; PRRSV, porcine reproductive and respiratory syndrome virus; PGE2, prostaglandin E2.

113

Figure 2: Supplementing diet with LC n-6 enhances antiviral interferon response leading to decreased viral replication in PRRSV-infected PAM. Porcine alveolar macrophages enriched from CON, LC-n6 and LC n-3 diets were infected with the VR-2332 strain of PRRSV for up to 48h. The mRNA abundance of INF-α and N were evaluated by qRT-PCR. Increased transcription of INF-α (A) and decreased N (B) in LC n-6 enriched PAM demonstrates an elevated anti-viral response causing decreased viral replication of PRRSV compared to LC n-3 enriched PAM. The results are mean fold-change relative to CON at each time point, and representative of a composite of n=6 per dietary treatment. A dietary and viral time point interaction was observed at P < 0.0001. Values are mean ± SEM. Bars lacking a common letter differ. CON, control diet; INF-α, interferon alpha; hpi, hours post infection; LC n-6/ LC n-3, long chain n-6 /long chain n-3 polyunsaturated fatty acid; N, nucleocapsid; PAM, porcine alveolar macrophages; PRRSV, porcine reproductive and respiratory syndrome virus.

114

Figure 3: Dietary long-chain PUFA alters genes involved in innate antiviral immune signaling in PAM Profiling of 84 genes related to an antiviral response were performed using the RT2 Profiler PCR Array Pig Antiviral Response (PASS-122Z Qiagen) at 12 and 24hpi with the VR-2332 strain of PRRSV from PAM enriched with LC-n6 of LC n-3 PUFA. Results are a composite of 6 pigs per diet, and mRNA abundance is expressed relative to CON at each time point. hpi, hours post infection; LC n-6/ LC n-3, long chain n-6 /long chain n-3 polyunsaturated fatty acid; PAM, porcine alveolar macrophages; PRRSV, porcine reproductive and respiratory syndrome virus.

115

116

117

Figure 4: Dietary arachidonate enhances pro-inflammatory cytokine response in PRRSV- infected PAM. Porcine alveolar macrophages enriched from CON, LC-n6 and LC n-3 diets were infected with the VR-2332 strain of PRRSV for up to 48h. The mRNA abundance of ALOX5, TNF-α, and IL-6 were evaluated by qRT-PCR. Dietary LC n-6 enhanced an elevated abundance of (A) ALOX5 throughout the first 24hpi, which resulted in abundance of (B) TNF-α, and (C) IL- 6 peaking at 6hpi. The results are a composite of 6 pigs per diet, mRNA abundance is relative to CON at each time point. An interaction between diet and hpi was observed at P < 0.0001. Values are mean ± SEM. Bars lacking a common letter differ. ALOX5, lipoxygenase 5; CON, control diet; ELISA, enzyme-linked immunosorbent assay; hpi, hours post infection; IL-6, interleukin 6; LC n-6/ LC n-3, long chain n-6 /long chain n-3 polyunsaturated fatty acid; PAM, porcine alveolar macrophages; PRRSV, porcine reproductive and respiratory syndrome virus; TNF-α, tumor necrosis factor alpha.

118

119

Figure 5: Dietary LC n-6 PUFA reverses PRRSV upregulation of anti-inflammatory cytokines in PAM. Alveolar macrophages from pigs fed CON, LC n-6 or LC n-3 diets were infected with PRRSV strain VR-2332 over the course of 24h. Relative abundance of ALOX 12/15 and IL-10 were determined via qRT-PCR. Results are relative to CON diet at each time point, and demonstrative of a composite of n=6 per treatment group, interaction between diet and hpi was P < 0.001. Values are mean ± SEM. Bars lacking a common letter differ. ALOX 12/15, lipoxygenase 12/15; CON, control diet; hpi, hours post infection; IL-10, interleukin 10; LC n-6/ LC n-3, long chain n-6 /long chain n-3 polyunsaturated fatty acid; PAM, porcine alveolar macrophages; PRRSV, porcine reproductive and respiratory syndrome virus.

120

Chapter IV

Conclusions and future perspectives

121

Conclusions

In the US swine industry, respiratory problems are one the most reported health problems across all stages of production. In preweaning to grower/finisher phases alone, respiratory problems account for 4.4-75.1% of deaths (USDA, 2015a). Currently, vaccination and antibiotic treatment are standard practice for prevention and treatment of bacterial and viral respiratory infections. Despite these current practices, gram-negative bacteria and PRRSV are two of the leading causes of respiratory-related diseases and deaths in the swine industry (USDA, 2015a;

USDA, 2015b). Novel approaches involving the use of dietary nutrients as alternative methods or used in conjunction with vaccines to alleviate the severity of respiratory infections in swine have been proposed, but these studies are sparse.

Long-chain polyunsaturated fatty acids (LC-PUFA), ARA (n-6), EPA (n-3), and DHA (n-

3), are synthesized from their precursors linoleic acid and alpha-linolenic acid. However, conversion rates from precursors to long-chain PUFA are low and supplementing diet with preformed long-chain PUFA has become an increasing trend. Arachidonic acid synthesizes potent eicosanoids, PGE2, which promotes pro-inflammatory and antiviral signaling at the onset of an acute challenge, and in a negative feed-back loop, hinders its initial response to promote anti- inflammatory and pro-resolving cascades (lipid-mediator class switching) (Botham and Mayes,

2009). Previous studies have demonstrated opposing effects on immune cell function and eicosanoid production, when supplemented with ARA (Bagga et al., 2003a) or EPA (Skuladottir et al., 2007). Suggesting the supplementation with n-3 PUFA incorporates into immune cells at the expense of n-6 PUFA decreasing pro-inflammatory and antiviral responses. Studies have reported supplementation with long-chain n-3 PUFA to be detrimental to control and elimination of bacterial (Møller and Lauridsen, 2006; McFarland et al., 2008) and viral respiratory infections

122

(Bassaganya-Riera et al., 2007; Schwerbrock et al., 2009). This research assessed the ability of dietary pre-formed ARA or EPA to enrich the long-chain PUFA content of piglet alveolar macrophages and modify eicosanoid and cytokine production for a more balanced response to

LPS or PRRSV challenge.

The study in Chapter II consisted of feeding milk-replacer to neonatal pigs supplemented with LC n-6 or LC n-3 PUFA, evaluating the enrichment of corresponding dietary fatty acids in

PAM and assessing inflammatory and eicosanoid markers following LPS stimulation. The aim of this study was to determine if supplemental LC n-6 PUFA could provide a heighted but balanced innate immune response following in situ LPS stimulation. The study confirmed increasing dietary LC n-6 PUFA can result in a 2-fold ARA enrichment in PAM, while increasing dietary

LC n-3 PUFA can increase EPA content 1.5-fold, while abating ARA enrichment by more than

50%. Enrichment with ARA led to increased TNF-α and ALOX 12/5 mRNA abundance, decreased ALOX 5 abundance, without eliciting a dietary effect on oxidative burst. The findings in Chapter II conclude supplementing neonatal pig diets with LC n-6 PUFA can enrich the ARA content in PAM leading to increased pro-inflammatory cytokine expression and eicosanoid production, while initiating the initial signaling for lipid-mediator class switching within a 24- hour period.

In Chapter III, long-chain PUFA enriched PAM collected from the feeding trial described in Chapter II were used to determine if supplemental ARA in formula-fed pigs could improve the innate immune response of PAM when challenged with PRRSV in situ. It was hypothesized, the dual nature of PGE2 could provide a heightened but balanced antiviral response and dampen

PRRSV’s immunosuppressive effects in PAM. Within 12hpi, LC n-6 PAM displayed a 73% increase in mRNA abundance of antiviral cytokines, while having 67% less transcription of viral

123

nucleocapsid compared to LC n-3 PAM. The findings in Chapter III infer LC n-6 enrichment in

PAM can dampen the inhibitory nature of PRRSV by enhancing antiviral and pro-inflammatory cytokine mRNA abundance and decreasing viral replication.

Interestingly, the increased mRNA abundance of COX-2 observed at 6hpi then decline to that of CON from Chapter III differs from the abundance oberserved at 24h post-LPS stimulation in Chapter II. The level at which COX-2 was upregulated following PRRSV infection was 5 times higher than what was oberseved in LPS-stimulated LC n-6 PAM. Although, the mRNA abundance of COX-2 was upregulated and the level to which it was upregulated differed between

LPS and PRRSV challenged PAM, the concentration of PGE2 was similar by 24h at ~336 pg/mL in LC n-6 PAM. Another interesting point to note, is in Chapter II we observed a stronger pro- inflammatory response, indicated by mRNA bundance of key pro-inflammatory markers, but also the initial stages of lipi-mediator class switching within 24h post-LPS stimulation in LC n-6

PAM. While LC n-6 PAM challenged with PRRSV demonstrated a better pro-inflammatory and antiviral response than CON and LC n-3 PAM, there were no indications of lipid-mediator class switching occurring within 48hpi. It is important to note and these differences demonstrate the diverse responses that can occur in PAM during bacterial or viral challenges, particularly when the fatty acid composition of the cells are altered. These differences further support work that lies ahead for continued evaluation of dietary PUFA supplementation and its role in infectious disease resistance.

Overall, this work demonstrates the ability of dietary LC n-6 PUFA to be an effective means to enhance a stronger, well-balanced innate immune response to respiratory challenges in neonatal pigs. Dietary supplementation with LC n-6 PUFA could provide an alternative therapeutic agent, and possibly in conjunction with vaccination, promote a quicker return to a

124

stable herd-health status, and lessen the overall economic impact of respiratory diseases in the swine industry.

Future perspectives

The research previously described in Chapters II and III were intended to provide an alternative nutritional approach to enhance swine immunological responses to respiratory pathogens, particularly PRRSV. As, PPRSV is still one of the most devastating viruses costing the US swine industry over $664 million in production losses per year (Holtkamp et al., 2013).

Dietary LC n-6 PUFA provides a prospective nutritional intervention that may help alleviate some of the production and economic impacts of respiratory infections in swine. The work described here helped bridge a knowledge gap in the use of dietary metabolites to alleviate the immunosuppressive effects of PRRSV in porcine alveolar macrophages.

Presently, vaccination against PRRSV is used for controlling infection. Between 8.8 and

46.4 % of all production phases vaccinate against PRRSV, with highest administration given to breeding females (USDA, 2015b). However, vaccine efficacy is low and maternal antibodies can decline within 3 weeks in neonates (Renukaradhya et al., 2015; Halbur, 2016). The long-chain

PUFA used in this study were single-cell sourced oils from DSM Nutritional Products, which are human-grade quality. In terms of cost effectiveness, use of human-grade supplements may not be economically feasible. However, veterinary-grade or less “quality-controlled” supplementations are available and could be plausible. As such, investigation into these alternative versions should be considered.

Another practical application point that should be addressed is feeding protocol. The feed trial described in Chapter II detailed supplementation to milk replacer-fed pigs. In a commercial setting, this is not practical in that piglets are sow-reared. The question that lies ahead, and has

125

begun to be addressed is: Could long-chain PUFA be fed to the sow, corresponding LC PUFA transfer to the piglets and still demonstrate the same benefits as described in these in situ studies?

In a recent study, 60 sows were fed a standard commercial lactation diet, and top-dressed once- daily with 2% ARA or EPA of total fatty acids or control (palm kern oil) for the remaining 14 days of lactation prior to weaning. Long-chain PUFA sources were the same single-cell oils used in Chapters II and III. Milk samples were collected at days 6 and 13 of supplementation.

Alveolar macrophages from 6 suckling pigs per treatment group were isolated as previously described in Chapter II on day 14. Sow milk from those fed 2% ARA, displayed an averaged

7.13% increase in ARA content (% total fatty acids) compared to control at 0.52% ARA. Milk from fed 2% EPA had an average 6.26% increase in EPA and a 1.2% increase in DHA (Chang,

P. L. Y. C., 2016). Arachidonic acid (20:4, n-6) concentration in PAM from piglets reared on

ARA-fed sows was 1.5-fold higher than control. Piglets that were raised on the EPA-fed sows demonstrated a 3.5-fold increase in 20:5n-3 compared to ARA and control treatment groups. The concentration of 20:4n-6 was 4-fold and 2.8-fold lower in PAM from the EPA treatment group compared to ARA and control respectively. Additional, 22:6n-3 was 3.8-fold higher in EPA-

PAM compared to ARA and 5-fold higher than control PAM. This study demonstrates that effective enrichment of long-chain PUFA in piglet alveolar macrophages can be achieved through supplementation of sow diet during the last 2 weeks of lactation.

The work recently described validates this current study, in which dietary LC PUFA is a practical approach to enriching the PUFA content of PAM. Further research is warranted to establish the impact of dietary LC PUFA on overall health status, proper dosage and duration, and intended infectious disease targets prior to administration in a commercial setting.

126

Continuous research of alternative means to control PRRSV infection is needed. Future work could extend into additional strains, full health impact, and field studies.

Improving animal health, through long-chain PUFA supplementation could improve quality and quantity of product for the swine industry. The swine industry strives to produce high quality pork products. Outbreaks of respiratory diseases have severe negative impacts on swine health, production and profit for the infected farms. A more comprehensive understanding of the porcine immunological response to respiratory pathogens, and development of better mitigation strategies is needed to help reduce this impact. Portions of the previously discussed future perspectives have been described in detail for a USDA Postdoctoral Fellowship that is currently pending.

127

Literature Cited

Chang, P. L. Y. C. 2016. Strategic use of lipids to improve health and productivity in pigs and sows. Doctoral dissertation, North Carolina State University.

Halbur, P. 2016. Porcine Respiratory Disease Complex. https://projects.ncsu.edu/project/swine_extension/healthyhogs/book1997/halbur2.htm (Accessed 4 2017.)

128

USDA. 2015a. Part I: Baseline reference of swine health and management in the united states, 2012. NAHMS Swine 2012. Retrieved March 8, 2018.

USDA. 2015b. Part II: Reference of swine health and health management in the united states, 2012. NAHMS Swine 2012. Retrieved March 8, 2018.

129

APPENDICES

130

Appendix A

Supplemental Table 1. Fatty acid composition brain tissue from pigs fed formulas varying in fatty acid composition.1-2 Diet CON LC n-6 LC n-3 SEM P-value

Fatty acid g/100g fatty acid3 14:0 0.85 0.87 1.63 0.44 0.39 16:0 36.07 33.30 32.90 1.28 0.25 16:1 1.20 1.10 1.0 0.10 0.50 18:0 33.44 34.60 38.05 3.51 0.66 18:1 13.23 13.01 13.50 1.74 0.90 18:2 (n-6) 1.41 0.91 1.18 0.17 0.18 18:3 (n-6) 0.05 2.54 0.00 1.54 0.44 18:3 (n-3) 0.02 0.00 0.12 0.06 0.43 20:0 0.48 0.22 0.29 0.09 0.15 20:1 0.60a 0.30b 0.28b 0.08 0.03 20:2 0.49 0.30 0.30 0.08 0.17 20:4 (n-6) 9.98 11.06 8.95 1.22 0.49 20:3 (n-3) 0.03 0.00 0.06 0.04 0.54 20:5 (n-3) 0.22a 0.07b 0.71a 0.15 0.02 22:0 0.56 0.47 0.41 0.07 0.39 22:1 0.19 0.13 0.14 0.04 0.68 22:6 (n-3) 1.16 0.57 1.18 0.37 0.45 Total 100 100 100 MUFA 15.22 14.48 14.98 1.80 0.90 PUFA 13.37 16.12 11.79 1.92 0.30 n-3 FA 1.45 1.35 1.34 0.39 0.90 n-6 FA 11.93 14.77 10.45 1.93 0.30 n-3:n-6 0.92 0.10 0.24 0.44 0.36 1 Diets contained 0.5% ARA (CON), 2.2% ARA or 3.0% EPA of total fatty acids. 2Values are least-square means and SEM, n=8. CON, control; ARA, arachidonic acid; EPA, eicosapentaenoic acid; FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acids. 3Values represent wt % of total identified fatty acids. a,b,cMeans within a row lacking a common letter differ, (P< 0.05).

131

Supplemental Table 2. Fatty acid compostion of liver tissue from pigs fed formulas varying in fatty acid 1-2 composition. Diet CON LC n-6 LC n-3 SEM P-value

Fatty acid g/100g fatty acid3 14:0 1.10a 0.82b 0.68b 0.08 0.01 16:0 22.73a 20.43b 19.88b 0.55 0.01 16:1 0.87a 0.24b 0.20b 0.08 <.0001 18:0 31.57a 35.88b 39.21c 0.69 <.0001 18:1 11.08a 8.37b 8.56b 0.32 <.0001 18:2 (n-6) 15.11ab 13.65b 17.26a 0.90 0.03 18:3 (n-6) 0.20a 0.03b 0.06b 0.04 0.05 18:3 (n-3) 0.21 0.13 0.25 0.06 0.42 20:0 0.22 0.13 0.17 0.05 0.57 20:1 0.12 0.00 0.09 0.05 0.25 20:2 0.58a 0.15b 0.21b 0.05 <.0001 20:4 (n-6) 14.72a 19.08b 9.04c 0.46 <.0001 20:3 (n-3) 0.05a 0.00b 0.00b 0.01 0.01 20:5 (n-3) 0.17a 0.16a 2.86b 0.12 <.0001 22:0 1.02a 0.62ab 0.39b 0.19 0.04 22:1 0.07a 0.28b 0.05a 0.04 0.001 22:6 (n-3) 0.20 0.04 1.05 0.51 0.35 Total 100 100 100 MUFA 12.14a 8.91b 8.83b 0.39 <.0001 PUFA 31.23 33.13 31.40 0.65 0.11 n-3 FA 0.62a 0.33a 3.86b 0.63 0.002 n-6 FA 30.61ab 32.81b 27.54a 1.07 0.01 n-3:n-6 0.02a 0.01a 0.16b 0.04 0.02 1 Diets contained 0.5% ARA (CON), 2.2% ARA or 3.0% EPA of total fatty acids. 2Values are least-square means and SEM, n=8. CON, control; ARA, arachidonic acid; EPA, eicosapentaenoic acid; FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acids. 3Values represent wt % of total identified fatty acids. a,b,cMeans within a row lacking a common letter differ (P< 0.05).

132

Supplemental Table 3. Fatty acid compostion of spleen tissue from pigs fed formulas varying in fatty acid composition.1-2

Diet CON LC n-6 LC n-3 SEM P-value

Fatty acid g/100g fatty acid3 14:0 4.40a 1.27b 1.46b 0.25 <0.0001 16:0 25.39 26.99 25.65 1.07 0.64 16:1 1.12a 0.22b 0.30b 0.07 <0.0001 18:0 14.66a 22.22b 23.84b 1.52 0.01 18:1 40.10a 25.25b 25.40b 1.36 <0.0001 18:2 (n-6) 8.48ab 7.29b 12.70b 1.33 0.04 18:3 (n-6) 0.09a 0.03ab 0.00b 0.02 0.04 18:3 (n-3) 0.44a 0.00b 0.00b 0.08 0.01 20:0 0.23 0.44 0.16 0.21 0.69 20:1 0.35 0.12 0.16 0.10 0.41 20:2 0.11 2.20 0.23 1.08 0.44 20:4 (n-6) 1.88a 11.82b 6.35c 0.58 <0.0001 20:3 (n-3) 0.05 0.28 0.01 0.14 0.45 20:5 (n-3) 0.35a 0.16a 2.63b 0.17 <0.0001 22:0 0.34a 1.09b 0.64ab 0.14 0.03 22:1 0.24 0.18 0.04 0.09 0.40 22:6 (n-3) 1.78 0.46 0.49 0.51 0.31 Total 100 100 100 MUFA 41.81a 24.60b 26.10b 1.50 <0.0001 PUFA 13.18a 22.01b 22.41b 1.78 0.02 n-3 FA 2.62 0.84 2.60 0.65 0.193 n-6 FA 10.56a 21.18b 19.81b 1.67 0.01 n-3:n-6 0.05a 0.03b 0.13ab 0.11 0.08

1 Diets contained 0.5% ARA (CON), 2.2% ARA or 3.0% EPA of total fatty acids. 2Values are least-square means and SEM, n=8. CON, control; ARA, arachidonic acid; EPA, eicosapentaenoic acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acids. 3Values represent wt % of total identified fatty acids. a,b,cMeans within a row lacking a common letter differ (P <0.05).

133

Appendix B

Supplemental Table 1. Fatty acid composition of porcine alveolar macrophages (PAM) from sow- reared piglets.1,2

Fatty acid, g/100g FA

Diet Control 2% ARA 2 % EPA P - Value

14:0 1.25 ± 0.14 0.28 ± 0.14 0.46 ± 0.24 0.0003 16:0 49.93 ± 2.51 49.58 ± 2.51 51.01 ± 2.51 0.92 16:1 1.00 ± 0.09 a 0.51 ± 0.09 b 0.82 ± 0.09a 0.01 18:0 19.92 ± 0.96 18.42 ± 0.96 19.97 ± 0.96 0.45 18:1 13.40 ± 0.85 11.33 ± 0.85 13.83 ± 0.85 0.12 18:2 1.51 ± 0.56 a 1.32 ± 0.56 a 4.28 ± 0.56 b 0.003 18:3 (n-6) 0.39 ± 0.13 0.39 ± 0.13 0.39 ± 0.13 0.16 18:3 (n-3) 0.00 0.00 0.00 20:0 0.32 ± 0.70 1.49 ± 0.70 0.17 ± 0.70 0.37 20:1 0.33 ± 0.26 0.52 ± 0.26 0.08 ± 0.26 0.50 20:2 0.43 ± 0.23 0.47 ± 0.23 0.11 ±0.23 0.49 20:4 (n-6) 9.70 ± 1.44 a 14.32 ± 1.44 b 3.49 ± 1.44 c 0.0003 20:3 (n-3) 0.00 0.00 0.00 20:5 (n-3) 0.00 ± 0.36a 0.00 ± 0.36a 3.47 ± 0.36b < 0.0001 22:0 1.59 ± 0.24 1.26 ± 0.24 1.35 ± 0.24 0.62 22:1 0.04 ± 0.02 0.03 ± 0.02 0.04 ± 0.02 0.83 22:6 (n-3) 0.18 ± 0.13a 0.24 ± 0.13a 0.91 ± 0.13b 0.002 Total 100 100 100 MUFA 14.77 ± 0.92 12.38 ± 0.92 14.77 ± 0.92 0.14 PUFA 12.22 ± 1.64 16.59 ± 1.64 12.27 ± 1.64 0.13 n-3 FA 0.18 ± 0.41a 0.24 ± 0.41a 4.38 ± 0.41b < 0.0001 n-6 FA 12.04 ± 1.52ab 16.35 ± 1.52a 7.89 ± 1.52b 0.01 n-3: n-6 0.01 ± 0.04a 0.02 ± 0.04a 0.55 ± 0.04b <0.0001 1 Values are least square means ± SEM. FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid. 2 Values represent weight % of total fatty acids. a,b,c;Means within a row lacking a common letter differ (P < 0.05).

134