Novel Insights Into the Mechanisms of Post-Infectious Irritable Bowel Syndrome Using Experimental Giardiasis

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2014-07-11 Novel Insights Into The Mechanisms Of Post-Infectious Irritable Bowel Syndrome Using Experimental Giardiasis

Halliez, Marie, C.M.

Halliez, M. (2014). Novel Insights Into The Mechanisms Of Post-Infectious Irritable Bowel Syndrome Using Experimental Giardiasis (Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/27133 http://hdl.handle.net/11023/1627 doctoral thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca THE UNIVERSITY OF CALGARY

THE UNIVERSITY OF ROUEN

Novel Insights Into The Mechanisms Of Post-Infectious Irritable Bowel Syndrome Using

Experimental Giardiasis

Marie C. M. Halliez

A COTUTELLE THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF DOCTOR OF PHILOSOPHY

DEPARTMENT OF BIOLOGICAL SCIENCES, UNIVERSITY OF CALGARY, CALGARY,

ALBERTA, CANADA

DEPARTMENT OF MEDICINE AND PHARMACY, UNIVERSITY OF ROUEN,

ROUEN, FRANCE

JULY, 2014

©Marie C.M. Halliez 2014 ABSTRACT

Irritable Bowel syndrome (IBS) is the most frequent functional gastrointestinal disorder in humans characterized by abdominal pain and altered bowel habits. The major pathophysiological features of IBS include: visceral hypersensitivity, intestinal barrier dysfunction, low grade inflammation appear following acute gastroenteritis despite the clearance of the inciting pathogen. This post-infectious (PI)-IBS may occur in patients following infection with bacteria such as C. jejuni, E. coli, Salmonella spp. Recent studies have implicated protozoan parasites such as Giardia duodenalis in the appearance of PI-IBS. G. duodenalis, the most common enteropathogen worldwide, is responsible for giardiasis, a disease causing intestinal malabsorption and diarrhea in a wide variety of species including humans. Using in vivo and in vitro models, the present study, established a proof-of-concept between Giardia-infection and the development of PI-IBS. This study also characterized one of the contributing mechanisms leading to post-giardiasis IBS. In a new neonatal immunocompetent rat model, the human assemblages of Giardia duodenalis caused a significant visceral hypersensitivity 50 days post-infection in two parts of the gastrointestinal tract. Visceral hypersensitivity was associated with mucosal structure modifications: villus atrophy and crypt hyperplasia after clearance of the pathogen. It was also associated with activation of the mucosal immune system as shown by an increase in intraepithelial lymphocytes and mast cell counts during the post-infectious stage. And with activation of the nociceptive signaling pathway by induction of c-fos expression starting at day 7 post-infection and continuing until the post-infectious stage. This study showed a dysfunction of the intestinal barrier, in vivo and in vitro, characterized by the translocation of commensal bacteria. Giardia-induced bacterial translocation, further characterized in vitro, was shown to occur via the paracellular route in conjunction with the degradation of the tight junctional proteins occludin and claudin-4. In conclusion, this study presented a new animal model of giardiasis eliciting PI-IBS symptoms. This study also showed that Giardia was able to induce the translocation of commensal bacteria through the epithelial monolayer via the paracellular route by degrading tight junctional proteins. This model suggest that the host immune system reactivity toward its own microbiota due to impaired intestinal barrier function seems to be one of the mechanisms contributing to post- infectious irritable bowel syndrome following acute giardiasis.

Acknowledgements

First I would like to thank my supervisors Dr. André Buret, Dr. Gilles Gargala and Dr. Loic Favennec for giving me the opportunity to work in their lab in this co-tutelle program. Working in both France and Canada was for me an amazing opportunity to develop new skills, learn new techniques and a new language. But let's not forget that it was also for me an amazing time abroad, which has allowed me to discover this great country that is Canada and the opportunity to meet those wonderful people that are Canadians. I would like to thank all my colleagues both in France and in Canada, for their welcoming and their help through this PhD. I wasn't always the most enthusiastic person with my bad moods and complaints, but I'm French what can I do..... Let's start with the University of Rouen where I did the first two years of my PhD. Gilles and Loic, thank you for choosing me to be your student, for your help and your kindness. Laëtitia thank you for your help especially with all those crazy animal studies, for the smoke breaks and the pint of Guinness after work, I had a great time with you and I'm really happy I had the opportunity to know you. Marie-Laure, my little trainee, thank you for all your help with those PCR, without you I would never have made it through. Thanks to Françoise for her help with the sequencing. Moving on to the University of Calgary I would like to thank Andre first, thank you for your enthusiasm, your support, your help, your availability, you are amazing don't change a bit. It really was a privilege for me to be part of your team. Thank you to all my colleagues and especially Amol and James for all your help with the in vitro studies, Jennifer for your help with my writing and your support, Kristen thank you for your help with the bacterial culture and the PCR, Troy we had such great moments and laughs over my animal studies, thank you for being here and for your help over this past two years, and sorry again for the little PFA incident...... Dr. T. for your kindness and your joy, and finally JP thank you for your help with my animal studies and the staining, you're a boss.

I would like to thank Dr. Doug Morck, Dr. Simon Hirota, Dr. Lash Gedamu. Dr. Norm Neumann, Dr. Nathalie Kapel, Dr. Gilles Gargala, Dr. Loic Favennec and Dr. André Buret for accepting to serve on my PhD supervisory and examination committees (Candidacy and defense). Thanks also to Dr. Tamia Lapointe and Dr. Christophe Altier, for your collaboration

iii and your help on the nociceptive part of this project, thank you both for your patience and understanding. Thanks to Dr. James Wasmuth, Dr. Jean-Paul Motta and Coralie Druelle for your help in editing parts of this document.

Cause you can't do a PhD without a Master, Anna, our little princess fairy doctor, my mentor, you taught me so much, thank you for your help with our little Pneumocystis. Coming to work at 6 am, finish at 11pm, spend two hours watching the FACS in the freezing room, the 45 minutes centrifuges starting at 8pm....the substractive hybridization.... those are so good memories I wouldn't change it for the world.

Finally, a huge thank you to Nicole and André for helping me in my move to Calgary, in finding a place to live and all the processes to adapt to this new life.

This work was supported by grants from the Natural Sciences and Engineering Research Council of Canada (individual operating and CREATE), the France-Canada Research Fund, and the "Ministère de l'enseignement supérieur et de la recherche" (French Ministry of secondary education and research).

Personal acknowledgements

Now I would like to thank all my friends and family for their support, I wouldn't be here today without you. Mom, Dad, and my "cat fish", thank you for always being here, helping me (especially with money, PhD student is really not a well paid job and life in Canada is quite expensive, I owe you big time), listening to me and keeping me on track.

Even though our lives took different paths there is two persons that I would like to thank cause without their encouragement at some point in my life I wouldn't have made it to a PhD, Datchu, thank you for convincing me to enter a biology degree, you were right to convince me to follow my dream, I wouldn’t be there today if it wasn't for you. Hervé, even though you think you weren't of any help, trust me you gave me the courage and the envy to keep going and enter a master research, you were there to help me when I was struggling with my exams I will never forget all you did for me and all the wonderful moments that we spent together you always will be in my heart.

To my "zozios" a huge thank you for being there, listening to my complaints, to sheer me up when I was feeling down, for the nights out, the drinks, the skypes, everything.

Coralie my best friend my sister of heart thank you for all your help your support your kindness and your friendship.

Georges, thank you for your craziness and love, you always make me laugh. Thank you for being there and listening to me so often.

Thierry, just because you are you. Our holidays in Digne, your yogourt, your technique to get out of my car, the nights at the raz playing darts.... So many memories

Mike, thank you for your kindness and your tenderness, you gave me strength when I needed it most, you'll always have a special place in my heart.

"Lapin" thank you for those amazing years, we met in our first year of biology I will never forget our great time together, and that "le lapin est passé par là" in our lecture theatre, the "pouf le cul" in front of the SN1 (when there was still water in those kind of ponds.....). For driving our

v physics teacher completely nuts. For all the nights studying (more or less); the letters during our exams, the tequila shots and the nights out. You are an amazing friend.

"Caillou" my crazy caillou we had such a great time together both at the University and with my little "crevette", it would'nt have been the same without you, you are awesome.

Georgette, as unlucky as I am, always something wrong with either of us... thank you it's because of you that I was able to went through this master degree.

Thibaut, thank you for still being here and listening to me when I need it, thanks for your advices for your time, for your visit, and for sharing your star with me.

Anthony, thank you for our long conversations in the night you always know how to make me smile again.

Thank you all. Mom, Dad, "Cat fish", Coralie, Thibaut, Hervé, Georges, Mike, Anthony, Lapin, Caillou, Georgette, Kris , Lily, Titron, Christophe, Anne-So, Aude, Claire, Abebe.

A big thank you to my roommate Jonathan for is patience and comprehension, especially this past few weeks. You are an amazing guy and I really enjoyed living with you

Finally a last thank you to Amanda and Lana, and to Tracy and Farley, I wouldn’t have been able to make it without horseback riding, it kept me sane and helped me relax during these tough times.

Remerciements personnels (en Français pour les non-anglophones)

Je tiens à remercier ma famille et mes amis pour leur soutien tout au long de ces années, je ne serais pas où j’en suis aujourd’hui sans vous. Maman, Papa, mon poisson chat, merci d’avoir et d’être toujours présents, de m’aider (particulièrement financièrement, étudiante en doctorat est loin d’être le boulot le mieux payé et la vie au Canada étant quelque peu hors de prix, j’ai une énorme dette envers vous), merci de m’avoir écoutée et aider à rester dans le droit chemin.

Même si aujourd’hui nos vies ont pris des chemins différents, il y a deux personnes que je tiens particulièrement à remercier car sans leurs encouragements à un certain point dans ma vie je ne serais pas en doctorat aujourd’hui. Datchu, merci de m’avoir convaincue d’entrer en DEUG de biologie, tu avais raison de me pousser à suivre mon rêve, je ne serais pas où j’en suis aujourd’hui si tu n’avais pas fait parti de ma vie. Hervé, même si tu penses ne pas avoir été d’une grande aide, crois moi tu m’as donné l’envie et le courage de continuer, de faire un master recherche et un doctorat. Tu étais là pour m’aider me réconforter, me soutenir durant mes examens, je n’oublierais jamais tout ce que tu as fais pour moi ainsi que tous les merveilleux moments que nous avons passé ensemble. Tu resteras à jamais dans mon cœur.

A mes zozios, un énorme merci pour toujours avoir été présents, m’écouter me plaindre et me remonter le moral quand je me sentais au 15ème sous sol, pour les soirées, les sorties, les skypes après mon déménagement à Calgary, bref merci pour tout.

Coralie, ma meilleure amie, ma sœur de cœur, merci pour ton aide toutes ces années, ton soutien, ton amitié, ta gentillesse, tu es la meilleure.

Georges, mon pti Georges, merci pour ton amitié, ton amour et ton pti grain de folie, tu arrives toujours à me faire rire. Merci d’avoir été là pour m’écouter si souvent.

Thierry, juste parce que tu es toi. Nos vacances à Digne, ton opercule de yaourt, ta technique pour sortir de ma voiture, nos soirées fléchettes au raz….. Tant de bons souvenirs….

Mike, merci de ta gentillesse et de ta tendresse, tu m’as donné de la force quand j’en avais le plus besoin. Tu auras toujours une place spéciale dans mon cœur.

vii

Lapin, merci pour ces supers années passées ensemble, nous nous sommes rencontrées durant notre première année de Biologie et je n’oublierais jamais les moments passés ensembles. Pour tous les "Le lapin est passé par là" en souvenir de nos vieux amphis, et les "pouf le cul" du mini bassin devant le SN1 (à l’époque où il y avait toujours de l’eau dedans….). Pour avoir rendu fou notre "charmant" prof de physique dans sa magnifique chemise de bucheron. Pour toutes les soirées à réviser (plus ou moins) avant les partiels, les lettres que l’on s’échangeait après les exams, les sorties et les shots de tequila. Tu es vraiment une amie merveilleuse.

Caillou, mon pti caillou, on a passé de tellement bons moments ensemble que ce soit à la fac ou avec ma crevette, ça n’aurait pas été pareil sans toi, tu es géniale.

Georgette, "poissarde for ever" tout comme moi, toujours quelque chose qui cloche que ce soit toi ou moi…. Merci c’est grâce à toi que j’ai survécu à ce master.

Thibaut, merci d’être toujours présent pour m’écouter me plaindre quand j’en ai besoin, merci pour tes conseils, le temps que tu m’accordes. Merci d’être venu me voir à Calgary et d’avoir partagé ton étoile porte bonheur avec moi. Je t’adore pti lou.

Anthony, merci pour nos longues conversations tu sais toujours comment me redonner le sourire.

Un grand merci à mon colocataire Jonathan, pour ta patience et ta compréhension en particulier ces dernières semaines. Tu es génial et j'ai vraiment apprécié de vivre en ta compagnie.

Merci à tous encore une fois, maman, papa, poisson chat, Coralie, Thibaut, Hervé, Georges, Mike, Anthony, Lapin, Caillou, Georgette, Anne-so, Kris, Lily, Titron, Christophe, Aude, Claire, Amanda, Abebe.

Un dernier grand merci à Amanda et Lana, ainsi que Tracy et Farley. Je n'aurais pas pu en arriver là sans monter à cheval, grâce à vous j'ai pu rester à peu près saine d'esprit et me détendre durant ces dures périodes.

viii

To my family,

To my mother,

for teaching me love and courage.

To my father,

for teaching me strength and will.

To my grand-parents,

for teaching me respect.

To my stepfather,

for teaching me confidence.

To Heliena,

for teaching patience and perseverance.

"Rien à perdre, tout à gagner"

Everything you taught me made this thesis reality.

TABLE OF CONTENTS

Approval Page i

Abstract ii

Acknowledgments iii

Table Of Contents x

List Of Tables xvii

List Of Figures xviii

Appendices xx

List Of Abbreviations xxi

1. Introduction 1

1.1. Physiology Of The Gastrointestinal Tract 1

1.1.1. Microbiota 2

1.1.2. Digestive And Absorptive Functions Of The Intestine 4

1.1.3. Motility 6

1.1.4. Secretions 8

1.1.5. Barrier Function Of The Intestine 10

1.1.5.1. Epithelial Tight Junctions 11

1.1.5.2. Epithelial Adherens Junction 13

1.1.5.3. Desmosomes 13

1.1.5.4. Gap Junctions 14

1.1.6. Immunology Of The Intestine 16

1.2. Pathophysiology Of The Gastrointestinal Tract 19

1.2.1. Chronic Gastrointestinal Disorders 19

1.2.1.1. Functional Gastrointestinal Disorders 19

1.2.1.1.1. Functional Dyspepsia 19

1.2.1.1.2. Irritable Bowel Syndrome 20

1.3. Irritable Bowel Syndrome 20

1.3.1. Epidemiology 21

1.3.2. Classification 22

1.3.3. Clinical Manifestations 22

1.3.3.1. Visceral Pain 23

1.3.3.2. Constipation And / Or Diarrhea 24

1.3.3.3. Bloating 24

1.3.3.4. Associated Gastrointestinal And Non Gastrointestinal Symptoms 24

1.3.3.4.1. IBS And Other Gastrointestinal Disorders 25

1.3.3.4.2. IBS And Other Extra-Intestinal Disorders 25

1.3.3.4.2.1. Fibromyalgia 26

1.3.3.4.2.2. Chronic Fatigue Syndrome 26

1.3.3.4.2.3. Chronic Pelvic Pain 27

1.3.3.4.2.4. Sexual Dysfunction 27

1.3.3.4.2.5. Psychological / Phychiatric Co-Morbidity 27

1.3.4. Diagnostic 28

1.3.5. Pathophysiology 32

1.3.5.1. Gastrointestinal Motility 32

1.3.5.2. Visceral Hypersensitivity 33

1.3.5.3. Neurogenic Inflammation In IBS 34

1.3.5.4. Activation Of The Mucosal Immune System 38

1.3.5.5. Microbiota And Brain-Gut Axis Alterations 39

1.3.6. Treatment 41

1.3.6.1. Dietary Treatment 42

1.3.6.2. Psychological And Behavioral Therapy 42

1.3.6.3. Pharmacological Treatments 42

1.4. Post-Infectious Irritable Bowel Syndrome 45

1.5. Giardia Duodenalis And Giardiasis 46

1.5.1. Pathophysiology Of Giardiasis 47

1.5.2. Long Term Consequences Of Giardiasis 49

1.5.2.1. Extra-Intestinal Pathologies 49

1.5.2.1.1. Ocular Pathologies 50

1.5.2.1.2. Arthritis 50

1.5.2.1.3. Allergies 53

1.5.2.1.4. Muscular Complications 53

1.5.2.2. "Metabolic" Consequences 54

1.5.2.2.1. Nutritional Consequences 54

1.5.2.2.1.1. Failure To Thrive 55

1.5.2.2.1.2. Stunting 56

1.5.2.2.2. Impaired Cognitive Functions 57

1.5.2.2.3. Chronic Fatigue Syndrome 59

1.5.3. Chronic Gastrointestinal Disorders 59

1.5.3.1. Functional Gastrointestinal Disorders 61

xii

1.5.3.2. Post-Giardiasis Irritable Bowel Syndrome 61

1.5.4. Cancer 62

1.6. Significance And Clinical Relevance 64

1.7. Hypothesis 66

1.8. Objectives Of This Study 66

2. Methods & Materials 68

2.1. In Vivo Experiments 68

2.1.1. Giardia Duodenalis Isolates 68

2.1.2. Animal Model 69

2.1.2.1. Infection 69

2.1.2.2. Infection Assessment 72

2.1.2.2.1. Microscopic Observation 72

2.1.2.2.2. Assemblage Identification By PCR 72

2.1.2.2.2.1. Trophozoites Isolation 72

2.1.2.2.2.2. DNA Extraction 72

2.1.2.2.2.3. PCR 73

2.1.2.2.2.4. Nested PCR 73

2.1.2.2.2.5. Sequencing 74

2.1.2.2.2.5.1. PCR Products Purification 74

2.1.2.2.2.5.2. Sequencing 74

2.1.2.3. Intestinal Histology 74

2.1.2.4. Whole Gastrointestinal Tract Motility 75

2.1.2.5. Neuronal Activation 76

xiii

2.1.2.5.1. Whole Animal Fixation 76

2.1.2.5.2. Spinal Cord Staining 76

2.1.2.5.3. PCR 77

2.1.2.5.3.1. Sampling 77

2.1.2.5.3.2. RNA Extraction 77

2.1.2.5.3.3. cDNA Synthesis 78

2.1.2.5.3.4. qPCR 78

2.1.2.6. Bacterial Translocation 79

2.1.2.6.1. Plating 79

2.1.2.6.2. Fluorescent In Situ Hybridization 81

2.1.2.6.2.1. Sampling And Fixation 81

2.1.2.6.2.2. Deparaffinization 81

2.1.2.6.2.3. Hybridization 81

2.1.2.7. Visceral Hypersensitivity 81

2.2. In Vitro Experiments 85

2.2.1. Giardia Duodenalis Isolate 85

2.2.2. Cell Culture 85

2.2.3. Bacterial Translocation 85

2.2.4. Bacterial Internalization 86

2.2.4.1. Gentamicin Assay 86

2.2.5. In Vitro Permeability 86

2.2.5.1. Fluorescein Isothiocyanate-Dextran Assay 86

2.2.6. Tight Junctions Integrity 87

xiv

2.2.6.1. Whole Cell Extraction And Standardization 87

2.2.6.2. Immunoblotting 87

2.3. Statistical Analysis 88

3. Results 89

3.1. Development Of An Animal Model Suitable For The Study Of Post-Giardiasis IBS

3.1.1. Giardia Infection Model 89

3.1.2. Visceral Hypersensitivity To Distension 89

3.1.2.1. Rats Infected With WB Giardia duodenalis Assemblage A (WB) 90

3.1.2.2. Rats Infected With Giardia duodenalis Assemblage B (H3) 90

3.1.3. Whole Gastrointestinal Transit 96

3.1.4. Intestinal Histology Analysis 96

3.1.4.1. Giardia Duodenalis Infection Induces Modification Of The Mucosal

Structure 96

3.1.4.1.1. Duodenal Observations 97

3.1.4.1.2. Jejunal Observations 97

3.1.4.2. Giardia duodenalis Infection Induces Variations In Jejunal

Intraepithelial Lymphocytes Counts 104

3.1.4.3. Giardia duodenalis Infection Induces Mucosal Mast Cells Infiltration

In The Jejunum 50 Days Post-Infection 104

3.1.5. Giardia duodenalis Infection Induces An Activation Of The Neuronal

Signaling 104

3.2. Identification Of The Contributing Factors Leading To PI-IBS 113

3.2.1. Giardia duodenalis Assemblage A Facilitates The Translocation Of

Commensal Bacteria Through The Intestinal Epithelium 113

3.2.1.1. Plating 113

3.2.1.2. Fluorescent In-Situ Hybridization 117

3.3. Characterization Of The Mechanisms Leading To Post-Giardiasis IBS 117

3.3.1. Giardia duodenalis Assemblage A Facilitates The Translocation Of Non-

Invasive E. coli Through Confluent Epithelial Monolayers 117

3.3.2. Giardia duodenalis Assemblage A Does Not Modify Bacterial Transcellular

Translocation 126

3.3.3. Epithelial Permeability Is Not Modified In Presence Of Giardia 129

3.3.4. Giardia duodenalis Assemblage A Induces The Degradation Of The Tight

Junctional Proteins Occludin And Claudin-4 129

4. Discussion 137

4.1. Summary 151

4.2. Future Directions 151

5. Conclusions 154

6. References 157

7. Appendices 213

Appendix I 213

xvi

LIST OF TABLES

Table 1. Irritable bowel syndrome - associated gastrointestinal and non gastrointestinal symptoms 29

Table 2. Manning criteria for the diagnostic of Irritable Bowel Syndrome 30

Table 3. Rome I criteria for the diagnostic of Irritable Bowel Syndrome 30

Table 4. Rome II criteria for the diagnostic of Irritable Bowel Syndrome 31

Table 5. Rome III criteria for the diagnostic of Irritable Bowel Syndrome 31

Table 6. Pathophysiological effects of Giardia duodenalis and their action mechanisms 52

Table 7. Metabolic consequences post-giardiasis observed worldwide 60

Table 8. Primer sequences of GAPDH and c-fos 80

xvii

LIST OF FIGURES

Figure 1. Structure of the Apical Junctional Complex 15

Figure 2.1. Giardia duodenalis infectious stages 70

Figure 2.2. Diagram of the visceral hypersensitivity model via blood pressure variation analysis in response to balloon distension 83

Figure 3.1. Giardia duodenalis assemblage A induces visceral hypersensitivity in the jejunum and rectum 50 days post-infection 92

Figure 3.2. Giardia duodenalis assemblage B induces visceral hypersensitivity in the jejunum and rectum 50 days post-infection 94

Figure 3.3. Giardia infection does not modify the gastrointestinal transit time in rats 98

Figure 3.4. Giardia assemblages A and B induces villus atrophy at D50 PI and Giardia assemblage B induces crypt hyperplasia at D7 and D21 PI in the duodenum 100

Figure 3.5. Giardia assemblage B induces villus and crypt hyperplasia at D21 PI in the jejunum 102

Figure 3.6. Giardia induces an increase in intraepithelial lymphocytes in the jejunum 50 days post-infection with either assemblage A or B 105

Figure 3.7. Giardia induces mast cell infiltration in the jejunum 50 days post-infection with either assemblage A or B 107

Figure 3.8. Representative micrograph of Giardia induction of c-fos expression in the dorsal horn neurons at day 7PI 109

Figure 3.9. The expression of c-fos mRNA of the infected rats was significantly higher 7 and 50 days post-infection 111

xviii

Figure 3.10. Giardia-infected animals showed a significant translocation of commensal bacteria through the intestinal epithelium in both liver and spleen during the acute stage of the disease 114

Figure 3.11. Infiltration of commensal bacteria into the colonic mucosa during the acute stage (D7 PI) 118

Figure 3.12. Infiltration of commensal bacteria into the colonic mucosa during the clearance stage (D21 PI) 120

Figure 3.13. Infiltration of multiple commensal bacteria into the colonic mucosa during the post-infectious stage (D50 PI) 122

Figure 3.14. Giardia duodenalis assemblage A facilitates the translocation of non-invasive E. coli HB101 across confluent intestinal epithelial monolayers 124

Figure 3.15. Giardia duodenalis assemblage A does not induce E. coli HB101 internalization in confluent Caco-2 monolayers 127

Figure 3.16. Giardia duodenalis seems to increase the epithelial permeability of confluent Caco-2 monolayers 130

Figure 3.17. Giardia duodenalis induces the degradation of the tight junctional protein occludin at 1, 2, 3 and 6 hours post-infection 133

Figure 3.18 Giardia duodenalis induces the degradation of the tight junctional protein claudin-4 at 1, 2, 3 and 6 hours post-infection 135

xix

APPENDICES

Appendix I: TYI-S-33 Giardia culture media 213

LIST OF ABBREVIATIONS

5-HT ==> 5-Hydroxytryptamine

Ags ==> Antigens

AJC ==> Apical Junctional Complex

ANOVA ==> Analysis Of Variance

BD ==> Becton Dickison

BGA ==> Brain Gut Axis

Ca2+ ==> Calcium

CCK ==> Cholecystokinin

CDx ==> Cluster of Differenciation (CD3+, CD4+, CD8+, CD25+)

CD ==> Crypt D

CFS ==> Chronic Fatigue Syndrome

CFU ==> Colony-Forming Unit

CGRP ==> Calcitonin Gene Related Peptide

Cl- ==> Chloride

CNS ==> Central Nervous System

CPP ==> Chronic Pelvic Pain

CVID ==> Common Variable Immunodeficiency

D ==> Day

Da ==> Dalton

DAPI ==> 4',6'-Diamidino-2-Phenylindole

DC(s) ==> Dendritic Cell(s)

DMSO ==> Dimethyl Sulfoxide

DNBS ==> Dinitrobenzene Sulfonic Acid

xxi dNTP ==> deoxynucleoside Triphosphate

DNA ==> Desoxyribonucleic Acid

DRG(s) ==> Dorsal Root Ganglion(s)

DSS ==> Dextran Sulfate Sodium

EMG ==> Electromyographic

FBS ==> Fetal Bovine Serum

FD ==> Functional Dyspepsia

Fe2+ ==> Fer

FGID ==> Functional Gastrointestinal Disorders

FITC ==> Fluorescein Isothiocyanate

FTT ==> Failure to Thrive

GE ==> Gastroenteritis

GERD ==> Gastroesophageal Reflux Disease

GI ==> Gastrointestinal

H2S ==> Hydrogen Sulfide

HAZ ==> Height-for-Age

HCl ==> Hydrochloride acid

- HCO3 ==> Bicarbonate

HLA ==> Human Leukocyte Antigen

HRP ==> Horseradish Peroxidase

IBD ==> Inflammatory Bowel Disease

IBS ==> Irritable Bowel Syndrome

IBS-A ==> Alternating bowel pattern - Irritable Bowel Syndrome

IBS-C ==> Constipation predominant - Irritable Bowel Syndrome

IBS-D ==> Diarrhea predominant - Irritable Bowel Syndrome

xxii

IBS-M ==> Mixed bowel pattern - Irritable Bowel Syndrome

IBS-U ==> Unspecified Irritable Bowel Syndrome

IEC(s) ==> Intestinal Epithelial Cell(s)

IEL(s) ==> Intraepithelial Lymphocyte(s)

Ig ==> Immunoglobulin

IL ==> Interleukin

JAM(s) ==> Junctional Adhesion Molecule(s)

K+ ==> Potassium kDa ==> Kilo Dalton

LB ==> Luria-Bertani (or Lysogeny Broth)

LPS ==> Lipopolysaccharide

LTA ==> Lipoteichoic Acid

MAGUK ==> Membrane-Associated Guanylate Kinase homologue family

M cells ==> Microfold Cells

MEME ==> Minimum Essential Media with 1X Earle's salt

MHC ==> Major Histocompatibility Complex

MLC ==> Myosin Light Chain

MLCK ==> Myosin Light Chain Kinase

MLN(s) ==> Mesenteric Lymph Node(s)

MO ==> Mustard Oil

MOI ==> Multiplicity of Infection mRNA ==> messenger Ribonucleic Acid

Na+ ==> Sodium

NaCl ==> Sodium Chloride

NK ==> Natural Killer

xxiii

P ==> P value

PAMP(s) ==> Pathogen-Associated Molecular Pattern(s)

PAR(s) ==> Protease-Activated Receptor(s)

PBS ==> Phosphate Buffer Saline

PCR ==> Polymerase Chain Reaction

PDZ ==> Post synaptic density protein (PSD95), Drosophila disc large tumor suppressor (Dlg1), and Zonula Occludens-1

PFA ==> Paraformaldehyde

PGN ==> Peptidoglycan

PI ==> Post-Infection

PI-IBS ==> Post-Infectious Irritable Bowel Syndrome

PRR(s) ==> Pattern Recognition Receptor(s) qPCR ==> quantitative Polymerase Chain Reaction

RegIIIγ ==> Regenerating islet-derived protein 3-gamma

RIPA ==> Radio-Immunoprecipitation Assay buffer

RNA ==> Ribonucleic Acid

RT-qPCR ==> Reverse Transcription - quantitative PCR

SEM ==> Standard Error of the Mean

SDS ==> Sodium Dodecyl Sulfate

SST ==> Somatostatin

TBS ==> Tris Buffer Saline

TBS-T ==> Tris Buffer Saline with 0.1% Tween

TER ==> Transepithelial Electrical Resistance

TJ ==> Tight Junction

TLR(s) ==> Toll-Like Receptor(s)

xxiv

TNBS ==> Trinitrobenzene Sulfonic Acid

TPI ==> Triose Phosphate Isomerase

TRP ==> Transient Receptor Potential

TRPA1 ==> Transient Receptor Potential cation channel A1

TRPV1 ==> Transient Receptor Potential cation channel Vanilloid 1

TRPV4 ==> Transient Receptor Potential cation channel Vanilloid 4

VH ==> Villus Height

WAZ ==> Weight-for-Age

WHO ==> World Health Organization

WHZ ==> Weight-for-Height

XLA ==> X-Linked Agammaglobulinemia

ZO ==> Zonula Occludens

xxv

1. Introduction

1.1. Physiology Of The Gastrointestinal Tract

The intestine serves two major functions, digestion and absorption of the nutrients the body requires, as well as acting as a barrier which excludes potentially harmful agents from the internal environment and a key role in immunity. The Gastrointestinal (GI) tract consists of multiple layers and multiple cell types. Intestinal epithelial cells (IECs) that line the luminal surface of the GI tract constitute a layer of defense. There are a number of different cell types contained within the IEC barrier, including: absorptive enterocytes, microfold (M) cells which transport antigens (Ags) through pinocytosis to the Peyer's patches (secondary mucosal- associated lymphoid tissue), enteroendocrine cells that produce GI hormones and neuropeptides

(such as serotonin and secretin), goblet cells that produce the mucus layer and paneth cells situated in the crypt of Lieberkuhn, producing antimicrobial factors. These cells cooperatively form a physical and immunological network for the creation and maintenance of proper homeostasis, which refers to a dynamic balance in the GI tract between tolerance and inflammation [1–3]. Beneath the epithelium is the lamina propria, second defense layer, which contains dendritic cells that can sample the luminal content and may present Ags to T-cells present in the lamina propria as well as to macrophages [2–4]. Finally separating the intestinal epithelial cells and the commensal microbiota is a single protective layer of mucus. The epithelium must act as a selective, semi-permeable barrier, letting through the intestinal barrier nutrients, electrolytes, vitamins and minerals necessary for the organisms while protecting against the invasion of unwanted materials and microbes.

1.1.1. Microbiota

The mucosal surface of all higher animals are colonized by diverse microbial communities, composed mainly of bacteria, but also includes archea, viruses, fungi and unicellular eukaryotes.

This complex microbial ecosystem is termed "microbiota", but is also referred as microflora or normal flora [5,6]. Those microorganisms, although covering all the mucosal surfaces, are found in majority in the GI tract. The vast majority of these organisms are living in symbiosis with their host; a symbiotic relationship is well established between the host and its commensal microbiota.

In fact, commensals play numerous essential roles for their host; they facilitate the metabolism of otherwise indigestible polysaccharides and produce essential vitamins. They are required for the development and differentiation of the host's intestinal epithelium and immune system. They confer protection against invasion by opportunistic pathogens; they can defend their mucosal home by directly combating invading pathogens or by mobilizing host antimicrobial immune defenses. Commensals microorganisms also have a key role in maintaining tissue homeostasis

[7,8]. Recent studies also revealed that the human microbiota influences the development and homeostasis of tissues other than the GI tract, including the bone and the brain [9,10]. The microbiota also benefits from this symbiotic relationship with their host as the GI tract is a nutrient-rich environment that is maintained at a constant temperature. However, it is also a dynamic habitat that undergoes constant and rapid changes in its physiological parameters due to variations in, for example, host diet, lifestyle, hygiene or use of antibiotics, which can affect gut microbial composition.

Humans are born either sterile or colonised with a very basic microbiota that is not necessarily still present in the adult gut. The microbiota is partly inherited from the mother and partly from exposure to the environment in the first two years of life [11]. Starting at birth, and depending on

the type of delivery (vaginal, cesarean), microbial colonization of the fetal intestine will have a strong impact on future colonization and establishment of the flora [5,12–14]. Alimentation also has a major impact in modifying the intestinal microbiota, changes in the feeding regimens of the infant are responsible for the variation in the microbiota during the first year of life [5,12,14].

The stable transition to an adult-like flora is observed around one year of age and follows the introduction of solid food in the feeding regimen of the child. The child microbiota is then heterogeneous and unstable along childhood, and will evolve during the growth, notably due to bacteria-bacteria interactions and selective pressure from the host and the environment [5,12,14].

Once established, the "normal" adult gut microbiota is dominated by anaerobic bacteria, which outnumber aerobic and facultative anaerobic bacteria by 100- to 1000-fold. The intestinal microbiota consists of approximately 500-1000 species that interestingly belong to only a few of the known bacterial phyla, although to date, there have been over 50 phyla described [8]. The human microbiota is dominated by two phyla: Firmicutes and Bacteroidetes, but other species present are members of the phyla Proteobacteria, Verrumicrobia, Actinobacteria, Fusobacteria and Cyanobacteria [5,8,15]. The microbial distribution in the GI tract is similar in all humans and follows a gradient of both density and diversity. The lowest density and diversity of microbial species are found in the proximal gut, and increase toward the distal gut to reach its maximum in the colon where the bacterial density can attain 1012 cells per gram of content. The majority of the bacterial species of the GI tract are found in the lumen, however, few but well-adapted species are able to adhere and reside within the mucus layer close to the tissue [5,8,16].

A total of about 1014 bacterial cells are present in the adult intestine, and their combined genomes, termed "microbiome", contain more than 5 million genes which provide a diverse range of biochemical and metabolic activities that complement host physiology. Commensal

bacteria are in fact essential for several aspects of host physiology, and their metabolic activity equals that of the liver, allowing the microbiota to be considered as an additional organ

[8,11,17,18].

1.1.2. Digestive And Absorptive Functions Of The Intestine

The primary function of the GI tract is the digestion of food into smaller absorbable nutrients.

The diet is composed by three major nutritive components: carbohydrates, proteins and fat presenting each different digestive and absorptive pathway in the GI tract. Food assimilation takes place primarily in the small intestine and is aided by anatomical modifications that increase the luminal surface area: kerkring's fold, villi and microvilli composing the brush border.

Digestion of complex carbohydrates, proteins and fats to absorbable monomer units' monosaccharide, amino acids and lipids respectively, is the first step in metabolic energy production as well as for the construction of cellular components. Carbohydrates that are ingested are in majority complex polysaccharides known as starches, and disaccharides such as sucrose and lactose to a lesser extent. Humans are unable to absorb carbohydrates in any form but the single unit monosaccharides (D-glucose, D-galactose, D-fructose); therefore, those carbohydrates must be broken down into these three monosaccharides to be absorbed. The digestion is actually the chemical breakdown of food by enzymes secreted by glandular cells in the mouth, chief cells in the stomach and exocrine cells of the pancreas. Once digested the food components can be absorbed following different pathway, absorption can occur via passive diffusion as it is the case for glucose. However dietary hexoses for example are too large to penetrate by passive diffusion and will use as major route of entry brush border membrane carrier systems (e.g. glucose and galactose are actively absorbed via a Sodium-dependent carrier system). Proteins are digested by endopeptidase activity to be reduced in peptides, dipeptides,

tripeptides and hexapeptides. Free, di- and tripeptides will then be absorbed by a mechanism similar to glucose, requiring a carrier system, sodium-dependent. However, hexapeptides are poorly absorbed and are instead hydrolysed by brush border peptidases to free amino acids or smaller absorbable peptides. Finally for the lipids, their assimilation occurs via a sequence of chemical and physical events that render water-insoluble molecules capable of being absorbed by passive diffusion. The enzymes involved in fat digestions are the lipases (food, lingual and pancreatic lipases) and bile salts. The water insoluble monoglycerides from lipolysis are solubilised within the hydrophobic center of the micelle; this is the micellar solubilisation which enhances the diffusion of poorly soluble dietary lipids through the unstirred aqueous layer overlying the enterocytes. Different mechanisms of lipid uptake by enterocytes have been proposed, one is the absorption of the entire micelle, another one is an equilibrium existing between lipids in the micellar phase and the aqueous phase, lipids in the aqueous phase may collide with and become incorporated into other micelles or may contact and diffuse through the brush border, shifting the equilibrium between products in the micelle and those in the unstirred layer causing further release from the micelle. Minerals and water enter the body through the intestine and provide the solutes and solvent water for body fluids. The electrolytes of primary

+ + - - 2+ 2+ importance includes: Na , K , HCO3 , Cl , Ca , Fe . Each of these ions has one or more transport mechanisms by which crossing the intestinal epithelium: passive diffusion through the lateral spaces and tight junctions; passive diffusion through pores; carrier-mediated transport; co- transport via pump (NaCl pump), electrogenic transported coupled to H+ influx, or neutral

- exchange (i.e. HCO3 ). The last components that must be absorbed are vitamins, which are compounds that cannot be manufactured by the body and are vital for metabolism. The solubility of the vitamins dictates the general mechanism by which they are absorbed, the most common

mechanism is passive diffusion also special transport mechanisms have also been identified such as pinocytosis or solubilisation within the bile salt micelles [19].

1.1.3. Motility

The main functions of the GI tract are directly related to motility. Gastric motility is the result of the activity of smooth muscle cells that are arranged in three layers: an outer longitudinal layer, a middle circular layer and an inner oblique layer. The stomach is divided into two major areas for motility: the orad portion comprises the fundus and a portion of the body and the caudad portion comprise the distal body and the antrum. The orad area presents little contractile activity and is concerned predominantly with accommodation of ingested material, via active relaxation. On the other hand, the caudad region exhibit marked activity with a primary contractile event named peristaltic contraction or retropropulsion which propelled back the content into the main body of the stomach. Vigorous contraction occurs every 3 to 5 minutes and constitute part of the migrating motility complex that occurs cyclically about every one and a half hours in humans to end by the gastric emptying step which regulated in a manner to allow optimum time for digestion and absorption of foodstuff from the small intestine [20].

Motility of the small intestine is organized to optimize the processes of digestion and absorption of nutrients. Thus contractions perform at least three functions: (i) mixing of ingested foodstuff with digestive secretions and enzymes, (ii) circulation of all intestinal contents to facilitate contact with the intestinal mucosa, (iii) net propulsion of the intestinal contents in an aboral direction. Contractions of the small intestine are caused by activities of two layers of smooth muscle cells: an outer layer with the long axis of longitudinally arranged cells and an inner layer with the long axis of circularly arranged cells. During musculature contraction, the lumen is

partially or totally occluded and pressure increases. Contraction produces intraluminal pressure waves, but sometimes other types of pressure waves can be observed: flow back proximal-distal in order to mix and circulate the content or aboral propulsion to move the content from the proximal to the distal part of the small intestine. The small intestine's contractions depend essentially on nervous activity (extrinsic and intrinsic neurons activity) and circulating or local chemical agents (epinephrine, serotonin, prostaglandins, gastrin, cholecystokinin (CCK), motilin, insulin and glucagon) [21].

Contractions of the large intestine are organized to allow for optimum absorption of water and electrolytes, aboral movement of contents, storage and orderly evacuation of feces. The large intestine is divided into caecum, ascending colon, transversal colon, descending colon, sigmoid colon, rectum and anal canal. Contractions of the large intestine are caused by activity of the muscular layers which are both composed of longitudinally and circularly arranged fibers. Flow of content from the small intestine to colon is intermittent and regulated partly by sphincteric mechanisms at the ileocaecal junction. When the ileo-cecal sphincter relaxes periodically, ileal contractions propels content into the large intestine, once the material reaches the proximal large intestine, it is acted on by a wide variety of contractions partly responsible for the haustrations seen in the colon. When the material reaches the descending and sigmoid colon it has changed from liquid to semi solid state. Although there are more frequent segmenting contractions in these intestinal portions, there is less absorption but no more propulsion which offer resistance and thus retards the flow of contents from proximal regions to the rectum, in which propulsion occurs during mass movement. Once in the rectum, the material is emptied or nearly so after rectosphincteric reflex (relaxation of the internal anal sphincter followed by voluntary contraction of the external sphincter).

The motility of the GI tract is very important for a well regulated transit and at least 4 different factors influence it: intrinsic smooth muscle properties, enteric nerves, extrinsic nerves and circulating or locally released chemicals. In some diseases, modification of the motility is one of the major features, for example in Irritable Bowel Syndrome. A decrease of segmentation in the sigmoid colon has been observed in patients suffering from IBS with diarrhea predominance and an exaggerated segmental contraction in the sigmoid colon in patient suffering from constipation predominant IBS [22].

1.1.4. Secretions

The proper functions of the GI tract require secretions from numerous organs: salivary secretion, gastric secretion, pancreatic secretion, bile secretion.

Saliva which contributes to normal digestion is produced by the salivary glands. They secrete initial saliva containing water, electrolytes and organic molecules such as amylase. Saliva cover two major functions: digestion (dissolve and wash away food particles, amylase helps in the breaking down of starch and lingual lipase play an important role in dietary lipids hydrolysis) and protection (dissolve and wash away retained food particles between teeth, saliva contains fluoride, calcium phosphate, iodine and chloride. It also contains an anti bacterial enzyme: lysozyme, which attack the microbial cell wall; a binding glycoprotein for Immunoglobulin (Ig)

A immunologically active against bacteria and viruses; and another antibacterial component: lactoferrin, which deprives organisms of nutrient iron) [23].

Gastric secretion plays an important role in digestion. The gastric juice is composed of 4 constituents secreted by various cells of the gastric mucosa: intrinsic factor, hydrogen ion, pepsin and mucus. The intrinsic factor is required for the absorption of vitamins by the ileal mucosa, the

presence of acid is necessary for the conversion of inactive pepsinogen to an active enzyme: pepsin, which in complement with acid begins the digestion of proteins, and also kills a large number of bacteria. The mucus lines the wall of the stomach and plays a protective role from physical damages by neutralizing small amount of acids and serves as a lubricant. Two types of glands are found: oxyntic glands which contain parietal cells producing hydrochloric acid and intrinsic factor as well as chief or peptic cells secreting pepsinogen; and pyloric glands which contains gastrin-producing cells and mucus cells which can also produce pepsinogen. During stomach distension by foodstuff and bathing of the gastric mucosa with certain chemicals, primarily amino acid and peptides starts the gastric phase and begin the gastric secretion necessary for the digestion [24].

Pancreatic enzymes are essential to normal digestion and absorption, the pancreatic secretion is exocrine and divided into an aqueous or bicarbonate component and an enzymatic component.

Essentially all the proteins present in the pancreatic juice are digestive enzymes. The pancreas produces insulin from β cells and glucagon from α cells in the Langerhans islets distributed throughout the pancreatic parenchyma. In addition, pancreas produces pancreatic polypeptide containing large amounts of somatostatin which may act as a paracrine to inhibit the release of insulin and glucagon. The pancreatic acinar cells synthesize and secrete the major enzymes necessary for proper digestion of all three primary nutritive components: pancreatic protease, amylase and lipase. Pancreatic secretion is primarily regulated by secretin, CCK and vago vagal reflexes but intestinal stimuli account for the most pancreatic secretion [24].

Secretion of bile is also necessary for the proper digestion and absorption of lipids as well as for the normal elimination of various endogenous products (i.e. cholesterol, bile pigments) and exogenously administered chemicals (phenotrazines and heavy metals). Bile is a complex

mixture of organic (bile acids i. e. carboxylic acids: cholic acid, chenodeoxycholic acid, deoxycholic acid and lithocholic acid; phospholipids: lecithins; cholesterol; bile pigments:

+ + 2+ - - bilirubin) and inorganic components (ions: Na ; K ; Ca ; Cl ; HCO3 ). Bile acids once in the small intestine take part in digestion and absorption of lipids. Most bile secretion occurs during digestion of a meal; however significant amounts are secreted periodically during fasting. As well as for other secretion, bile is swept aborally along the bowel by gallbladder and duodenal contractions both regulated by hormones such as CCK, gastrin or secretin [25].

1.1.5. Barrier Function Of The Intestine

To maintain proper homeostasis, specific mechanisms exist. Indeed, the GI lumen is constantly exposed to a plethora of foreign antigens (Ags) including those from food as well as microbial products of the commensal bacteria which can be either harmless or pathogenic. Therefore the

GI tract has to exert an important function: a barrier function which allows the passage of essential molecules and nutrients and at the same time prevents Ag-sized molecules from penetrating into the sub-epithelial compartment and abnormal activation of the immune system.

This barrier in the intestine has been first recognized over 130 years ago as a "terminal bar" at the apical edge of the epithelial cells but was thought to be a rigid and unchangeable structure

[26] and it's not until 1953 that the understanding of the terminal bar became clearer. Farquhar and Palade [27] described the terminal bar as a junctional complex consisting of three main components: zonula occludens, zonula adherens and macula adherens, each of which consists of a complex of several proteins.

In order to cross the intestinal barrier, substances can use two different routes, the transcellular or the paracellular route. The transcellular transport consists of the movement of material through the epithelial cells either via internalization of this material at the apical brush border membrane

by endocytosis, or facilitated or active transporters, or diffusion. Once internalized the substances are then moved through the cytoplasm to the basolateral membrane via a mechanism called transcytosis. Once at the basolateral membrane the material is then released via similar mechanisms. The paracellular transport of ions, nutrients, and immune cells across the GI epithelium is regulated by the Apical Junctional Complexes, including tight junctions and immediately subjacent adherens junctions. Apical Junctional Complexes also act as signaling molecules and intermediary scaffolds for intracellular signaling molecules, thus regulating several cellular functions including cell death, proliferation, differentiation, and migration

(reviewed by Matter & Balda [28]).

The maintenance of the homeostatic balance of the GI considerably relies on the integrity of the

Apical Junctional Complexes integrity (Figure 1).

1.1.5.1. Epithelial Tight Junctions

Epithelial tight junctions (TJ) are the most apical component of the apical junctional complexes and are formed by the interaction of over 40 distinct proteins or protein families. The first TJ component identified was Zonula Occludens (ZO)-1, a 220kDA cytosolic membrane-associated protein [29]. Two other ZO proteins were subsequently isolated, ZO-2 and ZO-3 [30,31]. ZO proteins are members of the membrane-associated guanylate kinase homologue family

(MAGUK), and contain a guanylate kinase domain, a Src homology (SH)3 domain, and three

PDZ domains specialized in proteins interactions [32–34] (Figure 1).

The first tight junctional transmembrane protein to be discovered was Occludin, a 65kDA protein

[35]. Occludin structure presents four transmembrane domains, two extracellular loops and intracellular N- and C- termini [35]. In order for occludin to localize at the tight junction, it needs

to be hyperphosphorylated [36]. Although occludin interacts intracellularly with all three members of the Zonula Occludens family, and extracellularly with equivalent loops on adjacent cells [30,32,37,38], occludin does not appear to be necessary to maintain either the structure or function of tight junctions [39,40] (Figure 1).

The Claudin family regroup at least 24 members of tight junctional transmembrane proteins.

Claudins are considered the main functional determinant of tight junction. They range between

20 and 27 kDa and are expressed in a tissue-specific manner [41]. Claudins possess four transmembrane domains, two extracellular loops and cytosolic N- and C-terminal tails, as observed for occludin. The C-terminal region of the claudin family proteins binds the PDZ domain of ZO-1 and ZO-2 intracellularly [42,43], essential interaction for the formation of the tight junctions. Indeed, Umeda et al. [44] showed that the deletion of ZO-1 and ZO-2 prevents the establishment of the barrier function in vitro by prohibiting the polymerization of claudins at the tight junction. The essential role of claudins in barrier function has been shown in several reports examining claudin-specific knockout mice. Thus, claudin-5-deficient mice exhibit decreased paracellular permeability to ions and develop megainstestine; claudin-1 and -5 deficient mice show severe newborn lethal phenotypes attributed respectively to abnormal skin water loss and blood-brain barrier defects [45–47] (Figure 1).

The last component of the tight junction consist of 38 kDa protein called junctional adhesion molecules (JAMs) which are single membrane-spanning domain proteins of the immunoglobulin gene superfamily. JAM-A appears to be the predominant isoform involved in tight junction structure and function and is expressed in both endothelial and epithelial cells [48,49].

Intracellularly, JAM-A interacts with the PDZ-2 and PDZ-3 domains of ZO-1 [48,49]. Cellular adhesion appears to result from JAM-A homophilic interactions between adjacent cells [50–53].

JAM-A plays an important role in tight junction structure and function in the GI tract [54].

Indeed, as shown by Laukoetter et al. [55] JAM-A deficiency results in increased epithelial permeability both in vitro and in vivo. (Figure 1)

1.1.5.2. Epithelial Adherens Junctions

Adherens junctions assure a role of cellular proximity, polarization and differentiation and are required for the formation of tight junctions [56] whose role is to seal the paracellular space between neighboring epithelial cells. Adherens junctions are composed of the following proteins: cadherins (transmembrane protein family), and catenin (alpha, beta, delta and gamma) linking protein between cadherin and actin cytoskeleton). They participate in cell-cell adhesion between adjacent epithelial cells via Ca2+-dependent homophilic binding of E-cadherin [57].

E-cadherin is a glycoprotein with five cadherin-motif domains, a single membrane-spanning domain, and a short intracellular tail interacting directly with the cytosolic protein β-catenin or the homologous γ-catenin, which are both anchored to the actin cytoskeleton via the intermediary of α-catenin [58–61] (Figure 1).

1.1.5.3. Desmosomes

Desmosome, also known as macula adherens form intermittent spot adhesions along the lateral membrane of the epithelial cells that anchor intermediate filaments to the plasma membrane.

These structures provide the mechanical plasticity to the epithelium, thus contributing to tissue homeostasis. Desmosomes also interact with signaling cascades to activate or suppress pathways important for cell polarity, shape and motility, proliferation and differentiation. Desmosomes comprise members of three gene families: cadherins, armadillo proteins and plakins. There are two types of desmosomal cadherins: desmogleins and desmocollins which have each several

isoforms. Human desmosome are composed of four desmogleins and three desmocollins isoformes. It was recently reported that demosomal cadherins may have differentiation-specific functions beyond their roles in intercellular adhesion [62–64]. Further studies are warranted to understand the desmosome dynamics.

1.1.5.4. Gap Junctions

Gap junction also called macula communicans are specialized intercellular connections that directly join the cytoplasm of two adjacent cells allowing the passage of various molecules and ions between cells. Intercellular communication through gap junctions is involved in the processes of tissue differentiation and homeostasis, in addition gap junctional communication has been involved in response to innate immune activation to inflammatory injury [65]. Gap junction is a dense aggregation of multimeric channels that are formed by 6 identical proteins named connexins. This channels are formed of two hemichannels (or connexons), either two identical (homotypic channel) or each containing a different connexon isomer (heterotypic channel)[66–68]. The formation of gap junctions requires close apposition of cell-membranes and is highly dependent on the cell-cell binding mediated by cellular adhesion molecules, cadherins or tight junction proteins. [69,70]. In addition, loss of gap junctional communication has been associated with cellular damage and inflammation resulting in compromise physiological functions [71]

Figure 1: Structure of the apical junctional complex

1.1.6. Immunology Of The Intestine

The immune system has to be able to discriminate between self and non-self antigens, while still retaining the ability to detect and eliminate invading pathogens. The mammalian immune system can be divided in two branches called innate and adaptive immunity. In order to maintain proper function and homeostasis in the GI tract, the mucosal immune system has developed numerous tools allowing it to protect the host from pathogenic infections while tolerating and strictly regulating the highly dense commensal microorganisms present in the lumen. Both these tasks require a recognition system of microbial organisms, pathogenic or non pathogenic. Detailed gut immune response has been extensively reviewed [3,72–74], hence this chapter focused on presenting the major players in mucosal immune response.

First, the mucus layer protects the epithelium from direct interaction with most but not all the bacteria (some bacteria such as segmented filamentous bacteria have the capacity to enter the mucus layer). Second the glycocalyx, produced by epithelial cells opposes most of the microorganisms negatively charged via its own negatively-charged epithelial cells. Paneth cells and epithelial cells also release numerous antimicrobial peptides (mainly lysozyme and α- defensins, phospholipase A2 and RegIIIγ) to control different class of microorganisms. Finally, epithelial cells, connected to each other by tight junctions, protect from the entry of microorganisms via the intercellular space and secrete β-defensins.

The innate immune system contains germline encoded pattern recognition receptors (PRRs) that detect shared microbial components termed pathogen-associated molecular patterns (PAMPs) which play crucial roles in survival, replication and pathogenesis. PAMPs can be microbial components such as peptidoglycans (PGN), lipoteichoic acid (LTA), lipopolysaccharide (LPS),

glycosylphosphatidylinositol, lipoproteins, surface glycoproteins, bacterial toxins or microbial nucleic acids (including DNA, unmethylated CpG motifs, double-stranded RNA, single-stranded

RNA). When the PRRs are activated by ligation with PAMPs, they launch immune and inflammatory responses and function as an important link between innate and adaptive immunity

[3]. PRRs discovered in the 1990's, called Toll-like receptors (TLRs) belong to a superfamily called the IL-1 Receptor/TLR superfamily and play an important role in protection against parasitic infection [75–79]. The NLR family of intracellular sensors comprise 22 members sharing a common tripartite organization: C-terminal leucine-rich repeats involved in ligand sensing, central nucleotide-binding and oligomerization domain and N-terminal protein-protein- interaction domain. Upon sensing a wide array of microbial or danger-asseociated molecular patterns (MAMPs and DAMPs), they undergo conformational changed to allow protein-protein interactions and signaling of adaptor molecules. These interactions lately drive the expression of inflammatory and anitmicrobial genes involved in both innate and adaptive immune response

(reviewed by Parlato & Yeretssian [80]). NOD1 and NOD2 are the first identified NLRs and play a mojor role in triggering innate immune signaling following bacterial sensing. NOD1 and 2 discriminate Gram-negative and Gram-postive bacteria by sensing specific peptidoglycan motifs

[81,82]. Their activation results in the production of an array of antimicrobial peptides as well as pro-inflammatory cytokines (TNF-α, IL-6) and chemokines (CCL2, CXCL8, CXCL2) [83–85]

Apart from NOD1 and NOD2, the other NLRs with cytosolic components such as protease caspase-1 and adaptor protein apoptosis-associated speck-like protein (ASC) form a protein complex called inflammasome that promoted the subsequent secretion of pro-inflammatory cytokines such as IL-1β and IL-18 and induce pyroptosis (a form of cell death induced bu bacterial pathogens). Inflammasome activation requires both TLRs and NLRs stimulation to

process pro-forms of the pro-inflammatory cytokines into their active mature forms. Rcent research emphasizes a significant role for NLRs in promoting intestinal health as they contribute to the maintain of intestinal mucosal integrity and homeostasis by controlling tolerance to the commensal microbiota and regulating inflammatory signaling events. Dendritic cells (DCs) and other mononuclear phagocytes densely populate the intestinal lamina propria and form a microbe-sensing network. DCs express a diverse repertoire of TLRs and their activation stimulates the secretion of cytokines and chemokines that in turn stimulates and coordinates the antimicrobial activity. Nucleotide-bondong oligomerization domain-like receptors (NLRs) act as intracellular sensors for infection and play critical roles in sensing the commensal microbiota, maintaining homeostasis and regulating intestinal inflammation.

Upon recognition of foreign antigens presented by the APC, DCs migrate to the mesenteric lymph nodes (MLNs) to initiate adaptive immune response. Antigens are then recognized by T lymphocytes through the TCR and activated T cells rapidly proliferate by clonal expansion, and migrate to the antigen presence site where they either produce cytokines (CD4+) or become cytotoxic (CD8+). CD4+ and CD8+ play a role in the production memory T cells. In addition

Regulatory T cells (Tregs) play a critical role role in the maintenance of peripheral tolerance, down-regulation of the immune response, prevention of autoimmune diseases. The majority of

Tregs are CD4+ T cells and are characterized by the constitutiv expression of CD25 and the transcription factor FoxP3 [86]. Neutrophils are a critical component of the early innate immune response to intestinal pathogens by phagocytising microbes and producing microbial factors.

Immunoglobulin (Ig) responses also play an important role in mucosal immunity; IgA produced in the intestinal epithelium and secreted in the lumen provides protection against microbes by neutralizing pathogenic bacteria and controlling commensals. The presence of high

concentrations of IgA in the mucus layer restricts commensal microbes from entering the lamina propria. Resting lymphocytes also express two types of membrane bound Ig: IgD and IgM that are associated with Igα and Igβ to form the BCR which initiate B cells activation upon recognition of foreign antigens. Once activated an increase in protein tyrosine kinases is observed resulting in the initiation of several distinct cell-signaling pathways such as Ras,

Phospholipase C and PI3 Kinase via various adaptor molecules. This signaling pathway results in the subsquent activation of protein kinases that ultimately activate transcription and production of plasma cells or memory B cells [87].

1.2. Pathophysiology Of The Gastrointestinal Tract

1.2.1. Chronic Gastrointestinal Disorders

1.2.1.1. Functional Gastrointestinal Disorders

Functional Gastrointestinal Disorders (FGID) represents a group of disorders characterized by recurring or chronic gastrointestinal symptoms without an identifiable disease process. FGID are disorders attributable to the middle or lower GI tact and include: Irritable Bowel Syndrome

(IBS), functional dyspepsia (FD), functional bloating, functional constipation, functional diarrhea and unspecified functional bowel disorders. Irritable bowel syndrome and functional dyspepsia are the best described FGID.

1.2.1.1.1. Functional Dyspepsia

Dyspepsia is a common disorder affecting up to 40 % of the general population and affects significantly the quality of life of patients [88,89]. The underlying cause of dyspepsia may include erosive esophagitis, peptic ulcer disease, or gastro-esophageal malignancy. However it is important to note that the majority of patients suffering from dyspepsia will have no structural

cause for their symptoms, and hence are labelled as having functional dyspepsia. A 5 year follow-up study showed that the majority of patients suffering from functional dyspepsia continue to have symptoms [90]. Dyspeptic symptoms are more likely to appear after an acute GI infection, and this association has been reported to be even stronger than that seen in IBS, with symptoms that can last for at least 8 years [91–93]. However, the cause of functional dyspepsia remains unclear and further studies are needed for a better understanding of the mechanistic pathophysiology of FD.

1.2.1.1.2. Irritable Bowel Syndrome

Irritable bowel syndrome will be detailed in the next section.

1.3. Irritable Bowel Syndrome

Irritable Bowel Syndrome (IBS) is the most common functional gastrointestinal disorder worldwide with a prevalence ranging between 7 and 10 % of the population [94–96]. In 1849,

Cumming reported for the first time observations in the bowels that lead later to the definition of irritable bowel syndrome: "The bowels are at one time constipated, another lax, in the same person. How the disease has two such different symptoms I do not profess to explain". Following this first statement, IBS has been described in several terms over the years: mucous colitis, spastic colitis, nervous colon or irritable colon [97]. In the 1970's Manning and colleagues [98] made the first attempt to establish diagnostic criteria to define IBS. To date, IBS as for other functional gastrointestinal disorders are defined by the Rome classification, three different Rome criteria have been established over the years. The Rome I criteria were published in 1990, the

Rome II in 1999 and finally the Rome III (more precise and specific than Rome II for pain) in

2006 [94]. According to the Rome II and III criteria IBS is characterized by abdominal pain with

symptoms such as cramping, bloating and discomfort, and altered bowel habits: diarrhea, constipation, or both in an alternate fashion with no mechanical, biochemical, organic, or overt inflammatory condition explaining these symptoms. Although the Rome II classification system defined only two subtypes of IBS, based on the symptoms (diarrhea predominant, i.e. IBS-D, and constipation predominant, i.e. IBS-C) [99] the Rome III criteria classify IBS into four subtypes

(IBS-D, IBS-C, mixed bowel pattern, i.e. IBS-M; or unsubtyped, i.e. IBS-U), based on predominant stool pattern using the Bristol Stool Form Scale [100,101].

1.3.1. Epidemiology

Irritable bowel syndrome prevalence is ranging between 3 and 20 % of the general population in

Western countries, but most studies reported a range between 10 to 15% [94–96]. Prevalence is estimated between 2.5 and 22% in United Kingdom; 4.4 and 13.6% in Spain; less than 10% in

Italy, France, Denmark and Sweden [102–105] and range between 5.7 and 10% in Asian countries such as China, Japan, Korea, India but can reach up to 16-45% in selected population

[106–108].

In most populations, IBS symptoms are more reported in women than men, independently of the diagnostic criteria employed. In women, IBS rates are approximately 1.5- to 3-fold higher than those seen in men. The overall prevalence in women is 14% compared to 8.9% in men [109,110].

Female patients also more frequently report associated symptoms such as headache, dizziness, backache, muscular soreness, inappetence, insomnia and fatigue while male report more frequently anxiety and depression [111]. Sex hormones may play a role in GI function and GI disorders. Sex hormones may influence peripheral and central regulatory mechanisms of the brain-gut axis involved in the pathophysiology of IBS and would be involved in the differences

between IBS female and male patients regarding symptomatology and comorbidities with other disorders (reviewed by Mulak et al., [112])

IBS occurs in all age groups, including children [113–115] and the elderly [116]. However, the majority of diagnosed-IBS patients are young adults (under 50 years old), and most often the diagnosis is done between 30 and 50 years old [117]. However a large proportion of IBS cases are underreported. Indeed, as IBS-associated symptoms are commonly experiences within the population, it has an insidious onset, and frequently does not result in medical care, resulting in a discrepancy between reported and overall incidence of IBS within the general population

[97,118,119]. Although IBS patients are usually diagnosed between 30 and 50 years old, symptoms persist beyond middle life and continue to be reported by a substantial proportion of individuals in their seventh or eighth decades [94].

1.3.2. Classification

Attempts have been made to subclassify IBS according to the predominant bowel habit: (i) diarrhea predominant IBS (IBS-D); (ii) constipation predominant IBS (IBS-C); (iii) mixed bowel patterns with both loose and hard stools in an alternate fashion (IBS-M or IBS-A); (iv) unsubtyped (IBS-U). Some individuals switch subtype over time, those are called "alternators".

Mostly patients with IBS-D or IBS-C switch to a mixed pattern [94,100,120–123]. About one third of the patients are IBS-D, one third IBS-C, and one-third to one-half are IBS-M, a small proportion of patients (4%) are IBS-U [94,123].

1.3.3. Clinical Manifestations

Symptoms expression in IBS is quite heterogeneous. The typical clinical presentation includes abdominal pain, discomfort, altered bowel habits (diarrhea and/or constipation), cramping and

bloating. Most patients experience symptoms intermittently with flares lasting 2 to 4 days followed by periods of remission [100].

1.3.3.1. Visceral Pain

Visceral pain is the major clinical feature of IBS and is the symptom influencing the quality of life, social functioning, and is the leading cause to consultation [95,117,124,125]. Visceral pain is typically diffuse and not easily located. It is often projected to cutaneous structures with somatic irradiation that makes the topographic diagnosis complicated. Visceral pain is defined by two types of pain: hyperalgesia characterized by an increased response to mechanic and thermal stimuli and linked to sensitization of peripheral nociceptor; allodynia, characterized by a painful response to normally non painful mechanic or thermal stimuli usually due to inflammation of the mucosa.

About 50% of patients believe that stress and eating aggravate their symptoms. Pain has been reported to be worsened after meal ingestion in 50% of occasion and this may represent either symptoms originating in the small intestine or an exaggerated colonic response to food. It may also reflect an increased sensitivity to intestinal distension induced by meal [94]. Food allergy may also be a contributing factor in visceral pain as many patients report aggravated pain after ingestion of certain types of food [100,126]. Pain is usually associated with a change in bowel movement frequency and stool form (suggesting a link to changes in intestinal transit, possibly reflecting changes in either motor patterns or secretion), and is relieved by defecation

(suggesting a colonic origin) [94,97,100].

1.3.3.2. Constipation And/Or Diarrhea

Altered bowel habits, abnormal stool form: hard and/ or loose and abnormal stool frequency

(more than 3 times a day or less than 3 times a week), straining at defecation, urgency, feeling of incomplete evacuation and passage of mucus are common in IBS.

Diarrhea predominant IBS (IBS-D) is defined by at least two of the following: (i) loose/watery stools at least 25 % of the time; (ii) lumpy/hard stools less than 25 % of the time; (iii) 3 or more bowel movement per day; (iv) urgency [94,100].

Constipation predominant IBS (IBS-C) is defined by at least two of the following: (i) lumpy/hard stools at least 25% of the time; (ii) loose/watery stools less than 25% of the time; (iii) feeling of incomplete evacuation at least 25% of the time; (iv) 3 or less bowel movement per week

[94,100].

Mixed bowel habit pattern (IBS-M) is defined by Rome III as individual who reports more than

25% of their stool as being loose/watery and more than 25% of their stool as being lumpy/hard in absence of laxatives or antidiarrheals agents [120,121,127].

1.3.3.3. Bloating

Bloating is reported up to 96% of IBS patients and can be associated to a visible abdominal distension. Although there is no physical signs of IBS, abdominal tenderness may be present

(tensing in the abdominal wall increase local tenderness associated with abdominal pain) [100].

1.3.3.4. Associated Gastrointestinal And Non-Gastrointestinal Symptoms

Numerous IBS patients often present with an increase risk of somatic comorbidities, which could possibly be caused by a common pathophysiological mechanism, although not elucidated yet.

Patients with IBS can also suffer from other gastrointestinal disorders such as functional dyspepsia, gastroesophageal reflux disease, functional constipation, anal incontinence, but can also present a broad variety of extra-intestinal comorbidities such as fibromyalgia, chronic fatigue syndrome, and chronic pelvic pain [128–130]. Some IBS patients can also present a comorbidity with psychiatric disorders, especially depression, anxiety, and somatoform disorders

[131–134].

1.3.3.4.1. IBS And Other Gastrointestinal Disorders

Many patients suffer from more than IBS; the most common functional disorder associated with

IBS is functional dyspepsia. Numerous studies have reported a high prevalence of overlap between IBS and FD, and recent studies reported the prevalence of both disorders to be between

15 and 42% [135–137]. In addition, patients with FD present an 8 fold increase in the prevalence of IBS. Furthermore, long-term follow ups studies of patients with IBS and FD have demonstrated that patients with IBS develop FD symptoms over time and vice versa [138].

IBS can also be associated with gastroesophageal reflux disease (GERD). Several studies have reported an overlap between IBS and GERD [139–143]. Furthermore, the concomitant presence of IBS in GERD patients predicted higher symptom ratings and lower quality of life both before and after proton pump inhibitor therapy [144].

1.3.3.4.2. IBS And Other Extra-Intestinal Disorders

Several non gastrointestinal symptoms have been reported in association to IBS; those include: heartburn, lethargy, headache, backache and genito-urinary symptoms (nocturia, urgency of micturition, incomplete bladder emptying, dyspareunia) [94,100,145,146]. Although these symptoms have been associated with IBS and can be used to improve the diagnosis accuracy,

none can be used as a sole diagnostic criterion [94,100]. These associated symptoms have also been reported to increase as the severity of IBS increases and may be associated with psychological factors [100,128]. (Table 1)

1.3.3.4.2.1. Fibromyalgia

Fibromyalgia is a soft tissue disorder characterized by diffuse musculoskeletal pain. Estimates of the prevalence of IBS in patients with fibromyalgia range from 30-35% [147] to high as 70 %

[148]. Fibromyalgia is considered a disorder of somatic hypersensitivity while IBS is considered a disorder of visceral hypersensitivity, thus Chang et al., [149] reported that female IBS patients with co-morbid fibromyalgia showed increase sensitivity to somatic stimuli, while those with

IBS only have a blunted response. Moreover patients with both IBS and fibromyalgia have more severe disorders than those with IBS only [130,150,151].

1.3.3.4.2.2. Chronic Fatigue Syndrome

Fatigue is a non-specific, subjective feeling of physical or mental tiredness. Fatigue that lasts 6 months or longer has been defined as chronic fatigue [152]. While Chronic Fatigue Syndrome

(CFS) is rare, with a prevalence of 0.4% in the general population; it is generally associated with marked functional impairment, and has a remarkable tendency to occur with other clinically unexplained conditions. CFS frequently co-occurs with IBS as about 15% of IBS patients experience CFS. Conversely studies of IBS among CFS patients have reported a prevalence ranging from 35 to 92% [153–156]. Hamilton et al., [157] showed that IBS and CFS both shared predisposing risk markers, suggesting a predisposing pathophysiology. Moreover, CFS has also been reported in the cases of PI-IBS, in particular after giardiasis (cf. section 1.5.2.4).

1.3.3.4.2.3. Chronic Pelvic Pain

Definitions of chronic pelvic pain (CPP) vary, but it is commonly referred as pain in the lower abdominal area of at least 6 months duration that is not associated with menstruation or intercourse. About a quarter of women report experiencing long lasting pelvic pain [158] and a considerable overlap exist between CPP and IBS [159]. Moreover it has previously been shown that CPP and IBS have similar psychosocial factors; women with CPP tend to have a substantial prevalence of depression, somatisation, substance abuse and an history of abuse [160] as seen in numerous IBS patients [94,100].

1.3.3.4.2.4. Sexual Dysfunctions

Several studies have reported an increased prevalence of sexual dysfunctions among IBS patients such as reduced sexual drive, increased dyspareunia, and more severe symptoms of IBS after intercourse [145,161]. Fass et al., [161] reported a prevalence of about 30% of various sexual problems in women with IBS (decreased sexual drive , dyspareunia, bowel symptoms preventing intercourse engagement). In addition, Chao et al., [162] recently demonstrated that IBS patients had a higher risk of developing erectile dysfunctions.

1.3.3.4.2.5. Psychological / Psychiatric Co-Morbidity

IBS is best viewed as an interaction of important biological and psychosocial factors. Depending on the individual, biological factors (altered motility, visceral hyperalgesia, disturbance of brain- gut interactions) and psychosocial factors (psychiatric disorders, sleep disturbances, dysfunctional coping) are variably involved and there is a well recognized overlap between IBS and psychiatric disorders in a large percentage of IBS patients [163]. The "conceptual model" of

the origin of IBS involve a relationship between genetics, family, support group, psychosocial factors, and response to early stress events, and correlate with the fact that IBS patients with coping issues, poor functional status, and a history of abuse have a greater predisposition for severe forms of IBS [164]. However, it has been shown that most IBS patients do not have psychiatric illness per se but do present psychoform symptoms that are similar to those seen in psychiatric disorders but may not have the same significance [165]. Garakani et al., [166] reviewed the association between psychiatric disorders and IBS, regrouping several studies that presented a strong association between IBS and disorders such as depression, dysthymia, panic disorder and anxiety disorder. Fond et al., [134], recently confirmed that higher levels of anxiety and depression were found in patients with IBS, independently of the IBS subtype.

1.3.4. Diagnostic

The first attempt to establish diagnostic criteria to define IBS was made in the 1970's by

Manning & colleagues. These diagnostic criteria were identified by comparing symptoms in patients with abdominal pain who turned out either to have or not to have organic disease (table

2) [98]. Over the following decades, more attention has been paid to IBS, and more detailed, accurate and useful definition of IBS has been elaborated by the successive Rome parties. The

Rome I criteria were first published in 1990 and adopted most of Manning criteria (table 3). The

Rome II criteria appeared in 1999 (table 4) and finally the Rome III in 2006 were more precise and specific than Rome II for pain, specifying that pain must be present for three or more days a month in the past three months and that the criteria needs to be fulfilled for the past three months for a patient to be considered as currently having IBS (table 5). The Rome III criteria also advised that "in pathophysiology research and clinical trials a pain/discomfort frequency of at least two days a week during screening evaluation is recommended for subject eligibility". The

Co-morbid diseases and common extra-intestinal symptoms in IBS Associated functional Functional dyspepsia, gastroesophageal reflux disease GI disorders Associated disorders Fibromyalgia, Chronic fatigue syndrome, Multiple chemical sensitivity syndrome, Post-traumatic stress disorder, Chronic pelvic pain Psychological Somatisation disorder, Depression, Anxiety, Panic disorder co-morbidity Genito-urinary related Interstitial cystitis and dysuria, nocturia, frequency and urgency of disorders micturition, incomplete bladder emptying, dyspareunia, exacerbation of IBS during menses, decreased libido Associated symptoms Migraine and tension headache, temperomandibular joint pain Common unexplained Sleeping problems, muscle pain, fatigue, headache, dizziness, symptoms palpitations, back pain, shortness of breath, dry mouth Table 1: Irritable Bowel Syndrome - associated gastrointestinal and non gastrointestinal symptoms

Manning criteria 1 Pain relieved by defecation 2 More frequent stools at onset of pain 3 Looser stools at onset of pain 4 Visible abdominal distension 5 Passage of mucus per rectum 6 Sense of incomplete evacuation Table 2: Manning criteria for the diagnostic of Irritable Bowel Syndrome (Manning et al., 1978)

Rome I criteria three months of continuous or recurring symptoms of abdominal pain or irritation that may be relieved with a bowel movement, may be coupled with a change in frequency, or may be related to a change in the consistency of stools Two or more of the following are present at least 25 percent (one quarter) of the time: 1 Change in stool frequency (more than 3 bowel movement per day or fewer than 3 bowel movement per week) 2 Noticeable difference in stool form (hard, loose and watery stools or poorly formed stools) 3 Passage of mucus in stools 4 Altered stool passage (e.g. sensation of incomplete evacuation, straining, or urgency) 5 Bloating or abdominal distension Table 3: Rome I criteria for the diagnostic of Irritable Bowel Syndrome (Saito et al., 2000)

Rome II criteria for the diagnostic of IBS At least 12 weeks, which need not be consecutive, in the preceding 12 months of abdominal discomfort or pain that has two out of three features: 1 Relieved with defecation 2 Onset associated with a change in frequency of stool 3 Onset associated with a change in form (appearance) of stool Symptoms that cumulatively support the diagnosis of irritable bowel syndrome 1 Abnormal stool frequency (for research purposes "abnormal" may be defined as greater than 3 bowel movements per day and less that 3 bowel movement per week) 2 Abnormal stool form (lumpy/hard or loose/watery stool) 3 Abnormal stool passage (straining, urgency, or feeling of incomplete evacuation) 4 Passage of mucus 5 Bloating or feeling of abdominal distension Table 4: Rome II criteria for the diagnostic of Irritable Bowel Syndrome

Rome III criteria for the diagnostic of IBS Diagnostic criterion *: Recurrent abdominal pain or discomfort** at least 3 days/ month in the last 3 months associated with 2 or more of the following: 1 Improvement with defecation 2 Onset associated with a change in frequency of stool 3 Onset associated with a change in form (appearance) of stool * criterion fulfilled for the last 3 months with symptom onset at least 6 months prior to diagnostic ** discomfort means an uncomfortable sensation not described as pain Table 5: Rome III criteria for the diagnostic of Irritable Bowel Syndrome

diagnosis of a functional bowel disorder such as irritable bowel syndrome always presumes the absence of a structural or biochemical explanation for the symptoms.

In addition to fulfilling the Rome criteria, few tests can be required for IBS diagnostics: sigmoidoscopy or colonoscopy to determine the presence of inflammation, tumors or melanosis coli; and stool examination to assess the presence of occult blood, leukocytes, ova or parasites.

1.3.5. Pathophysiology

The pathophysiological mechanisms of IBS are still unclear. Multiple factors are thought to contribute to IBS symptoms and involve: altered gastrointestinal motility, visceral hypersensitivity, activation of the mucosal immune system, alteration of the microbiota and psychosocial factors [167,168].

1.3.5.1. Gastrointestinal Motility

Irritable Bowel Syndrome was previously described by the terms "spastic colon" or "irritable colon" indicating that clinicians thought that this condition reflected a motility disorder. Motors disturbances do occur in IBS but are variable between IBS subtypes, and can possibly also change with time as patients can switch between subtypes over the time [167,168]. Disturbed gastric emptying has been observed in a proportion of IBS patients especially IBS-C patients and those presenting a FD comorbidity [169,170]. Although various abnormabilities in small bowel motor activity have been demonstrated in IBS, none appears to be specific, small bowel disturbances reported include: increased frequency and duration of discrete cluster contractions, increased frequency of the migrating motor complex, more retrograde duodenal and jejunal contraction and an exaggerated motor response to meal ingestion [171,172]. These observations have in majority been made in IBS-D patients. A proportion of IBS-D patients also present

enhanced colonic motility and accelerated colonic transit that can be aggravated in response to emotional stress or meal ingestion. However IBS-C patients present a reduced colonic motility and delayed transit [173,174].

1.3.5.2. Visceral Hypersensitivity

The majority of IBS patients show visceral hypersensitivity (enhanced pain sensitivity to experimental gut stimulation), and it is thought to play an important role in the development of chronic pain and discomfort observed in patients [175–178]. Dysregulation of the brain-gut axis, with alterations at different levels of the enteric, autonomic and/or central nervous system, or a disturbed interplay between these systems is viewed as a contributing factors in the pathophysiology of IBS [179]. These alterations are thought to lead to abnormal gastrointestinal sensitivity, motility and secretion. The mechanisms underlying abnormal nerve function in IBS and other functional gastrointestinal disorders are not clear, but evidence suggests that a subgroup of IBS patients has a low-grade inflammation within the gut wall and altered immunological function, which might lead to abnormal nerve function within the GI tract [180].

Visceral sensitivity is thought to be caused by a combination of factors involving heightened sensitivity of both peripheral and central nervous system (CNS). Visceral stimuli are transmitted via afferent nerves to the spinal cord and to the brain where pain sensations are integrated [181].

Peripheral sensitisation is believed to cause hyperalgesia (increased sensitivity to painful stimuli) and allodynia (non-painful stimuli perceived as painful). Peripheral sensitisation initially occurs during tissue injury and inflammation where peripheral nociceptors are exposed to immune and inflammatory mediators (such as prostaglandins, serotonin, leukotrienes, histamine, cytokines, neurotrophic factors and reactive metabolites) which acts on nociceptors terminals, leading to the activation of intracellular signalling pathways upregulating their sensitivity and excitability. As a

consequence to peripheral sensitisation occurs central sensitisation; the surrounding tissue develop an hypersensitivity, due to an increase in the excitability of the adjacent neurons which result in the recruitment and amplification of nociceptive and non-nociceptive inputs from the adjacent tissue [182,183]. Overall neurogenic inflammation is now thought to play an important role in pain and discomfort observed in IBS patients.

1.3.5.3. Neurogenic Inflammation In IBS

Inflammation is neurogenic when inflammatory neuropeptides are released from the peripheral terminals of afferent (sensory) neurons. That afferent neurons have efferent function has been long appreciated and neurogenic inflammation is important to the pathogenesis of a number of diseases. Neurogenic inflammation in the gut is characterized by arteriolar vasodilatation and extravasation of plasma proteins and neutrophils. Immunohistochemical studies have documented substance P and calcitonin gene related peptide (CGRP) - immunoreactivity in nerves throughout the wall of the GI tract. The content of substance P is increased in the inflamed colon of patients with ulcerative colitis and in animal models of intestinal inflammation

[184]. Substance P and CGRP are frequently co-expressed in peptidergic sensory neurons and presumably co released from the same terminals, where substance P and CGRP can exert distinct effects. There are relatively few studies that have examined the roles of Substance P and CGRP in intestinal inflammation, mostly in rodent models of colitis, and fewer still have addressed IBS.

In a rat model of chronic colorectal hypersensitivity, a CGRP receptor antagonist reduced the hypersensitivity, suggesting that CGRP receptors can modulate colorectal hypersensitivity and may provide a promising target for treatment of IBS [185]. Correspondingly, Wang et al., [186] reported that the expression of Substance P in the enteric nervous system in a rat model of IBS is abnormal, suggesting that local changes in Substance P may be involved in the pathogenesis of

IBS and may play an important role in the regulation of gastrointestinal function. The studies mentioned above suggests that the mechanism underlying the reduction in Substance P and

CGRP may involve cytokines that have been shown to be upregulated in colitis. In addition, colorectal inflammation is associated with a decreased co-expression of Substance P and CGRP in both colorectal thoracolumbar and lumbosacral DRGs, suggesting increased release of these peptides at peripheral and central endings.

Intestinal mast cells are the cell type most consistently identified as increased in IBS. Mast cells granules contain substances such as histamine, and proteases (tryptase) which, when mast cells degranulate, can trigger inflammatory reactions [187]. Park et al. [188] found more mast cells degranulated and in close proximity (0.2 mm) to enteric nerves in both caecum and rectum of

IBS patients. Barbara et al., [189] reported similar findings and in addition, they detected higher contents of mucosal histamine and tryptase in IBS patients, and a significant correlation between mast cells in close proximity to nerves and the severity/frequency of abdominal pain/discomfort.

Mast cell tryptase is a serine protease that activates the protease-activated receptor-2, a G protein-coupled receptor expressed in sensory neurons in rodents [190,191]. Activation of PAR-

2 releases neuropeptides such as Substance P and CGRP from sensory nerve terminals to initiate neurogenic inflammation, and potentiates transient receptor vanilloid 1 and 4 (TRPV1 and

TRPV4) channels, both of which have been implicated in colorectal mechanosensation and/or hypersensitivity [192]. Afferent that release substance P and CGRP also express the TRPV1 ion channel, which can modulate peptide release. It is noteworthy that resident intestinal macrophages are also in close proximity to CGRP-positive nerve fibers in murine colon. In endometriosis, a chronic inflammatory condition related to pelvic pain and infertility in women, an increase in macrophages is associated with a higher nerve fiber density in endometriotic

regions where the nerve fibers consist of autonomic and sensory Ad- and C-fibers, suggesting that these nerve fibers can potentially be stimulated by inflammatory mediators secreted by macrophages. This potentially pronociceptive interaction between intestinal macrophages and nerve fibers remains to be established in IBS [187].

The transient receptor potential cation channel, vanilloid 1 and the transient receptor potential cation channel A1, are both member of the superfamily of transient receptor potential (TRP) cation channels, and have been a keystone in the comprehension of the molecular basis of pain signaling during inflammatory conditions. Because of their ability to be activated by nociceptive signals and sensitized by pro-inflammatory mediators, TRPV1 and TRPA1 are considered as potential targets in the treatment of inflammatory pain. Notably, TRPA1 expressed in visceral afferent neurons, is known to participate in inflammatory responses and the establishment of hypersensitivity [193]. The TRPV1 receptor is a ligand-gated, non-selective cation channel sensitive to many natural stimuli, including noxious heat (42-53ºC), acidic pH (5.0-6.0), lipid derivatives, anandamide, and H2S. Traditionally it was thought that TRPV1 was associated with somatic thermal hyperalgesia in tissue inflammation [194]; however, recent studies suggests that the TRPV1 channel plays a significant role in visceral hyperalgesia associated with tissue inflammation. It has been reported that the TRPV1 immunoreactivity was significantly higher

(3.5-fold) in the nerve fibers from IBS patients compared with controls and was associated with significantly high Substance P immunoreactivity in the nerve fibers, mast cells, and lymphocytes in the tissues in the IBS group, observed in immunohistochemical examination of tissues from rectosigmoid biopsies. This study also reported that high TRPV1 immunoreactive fibers and tissue mast cells closely correlated with the abdominal pain score in patients. Increased TRPV1 immunoreactive nerve fibers were observed in IBS together with a low-grade inflammatory

response [195]. It appears that the TRPV1 channel functions via positive feedback during the inflammatory process and visceral sensitivity. TRPV1 plays an important role in mechanotransduction properties of muscle afferents. Visceral sensitivity to mechanical distension of the colon was found to be significantly reduced in TRPV1 knockout mice [196].

Therefore, it is very likely that blocking the TRPV1 channel may reduce visceral pain. This has been confirmed in recent studies documenting that pre-treatment or post-treatment of a selective

TRPV1 antagonist significantly improves colonic inflammation and attenuates the visceral hypersensitivity [197,198].

Finally, c-fos expression is a well-established marker of neuronal activation, and immunohistochemical detection of c-fos allows a mapping of activated nervous tissues on a single cell level [199]. Some studies have shown that noxious distension of hollow viscera (i.e., colorectum, esophagus and stomach) induces specific pattern of c-fos expression in the rat spinal cord and some of brain nuclei [200–202]. Little is known about the activity of CNS and GI tract in patients with IBS. A recent study in an animal model of IBS showed an increase in c-fos the in

CNS (frontal lobe, hippocampus, and cornu dorsale), but normal c-fos in colon, which showed that psychological stress might induce hyperexcitability of colon indirectly through activation of the CNS. They also showed that the increase in the CNS was associated with colonic motility and sensation, suggesting that the CNS may interact with the colon and contribute to altered motility and sensation observed in IBS [203]. Gibney et al., [204] demonstrated an augmented c- fos activity in the prefrontal cortex of Wistar rats induced by colorectal distension, similar to that seen in IBS patients. Matricon et al., [205] showed that a non-inflammatory model of IBS shares some mechanistic features with models of visceral inflammatory pain by inducing neuronal plasticity in the spinal level. In rats treated with butyrate, sensitization of the thoracic spinal cord

is supported by the increased basal density of Fos immunoreactivity in thoracic T10-11-12, lumbar L1-2-6 and sacral S1 spinal segments indicating that even non-inflammatory visceral hypersensitivity model of IBS can also lead to the recruitment of thoracic spinal cord segment.

Taken together, c-fos expression in the CNS is critical for induction of visceral hypersensitivity in IBS.

1.3.5.4. Activation Of The Mucosal Immune System

Low grade chronic inflammation is recognized as a pathophysiological feature of IBS, indeed strong arguments are in favor of an activation of the mucosal immune system in the pathogenesis of IBS as immunological alterations are increasingly reported in patients. Alterations in circulating cytokines, mucosal permeability and altered microbiota in IBS subgroups suggest that altered mucosal immune function may contribute to the development of IBS. Indeed, Chadwick et al. [206] suggested a role of inflammation of the mucosa, as 31 of 77 patients with IBS evaluated for inflammation presented microscopic inflammation and 8 presented criteria of lymphocytic colitis. Even the patients who had normal conventional histology showed an increase in intraepithelial lymphocytes (IELs), CD3+ and CD25+ cells in the lamina propria when compared to control suggesting that all IBS patients presented signs of immune activation.

Collins [207] suggests that the increase presence of CD25+cells in IBS could possibly be due to auto- or exogenous antigen challenge, and that the presence of CD25+ cells prevents the progression to a large inflammatory response. Gonsalkorale et al. [208] also suggest that at least some patients with IBS may have a predisposition to produce lower amounts of the anti- inflammatory cytokine IL-10 and therefore are more susceptible to an inflammatory reaction.

Histological studies of IBS patients biopsies have shown an increased number of immunocytes, mainly T cells and mast cells in the rectum, colon, ileum and duodenum of IBS patients subsets

compared to healthy controls [206,209–211] as well as an alteration of gene expression of several components of the host mucosal immune response to microbial pathogens [212]. Barbara et al. [189] have shown a direct link between immune activation and symptoms by unravelling an increased mast cell degranulation in close proximity of nerve endings associated with symptoms severity. Moreover, biopsies from IBS patients contain higher quantities of proteases, histamine and prostaglandins but interestingly not pro-inflammatory cytokines [213,214]. Recently, several studies also showed that the mucosal mediators of IBS patients were able to increase the activation of sensory pain pathway in rat intestinal preparation [215], and increase somatic, visceral hyperalgesia and allodynia in murine sensory neurons [213], and also induced a higher activation of human enteric neurons [216]. Histamine, serotonin and proteases dependent mechanisms were involved in these activation suggesting the implication of mast cells and other possible cells [216]. Törnblom et al. [217] showed lymphocyte infiltration in myenteric plexus, and an increase in intraepithelial lymphocytes in IBS patients [206,218–220]. Ohman et al. [221] recently showed that IBS patients displayed increased frequencies of activated T cells expression and presented an increase in polyclonally stimulated T-cell secretion of IL-1beta, which correlated with enhanced bowel habit dissatisfaction. A strong relation between increased pro- inflammatory cytokines levels and IBS has also been reported and could be linked to an overactivation of the hypothalamic-pituitary-adrenal axis [222].

1.3.5.5. Microbiota And Brain-Gut Axis (BGA) Alterations

Microbiota appears to play a major physiological and immune role in the intestine. Gut microbiota is usually divided in two distinct ecosystems: luminal bacteria associated to feces and foodstuff and mucosal associated bacteria in close contact with the mucus layer and epithelial cells [223]. Abnormal breath hydrogen and methane profiles in IBS patients seems to support

evidence of dysbiosis in IBS, suggesting changes in bacterial fermentation [224,225]. Moreover recent studies using 16s-rDNA based PCR-DGGE have shown changes in the microbiota composition of IBS patients, including an important reduction in Lactobacillus and Clostridia species [225–227]. Other studies also showed a change in the overall bacterial diversity in IBS patients [228–230].

In addition, it is important to note that the microbiota seems to have an influence on various functions of the intestine including: motility, visceral sensitivity, sensory-motor function.

Growing evidence supports the importance of microbiota in the maturation and modulation of the brain-gut axis, in fact the brain can influence microbiota composition indirectly through modification of the GI motility, secretion and permeability, or directly via cytokines released in the lumen. But enteric microbiota also plays a role in the development of both sensory and motor gut function through communication with the brain either directly via stimulation of neuronal cells in the lamina propria, or indirectly via epithelial-cell and receptor-mediated signaling.

Studies have shown structural aberrations affecting germ-free mice such as enlarged caecum, reduced intestinal surface area, decreased epithelial cell turnover, smaller villus thickness which results in intestinal functional disorders, thus showing that microbiota regulates the development of the intestinal barrier and its functions [231–233]. The microbiota is also involved in maintenance of barrier function by inducing epithelial cell proliferation and enhancing epithelial integrity, through translocation of the tight junction proteins and up-regulation of the genes involved in desmosome maintenance [234]. Verdu et al. [235] by inducing perturbation in the intestinal microbiota showed an increase in the viscero-motor response to colonic distension, indicating microbiota-dependent sensory function and visceral perception. In addition, recent evidence showed that the intestinal microbiota influences the development of the enteric nervous

system [236,237]. Taken together, this indicates that dysbiosis observed in IBS could have numerous alterations of the intestinal functions as normal microbiota plays an important role in various physiological, immunological and homeostasis functions in the gut.

Historically, IBS was considered as a psychosomatic disorder, with an emphasis on psychiatric comorbidity [163,236]. During the past decades, gastroenteritis and low grade inflammation as mechanisms underlying GI dysfunction have been involved in IBS symptoms [236,238]. It is now well established that there is a relationship between the neural and immunological networks within the gut, and that the central nervous system and the gut are engaged in constant bi- directional communication, often related to as the brain-gut axis. Among the pathophysiological mechanisms of IBS, disorders of the BGA have been associated [236,238]. Recently, more evidence of emerging dysbiosis in IBS patients have been made [223], suggesting an important role of the microbiota-gut-brain axis [225,236,238–241]. Nevertheless, our understanding of the mechanisms of the bi-directional interactions between microbiota and GI physiology and its association with behavior needs to be explored with focus on the contributions of immunological and neural components to the microbiota-BGA relationship.

1.3.6. Treatment

Pathophysiological mechanisms in IBS remains unclear, thus the current therapeutic approach consists in ameliorating the quality of life of IBS patients by controlling and relieving symptoms instead of acting on the yet unknown underlying mechanisms. Dietary restrictions, psychological therapy, hypnotherapy as well as pharmacological treatment have shown more or less success in the relief of IBS [94,242].

1.3.6.1. Dietary Treatment

Irritable bowel syndrome symptoms are often reported to be worsen by eating, leading many patients to conclude that they are suffering from some form of "food allergy". Although there is little evidence to confirm a direct reaction to certain types of food in IBS patients, some intolerance and malabsorption have been reported [126,243–247]. Some studies have reported symptoms improvement with exclusion diets, suggesting that dietary restrictions could be useful for a proportion of IBS patients [248–250].

1.3.6.2. Psychological And Behavioral Therapy

Psychological and behavioral co-morbidities are common in IBS, and patients have reported a close relation between stress and worsening of gut symptoms [251] providing a rationale for psychological therapy. Different therapies can be useful in case of stress event worsening of symptoms such as relaxation training including muscle relaxation, yoga or meditation [252].

Cognitive behavioural therapy can also be used for patients with IBS symptoms in response to stress. The efficacy of this therapy remains controversial but studies suggest that it may help patients to cope with their symptoms without necessarily abolishing them [253–255].

Psychological and hypnotherapy can also be used especially for patients with constant pain and refractory patients. Some studies have reported beneficial effects with hypnotherapy that appear to be sustained over time, with continued relief of symptoms [256,257].

1.3.6.3. Pharmacological Treatments

Specific treatment is determined by the predominant symptoms (abdominal pain, diarrhea, constipation) which are then treated with therapeutics used in other functional disorders (i.e.

IBS-C treated as functional constipation, IBS-D treated as functional diarrhea).

Various pharmacological agents have been tried in the management of IBS, the majority targets the relief of abdominal pain and bloating, by either relaxing smooth muscle of the gut, alter gut transit or modulate perception of visceral afferent information to the CNS. In many drug trials in

IBS, a high proportion of responses to placebo has been reported, rendering interpretation of drug efficacy more delicate (reviewed by Shah and Pimentel [258]). Among the pharmacological agents used in IBS treatment, antispasmodic agents have been reported to have inconsistent benefits, as no beneficial effects was shown on the symptoms of diarrhea or constipation and a limited effect on pain relief [259,260].

Antidepressants, in particular tricyclic antidepressants have been reported to have a beneficial effect on the relief of pain primarily in IBS-D when used at a lower dosage than for depression treatment [254,261].

Antidiarrheal agents such as loperamide and diphenoxylate, stimulates inhibitory presynaptic receptors in the enteric nervous system resulting in inhibition of peristalsis and secretion, and reduces diarrhea in IBS patients with acute, presumed infective onset and nocturnal diarrhea

[262,263].

Recent observations have reported modified concentration of serotonin (which plays a significant role in the control of gastrointestinal motility, sensation and secretion) in IBS patients with an increased concentration in IBS-D patients and a reduced concentration in IBS-C patients

[264,265]. Serotonin act through the 5-HT3 and the 5-HT4 receptors, agonists at the 5-HT4 receptors and antagonists at the 5-HT3 receptors have been shown to modify the gastrointestinal transit and reduce visceral sensation [266–268].

Alternatives pharmacological strategies have also made an appearance in correlation with evidence supporting an alteration of the host microbiota in IBS patients. Thus the use of antibiotics and probiotics has become more common to regulate small intestinal bacterial overgrowth, microbiota composition and diversity. Pimentel et al. [224,269] showed that small intestinal bacterial overgrowth eradication by antibiotics lead to a normalization of the lactulose breath test and symptoms elimination in IBS patients. Probiotics are another way of altering the bowel flora, and randomised placebo control trials of probiotics have shown benefits for some symptoms notably bloating and flatulence [235,270,271].

Although some therapy seems to have a certain degree of efficacy in the relief of IBS symptoms, the current therapy targets only symptoms and not the underlying mechanisms involved in IBS, indicating that the relief may be short term. Further studies are sorely needed for a better understanding of the mechanisms of IBS and the development of new therapeutic strategies.

Recently a 14-amino acid peptide, linaclotide has been shown to have great protential in the treatment of chronic constipation and IBS-C. This minimally absorbed component act through its binding to the guanylate cyclase C (GC-C) receptor on the luminal surface of the intestinal enterocyte which increases intracellular cyclic guanosine monophosphate (cGMP) that triggers a signal transduction cascade leading to the secretion of chloride and bicarbonate in the intestine

[272–274]. This increased fluid secretion in turn accelerates the colonic transit. In addition this component has been shown to act on visceral pain through a mechanism believed to be dependent on GC-C/cGMP [275]. Linaclotide has demonstrated efficay relative to placebo for the treatment of both chronic constipation and IBS-C in clinical trials and adverse effects have been reported to be generally mild making it an important advance in the treatment of constipative bowel disorders.

1.4. Post-Infectious Irritable Bowel Syndrome

In some patients, IBS symptoms seem to occur following acute gastroenteritis (GE). This post- infectious IBS denotes the persistence of abdominal discomfort, bloating and diarrhea, despite clearance of the inciting pathogen. Approximately 10 % of IBS patients believe that their symptoms began following an infectious disease [91,276–278]. Recent meta-analyses demonstrated that the risk of developing IBS increases six-fold after gastrointestinal infection and remains elevated for at least 2-3 years post-infection, and it is estimated that 7–31% of patients with infectious GE go on to develop PI-IBS [276,279,280]. Many commonly encountered enteric pathogens can lead to chronic GI conditions, and PI-IBS has been reported following infection with numerous pathogens such as Shigella spp; pathogenic Escherichia coli,

Salmonella sp., and Campylobacter jejuni. Recent studies have also described a role for protozoan parasites in the etiology of IBS such as Blastocystis hominis, Dientamoeba fragilis,

Cryptosporidium parvum or Giardia duodenalis [276–278,281,282]. Higher risk factors include longer duration of symptoms, young age and female gender. As for IBS clinical presentations of

IBS following enteric infection include altered intestinal motility and hypersensitivity [283–285].

The current conceptual framework regarding the pathophysiological mechanisms for PI-IBS suggests that it is associated with increased intestinal permeability and motility, increased numbers of enterochromaffin cells and persistent intestinal inflammation, characterized by increased numbers of T-lymphocytes and mast cells, and increased expression of pro- inflammatory cytokines [189,217,280,286–291]. Possible mechanisms for PI-IBS include genetic predisposition, motility dysfunction, such as accelerated colonic transit and smooth muscle hyper-reactivity to acetylcholine, continuous antigenic exposure (bacterial, parasitic or dietary), or molecular mimicry of foreign antigens [292].

1.5. Giardia duodenalis And Giardiasis

Gardia duodenalis (syn. Giardia lamblia, Giardia intestinalis) is an intestinal flagellated protozoan parasite of the upper small intestine. Very common worldwide, Giardia was recently included in the World Health Organisation's (WHO) Neglected Disease Initiative [293,294].

Giardia is transmitted through the ingestion of cysts in contaminated food or water, or directly via the fecal/oral route. Ingestion of cysts results in giardiasis, a disease causing intestinal malabsorption and diarrhea in a wide variety of species including humans. In developing countries, the prevalence of human giardiasis commonly ranges from 20 to 30% of the population, with reports of 100% prevalence in some populations; in developed countries, prevalence ranges from 3 to 7% [295,296]. The classification of G. duodenalis is a topic of debate and at present, the species is divided into eight distinct genetic assemblages, i.e., assemblages A to H. Only the assemblages A and B are considered to be pathogenic in humans.

Although parasites with assemblage A or B can infect non-human mammalian species, other genotypes appear to have a more restricted host range; for example assemblages C and D are commonly found in dogs [297], while assemblage E is common in cattle [298]. Ongoing research suggests that giardiasis is often due to anthroponotic spread, but zoonotic transmission can occur

[299–301]. A striking feature of giardiasis is the spectrum of clinical symptoms that occur in infected individuals. The clinical manifestations can range from asymptomatic, to acute or chronic diarrheal disease. When present, the clinical signs of infection may include diarrhea, nausea, weight loss, bloating and abdominal pain [295,302]. In giardiasis, the acute pathophysiology occurs without invasion of the small intestinal tissues by the trophozoites, and in the absence of overt inflammatory cell infiltration, with the exception of a modest increase in intraepithelial lymphocytes [303–305]. Multiple factors have been proposed to account for the

disease variability, including the state of the host immune system, host age and nutritional status, strain genotype, infectious dose and, possibly co-infections [295,300,302]. The pathophysiological consequences of Giardia infection are clearly multifactorial, and involve both host and parasite factors, as well as immunological and non-immunological mucosal processes. Recent observations suggest a role for disruptions of the host intestinal microbiota during the acute infection stage in the production of chronic symptoms, and further research is warranted to corroborate these findings [306]. The pathophysiology of giardiasis and key aspects of the host response to Giardia remains incompletely understood.

1.5.1. Pathophysiology Of Giardiasis

Central features of the pathophysiology of giardiasis are briefly outlined below, as these mechanisms may be key to our understanding of the complications discussed further. While the

Giardia genotype has been proposed to play a role in the induction of symptoms, there is currently no consensus concerning the connection between genotype and virulence [307] (Table

6).

After cyst ingestion in contaminated water or food, excystation occurs liberating two or four trophozoites, which adhere to the epithelial surface of the intestine via a ventral adhesive disk.

This tight attachment between Giardia trophozoites and intestinal epithelial cells, as well as the production of yet incompletely characterized parasitic products, culminate in the production of diarrhea. Pathophysiology is believed to involve heightened rated of enterocytes apoptosis, intestinal barrier dysfunction, activation of host lymphocytes, shortening of brush border microvilli with or without coinciding villous atrophy, disaccharidase deficiencies, small intestinal malabsorption, anion hypersecretion and increased intestinal transit rates

[302,305,308–314].

As it is the case with other enteropathogens, induction of apoptosis in enterocytes by Giardia represents a key component in the pathogenesis of the infection [302,310,311,314–316].

Enterocytes apoptosis during giardiasis is caspase-3 and -9 dependent [310,315]. While both host and parasite factors may modulate intestinal epithelial cell apoptosis, the products responsible for its activation during giardiasis have yet to be identified. In addition to promoting increased rates of enterocyte apoptosis, Giardia trophozoites may also halt enterocyte cell-cycle progression via consumption of arginine, and up-regulation of cell-cycle inhibitory genes [317].

Findings from studies on giardiasis in vivo demonstrate that the most severe intestinal permeability and macromolecular uptake coincides with the peak of trophozoites colonization

[316,318,319]. The effects of the infection on gut barrier function following host parasite clearance require further investigation. Giardia-mediated increases in intestinal permeability result from alterations to the apical tight junctional complexes, including disruption of F-actin, zonula-occludens (ZO)-1, claudin-1, and alpha-actinin, a component of the actomyosin ring that regulates paracellular flow [311,318–321]. The role of Giardia proteinases in these effects is a topic of ongoing research.

Giardia-induced diffuse shortening of epithelial brush border microvilli represents a key factor in the production of diarrhoeal disease via malabsorption and maldigestion [305,307,322].

Whether or not the diffuse loss of microvillous border surface area associated with giardiasis is related to the release of a “toxin” by the parasite, a phenomenon similar to the release of proteases in the bacterial overgrowth syndrome [323], remains poorly understood. Regardless, G. duodenalis infection causes microvillous shortening in a lymphocyte-mediated manner which in turns impairs activities of disaccharidases [305].

Bacterial components of the intestinal microbiota from Giardia-infected hosts may act as stimulatory factors for protozoan pathogenicity [324]. Indeed, micro-organisms isolated from the duodenal microbiota of patients with symptomatic giardiasis can stimulate the pathogenicity of

G. duodenalis in a gnotobiotic animal model [324]. The biological basis of this phenomenon remains unclear.

Giardia infections tend to be self-limiting in individuals with competent immune systems. A recent study in Brazilian children suggests that symptoms are less severe during re-infection, consistent with the hypothesis that if previous exposure does not always protect against future infections, it does at least reduce the severity of pathology [325]. Patients with common variable immunodeficiency (CVID) and Bruton's X-linked agammaglobulinemia (XLA) are prone to chronic giardiasis [326,327], which underscores the necessity of antibodies to fully control giardiasis.

In addition to its acute symptoms, giardiasis may also cause anorexia and failure to thrive.

Indeed, Giardia infections may have detrimental effects on nutritional status, growth status and cognitive function in humans [328–332]. Giardia infections may also have detrimental effects on body weight in food-producing animals making this a serious concern for the agricultural industry [333–336].

1.5.2. Long Term Consequences Of Giardiasis

1.5.2.1. Extra-Intestinal Pathologies

Until recently, the scientific literature rarely reported extra-intestinal manifestations in giardiasis.

However, a recent study estimated that 1/3 of the patients infected with this parasite will express

long-term extra-intestinal symptoms, suggesting that this phenomenon is not as uncommon as previously thought [337].

1.5.2.1.1. Ocular Pathologies

The first description of ocular complications in patients with giardiasis was made in 1938 by

Barraquer [338], who reported cases of iridocyclitis, choroiditis, and retinal hemorrhages in patients that presented diarrhea linked to the presence of Giardia. More recent observations described a "salt and pepper" degeneration (punctuate areas of normal hyperpigmentation on a light yellow pink-retina) involving the retinal pigmented epithelium in children suffering from giardiasis [339]. The same complication was described in children with past giardiasis, indicating that the ocular changes observed did not require the concurrent presence of the parasite in the gut

[340]. Small children appear to be more susceptible to ocular lesions during giardiasis, and the lesions are thought to be caused by damage to the cells of the retina, accompanied by the release of pigment granules in retinal layers, where they can be seen as blackish dots [340]. The mechanisms linking ocular lesions with giardiasis remain obscure, but they exclude the possibility of direct invasion by the parasite. It has been speculated that the pigmented degeneration may result from toxic metabolites produced by the parasites, which has yet to be proven [339]. The role of increased intestinal permeability in the ocular complications seen in giardiasis needs to be elucidated.

1.5.2.1.2. Arthritis

Reactive arthritis is classically seen following infection with enteric pathogens such as Yersinia sp., Salmonella sp., Campylobacter jejuni and Shigella sp., but inflammatory arthritis has also been described following enteric infections with other organisms such as Clostridium difficile,

Brucella sp. and Giardia sp. [341]. The interval between the preceding infection and the manifestation of arthritis is 2 to 4 weeks [341]. Post-infectious arthritis has a predilection for joints of the lower limbs particularly the knee and ankle [342]. Post-infectious reactive arthritis has been classified as a classical spondyloarthropathy associated with HLA-B27, an allele of the major histocompatibility complex class I (MHC I) present in 50% of the cases of patients with enteric-infection-related arthritis [342,343]. However, inflammatory arthritis following infection with Clostridium sp. or G. duodenalis does not fit classical spondyloarthropathy, as it fails to show association with HLA-B27 [341]. Therefore, these are referred to enteric-infection-related- arthritides. Although G. duodenalis infections account for a significant proportion of enteric infections worldwide, reports of an association with post-infectious arthritis are relatively few.

Little is known of the pathogenesis of arthritis in these conditions. Unlike post-enteric reactive arthritis, these arthritides are characteristically responsive to antibiotic therapies [343]. The variable degrees of host immune responses, and the lack of a robust systemic inflammatory response, may account for the infrequency of post-giardiasis arthritis despite the high prevalence rate of the infection [341]. Antigens from enteric bacteria have been isolated from the synovial fluid of affected joints [343]. In a case of Yersinia pseudotuberculosis reactive arthritis, evidence of viable bacteria within the joint was demonstrated over a year later [344]. Here again, a possible role for increased intestinal permeability in enteric-infection-related-arthritis warrants further investigation.

Giardia-induced Mechanisms involved or Selected references pathophysiological hypothesized to be involved responses Intestinal epithelial Induction of pro-apoptotic Chin et al., 2002[18]; Troeger et al., cell apoptosis factors: Caspase-3,8 and 9, 2007[19]; Panaro et al, 2007[23]; Inhibition of anti-apoptotic Ankarklev et al., 2010[21]; Cotton et factors: PARP cleavage al., 2011[10] Halt of enterocyte Nutrient competition (arginine), Stadelmann et al., 2012[25] cycle progression up-regulation of cell-cycle genes Intestinal barrier Alteration of apical junctional Teoh et al., 2000[29]; Buret et al., dysfunction complexes: disruption of 2002[30]; Scott et al., 2002[26]; claudin-1 and α-actinin by Troeger et al., 2007[19]; Buret, 2007- unknown mechanisms, caspase- 2008[27,17]; Ankarklev et al., 3 mediated disruption of zonula- 2010[21]; Cotton et al., 2011[10]; occludens (ZO)-1, MLCK- Maia-Brigagão et al., 2012[28] mediated disruption of F-actin, and ZO-1 Small intestine Adaptive immunity, neuronal Andersen et al., 2006[119]; Li et al., hypermotility nitric oxid, mast cell 2006 - 2007[120,121] degranulation Diffuse shortening of CD8+ lymphocytes - mediated Erlandsen & Chase, 1974[31]; Buret brush border via parasite secretory/excretory et al., 1991[16]; Scott et al., 2004[13]; microvilli products Ankarklev et al., 2010[21]; Cotton et al., 2011[10] Crypt hyperplasia Alteration villus/crypt ratio Farthing, 1996[98]; Araújo et al., 2008[62]; Ankarklev et al., 2010[21]; Benere et al., 2012[111] Microbiota Microbiota from infected animal Torres et al., 2000[33]; Beatty et al., composition may stimulate pathophysiology 2013[14] Increased mucus Increased mucus secretion in Araújo et al., 2008[62] production response to intetinal colinization Brush border enzyme Loss of surface area (microvilli Buret et al., 1991[16]; Ankarklev et activity deficiencies and villi) al., 2010[21]; Cotton et al., 2011[10]; Benere et al., 2012[111] Disaccharidases Loss of surface area (microvilli Farthing, 1996[98]; Buret et al., deficiencies and villi) 1991[16]; Cotton et al., 2011[10]; Benere et al., 2012[111] Electrolyte/nutrient/w Loss of surface area (microvilli Farthing, 1996[98]; Troeger et al., ater malabsorption and villi) 2007[19]; Araújo et al., 2008[62]; Ankarklev et al., 2010[21]; Cotton et al., 2011[10]; Gomes et al., 2012[112] Anion hypersecretion Unknown mechanisms Farthing, 1996[98]; Troeger et al., 2007[19]; Cotton et al., 2011[10]; Ankarklev et al., 2010[21] Table 6: Pathophysiological effects of Giardia duodenalis and their action mechanisms

1.5.2.1.3. Allergies

Concomitant presence of G. duodenalis, cutaneous allergic manifestations, and gastrointestinal symptoms have been described, which may explain why complete symptom resolution can be achieved with metronidazole and corticosteroids [345]. Significant anecdotal evidence suggests a causative link between giardiasis and the development of urticaria. In a recent study in children, giardiasis was associated with an increase in total serum IgE levels, and an enhanced IgE antibody response to common allergens [346]. These patients also demonstrated IgE reactivity to cow's milk and Giardia antigens. These observations suggests that alteration in antigen uptake from the small intestine during giardiasis, perhaps in association with connective tissue mast cell proliferation, may contribute to the development of allergic disease [347–349]. Dysfunction of the intestinal barrier during giardiasis may facilitate the translocation of food macromolecules and in turn prime the host for sensitization [346].

1.5.2.1.4. Muscular Complications

Hypokalemic myopathy has been associated with celiac disease, radiation enteropathy, immunosuppressive drugs, and various infectious diseases. In the patient, this presents as marked proximal muscular weakness in all four limbs and the neck [350]. Analyses of muscular biopsies reveal an abnormal size of the muscular fiber due to the presence of numerous rounded atrophic and hypertrophic fibers, proliferation of myonuclei, and necrotic fibers [351]. The findings are consistent with impairment of muscle excitability and denervation due to muscle necrosis.

Analysis of these fiber components showed that glycogen and lipid levels, as well as the inter- myofibrillar network pattern, are normal [351]. Several cases of myopathy following hypokalemia induced by giardiasis have been reported in both immunocompetent and

immunocompromised patients [350,351]. This suggests that G. duodenalis infections can trigger muscular manifestations independently of the immune status of the host. During giardiasis, potassium loss is closely related to the number of bouts of diarrhea per day [351]. Loss of potassium results in hypokalemia which can trigger a severe and transient myopathy [351]. In fact, muscular symptoms can improve with increased levels of potassium and recovery from diarrhea [350]. However, G. duodenalis diarrhea as a cause of myopathy due to hypokalemia is rare. It seems that the duration of symptoms is crucial for development of hypokalemic myopathy [351]. Giardiasis-associated hypokalemia occurs more often in elderly people, particularly women, who are hospitalized for giardiasis [352]. The causes, and the clinical consequences, of Giardia-associated hypokalemia remain unclear. It has been suggested that giardiasis-induced impairment of nutrient and electrolyte absorption may contribute at least in part to hypokalemia and hyponatremia [353].

1.5.2.2. "Metabolic" Consequences

1.5.2.2.1. Nutritional Consequences

In developing countries of the World, because of infectious diseases and lack of food, 206 million children under 5 years of age suffer from stunting, 50 million from chronic wasting disease, and 167 million are grossly underweight [354]. Growth failure, reflected in stunting, wasting and underweight conditions, is assessed by anthropometric indices of height-for-age

(HAZ), weight-for-age (WAZ), and weight-for-height (WHZ) [355]. Optimum health for children has long been linked to physical, socio-cultural, economic, and environmental factors.

In developing countries, the incidence of giardiasis is often over four times higher than the incidence reported in industrialized countries [356]. Children between 6 months and 5 years of age are the most susceptible [357]. In combination with diarrhea, G. duodenalis infection can

cause iron deficiency anemia, micronutrient deficiencies, protein-energy malnutrition, growth and cognitive retardation, and malabsorption [354,358]. Studies conducted on children from

Brazil and Peru found that diarrheal disease occurring in the first 2 years of life negatively correlates with cognitive function, verbal fluency, and physical fitness, and may lead to long- term growth faltering [329,359]. These studies demonstrate that the effects of early childhood diarrhea are more far-reaching than merely causing dehydration. Diarrhea caused by Giardia sp. or Cryptosporidium sp. has frequently been associated with stunting and lower cognitive function [329,359] (Table 7). Intriguingly, a recent study observed that in a cohort of Tanzanian children infected with Giardia, infection had a protective role against diarrhea, and that this protection was lost with multi-nutrient supplementation [360]. Research needs to determine whether these interesting findings reflect a negative regulation by Giardia sp. of other enteric pathogenic processes that may occur in these children.

1.5.2.2.1.1. Failure To Thrive

Childhood and adolescence are the period of most rapid skeletal growth. Failure to thrive (FTT) is a term generally used when a child presents with a rate of weight gain that is significantly below that expected of similar children of the same sex, age and ethnicity. Failure to thrive is a common problem that may be present at any time during the childhood, but is usually prevalent within the first 1-2 years of life. Long-term sequelae involving all areas of growth, behaviour and development may be seen in children suffering from FTT [361]. Causes for FTT usually include:

(i) inadequate food intake, (ii) reduced absorption or digestion of nutrients or excessive loss of nutrients, and (iii) excessive utilisation of energy. There is a strong association between Giardia infection and malnutrition, wasting and stunting [331,354–356,360,362]. Malabsorption, maldigestion and malnutrition due to giardiasis have been shown to affect anthropomorphic

factors as well as the calorie intake during childhood, most commonly in the second year of life in infected children [328,331,332,354,363]. Duration of the infection episodes, and their association with diarrhea, appeared to be the key factors associated with growth disturbance and failure to thrive [328]. While several studies have established a strong link between Giardia infection during the first two years of life, FTT and development impairment, more research is needed to unravel the mechanisms and the potential implications of polyparasitism in these phenomena.

Malnutrition, a common feature of numerous intestinal diseases, has been associated with an increase in macromolecular uptake due to heightened intestinal permeability [364], two phenomena known to occur during giardiasis [311,347]. Giardia infection can reduce food intake, and produce steatorrhea, maldigestion and malabsorption of carbohydrates and vitamins

(including vitamin A, B3, B5, B6, B12, E, and folacin) [295,313,355,365]. Together, these effects may contribute at least in part to failure to thrive in giardiasis. (Table 7)

1.5.2.2.1.2. Stunting

Growth failure due to malnutrition and chronic infections like giardiasis is associated with increased morbidity and mortality in children from developing countries [328,354,355]. More specifically, significant impairments in weight-for-age and weight-for-height ɀ scores have been associated with G. duodenalis infection during the first two years of life [363]. Indeed, the relative odds of low height-for-age may be 7.7 times higher among children with giardiasis

[354]. In a number of developing countries, diarrhea caused by enteric parasitic Protozoa in early childhood represents predictors of stunting [355]. Given the high prevalence of asymptomatic infection in this study population (78.8%), children may appear to have normal weight-for-age and weight-for-height early on, but, present with growth retardation at a later age. This

phenomenon is known as "homeorhesis", and it is probable that the high prevalence of asymptomatic Giardia infection among children may play a key role in it. Similarly, Giardia infection has been associated with decreased weight gain and impaired feed conversion efficiency in lambs and cattle, illustrating that growth retardation associated with Giardia infections also pose an important problem to the agriculture industry [333–336]. Overall, human giardiasis combines with other factors, including low nutritional status, as well as sanitary and socioeconomic conditions, to lead to stunting [355]. However, findings from numerous studies, to date, indicate that the well established loss of intestinal surface area, maldigestion, and malabsorption caused by giardiasis may contribute to growth retardation following Giardia infection. (Table 7)

1.5.2.2.2. Impaired Cognitive Functions

Cognitive function in children can be affected by environmental and health related factors [366].

Risk factors that interfere with cognitive function are especially important during infancy because the first two years of life are an essential period of rapid growth and development that is marked by rapid brain growth and maturation, by neuronal arborisation, myelinisation and emergence of brain networks. Thus the development of cognitive function in early life depends on the hierarchical maturation of neocortical association areas, as well as interactions with the environment. Nutrition, infection, and environment, have been found to affect neuroplasticity and to have long lasting effects in developing children [367]. Many of the hazards to early brain development are well known, and include head injury, newborn asphyxia, infections of the brain in utero and in the first year of life, genetic defects, lead poisoning and malnutrition.

Micronutrient deficiencies (e.g. Iodine) and iron deficiencies have also been found to impair cognitive development [367]. Studies have attempted to link possible long-term cognitive

deficits with severe diarrhea in early childhood [329,330,359]. The complex interrelation among malnutrition, diarrheal disease and environmental factors such as socioeconomic status and education make it difficult to determine the unique contribution of either malnutrition or diarrheal disease to cognitive development. However, chronic malnutrition and stunting during infancy secondary to G. duodenalis infections, has been associated with poor cognitive function

[329,330,368]. Moreover, diarrhea during early childhood was also found to impair visual-motor coordination, auditory short-term memory, information processing, and cortical cognitive function [359,367].

Interestingly, poor language cognition and impaired psycho-motor development appear to be associated with Giardia sp. more so than with other enteropathogenic parasites such as

Entamoeba histolytica, Ascaris lumbricoides, Enterobius vermicularis, or Trichuris trichiura

[354]. These studies have suggested a role for nutrient malabsorption and micronutrient deficiencies, such as zinc, iron or vitamins (A and B-12) in humans as well as in animals

[354,365,369,370]. Indeed, significantly lower levels of iron and ferritin, known to affect psychomotor development, have been detected in patients with giardiasis [355]. Similarly, diarrhea due to giardiasis was linked to poor cognitive function by causing zinc and iron micronutrient deficiencies, as well as defects in the anti-oxidant system, which may all affect neuroplasticity [367]. Indeed, perinatal iron deficiency in rats reduces neuronal metabolic activity, specifically targeting areas of the brain involved in memory processing [371]. Zinc supplementation was recently found to reduce the rate of diarrhea caused by giardiasis [372].

The complexity of these profound effects on functional impairments requires further investigation. More research is also needed to determine whether and how these effects can be

reversed with targeted antimicrobials, with micronutrient and/or oral rehydration, or nutrition therapy [359]. (Table 7)

1.5.2.2.3. Chronic Fatigue Syndrome

Viral, bacterial, as well as parasitic pathogens can trigger chronic fatigue syndrome (CFS), and are responsible for work-related disability reflected in long-term sickness, absence from studies and employment [373]. Although the biological basis of CFS is unknown, it is generally thought that post-infectious fatigue develops shortly after acute infection. CFS has been described following Q-fever, Epstein-Barr virus infection, Ross river virus infection, brucellosis, Lyme disease, viral meningitis and Dengue fever [374]. Recent studies have reported a high prevalence of post-infectious fatigue following a giardiasis outbreak in Bergen, Norway, in 2004 [307,373–

377]. Fatigue was reported in 41% of the people in Bergen 2 years after the Giardia outbreak, compared to 22% in the general population [373]. In this population, old age and female gender were a significantly higher risk factor for post-infectious fatigue [375,378].

Although Giardia is a non-invasive parasite, post-giardiasis CFS is likely to include immunologic components [373]. Studies have implicated differences in activation and function of peripheral blood lymphocytes subsets in post-giardiasis CFS, including altered natural killer

(NK)-cell levels and lowered CD4:CD8 ratios [378,379]. The exact roles of immune factors in co-morbidities associated with gastrointestinal disorders and CFS need be further explored.

Fatigue is a frequent symptom in patients with functional gastrointestinal disorders (FGID), especially irritable bowel syndrome (IBS) [128].Chronic Gastrointestinal Disorders

Post-giardiasis effects Country references Lower cognitive function India, Peru, Guerrant et al., 1999[68]; Berkman et al., Lower intellectual quotient Turkey 2002[40]; Çeliksoz et al., 2005[77]; Koruk et al., Lower social quotient 2010[67]; Ajjampur et al., 2011[76] Lower weight Brazil, Farthing et al., 1986[37]; Lengerich et al., Lower height Columbia, 1994[66]; Guerrant et al., 1999[68]; Fraser et al., Stunting Ecuadora, 2000[72]; Newman et al., 2001[113]; Muniz- Guatemala, Junqueira et al., 2002[114]; Sackey et al., Iran, Israel, 2003[115]; Simsek et al., 2004[63]; Çeliksoz et al., Mexico, 2005[77]; Matos et al., 2008[116]; Botero-Garcès et Rwanda, al., 2009[64]; Ettehad et al., 2010[38]; Quihui et al., Turkey, USA 2010[78]; Ignatius et al., 2012[39]; Koruk et al., 2010[67]; Lander et al.,2012[117] Failure to Thrive Columbia, Lengerich et al., 1994[66]; Sackey et al., Ecuadora, 2003[115]; Botero-Garcès et al., 2009[64] USA Nutrient deficiencies Iran, Mexico, Ettehad et al., 2010[38]; Quihui et al., 2010[78]; Tanzania Veenemans et al., 2011-2012[69,81] Table 7: Metabolic consequences post-giardiasis observed worldwide

1.5.3. Functional Gastrointestinal Disorders

Functional Gastrointestinal Disorders (FGID) represents a group of disorders characterized by recurring or chronic gastrointestinal symptoms without an identifiable disease process. Irritable bowel syndrome (IBS) and functional dyspepsia (FD) are the best described FGID. Post- infectious-IBS (PI-IBS) has been reported following acute gastroenteritis due to bacteria such as

Salmonella sp., Shigella sp. and Campylobacter jejuni [276,279]. Recent evidence now indicates that a proportion of patients diagnosed with Giardia duodenalis will also develop PI-IBS symptoms in the absence of detectable parasitic loads [380,381].

1.5.3.1. Post-Giardiasis Irritable Bowel Syndrome

Early reports indicated that Giardia may cause prolonged symptoms, including secondary lactose intolerance, for several weeks after successful treatment [382]. Chronic giardiasis resembles IBS, and symptomatic infection may exacerbate existing IBS [383]. Giardia infection has been diagnosed in 5-10% of patients with IBS [281,384], and it was recently demonstrated that G. duodenalis may indeed cause IBS and functional dyspepsia [381]. High frequency of microscopic duodenal inflammation was found in patients post-giardiasis when the infection lasted 2–4 months, further supporting the hypothesis that longer duration of infection is a risk factor for PI-IBS [385]. Early diagnosis of Giardia infection and treatment may shorten the duration of the infection and hence may help reduce the risk for such complications [374].

Pathophysiological mechanisms of post-giardiasis IBS remains unclear, but studies have shown an increased visceral sensitivity as well as an increase in CCK, decrease in enterochromaffin cells and serotonin [380,386]. Hanevik et al. [385] also showed duodenal inflammation with elevated levels of calprotectin in patients that had ongoing or recent Giardia infection. Giardia

duodenalis is also well known to disturb homeostatic barrier function by inducing enterocytes apoptosis, villus and microvillus shortening, alteration of tight junctions, suggesting several possible mechanisms involved in the promotion of IBS (Giardia pathophysiological mechanisms reviewed by Cotton et al. [302]). In addition, interactions between the host and gastrointestinal microbiota may play a key role in the pathogenesis of IBS [225]. Fecal microbiota is altered in patients with IBS, and patients with diarrhea-predominant IBS appear to host more

Proteobacteria, and fewer Bacteroidetes compared to asymptomatic patients [223,387].

Recently, Beatty et al. [306] showed that Giardia was able to modify the structure and composition of the microbiota suggesting a link between parasite-microbiota interactions in the development of post-infectious GI disorders. Whether these alterations may result to PI-IBS requires further investigation [306].

Insights into the interactions between enteric pathogens, the host epithelia, and the intestinal microflora are needed to improve our understanding of disease processes that may initiate IBS or even exacerbate intestinal inflammation in patients with IBD [388]. Studies on giardiasis offer a powerful model to investigate these mechanisms.

1.5.4. Cancer

A few reports have described Giardia trophozoites in the tumoral mass of pancreatic tissue and gallbladder. While G. duodenalis trophozoites are generally localized to the proximal small bowel, they may also be identified in the stomach, distal small bowel, or caecum, and studies have reported pancreatic infection with Giardia [389–391]. Although the relationship between pancreatic giardiasis and pancreatic cancer is presently unknown, the coexistence of these two diseases may prompt exploration into mechanisms of carcinogenesis in giardiasis. In another study, following cholecystectomy with liver bed resection and lymph node dissection, intra-

operative cytological examination of the patient’s bile juice revealed the presence G. duodenalis trophozoites, and pathological examination revealed gallbladder cancer [392]. However, no cause-to-effect has yet been established between the presence of Giardia and the development of cancer.

1.6. Significance And Clinical Relevance

Irritable bowel syndrome is the most common functional gastrointestinal disorder presenting human visceral hypersensitivity associated with altered bowel habits, and affecting up to 30% of the general population. IBS can affect children as well as adults, and is responsible for a significant loss in quality of life. To date, no specific organic pathology has been identified in

IBS; hence the majority of current therapies target the relief of symptoms. The biological mechanism responsible for the development of IBS remains obscure. Recent findings have implicated gastroenteritis caused by bacterial pathogens in the development of post-infectious events. Parasitic infection may also be involved and studies indicate that Giardia duodenalis, the most common human intestinal parasite worldwide, may contribute to IBS.

Ingestion of cysts results in giardiasis, a disease causing intestinal malabsorption and diarrhea in a wide variety of species including humans. After acquisition, about 50% of patients clear the parasite without any secondary effects; between 5 and 15% shed cysts asymptomatically while the remainders 35-45% develop an acute/or chronic infection [293]. Giardia chronic infections resemble IBS indicating the importance of Giardia discrimination in diagnostics. Furthermore,

D'Anchino et al. [383], reported evidence for post-infectious IBS secondary to low grade inflammation associated with the fecal persistence of Giardia. In addition, Grazioli et al. [384], recently reported Giardia infection in 6.5% of patients with IBS, indicating that Giardia may be a common cause of IBS-like symptoms. Following the 2004 outbreak of giardiasis in Bergen,

numerous cases of IBS and CFS were reported indicating a relationship between Giardia and PI-

IBS [307,376,377,381,385].

Although Giardia has only recently been linked to the appearance of PI-IBS, numerous giardiasis outbreaks, essentially waterborne and foodborne, have been reported worldwide over the past 40 years and keeps being reported today [393–410] underlying the importance of

Giardia infections in developing as well as in developed countries. With about 50 to 65% of patients either asymptomatic or without untoward consequences, and accounting for the fact that the presence of Giardia cysts is not routinely tested in gastroenteritis diagnosis, Giardia infections remains fairly under reported. Similarly, IBS prevalence has been shown to be under reported. Thirty-three to 90% of sufferers do not consult, and a proportion of consulters meeting

IBS criteria are not labelled as having IBS underlying the important rate of undiagnosed IBS

[118,411,412]. It is then reasonable to imagine that numerous PI-IBS following acute giardiasis could also be under reported. In this context a proof-of-concept between Giardia and PI-IBS is sorely needed and a greater understanding of the mechanisms involved in the development of post-giardiasis IBS may further increase our knowledge of the pathogenesis of giardiasis and possibly highlights a previously underestimated need of routine parasite diagnostic.

Several post-infectious irritable bowel syndrome models have been developed, which can be divided in two categories. The first are post-inflammatory models, which are developed with inflammation-inducing chemical agents such as Trinitrobenzene sulfonic acid (TNBS), Mustard

Oil (MO), or Dextran sulfate sodium (DSS). The second are post-infectious models, which are developed with parasites or bacteria-induced infection. Few models have been developed using enteric infection relevant to human diseases with bacteria such as Campylobacter jejuni,

Escherichia coli, Salmonella and Shigella [276,420]. Over the recent years, inductions of IBS

following parasitic infection have been reported and new models have been developed.

Examples include: the Trichinella spiralis mouse model [283,421–423], the Nippostrongylus brasiliensis rat and mouse models [418,424] or the Cryptosporidium parvum neonatal rat model

[284,419] (PI-IBS animal models reviewed by Qin et al., [425]); . Following the 2004 giardiasis outbreak in Bergen, Norway, the need of a new model of PI-IBS using experimental giardiasis has become apparent.

1.7. Hypothesis

Giardia infection induces the translocation of commensal bacteria by disrupting the intestinal barrier function which contributes to intestinal hypersensitivity and the subsequent development of post-infectious irritable bowel syndrome.

1.8. Objectives Of This Study

The present study objectives were to determine the role of Giardia duodenalis in the appearance of post-infectious irritable bowel syndrome and to characterize the effect of Giardia duodenalis on the intestinal barrier function and the commensal microbiota localization. All studies were carried out using either a newly developed in vivo animal model or an in vitro cell culture model system using trophozoites from the human assemblages (A and B) of Giardia duodenalis. The aims of the individual studies in this thesis are:

 To develop an animal model using Giardia trophozoites from the assemblages A

and B in which we could establish a cause-to-effect relationship between Giardia

and post-infectious intestinal hypersensitivity and the seubsequent development of

PI-IBS

 To characterize the mechanisms by which Giardia may induce post-infectious

irritable bowel syndrome. This second aim was divided in three further parts:

o To determine if Giardia is able to facilitate the translocation of commensal

bacteria through the intestinal epithelium in vivo and in vitro

o To determine the route (paracellular vs. transcellular) by which Giardia

facilitates the translocation of commensal bacteria in vitro

o To determine the mechanisms behind Giardia-induced alteration of the

small intestinal barrier in vitro

2. Methods & Materials

2.1. In Vivo Experiments

2.1.1. Giardia duodenalis Isolates

For the purpose of this studies, Giardia trophozoites were either maintained axenically or excysted through passage in gerbils (Meriones unguculatus). Two different assemblages

(assemblages A and B), one isolate per assemblage (WB and H3, respectively) were used.

WB trophozoites (assemblage A, ATCC® Number 30957, ATCC-LGC Promochem, Molsheim,

France) were maintained in axenic cultures. Briefly, trophozoites were grown in 15 mL polystyrene tubes containing 14 mL of TYI-S-33 medium (appendix I). Trophozoites were fed every two days and passaged when confluent.

H3 isolates (assemblage B, Waterborne Inc., P101. Cysts of Giardia lamblia*, Human isolate H-

3, aka CH-3) were obtained by excystation through passage in gerbils (Meriones unguculatus).

Gerbils were orally infected with a suspension of 103 cysts of the H3 isolate. Seven days post- infection, gerbils were euthanized by intra-peritoneal injection of a lethal dose of sodium pentobarbitone (Abbott Diagnostic, Rungis, France). After a laparotomy, duodenum and jejunum were sampled and conserved in TYI-S-33 media on ice until parasite extraction. Intestine was grounded with a cold mortar and pestle, filtered twice on doubled sterile gauze. After filtration parasites were rinsed twice with cold PBS (PBS added on parasite, centrifuge 10 minutes at

1800g). The pellet was then resuspended in TYI-S-33, trophozoites presence assessed under microscopy, and dilution were realized for infection.

2.1.2. Animal Model

2.1.2.1. Infection

Five day-old suckling Sprague-Dawley rats (Janvier, Le Genest Saint Isles France) were used to evaluate Giardia duodenalis pathogenicity. Mother and litter were maintained under pathogen- free conditions, held in plastic cages in a ventilated rack and given food and water ad libitum.

Suckling rats were orally infected by 104 live Giardia trophozoites in 100 μL of TYI-S-33 media containing 10% DMSO (infected groups: infected with WB: n=20; infected with H3: n=20).

Controls animals were gavaged with 100 μL of TYI-S-33 medium containing 10% DMSO, free of Giardia trophozoites (control group n=20). Animals were handled according to the regulations enforced by the French Ministry of Agriculture and the University ad hoc ethical committee.

The disease consists of three stages: infectious stage, clearance stage and post-infectious stage

(described in Figure 2.1). Rats are infected at Day 0, infectious stage last for about 2 weeks with day 7 post-infection (PI) as the peak of infection, between day 14 and day 21 PI occurs the clearance stage were the disease resolves itself and parasites are naturally eliminated, after day

21 PI, all parasites have been eliminated from the intestine, the post-infectious stage starts. For all the following experiments three time points have been chosen, day 7 PI (peak of infection), day 21 PI (clearance) and day 50 PI (post-infectious period with a delay allowing rats to completely recover from the disease).

Figure 2.1: Giardia duodenalis infectious stages: D0: infection with a suspension of 104 live

Giardia trophozoites of either assemblage A or assemblage B. D5 to D14: acute stage of the infection, parasite proliferation with the peak of infection at D7. D14 to D21: clearance stage, natural elimination of the parasite from the intestine. D21: beginning of the post infectious stage.

D50: time point chosen for our studies

2.1.2.2. Infection Assessment

At day 7 post-infection, the presence of Giardia duodenalis was assessed by microscopic observation and identification of the infecting assemblage was done by nested-PCR. At day 21 and day 50 post-infection, the small intestine was microscopically assessed for the presence of

Giardia.

2.1.2.2.1. Microscopic Observation

At each time point, 1cm of jejunum was sampled, opened longitudinally, transferred in a microtube containing PBS and incubated on ice 10 minutes. 10 μL of the supernatant was then added on a haemocytometer and the presence of Giardia was assessed under microscope.

2.1.2.2.2. Assemblage Identification By PCR

2.1.2.2.2.1. Trophozoites Isolation

At day 7 PI, the whole duodenum was sampled and conserved in TYI-S-33 at -20°C until parasites extraction. Briefly, the duodenum was transferred in a Petri dish containing 1 mL of sterile PBS and homogenized manually with fine scissors. The homogenate was then filtered twice on sterile gauze and rinsed three times with PBS (centrifuge 10 minutes at 1500g at 4°C, pellet resuspended in 25 mL of PBS, centrifuge as previously). After final wash the pellet was resuspended in 2 mL of PBS.

2.1.2.2.2.2. DNA Extraction

DNA extraction was realised from 55μL of suspension obtained from the duodenum using the kit

InstagenMatrix (BioRad). Briefly, 55 μL of suspension was transferred in a new sterile microtube and underwent 6 freeze/thaw cycles. Following this procedure, 55 μL of

InstagenMatrix was added in the microtube and incubated at 56°C for 35 minutes. The suspension was then lysed 8 minutes at 100°C and centrifuged 10 minutes at 10000g at room temperature. The supernatant containing the DNA was transferred in a new microtube and stored at -20°C until PCR.

DNA was quantified with a Nanovue (GE Healthcare) and all PCR templates were standardized at 100ng of DNA per reaction.

2.1.2.2.2.3. PCR

A first amplification was realised at the Triose Phosphate Isomerase (TPI) gene locus as previously described by Sulaiman et al. [413]. Briefly, a PCR product of 605 bp was amplified by using primers AL3543 [5' - AAATIATGCCTGCTCGTCG - 3'] and AL3546 [5' -

CAAACCTTITCCGCAAACC - 3']. The PCR reaction consisted of 2 μL of DNA normalized at

100ng, 200 μM of each deoxynucleoside triphosphate (dNTP), 1X of ReddyMixTM MasterMix

(Thermo Scientific) and 200 nM of each primers. PCR reactions were performed for 35 cycles

(94°C for 45 sec, 50°C for 45 sec and 72°C for 60 sec) in a Mastercycler® (Eppendorf), with an initial start step (94°C for 5 minutes) and a final extension step (72°C for 10 minutes).

2.1.2.2.2.4. Nested PCR

For the assemblage specific amplification of the Giardia TPI gene, assemblage-specific primers were employed as previously described [414,415]. For the detection of the assemblage A specific primers Af [5' - CGCCGTACACCTGTCA - 3'] and Ar [5' - AGCAATGACAACCTCCTTCC -

3'] were used [414] and the specific primers AssBF [5' - GTTGTTGTTGCTCCCTCCTIT - 3'] and ASSBR [5' - CCGGCTCATAGGCAATTACA - 3'] [415] were used to detect the assemblage B. The second PCR reaction consisted of 2 μL of the amplification products from the

primary PCR, 200 μM of each deoxynucleoside triphosphate (dNTP), 1X of ReddyMixTM

MasterMix (Thermo Scientific) and 200 nM of each primers. Nested PCR reactions were performed on a Mastercycler® (Eppendorf) with an initial denaturation step for 10 minutes at

95°C, followed by 35 cycles (denaturation for 45 sec at 95°C, annealing for 45 sec at 62°C, extension for 60 sec at 72°C) and a final extension step at 72°C for 5 minutes.

All PCR products were assessed by electrophoresis on 1.5% agarose gels and visualized with ethidium bromide.

2.1.2.2.2.5. Sequencing

2.1.2.2.2.5.1. PCR Products Purification

Amplifications product were isolated from the electrophoresis agorose gel under UV light and processed to purification with the QIAquick Kit (QIAGEN) following the manufacturer's instructions except for the elution step. Elution was done with 30 µL of elution buffer.

2.1.2.2.2.5.2. Sequencing

Sequencing was realized in collaboration with the genetic group (INSERM UMR 614) of the

University of Rouen. Sequencing was done on ABI PRISM 3100 (Applied BiosystemsTM, CA,

USA) using Big Dye Sequencing kit (Applied BiosystemsTM). Sequences analysis and comparison to sequences from data bank were done using BLAST software (Basic Local

Alignment Sequence Tool, National Institute of Health, USA).

2.1.2.3. Intestinal Histology

Five rats in each group at days 7, 21 and 50 post-infection were euthanized by intraperitoneal injection of a lethal dose of sodium pentobarbitone (Abbott Diagnostic, Rungis, France) for

histological examination. Pieces from the duodenum, jejunum, and colon were fixed in 10 % formaldehyde solution and embedded in paraffin.

This part of the work was done in collaboration with the pathology service of the Rouen

University Hospital, embedding, slicing and marking were done by Dr. Arnaud François and Ms.

Élodie Colasse. Analysis were realised at the University of Rouen in the laboratory with the help of Ms. Hajer Nedhif (MSc student), Dr. Laëtitia Le Goff, Dr. Gilles Gargala and Dr. Loic

Favennec.

At days 7 and 21 PI, 5 μm sections were Giemsa stained. Villus heights (VH) and crypt depths

(CD) were measured in each section on 15 well-oriented villus-crypt units by using the image analysis software Histolab 6.13.0 (Microvision, Evry, France). For each group, the VH/CD ratio was calculated as the mean VH divided by the mean CD.

Intestinal intraepithelial lymphocytes (IELs) were labeled in 5 μm sections with Periodic Acid

Schiff staining. Intestinal IELs were counted per villus for 10 villi in each animal.

Mast cells were labeled on 5 μm sections with a monoclonal mouse anti-mast cell tryptase antibody (Abcam, Paris, France) at 1/8000 and revealed using a horseradish peroxidase- conjugated goat anti-mouse secondary antibody from Ultraview Universal DAB Detection Kit

(Ventana, Roche, Boulogne-Billancourt, France). Mast cells were counted per villus for 100 villi in each animal.

2.1.2.4. Whole Gastrointestinal Tract Motility

At day 7, 21 and 50 PI, 5 rats of each group were used to assess whole GI motility. To do so, each rat was orally gavaged with 100μL of a semi-solid solution of Evans blue and arabic gum

(5% Evans Blue, 5% Arabic Gum in ddH2O), and time was recorded until appearance of colored feces.

2.1.2.5. Neuronal Activation

At day 7, 21 and 50 PI, c-fos expression was assess in the spinal cord of the animals either by staining following the whole fixation of the animal, or by RT-qPCR on fresh spinal cord samples.

2.1.2.5.1. Whole animal fixation

At day 7, 21 and 50 PI, 3 rats of each group were anesthetized by intraperitoneal injection of sodium pentobarbitone (100 µL per 100 gram of weight / 6mg per kg) (euthanyl, Vetoquinol

Canada INC.) to assess the neuronal activation of pain. Prior to sampling, the whole animal was fixed by intra-cardiac perfusion of a 10% paraformaldehyde solution following a wash with PBS

(5mL at day 7 PI, 8 mL at D21 PI, 15 mL at D50 PI). It is important to note that the perfusion has to be done while the heart was still beating but after complete anesthesia of the rat assessed by absence of reaction to painful stimuli (paw pinching).

2.1.2.5.2. Spinal Cord Staining

After fixation, the spine was sampled, opened longitudinally to expose the spinal cord. The ventral part of the spine with the spinal cord was then conserved in a 4% formaldehyde solution overnight. Spinal cord from T10 to L2 were selected and transferred in a 30% sucrose solution for 3 days. After incubation in sucrose, samples were mounted in OCT on dry ice and stored at -

20ºC until cryosection. OCT embedded specimens were cut with a cryostat at 8 µm, mounted on histobond-coated slides (VistaVisionTM, Histobond® Adhesive Slides, VWR) and processed for immunohistochemistry. Samples were blocked 1 hour in a blocking buffer (PBS, 3% FBS, 0.3%

Triton X), in order to block non specific binding of antibody. Section were incubated with rabbit monoclonal antibody directed against c-fos (diluted 1/1000; Calbiochem, Millipore, USA)

overnight in a humid chamber at 4ºC. Following thorough washes in PBS, slides were incubated for 1 hour in the dark at room temperature with a secondary goat anti-rabbit antibody coupled with Alexa fluor 488 (diluted 1/1000; Invitrogen, USA). The washing steps were performed at room temperature three times for 20 minutes. Slides were mounted with FluoroShield™

(histology mounting medium with DAPI, Sigma-Aldrich). All dilutions were done in blocking buffer.

2.1.2.5.3. PCR

2.1.2.5.3.1. Sampling

At day 7, 21 and 50 post-infection, 5 rats in each group were euthanized by intraperitoneal injection of a lethal dose of pentobarbitone. The spinal cord was sampled as previously described, sections between T10 and L2 and L6 and S2 were sampled, snap frozen in RNAlater®

(Qiagen), and stored at -70ºC until RNA extraction.

2.1.2.5.3.2. RNA Extraction

RNA extractions were done on 20 mg of the thoracolumbar part of the spinal cord with the

RNeasy Mini Kit (Qiagen) following the manufacturer instructions after tissue homogenisation.

Twenty mg of spinal cord were transferred in a fast prep tube containing two 3.2 mm stainless steel beads and 600 µL of RLT buffer. Spinal cord was then homogenized in a bead beater

(FastPrep®-24 MP Biomedicals) for 20 seconds. Suspension was transferred in a new 1.5 mL microtube, centrifuged for 3 minutes at 20000g at room temperature. Supernatant was transferred in a new 1.5mL and extraction was realised following the manufacturer instruction except for the elution. Briefly, 40µL of RNase free water was added to each micro column, and centrifuged for

1 minute at 8000 g at room temperature. The eluate was then re-deposed on the membrane for a

second elution in order to increase the RNA concentration. RNA concentration and quality was assessed using a Nano Spectrophotometer (ND-1000, NanoDrop).

2.1.2.5.3.3. cDNA Synthesis

Complementary DNA was produced from 1µg of RNA with the QuantiTect Reverse

Transcription Kit (Qiagen) following the manufacturer instructions. Briefly, genomic DNA was eliminated using the gDNA wipeout Buffer (1X final concentration), 1µg of RNA template and

RNase-free water qsp 14 µL. The solution was incubated 2 minutes at 42ºC. Following this first step, reverse transcription was realised according to the manufacturer instructions. From the previous step were added 1µL of Quantiscript Reverse transcriptase, 4 µL (1X final) of

Quantiscipt RT Buffer and 1 µL of RT Primer Mix. The samples were then incubated 15 minutes at 42ºC, followed by an inactivation step of the reverse transcriptase 3 minutes at 95ºC. Samples were stored at -20ºC until qPCR reaction.

2.1.2.5.3.4. qPCR

All quantitative PCR reactions were realised with the QuantiFast SYBR® Green PCR kit

(Qiagen) on Rotor-Gene Q thermocycler (Qiagen) in 0.2mL tube on a 36 wells rotor.

Amplifications were realised for the target gene c-fos and for the internal control GAPDH with primers previously described by Jawed et al. [416] (cf. table 8 for primers sequences). The qPCR reaction consisted of 1X of QuantiFast SYBR® Green PCR Master Mix, 1 µM of forward primer,

1 µM of reverse primer, 100 ng of cDNA template and RNase-free water qsp 25µL. The qPCR reaction consisted of a 5 initial activation step at 95ºC for 1 min, followed by 35 cycles of 10 seconds denaturation at 95ºC, 30 seconds combined annealing/extension at 60ºC. A final step

was done to obtain the melting curve: starting at 55ºC and rising of 1ºC every 5 seconds to reach

99ºC.

Analysis was performed with the Rotor Gene Q software and the 2-(ΔΔCt) method was applied to measure the fold change of mRNA expression between the control and the infected group [417].

2.1.2.6. Bacterial Translocation

At day 7, 21 and 50 PI, 5 rats of each group were assessed for bacterial translocation as followed.

2.1.2.6.1. Plating

A piece of spleen, liver and Mesenteric Lymph Nodes (MLN) were aseptically removed and transferred in a sterile tube containing two 3.2 mm stainless steel beads. Each organ was weighed and 1 mL of sterile PBS was added in each tube. Tissue was then homogenised in a bead beater for 2 x 20 seconds at 4.o/ms (FastPrep®-24; MP biomedicals). After homogenisation samples were serially diluted and 20 µL plated on Columbia agar containing 5% of sheep blood.

Plates were incubated two days at 37°C under aerobic or anaerobic conditions (AnaeroGen 2.5L pack in an AnaeroJar, Oxoid, ThermoScientific) and colony-forming units (CFU) were enumerated. Bacterial counts were standardized in CFU per gram of tissue.

Target gene Sequences PCR Annealing

product size temperature (ºC)

GAPDH forward 5'-GGAAAGCTGTGGCGTGATTGG-3' 60 414 GAPDH reverse 5'-GTAGGCCATGAGGTCCACCA-3' 60 c-fos forward 5'-AACCATCCCCGAAATCCTAC-3' 60 185 c-fos reverse 5'-AGCGGAACAGAGAAACTGGA-3' 60

Table 8: Primer sequences of GAPDH and c-fos

2.1.2.6.2. Fluorescent In-Situ Hybridization

2.1.2.6.2.1. Sampling And Fixation

A piece of spleen, liver and colon were aseptically removed and fixed in 4% paraformaldehyde overnight. After fixation, tissues were rinsed in PBS and embedded in paraffin. To stain our tissue for bacteria we used two hybridization probes: EUB-338 (10X, non formamide) and nEUB-338 for negative control and background staining (10X) used at 5ng/µL (1X)

2.1.2.6.2.2. Deparaffinization

Before hybridization, slides were deparaffinised, to do so slides were incubated in successive bath: Xylene for 5 min. xylene for 5 min, 95% ethanol for 1 min, 95% ethanol for 1 min, and rinsed under water for 5 min. Following the baths slides were air dried 15 minutes and processed for hybridization.

2.1.2.6.2.3. Hybridization

Each sample was added 16 µL of hybridization buffer (0.9 M NaCl, 20 mM Tris HCl pH7.4,

0.01% SDS, qsp H2O) and 2 µL of probe (1X). Slides were first denaturised for 5 minutes at

70ºC, and hybridization was done at 46ºC for 60 to 120 minutes. Following hybridization, slides were rinsed once quickly in ddH2O, and rinsed for 15 minutes at 48ºC in washing buffer (20 mM

Tris HCl pH7.4, 1mM NaCl, 0.01% SDS). A last quick rinse in ddH2O was performed before mounting with FluoroShield™ (histology mounting medium with DAPI, Sigma-Aldrich)

2.1.2.7. Visceral Hypersensitivity

Jejunal and rectal sensitivity to balloon distension were tested in 15 rats from each group on day

50 PI as previously described [284,418,419]. Rats were anesthetized with intraperitoneal

injection of sodium pentobarbitone as previously described (Pentobarbital Sodique, Ceva santé animale, Libourne, France; 6mg/kg) (see section 2.1.2.5.1) (Abbott Diagnostic, Rungis, France).

A first incision was made in the ventral neck to expose the trachea, an incision was made and a tube inserted and fixed to the trachea to allow smooth breathing during the experiment. Then a midline abdominal incision was made to expose the small intestine, in the jejunum, at 7cm from the Treitz ligament, a cut was made on the anti-mesenteric side of the jejunum. A balloon was inserted in the jejunal segment and fixed. The intestinal segment was then replaced in the peritoneal cavity which was sutured. Rectal distensions were performed by inserting a balloon via the anal route. Balloons were arterial embolectomy catheters (Fogarty-Edwards Life

Sciences, Saint-Priex, Switzerland). Distensions were performed in a stepwise fashion. Each twenty seconds distensions were followed by a 5-minutes rest period. Distending the jejunum or rectum (0.1 to 0.4 mL and 0.2 to 1.0 mL, respectively) resulted in a stimulus-related decrease in systemic blood pressure. Blood pressure variation was continuously recorded from a side arm carotid cannula by using a pressure transducer (P10EZ) connected to a window graph 240

(Gould, Courtaboeuf, France), linked to a data acquisition and analysis module, iWorx404. All data were recorded and analyzed with the LabScribe 2 software (Bioseb, Vitrolles, France)

(Figure 2.2).

Figure 2.2: Diagram of the visceral hypersensitivity model via blood pressure variation analysis in response to balloon distension A: Computer for analysis of blood pressure variation recorded with LabScribe2 software (BioSeb, Vitrolles, France); B: carotid cannula; C: pressure transducer (P10EZ) connected to a window graph 240 (Gould, Courtaboeuf, France), linked to a data acquisition and analysis module, iWorx404 (BioSeb, Vitrolles, France); D: arterial embolectomy catheters (Fogarty-Edwards Life Sciences, Saint-Priex, Switzerland) used for balloon distension, one balloon surgically inserted in the jejunum, second balloon inserted in the rectum via the anal route.

2.2. In Vitro Experiments

2.2.1. Giardia duodenalis Isolate

All in vitro experiments were performed with Giardia duodenalis assemblage A strain WB maintained in axenic culture as previously described.

2.2.2. Cell Culture

Caco-2 human colonic epithelial cells (passage 26 to 36, ATCC® HTB-37TM) were grown in

Minimum Essential Media with 1X Earle's salt (MEME) containing 20% fetal bovine serum

(FBS), 200 mM L-glutamine, 100U/mL penicillin, 100U/mL streptomycin, 100 mM Sodium pyruvate, and incubated at 37°C and 5% CO2. Medium was replenished every 2 to 3 days. Cells were passaged when reaching 80% confluence.

For translocation and permeability studies, cells were seeded onto Transwell filters at 104 cells/mL

(12 mm Transwell® with 3.0 µm Pore Polycarbonate Membrane Insert, Sterile, Costar, Corning

Inc. Corning, NY). Transepithelial electrical resistance (TER) was monitored with an electrovoltohmeter (World Precision Instrument, Sarasota, FL) and monolayers were used at confluence (TER > 400Ω).

For internalization assay, cells were seeded onto 6 well plates at 104 cells/mL (BD BioCoatTM,

Becton Dickinson Biosciences, Canada, Mississauga, ON).

2.2.3. Bacterial Translocation

Monolayers were used in antibiotic-free MEME to the apical and basolateral compartments.

Monolayers were inoculated apically with ± Giardia duodenalis assemblage A (WB strain) to achieve a MOI of 101 trophozoite/enterocytes and ± E. coli HB101 to achieve a MOI of 100

CFU/enterocyte (4 groups: controls (no Giardia - no E. coli), Giardia alone, E. coli alone,

Giardia and E. coli). Following 1, 2, 3 and 6 hours of incubation in aerobic conditions, E. coli recovered in the basolateral compartment were enumerated by spreading serial dilutions onto non-selective LB agar and incubation overnight at 37°C in aerobic conditions.

2.2.4. Bacterial Internalization

2.2.4.1. Gentamicin Assay

To assess E. coli internalization, monolayers grown on 6 well plates, after infection and incubation as previously described, were washed twice with PBS and incubated for 1 hour with

MEME 20% containing gentamicin (250 μg/mL; Sigma-Aldrich, Oakville, ON). Monolayers were washed, lysed with RIPA buffer (1% Igepal CA-630, 0.1% SDS, 0.5% sodium deoxycholate diluted in PBS with protease inhibitor (cOmplete Mini, Roche Diagnostic,

Indianapolis, IN, 1 tablet/10 mL) and viable bacteria were enumerated by spreading onto non- selective LB agar. A preliminary experiment confirmed that surface E. coli were killed by the gentamicin treatment. Briefly, for each condition (Control, Giardia, E. coli, Giardia + E. coli) serial dilution of the supernatant after 1 hour incubation with gentamicin were plated on LB agar, no bacteria were observed after 24 hours incubation at 37ºC (Data not shown).

2.2.5. In Vitro Permeability

2.2.5.1. Fluorescein Isothiocyanate - Dextran Assay

Using 12 well Transwells as previously described and following the infection period, monolayers were washed with sterile Ringer's solution. A 3kDa FITC-dextran probe (500μL, 100 mM

Ringer's solution, Molecular Probes) was added to the apical compartment, and 1 mL of Ringer's solution added to the basolateral compartment and incubated for 3 hours at 37°C, as described

previously [310]. Samples were collected in triplicate from the basolateral compartment and absorbance at 480/520 nm was measured.

2.2.6. Tight Junctions Integrity

2.2.6.1. Whole Cell Protein Extraction And Standardization

Cell monolayers grown on six-well plates were washed twice with PBS and lysed with 350 μL of

RIPA buffer containing protease inhibitor as previously described. Lysates were sonicated for 5 seconds (550 Sonic Dismembrator, Fisher Scientific), centrifuged at 10000 g for 10 minutes at

4°C. The supernatants were collected, and protein concentration was done using a Bradford assay (BioRad DCTM Protein assay kit, Bio-Rad Laboratories, Hercules, CA). Protein concentration was normalized to 3 mg/mL, and samples were diluted 1:1 in 2X Laemmli buffer and boiled for 3 minutes. Samples aliquots were stored at -20° for until immunoblotting.

2.2.6.2. Immunoblotting

Samples were separated on 13% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes (Whatman, Buckinghamshire, UK) and immunostained for Occludin and Claudin-4 as follows. Membranes were first reversibly stained with Ponceau red S solution (Sigma-Aldrich) to verify the transfer efficiency as well as the loading of proteins.

Membranes were then incubated 2 minutes in 0.2 M NaOH and rinsed in Tris-Buffered saline

(TBS) + 0.1% Tween (TBS-T). Membranes were then blocked in TBS-T containing 5% of non- fat dry milk for 1 hour at room temperature, rinsed three times with TBS-T, and incubated with either rabbit polyclonal anti-claudin-4 antibody (diluted at 1/1000 in 5% milk TBS-T; AbCam) or with mouse monoclonal anti-occludin antibody (diluted at 1 1000 in TBS-T with 5% milk,

Invitrogen) overnight at 4°C under agitation. After primary antibody incubation, membranes

were rinsed three times in TBS-T, incubated with horseradish peroxidase (HRP) conjugated rat anti-rabbit Ig at 1 1000 in TBS-T with 5% milk or with HRP conjugated goat anti-mouse Ig at

1 1000 in TBS-T with 5% milk for 1 hour at room temperature, rinsed three times in TBS-T.

Bands were visualized using the ECL-plus western blotting detection system (GE Healthcare,

Pittsburgh, PA).

2.3. Statistical Analysis

Data were expressed as means ± one standard error of the mean (SEM: 95% confidence interval).

Significance of differences between groups were evaluated using t-test, Mann-Whitney, Kruskall

Wallis and Newman, or one- two-way ANOVA depending on the parameter analyzed. P values under 0.05; 0.01 and 0.001 were considered significant.

3. Results

3.1. Development Of An Animal Model Suitable For The Study Of Post-Giardiasis IBS

3.1.1. Giardia Infection Model

Five days old Sprague-Dawley rats were orally gavaged with a 100 µL of TYI-S-33 media containing 104 live Giardia duodenalis trophozoites from either assemblage A (strain WB) or assemblage B (strain H3). Control animals were orally gavaged with 100µL of TYI-S-33 media containing PBS. Presence of the parasite, identification of the infecting assemblage and parasitic load were assessed during the infectious stages described in Figure 1.

At day 7 PI, peak of the infection, Giardia trophozoites were found in none of the animals in the control group and were present in all infected animals. The average parasitic load was 6.64x105

(±2.5x105) trophozoites per cm of jejunum. At day 21 PI, no trophozoites were found in the animals from any groups indicating that the parasites have been cleared from the intestine 21 days after the initial infection. Similar results were observed at D50 PI, indicating no re-infection or long term residual infection with the parasite. No control rat became infected throughout the course of the studies.

After nested PCR and sequencing (data not shown), the infectious assemblage was verified and corresponded to the initial assemblage with whom the animals were infected.

3.1.2. Visceral Hypersensitivity To Distension

Visceral hypersensitivity is one of the main feature of IBS, and has been used in numerous models of post-infectious and post-inflammatory-IBS [284,418,422,426,427]. In this context we decided to assess the visceral hypersensitivity in response to distension at two different sites of the GI tract: jejunum and rectum. This was done 50 days post-infection, when all parasites have

been cleared of the intestine and after recovery. In anesthetized rats, a cardiovascular depressor response in response is considered to be predictive of visceral nociception [418,419,428–430].

Thus, blood pressure decreases to distension were recorded in all groups and statistically compared to assess visceral hypersensitivity to distension.

3.1.2.1. Rats Infected With Giardia duodenalis Assemblage A (WB)

On day 50 PI, we observed a significantly greater decrease in the blood pressure in the assemblage A (WB) infected rats, in response to jejunal distensions for the volumes of 0.3 and

0.4 mL (Figure 3.1, A).

Similarly, when rectal distensions were applied, we observed a significantly greater decrease in the blood pressure of the rats infected with WB compared to control for 0.6; 0.8 and 1 mL of distension volumes (Figure 3.1, B).

To assess the strength of the model, we determined the percentage of rats which presented visceral hypersensitivity to distension. When the rats were infected with Giardia duodenalis assemblage A, we observed that 12 of 19 tested animals presented hyperalgesia. We also compared if the sex of the animal had an influence on the sensitivity to distension. Seven of 9 males tested presented visceral hypersensitivity, while 4 of 4 females tested had visceral hypersensitivity. Sex was not noted for the remaining animals.

3.1.2.2. Rats Infected With Giardia duodenalis Assemblage B (H3)

Fifty days post-infection, we observed a significantly greater decrease in blood pressure in response to balloon distension in the rats infected with the assemblage B (H3) when compared to

control. The significant difference observed started from the lower distension volumes (0.1 mL)

(Figure 3.2, A)

Similarly, during rectal distensions, we observed a significantly greater decrease in blood pressure in H3 infected group compared to control, 50 days PI, starting at the lowest distension volume (0.2 mL) (Figure 3.2, B).

To assess the strength of the model, we determined the percentage of rats which presented visceral hypersensitivity to distension. When the rats were infected with Giardia duodenalis assemblage B, we observed that 10 of 18 tested animals presented hyperalgesia. We also compared if the sex of the animal had an influence on the sensitivity to distension. Seven of 14 males tested presented visceral hypersensitivity, while 3 of 4 females tested presented visceral hypersensitivity.

Figure 3.1: Giardia duodenalis assemblage A induces visceral hypersensitivity in the jejunum and rectum 50 days post-infection: Assessment of the decrease in carotid artery blood pressure in control and Giardia assemblage A infected animals during the jejunal and rectal balloon distensions. A: jejunal sensitivity to distension on day 50 post-infection using

Giardia duodenalis assemblage A (strain WB). B: Rectal sensitivity to distension on day 50 post- infection using Giardia duodenalis assemblage A (strain WB). The error bar represents one

Standard Error of the Mean (SEM). Values are means (± one SEM) (n= 20 in each group).

Statistical analysis by student t-test - Newman-Keuls. * P value <0.05, ** P<0.01, *** P<0.001, decrease of blood pressure of infected group significantly different from control group

Figure 3.2: Giardia duodenalis assemblage B induces visceral hypersensitivity in the jejunum and rectum 50 days post-infection: Assessment of the decrease in carotid artery blood pressure observed in control and Giardia assemblage B infected animal during the jejunal and rectal balloon distensions. A: jejunal sensitivity to distension on day 50 post-infection using

Giardia duodenalis assemblage B (strain H3). B: rectal sensitivity to distension on day 50 post- infection using Giardia duodenalis assemblage B (strain H3). The error bar represents one

Standard Error of the Mean (SEM). Values are means (± one SEM) (n= 20 in each group).

Statistical analysis by student t-test - Newman-Keuls. * P value <0.05, ** P <0.01, *** P <0.001, decrease of blood pressure of infected group significantly different from control group.

3.1.3. Whole Gastrointestinal Transit

Whole GI tract transit was assessed during the different infection stages of Giardia in our animal model using a semi-solid solution containing a dye (Evans Blue). No significant difference in transit time was observed between control and infected animals (Figure 3.3).

3.1.4. Intestinal Histology Analysis

Irritable bowel syndrome has been associated with modification of the mucosal structure, indeed

Barbara et al. [189] have shown a colonic mast cell infiltration and degranulation in proximity to mucosal innervations that could contribute to abdominal pain observed in IBS. In addition,

Giardia infections have been shown to induce alterations of mucosal epithelial cells including, villus atrophy, increased enterocyte apoptosis, lymphocyte activation and intestinal barrier dysfunction (reviewed by Cotton et al., [302]). In this context we decided to investigate the effects of Giardia infection in our model on the intestinal epithelial cells as well as on the mucosal structure. We assessed the structure of the villi and crypt, the quantity of intraepithelial lymphocytes and mast cells in the jejunum (infection site) at day 7 PI, during the acute phase of the disease and at day 50 PI, after complete clearance of the parasite and recovery of the rat.

3.1.4.1. Giardia duodenalis Infection Induce Modification Of the Mucosal

Structure

Several host species have been shown to exhibit intestinal villus atrophy and crypt hyperplasia, as well as microvillus atrophy in response to giardiasis [308,431–433]. However, clinical signs of giardiasis have also been reported in infected humans and rodents in absence of villus atrophy

[312,431]. In the present study, we assessed the length of crypts and villus together with the ratio

villus height / crypt depth in the duodenum, jejunum and colon of the animals during the acute, clearance and post-infectious stages of giardiasis.

3.1.4.1.1. Duodenal Observations

During the acute phase of the infection, a crypt hyperplasia was observed in the duodenum of the

H3 infected rats when compared to control (Figure 3.4, B). However at 21 days PI, during the clearance of the parasite, we observed villus atrophy associated with crypt hyperplasia in the duodenum of the WB and H3 infected groups when compared to control (figure 3.4, A and B).

No significant difference was observed on the overall ratio villus/crypts during the acute, clearance and post-infectious stage of giardiasis (Figure 3.4, C).

3.1.4.1.2. Jejunal Observations

No significant modification was observed in the jejunum 7 days post-infection. However, we observed an increase of the villus height associated with crypt hyperplasia 21 days post-infection in H3 infected rats compared to control (figure 3.5, A). No significant changes were observed within the WB infected groups (figure 3.5, A and B) and no significant difference were observed in the ratio villus crypt in either group (figure 3.5, C)

Figure 3.3: Giardia infection does not modify the gastrointestinal transit time in rats:

Assessment of the time elapsed between gavage with a semi-solid colored solution and the appearance of colored feces to measure the whole transit time. Control vs. Infected with Giardia assemblage A. Values are means ±SEM. (n=5 in each group for each time point). The error bar represents one SEM. Statistical analysis by student t-test - Newman-Keuls. No significant difference observed between Control and Infected animals.

Figure 3.4: Giardia assemblages A and B induces villus atrophy at D50 PI and Giardia assemblage B induces crypt hyperplasia at D7 and D21 PI in the duodenum: Measure of the crypt and villus length of the duodenal mucosa of the control and Giardia infected animals at

D7, D21 and D50 post-infection after Giemsa staining on 15 well-oriented villus-crypt units. A: average villus length in the duodenum of the rats at D7, D21 and D50 post-infection. B: average crypt length in the duodenum of the rats at D7, D21 and D50 post-infection. C: average ratio

VH/CD in the duodenum of the rats at D7, D21 and D50 post-infection. The error bar represents one Standard Deviation (SD). Values are medians (± one SD) (n= 10 in each group). * P value

<0.05, ** P value <0.01 by ANOVA-Tukey tests. Histological analysis for crypt/villus length and ratios were realized at the University of Rouen by Ms. Hajer Nedhif, Dr. Laëtitia Le Goff and Dr. Gilles Gargala.

100

Villus length in the duodenum

µm) Mean of Mean villus length (in

101

Figure 3.5: Giardia assemblage B induces villus and crypt hyperplasia at D21 PI in the jejunum: Measure of the crypt and villus length in the jejunal mucosa of the control and Giardia infected animals at D7, D21 and D50 post-infection after Giemsa staining on 15 well-oriented villus-crypt units. A: average villus length in the jejunum of the rats at D7, D21 and D50 post- infection. B: average crypt length in the jejunum of the rats at D7, D21 and D50 post-infection.

C: average ratio VH/CD in the jejunum of the rats at D7, D21 and D50 post-infection. The error bar represents one Standard Deviation (SD). Values are medians (± one SD) (n= 10 in each group). ** P value <0.01 by ANOVA-Tukey tests. Histological analyses for crypt/villus length and ratio were realized at the University of Rouen by Ms. Hajer Nedhif, Dr. Laëtitia Le Goff and

Dr. Gilles Gargala.

102

103

3.1.4.2. Giardia duodenalis Infection Induces Variations In Jejunal Intraepithelial

Lymphocytes Counts

Seven days post-infection, no significant difference was observed in the number of jejunal IELs in WB and H3 infected rats. Fifty days post-infection, a significant increase of IELs was observed in the infected groups when compared to controls (Figure 3.6)

3.1.4.3. Giardia duodenalis Infection Induces Mucosal Mast Cells Infiltration In

The Jejunum 50 Days Post-Infection

Seven days post-infection there is no significative difference between control and infected group in the number of mast cell either in the epithelium or the lamina propria

However, 50 days post-infection, we observed a significant mast cell infiltration in the rats infected with the assemblage A (WB) and with the assemblage B (H3), when compared to the control group (Figure 3.7).

3.1.5. Giardia duodenalis Infection Induces An Activation Of The Neuronal Signaling

In order to determine the mechanisms of post-infectious visceral hypersensitivity we assessed the neural expression of c-fos, a marker of neuronal activation, involved in pain signaling. Indeed, it has been shown to be increased in model of visceral pain and IBS [203]. Seven days post- infection, we observed an activation c-fos signaling in the spinal cord of our rats infected with

Giardia duodenalis assemblage A, and this marker was not activated in the control group (Figure

3.8).

We looked at the mRNA expression levels of c-fos in the spinal cord of our animals and we observed a significant increase in c-fos in the infected group at D7 PI, and D50 PI. However no significant difference was observed at D21 PI (Figure 3.9)

104

Figure 3.6: Giardia induces an increase in Intraepithelial lymphocytes in the jejunum 50 days post-infection with either assemblage A or B Count of intraepithelial lymphocytes in the jejunal mucosa of the control and Giardia infected rat at day 7 and day 21 post-infection after immunostaining with Periodic Acid Schiff on 10 villi. A: average number of intraepithelial lymphocytes per enterocytes in the jejunum of the rats at day 7 post-infection. B: average number of intraepithelial lymphocytes per enterocytes in the jejunum of the rats at day 50 post- infection. The error bar represents one Standard Deviation (SD). Values are medians (± one SD)

(n= 10 in each group). **** P value <0.0001 by ANOVA-Tukey test, increase in jejunal IELs of infected group significantly different from control group. Histological analyses for the intraepithelial lymphocytes were realized at the University of Rouen by Ms. Hajer Nedhif, Dr.

Laëtitia Le Goff and Dr. Gilles Gargala.

105

106

Figure 3.7: Giardia induces mast cell infiltration in the jejunum 50 days post-infection with either assemblage A or B Count of mucosal mast cells after immunohistochemistry marking with a mast cell tryptase directed antibody in the jejunum of the control and Giardia infected rats at D7 and D50 post-infection on 100 villi. A: mucosal mast cells count per villus in the jejunum of the rats from each group (Control, Infected with assemblage A, and Infected with assemblage

B) at day 7 post-infection. B: mucosal mast cells count per villus in the jejunum of the rats from each group at day 50 post-infection. The error bar represents one Standard Error of the Mean

(SEM). Values are means (± one SEM) (n= 10 in each group). ** P value <0.01, increase in jejunal mast cells of infected group at D50 PI significantly different from control group by

ANOVA-Tukey tests. Histological analyses for mast cells were realized at the University of

Rouen by Ms. Hajer Nedhif, Dr. Laëtitia Le Goff and Dr. Gilles Gargala.

107

mucosal mast cell numbers in the jejunum at D50 PI

108

Figure 3.8: Representative micrograph of Giardia induction of c-fos expression in the dorsal horn neurons at day 7 PI: Staining of a section of the thoracolumbar part of the spinal cord (between T10 and L2) at day 7 Post-infecion. A: control animal; B: high-magnification of the region highlighted by the white box in A; C: animal infected with Giardia; D: high magnification of the region highlighted by the white box in C. Scale bar indicates 400 µm in A and C, and indicates 200 µm in B and D.Yellow arrows indicates c-fos activated neurons.

109

110

Figure 3.9: The expression of c-fos mRNA of the infected rats was significantly higher 7 and 50 days post-infection: Expression of c-fos mRNA in the thoraco-lumbar part of the spinal cord of the rats (control vs. Giardia infected) at D7, D21 and D50 Post-infection. The error bar represent one SEM. Values are means ± one SEM. (n=10 in each groups). * P value < 0.05 in student t-test - Newman-Keuls, significant fold change in mRNA expression between control and infected animals.

111

112

3.2. Identification Of The Contributing Factors Leading To PI-IBS

3.2.1. Giardia duodenalis Assemblage A Facilitates The Translocation Of Commensal

Bacteria Through The Intestinal Epithelium

3.2.1.1. Plating

In order to understand the contributing factors to the appearance of visceral hypersensitivity, another experiment was performed in our neonatal rat model. Our hypothesis is that Giardia duodenalis by facilitating the translocation of commensal bacteria through the intestinal epithelium could contribute to the development of post-infectious visceral sensitivity. Rat pups were infected with either TYI-S-33 media alone or with a suspension of 104 live trophozoites in

TYI-S-33 media as previously described. Seven, 21 and 50 days post infection, spleen, liver and

MLN were aseptically removed from 5 rats in each group homogenized and plated on Columbia agar with 5% of sheep blood as described in the methods. CFU were enumerated after two days of incubation in aerobic or anaerobic conditions and we were able to observe a significant translocation of commensal bacteria in both spleen and liver at 7 days post-infection (Figure

3.10).

No bacteria were recovered in Mesenteric lymph nodes at D7, D21 and D50 PI (Data not shown).

113

Figure 3.10: Giardia-infected animals showed a significant translocation of commensal bacteria through the intestinal epithelium in both liver and spleen during the acute stage of the disease: Bacterial counts were examined in the spleen and liver of both control and Giardia infected animals after 7, 21 and 50 days post-infection. A: Bacterial translocation in the spleen at

D7, D21 and D50 PI in aerobic conditions; B: bacterial translocation in the spleen at D7, D21 and D50 PI in anaerobic conditions; C: Bacterial translocation in the liver at D7, D21 and D50 PI in aerobic conditions; D: Bacterial translocation in the liver at D7, D21 and D50 PI in anaerobic conditions. Values are means (±SEM). The error bar represents one SEM. (n= 5 in each group at each time). * P value < 0.05; ** P value < 0.01 in student t-test - Newman-keuls. Significant increase in bacterial translocation at Day 7 post-infection in both liver and spleen in aerobic and anaerobic conditions in the animals infected with Giardia assemblage A.

114

115

116

3.2.1.2. Fluorescent In-Situ Hybridization

To confirm our plating findings, we realized a fluorescent in situ hybridization using a bacterial

DNA probe on colonic tissue from our animals. We were able to observe a modification of the colonic structure with a modification of what seems to be the mucus layer thickness accompanied by bacterial infiltration in our infected animal at D7, D21 and D50 PI while the normal colonic structure were maintained in our control animals. However, the colonic structures at D7 and D21 PI was slightly different than observed at D50 PI due to the fact that the intestine of the rat was not fully mature and that the rats were weaned only after D21. (Figure 3.11 to

3.13).

3.3. Characterization Of The Mechanisms Leading To Post-Giardiasis IBS

To understand the mechanisms by which Giardia duodenalis facilitates the translocation of non- invasive bacteria through epithelial monolayers, we needed to reproduce the phenomenon observed in our animal model in vitro. To do so, we used Caco-2 cells monolayers grown in

3.0µm pore size transwell, infected them with Giardia duodenalis assemblage A and added a non-invasive E. coli HB101 of human commensal origin and assessed the translocation induced by Giardia at short incubation time to mimic the early human/animal infection.

3.3.1. Giardia duodenalis Assemblage A Facilitates The Translocation Of Non-Invasive

E. coli Through Confluent Epithelial Monolayers

After 2, 3 and 6 hours of incubation E. coli translocation was significantly increased (P < 0.05) in

G. duodenalis treated monolayers compared to controls (Figure 3.14).

117

Figure 3.11: Infiltration of commensal bacteria into the colonic mucosa during the acute stage (D7 PI): Representative micrographs of bacterial infiltration into the rat colonic mucosa at

7 days post-infection. Colonic segment of control animal and Giardia-infected animal subjected to FISH with EUB338 probe, specific for the domain Bacteria (16s rRNA) were detected in the crypts, epithelial layer and lamina propria of infected-rats but not in control animals. Host nuclei

(4',6-diamidino-2-phenylindole, DAPI) were colored in red; and FISH positive cells in green

(EUB338-Cy3); yellow asterisk (*) represent bacterial infiltrate observed int he colonic mucosa; white dashed line represent the separation between the mucosa and the mucus layer; yellow arrows represent luminal cells (probable immune cells). A: colonic segment of a control animal

(magnification 200X); B: colonic segment of a Giardia-infected rat showing bacterial infiltration in the mucosa (yellow asterisk) (magnification 200X); C: colonic segment of a Giardia-infected rat showing microbiota in direct contact with the mucosa and possible immune cells exudation to the lumen (yellow arrows) (magnification 200X). Scale bar indicates 50 µm.

118

119

Figure 3.12: Infiltration of commensal bacteria into the colonic mucosa during the clearance stage (D21 PI): Representative micrographs of bacterial infiltration into the rat colonic mucosa at 21 days post-infection. Colonic segment of control animal and Giardia- infected animal subjected to FISH with EUB338 probe, specific for the domain Bacteria (16s rRNA) were detected in the crypts, epithelial layer and lamina propria of infected-rats but not in control animals. Host nuclei (4',6-diamidino-2-phenylindole, DAPI) were colored in red; and

FISH positive cells in green (EUB338-Cy3); yellow asterisk (*) represent bacterial infiltrate observed in the colonic mucosa; white dashed line represent the separation between the mucosa and the mucus layer. A and B: colonic segment of a control animal (magnification 200X); C: colonic segment of a Giardia-infected rat showing bacteria infiltrate in the host mucosa (yellow asterisk) (magnification 200X). Scale bar indicates 50 µm.

120

121

Figure 3.13: Infiltration of multiple commensal bacteria into the colonic mucosa during the post-infectious stage (D50 PI): Representative micrographs of bacterial infiltration into the rat colonic mucosa at 50 days post-infection. Colonic segment of control animal and Giardia- infected animal subjected to FISH with EUB338 probe, specific for the domain Bacteria (16s r

RNA) were detected in the crypts, epithelial layer and lamina propria of infected-rats but not in control animals. Host nuclei (4',6-diamidino-2-phenylindole, DAPI) were colorized in red; and

FISH positive cells in green (EUB338-Cy3); yellow asterisk (*) represent bacterial infiltrate observed in the colonic mucosa. A: colonic segment of a control animal (magnification 200X);

B: higher magnification of A (magnification 400X); C: colonic segment of a Giardia-infected rat showing bacterial infiltration in the mucosa (yellow asterisk) (magnification 200X); D: higher magnification of C (magnification 400X). Scale bar indicates 50 µm.

122

123

Figure 3.14: Giardia duodenalis assemblage A facilitates the translocation of non-invasive

E. coli HB101 across confluent intestinal epithelial monolayers. Translocation of a non- invasive E. coli HB101 through confluent Caco-2 monolayers on transwell with 3.0 µm pore size. Values represent the number of CFU recovered from the basolateral compartment of the transwell after incubation with either E. coli HB101 alone or both Giardia and E. coli HB101 up to 6 hours post exposure (PE). Values are means (±one SEM) of four independent experiments where groups were tested in triplicate. The error bar represents one SEM. (n=9 in each group; *

P <0.05 with student t-test - Newman-Keuls). Increase in bacterial translocation was significantly different in presence of Giardia compared to control group for 2, 3 and 6 hours of incubation.

124

Bacterial translocation through confluent Caco-2 monolayers 1.00E+10 *

1.00E+09

1.00E+08

1.00E+07 *

CFU/ mL CFU/ E. Coli + Giardia 1.00E+06 *

E. coli 1.00E+05

1.00E+04 1h PE 2h PE 3h PE 6h PE time

125

3.3.2. Giardia duodenalis Assemblage A Does Not Modify Bacterial Transcellular

Translocation

In order to cross the intestinal barrier bacteria can use two different routes, the transcellular or the paracellular route. The transcellular route consists of the movement of material through the epithelial cells either via internalization of this material at the apical brush border membrane by endocytosis or transcytosis. Internalization can also occur via facilitated or active transporters, or diffusion. Once internalized the substances are then moved through the cytoplasm to the basolateral membrane via a mechanism called transcytosis. When reaching the basolateral membrane the material is then released via similar mechanisms (excystosis, facilitated/active transporters, diffusion). The paracellular route consists of the movement of substances between the epithelial cells through the tight junctions. Kalischuk et al., [434] previously demonstrated that another enteric pathogen, Campylobacter jejuni was able to induce the transcytosis of commensal bacteria across epithelial monolayers. We first tested this hypothesis in our giardia infection model. To do so, Caco-2 cells were grown to confluence on 6 well plates, exposed to

Giardia duodenalis assemblage A and E. coli HB101 as previously described. Following several short incubation times, cells were treated with a non absorbable antibiotic in order to kill all bacteria that are not internalized within epithelial cells. Caco-2 were then rinsed, lysed, serially diluted and plated on LB agar for CFU enumeration.

We observed no significant differences between cells treated with E. coli alone and treated with both Giardia and E. coli indicating that the translocation observed in our model did not occur via the transcellular route (Figure 3.13).

126

Figure 3.15: Giardia duodenalis assemblage A does not induce E. coli HB101 internalization in confluent Caco-2 monolayers. Internalization of a non-invasive E. coli HB101 in Caco-2 monolayers exposed to E. coli alone or to both Giardia and E. coli up to 6 hours. Values are means (±one SEM) of four independent experiments where each groups were tested in triplicate.

The error bar represents one SEM. Statistical analysis by student t-test - Newman-Keuls. No significant difference observed between Giardia treated and control group with t-test.

127

Bacterial internalization in confluent

1.00E+10 Caco-2 monolayers 1.00E+09 1.00E+08

1.00E+07

1.00E+06 E. coli 1.00E+05 1.00E+04 CFU/mL Giardia 1.00E+03 + E. coli 1.00E+02 1.00E+01 1.00E+00 1h 2h 3h 6h Exposure time

128

3.3.3. Epithelial Permeability Is Not Modified In Presence Of Giardia

The other translocation route possible is paracellular, meaning that the bacteria were able to cross between epithelial cells. To test this hypothesis we looked at the epithelial permeability in

Caco-2 cells cultures on transwell membranes with 3.0µm pore size, exposed as previously described with Giardia and E. coli. The same previously describred short incubation times were tested. No difference in permeability was observed between either of the group (Figure 3.14).

3.3.4. Giardia duodenalis Assemblage A Induces The Degradation Of The Tight

Junctional Proteins Occludin And Claudin-4

The intestinal homeostasis and barrier function of the intestinal epithelial monolayer is closely regulated by the tight junctional proteins integrity. Indeed, the barrier function which allows the passage of essential molecules and nutrients and at the same time prevents Ag-sized molecules from penetrating into the sub epithelial compartment and abnormal activation of the immune system via regulation of the tight junctions opening. However, it was previously demonstrated that Giardia was able to alter components of the tight junctionals complexes such as Zonula- occludens, claudin-1, F-actin and alpha-actinin [311,318–321]. In this context we decided to observe the effect of short-term incubation with Giardia on the integrity of two transmembrane proteins from the tight junctional complexes: occludin and claudin-4.

The integrity of epithelial junctional complexes upon exposure to Giardia duodenalis was first assessed by Western Blotting analysis. The housekeeping protein glyceraldehyde 3-phosphate

Dehydrogenase (GAPDH) was first used as a loading control for the western blot assay, however as Giardia seems to be able to disrupt gapdh (data not shown) we decided to use the Ponceau red

129

Figure 3.16: Giardia duodenalis does not modify the epithelial permeability of confluent

Caco-2 monolayers Paracellular permeability to fluorescein isothiocyanate (FITC)-dextran in

Caco-2 monolayers (control) and Caco-2 monolayers exposed either to Giardia alone, non- invasive E. coli HB101 alone, Giardia and non-invasive E. coli HB101 for up to 6. Values are means (±one SEM) of four independent experiments where each groups were tested in triplicate.

The error bar represents 1 SEM. No significant difference observed between Giardia treated and control group with ANOVA-Tukey.

130

Epithelial permeability to Dextran Fluorescein (3kDa) 160

140

120

100 Control

80 Giardia

Dextran control)(% - E. coli 60 Giardia + E. coli 40

Basolateral FITC Basolateral 20

0 1h PI 2h PI 3h PI 6h PI

131

staining of the membrane as loading control [435]. Regardless of the presence of E. coli, G. duodenalis induced a complete degradation of occludin after 1, 2, 3 and 6 hours of incubation

(Figure 3.15).

In presence of G. duodenalis we observed a significant decrease in claudin-4 expression further strengthened in the presence of E. coli after 1, 2, 3 and 6 hours of incubation (Figure 3.16).

132

Figure 3.17: Giardia duodenalis induces the degradation of the tight junctional protein occludin at 1, 2, 3 and 6 hours post-infection Immunoblotting analysis of the tight junctional protein expression on standardized protein concentration (3mg/mL). Ponceau red staining was used as loading control.

133

134

Figure 3.18: Giardia duodenalis induces the degradation of the tight junctional protein claudin-4 at 1, 2, 3 and 6 hours post-infection Immunoblotting analysis of the tight junctional protein expression on standardized protein concentration (3mg/mL). Ponceau red staining was used as loading control.

135

136

4. Discussion

Giardia duodenalis has been previously involved in the appearance of post-infectious irritable bowel syndrome and post-infectious chronic fatigue syndrome after the 2004 outbreak of giardiasis in Bergen, Norway. Following this outbreak, a better understanding of the mechanisms by which this common enteric pathogen could lead to post-infectious irritable bowel syndrome became critical. Unfortunately, animal models representative of the human pathology are currently lacking. In this context, the aims of this thesis were first to develop a suitable animal model in which we could establish a cause-to-effect relationship between Giardia and PI-IBS, and second to characterize the mechanisms contributing to the appearance of PI-IBS.

The major pathophysiological features of irritable bowel syndrome consist of: (i) visceral hypersensitivity, (ii) low grade inflammation (with increase in intraepithelial lymphocytes, enterochromaffin cells, mast cell infiltration and degranulation), (iii) activation of enteric cholinergic motor neurons, and (iv) intestinal barrier dysfunction. In this model, we presented the major pathophysiological features described in IBS each of which will be discussed below. In the present model of post-giardiasis IBS, I described: visceral hypersensitivity as shown with jejunal and rectal balloon distension; low grade inflammation, characterized here by the increase in intraepithelial lymphocytes and mast cells in the jejunum of our infected animals; intestinal barrier dysfunction with translocation of commensal bacteria, and finally nociceptive activation, with activation of c-fos in the thoraco-lumbar part of the spinal cord of our infected animals.

With these results we present for the first time a suitable immunocompetent animal model mimicking post-infectious irritable bowel syndrome using the human enteropathogen Giardia duodenalis assemblages A and B. We established a cause-to-effect relationship between Giardia

137

duodenalis infection and post-infectious irritable bowel syndrome as our animal model presents all the major pathophysiological features of IBS.

Visceral hypersensitivity has long been recognized as a biological marker of IBS with reports of up to 80-90% of incidence [177,178,181,436] and has been reported in several gastrointestinal sites: rectum [177,437,438], colon [174,439–441], jejunum [442,443], esophagus [444] suggesting that visceral pain in IBS is not necessarily specific to one GI site but can be pan- intestinal, especially when patients present concomitant symptoms of IBS and FD [181,445,446].

In this animal model I was able to show the appearance of long term effects of Giardia infection: post-infectious visceral hypersensitivity in two sites of the GI tract, jejunum and rectum, hence not only at the infection site of the parasite. Rats infected with either Giardia duodenalis assemblages (A or B) presented a significantly greater decrease in blood pressure during jejunal and rectal balloon distensions when compared to control animals indicating pain in these animals. The decrease in blood pressure observed in rats infected with Giardia assemblage A reached significance for the distension volumes of 0.3 and 0.4 mL in the jejunum and 0.6; 0.8 and 1 mL in the rectum. These results seem characteristic of hyperalgesia (increased sensitivity to a painful stimulus). However in the rats infected with Giardia assemblage B, the difference observed in the decrease of blood pressure reached significance at the lowest distension volumes

(starting at 0.1 mL in the jejunum and 0.2 mL in the rectum). This time the sensitivity observed with Giardia assemblage B seems more characteristic of an allodynia (increased sensitivity to non-painful stimuli). We also observed the maintenance of hypersensitivity as the decrease in blood pressure observed is those rats was still significantly different compared to controls for the distension volumes of 0.3 and 0.4 mL in the jejunum, and 0.4 to 0.8 mL in the rectum. These observations in the Giardia assemblage B-infected animals suggest that this assemblage could

138

induce a more severe hypersensitivity as we have both allodynia and hyperalgesia, while only hyperalgesia was observed with the assemblage A. Between 56% and 63% of the animals infected with Giardia assemblage B and A (respectively) presented hyperalgesia at distance from the infection (50 days PI). Animals from both sexes presented hyperalgesia in this model.

Indeed, between 50 and 77% of the males infected with Giardia assemblage B or A

(respectively) responded to the infection by developing post-infectious visceral hypersensitivity while 75 to 100% of the females infected with Giardia assemblages B or A (respectively) presented visceral hypersensitivity at distance from the infection. More studies are needed to assess wether these results suggest that females were more prone to develop post-infectious visceral hypersensitivity following a transient infection with Giardia duodenalis [381].

Moreover in this model we observed hypersensitivity to balloons distension in the jejunum (at the infection site) and in the rectum (away from the infection site) suggesting that this model is characteristic of IBS for the visceral hypersensitivity observations. Visceral hypersensitivity has been evaluated via the balloon distension model as most experts in the field rely on the barostat technique for an accurate and reproducible definition of visceral hypersensitivity [96]. We relied on the blood pressure measure describing that a cardiovascular depressor response is predictive of visceral nociception [418,419,428–430] as it allows to assess both jejunal and rectal hypersensitivity and was previously described in our laboratory [284,419]. Different techniques exist for the assessment of visceral pain such as measure of the electromyographic (EMG) response to visceral distension [213,447]. While the EMG model could only allow to perform colorectal distension due to the fact that the animal is conscious during the experiment [447] our model allow to perform distension at different sites of the GI tract.

139

Motility disturbances have been previously reported in IBS as well as in models of PI-IBS

[171,285,292,422,441]. Although whole GI transit time measurements were not able to detect any significant modification of the gastrointestinal transit time induced by Giardia infection, the data can not exclude that motility could be modified in either the small or the large intestine.

Indeed, no significant changes were observed in the whole GI transit time in our infected animals compared to control. However, it is possible that our rats presented an accelerated transit in the small intestine that could be slowed down in the large intestine or vice versa. We used a technique that was previously employed in our lab monitoring the time between gavage of a dye to the appearance of colored feces. Another technique to monitor colonic motility, consists of introducing a bead in the colon of the animal via the anal route and assess the time elapsed before expulsion of the bead [448]. Our animal model consists of neonatal rats infected with

Giardia; we considered this technique as too invasive for our rats as the first time point, D7 PI, when the rats are only 12 days old. In addition, measure of motility using beads requires fasting of the animals for at least 12 hours before the experiment. Fasting of weaning rats would require maternal deprivation, which would add a stress parameter to our infectious model. Indeed, maternal deprivation has also been described to cause stress-induced intestinal hypersensitivity model [449–455]. In addition, maternal deprivation is usually done for a maximum of 3 hours at a time, supporting the fact that the beads model was not ideal in our study. Furthermore, it has been previously shown that the motor activity of the rat GI tract becomes mature around 3-4 weeks, after the introduction of solid food in the diet [456], suggesting that the motility and contractility changes induced by Giardia infection observed in humans [457] and other animal models [458,459] could likely not be observed in our neonatal model.

140

Previous studies in both animals and humans have shown the presence of villus atrophy and crypt hyperplasia in response to giardiasis [431–433,460]. Other studies have also estabished that giardiasis could occur in the presence or in the absence of any changes in villu-crypt ratios. In the present study, we observed some modifications in the structure of the intestinal mucosa. In the duodenum of the Giardia-infected animals we observed a crypt hyperplasia during both the acute and clearance stages of the disease, for the assemblage B, while no significant alteration of the villus length was observed. When looking at the post-infectious stage of the disease (D50 PI), we observed significant villus atrophy in the duodenum of Giardia-infected animals (with either the assemblage A or B).

In the jejunum, crypt hyperplasia and villus atrophy were only observed after infection with the assemblage B at D21 PI (clearance), no changes were observed at D7 and D50 PI in the jejunum with either Giardia assemblage. The fact that the different assemblages of Giardia lead to different morphological modifications is consistent with what was previously observed in the literature. Indeed, Cevallos et al. [461] in a similar neonatal rat model, observed strain dependent modification of the mucosal morphology. The fact that modifications of the jejunal mucosal structure were observed only with Giardia assemblage B could also be consistent with the fact that this assemblage seems to induce a more severe visceral hypersensitivity than the assemblage

A as it induces both allodynia and hyperalgesia in the jejunum. However, this is the first report of villus atrophy associated with post-infectious visceral hypersensitivity. Although intestinal mucosal modifications have previously been associated with IBS such as mast cell and intraepithelial lymphocytes increases, no studies have looked at the villus/crypt structure

[189,211,220,284,462–466]. Moreover, physical damage to the architecture of the intestinal villi can produce maldigestion and malabsorption alike, depending on the severity of the injury. A

141

number of intestinal disorders, including giardiasis, presenting such mucosal alterations have been correlated with digestion/absorption impairments [308,431]. In addition, crypt hyperplasia and villus atrophy are the one of the major histological features of celiac disease (chronic enteropathy caused by intolerance to gluten). In celiac disease, absorptive functions may be impaired and lead to the development of other complications [467–469]. Observations from this study could also suggest a relationship between food allergy / intolerance and IBS as shown in celiac disease. As several studies have shown a correlation between malabsorption and IBS symptoms [243–245,470], we could therefore imagine a relationship between malabsorption due to villus atrophy shown in this model and IBS. Although there is a controversy present in the literature concerning an eventual relationship between visceral hypersensitivity and malabsorption, impairment in digestion and absorption due to villus atrophy still could be a triggering factor of IBS associated visceral hypersensitivity [244,246]. More research is needed to evaluate the role played by the altered villus-crypt structure in the development of IBS.

We then looked at other alterations of the intestinal mucosa. We saw no significant modification during the acute stage of the infection for both intraepithelial lymphocytes and mast cell counts.

However, at day 50 post-infection (after complete clearance of the parasite and recovery from the disease), we observed a significant increase in both IELs and mast cell counts in the jejunum of the animals infected with either Giardia assemblages (A or B). These results are consistent with previous findings observed in IBS patients [189,211,220,284,462–466] and in giardiasis

[303,304,347,433]. Moreover mucosal mast cell and T-cells have previously been linked to visceral hypersensitivity in IBS [188,221,471,472] suggesting that our observations in the mucosa of the infected animals could be linked to the appearance of post-infectious jejunal hypersensitivity. In addition mucosal mediators from IBS patients such as mast cell tryptase, and

142

trypsin have been involved in the excitement of enteric cholinergic motor neurons [473]. Mast cell counts have also been associated to increased levels of Substance P and vasoactive intestinal peptide, hormones involved in intestinal inflammation, in IBS-D patients [474]. Substance P also recently has been shown to be expressed in the enteric nervous system of an IBS rat model suggesting that Substance P may be involved in the pathogenesis of IBS and may play a role in the regulation of GI function [186]. Taken together those data are consistent with a correlation between mast cell and CNS activation.

In order to characterize the nociceptive signaling pathway linked to the observed visceral hypersensitivity we looked at the activation of c-fos, a well known marker of nociceptive signaling that has previously been involved in IBS [186,203,204,452]. The protein c-fos is a nuclear transcription factor of genes involved in adaptive response to different stimuli [475].

Indeed, increased mRNA expression of c-fos in neurons is the result of neurotransmitters inducing either activation or depolarization of synaptic neurons [476] and the expression of c-fos is regularly used to assess the activated areas of the CNS during various stimuli (reviewed by

Herrera and Robertson, [477]). In our model, we showed an activation of c-fos in the thoracolumbar part of the spinal cord of our infected animal starting at 7 days post-infection and still present until 50 days post-infection. These results indicate nociceptive activation in the CNS of our animal model during the infection, clearance and post-infectious stages of giardiasis. Here again, mast cells seem to play an important role in the activation of c-fos. Indeed Levy et al.

[478] recently showed that the intraperitoneal administration of a mast cell secretagogue was leading to the activation of c-fos in the dorsal horn neurons at two sites of the spinal cord; one responsible for the processing of cranial pain and the other one for the processing of pelvic visceral pain. Levy et al. [478] also reported that this nociceptive activation was associated with

143

the development of tactile pain. Although visceral pain was not evaluated in this model it seems highly probable that mast cell degranulation would also be associated with visceral pain. In our model we showed mast cell infiltration in the jejunal mucosa and c-fos activation in the dorsal horn neurons of the infected rats. Thus, it is reasonable to think that there may be a link between mast cells and nociceptive activation although more research is needed to determine the various roles that mast cell could play in this model.

In the second part of my thesis we wanted to understand the mechanisms that could contribute to the appearance of PI-IBS following acute giardiasis. Over the past decades several studies have shown the importance and the role played by the host microbiota in health and disease [5].

Indeed the microbiota play numerous essential roles for the host; they facilitate the metabolism of otherwise indigestible polysaccharides and produce essential vitamins; they are required for the development and differentiation of the host’s intestinal epithelium and immune system

[14,72,233,479]. Microbiota also confer protection against invasion by opportunistic pathogens.

Commensal bacteria can defend their mucosal home by directly combating invading pathogens or by mobilizing host antimicrobial immune defenses. Commensal microorganisms also have a key role in maintaining tissue homeostasis [5–8,11,479–482]. Recent studies also revealed that the human microbiota influence the development and homeostasis of other tissues than the GI tract, including the bone, and the brain [9,10]. Moreover, microbiota have also been implicated in IBS (reviewed by Collins et al. [225,483]), as several studies have reported dysbiosis

[229,484–487] and small intestinal bacterial overgrowth in IBS patients [224,488]. Jalanka-

Tuovinen et al. [489] recently showed that the fecal microbiota of PI-IBS patients differs from that of healthy controls. In addition, our group [306] recently demonstrated that Giardia infection induced changes on the host microbiota at a structural and compositional levels. Using

144

the Calgary Biofilm Device, the data indicate that Giardia was able to alter the composition of the microbiota from a healthy donor, inducing an increase in the Clostridiales family. They also showed that Giardia induced a thinning of the microbial biofilm and was able to favor the growth of planktonic bacteria. Numerous studies have observed intestinal barrier dysfunction during IBS [490,491]. In addition, intestinal barrier dysfunction have also been observed in

Giardia-infection [311,318,492]. In this context, we hypothesized that Giardia could also influence the comportment of the commensal microbiota and induce the translocation of commensal bacteria through the intestinal epithelium. Indeed, we showed in our animal model that Giardia assemblage A was able to facilitate the translocation of commensal bacteria through the intestinal epithelium, suggesting the presence of an intestinal barrier dysfunction. In vivo,

Giardia infection caused the translocation of aerobic and anaerobic bacteria into the spleen and liver, at day 7 post-infection. To further invesitgate the bacterial translocation results obtained in vivo, we used a technique of fluorescence in situ hybridization (FISH) with the EUB-338 probe targeting the domain Bacteria by recognizing the 16s r RNA. FISH revealed the presence of translocating bacteria in the colonic mucosa at day 7 post-infection. In our controls, no bacteria were observed in close proximity to the colonic mucosa, however in infected animals, bacteria were observed in direct contact with the mucosa. Moreover we were able to observe bacterial infiltration in the colonic mucosa of the rats infected with Giardia also at day 21 and 50 post- infection in correlation with the results recently published by Chen et al. [492]. Indeed, Chen et al. [492] showed that Giardia-infected mice presented persistent bacterial penetration accompanied by tight junctional damage and mucosal inflammation after parasite clearance (day

35 post-infection). When we observed the colonic mucosa of our animals at day 7 PI, the structure crypt/villi was not present, but we could clearly distinguish in our control animals the

145

muscular mucosa underlying the mucosa as well as a space that seems to correspond to the mucus barrier and the microbiota. In our infected animals, the muscular mucosa and mucosa were still distinguishable as well as the microbiota however the "space" separating mucosa and microbiota appears thinner, and microbiota and mucosa were in direct contact, which could indicate a modification of the mucosal barrier induced by the parasite (Appendix II). We were also able to observe the presence of cells in the lumen of our infected rats that could be immune cells but as to be further analysed to be clearly confirm. We could speculate that Giardia induces a modification of the microbiota and may be able to favor the development of mucolytic bacteria as it is the case in IBD [493,494], which could explain why the mucus is thinner in infected animals. We could also imagine that Giardia by modifying the microbiota could lead to an excessive immune response that could also play a role in the modification of the mucus barrier that seems to be present in our model. Finally studies are neede to assess whether Giardia is able to disrupt components of the host mucus, as found for other parasites such as Entamoeaba hystolitica [495,496]. Moreover it has been shown in the DNBS and DSS models of colitis that there is an exudation of neutrophils in the intestinal lumen that could be due to an inflammatory response of the host to modification of the microbiota and particularly to the promotion of pathogenic microbiota [497]. At day 21 the mucosal structure resembles that of the adult. While no bacteria were observed in close proximity of the mucosa of our controls, we were able to observe bacteria in the crypt in infected animals. Similar results were observed at day 50 PI. In control animals, bacteria were separated from the mucosa by a space corresponding to the mucus layer. In infected animals, bacteria were in close contact with the mucosa and the space corresponding to the mucus layer completely disappeared. In addition, bacteria were observed in

146

the crypt and infiltrated in the mucosa that would sustain the persistence of bacterial translocation at the post-infectious stage.

It is interesting to note that in the FISH staining for bacterial infiltration and endocytosis in the colon, we observed at day 7 and day 21 post-infection a majority of bacteria presenting a coccus shape, while at day 50 the species observed were presenting a bacillus shape. However, it is noteworthy that bacteria were more difficult to observe at day 21 PI corresponding to the weaning period (see appendix III). As stated earlier, the intestine of the rats is not fully developed until 3 to 4 weeks and rats are still unweaned [456]. At day 7 PI, the ingested food consist essentially of the mother's milk, while at day 21 post-infection the ingested food consist of a mix of mother's milk with the slow introduction of solid food. Indeed, after birth the GI tract undergoes vast structural and functional adaptations to be able to digest mother's milk and later solid food. Morphological observations indicated that the intestinal crypts as well as the villi were small before weaning and lengthened during the weaning period to reach mature full height after weaning (by the age of 3-4 weeks old) [498–500]. Cummins et al. [498] also showed in pre- weaned rats the presence of only Gram positive bacteria morphologically resembling lactobacilli and cocci, while the total number of gut bacteria was significantly reduced during the weaning.

Following the weaning, Gram negative bacteria were observed for the first time and approximately 16 different species of bacteria could be distinguished indicating a maturation and diversification of the microbiota after weaning [501,498].

As translocation of commensal bacteria induced by an enteropathogen could be a contributing factor to the appearance of PI-IBS, we wanted to understand how Giardia-induced translocation of commensal bacteria observed in vivo may occur. To characterize the mechanisms involved, we used Caco-2 cells monolayers grown to confluence on transwells with a 3.0 µm pore size. On

147

the apical side of the system, monolayers were exposed to Giardia trophozoites from the assemblage A, and a non-invasive E. coli HB101, of commensal origin, was added. After short incubation times (1, 2, 3 and 6 hours post-infection) serial dilutions of the media recovered in the basolateral compartment were spread on LB agar plates. After incubating those plates overnight at 37ºC in aerobic conditions, we were able to observe that Giardia assemblage A was able to induce the translocation of the non-invasive E. coli HB101 through confluent epithelial monolayer. The bacterial translocation observed reached statistical significance as early as 2 hours post-exposure, and persiste at least up to 6 hours post-infection. Those in vitro results corroborated our in vivo findings. In addition, they suggested an early phenomenon in the disease as short incubation times were sufficient for Giardia to induce the translocation of commensal bacteria.

The intestinal epithelial barrier can be crossed via two routes, either the transcellular or the paracellular route (see section 1.1.5). Kalischuk et al. [434] previously demonstrated that

Campylobacter jejuni, a common enteric pathogen, was able to induce the translocation of commensal bacteria across the intestinal epithelium using transcytosis. To test this hypothesis with Giardia we used confluent Caco-2 monolayers grown on 6 well plates. Cells were infected with Giardia assemblage A trophozoites and non-invasive E. coli HB101. After short incubation times as previously described, surface bacteria were killed using a non absorbable antibiotic, gentamicin. We showed that Giardia does not induce internalization of a non-invasive E. coli in enterocytes, indicating that Giardia uses mechanisms unique from Campylobacter to facilitate translocation of bacteria.

Over the past decades, evidence of increased epithelial permeability in IBS has been reported in several studies [218,490,502–509]. Moreover Giardia-infection has also been implicated in

148

epithelial barrier dysfunction [311,492,510–512]. However, when we looked at the intestinal permeability to FITC-dextran we didn't observed any difference in the presence of Giardia. The absence of significance in this experience is most probably due to variability between experiments. Although all experiments were done when Caco-2 monolayers reached confluence

(TER>400Ω), we observed an important variability in the fluorescence at 490ex/520em in the basolateral compartment of the transwell in each groups between experiments. Our studies were unable to detect any chnage in FITC-dextran fluxes between groups. However, as previous studies have shown an increased permeability in presence of Giardia, we could speculate a relationship between paracellular permeability and Giardia-induced translocation of commensal bacteria.

The epithelial barrier function allows the maintenance of intestinal homeostasis and relies essentially on the integrity of the apical junctional complexes (Figure 1). Tight junctions plays a critical role in maintaining a proper homeostasis in the intestine, they allow the passage of nutrients and solutes while protecting against invasion of pathogenic antigens. Recently, several studies have shown that the tight junctional proteins integrity was impaired during IBS

[464,491,509,513–518]. In addition, Giardia duodenalis has previously been reported to degrade proteins of the AJC such as ZO-1, occludin, F-actin, α-actinin, E-cadherin and claudin-1

[310,311,318–320,514,519,520]. We looked at the tight junctional proteins integrity in vitro in the presence of Giardia duodenalis and non-invasive E. coli HB101 for the short incubation times previously tested. We showed that Giardia duodenalis assemblage A was able to induce the degradation of two transmembrane tight junctional proteins: occludin and claudin-4 regardless of the presence of E. coli, indicating that the phenomenon observed is due to Giardia alone and does not require its interaction with commensal bacteria.

149

Several mechanisms have been involved in Giardia-induced modification of the intestinal barrier function such as: trophozoite excreting/secreting products rearrange the cytoskeletal proteins

[320]; caspase-3-dependent disruption of ZO-1 and enterocyte apoptosis [310,519]; myosin light chain kinase-dependent reorganization of ZO-1 and F-actin [318]; lipid-raft-dependent adhesion of the trophozoites involved in TJ proteins rearrangement and delocalization [520]. Although none of the above mentioned mechanisms have been tested in our model it seems to be the next step to understand how Giardia can induce the disruption of the tight junctional proteins.

However the majority of the mechanisms involved in Giardia-induced TJ proteins degradation are assemblage-dependent and sometimes strain-dependent. Indeed Chin et al. [310] showed in their study that Giardia trophozoites NF but not WB were able to induce enterocytes apoptosis in a caspase-3-dependent manner, suggesting that different mechanisms may be involved for different strains.

Modification of epithelial barrier function and tight junctional proteins degradation have also been reported in IBS and again several mechanisms have been involved such as: microRNA

[521,522]; colonic soluble mediators [490]; luminal cysteine proteases, faecal serine proteases

[516,523]; luminal proteases via PAR-2 activation [524,525] proteasome-mediated degradation

[513]; inflammatory markers [508] and mast cell tryptase [462,517,526]. It would be interesting to also evaluate these different mechanisms as a Giardia-dependent mechanism may initiate the barrier dysfunction and TJ degradation, but other mechanisms could be involved in the persistence of dysfunction observed in the post-infectious stage.

150

4.1. Summary

In summary, Giardia duodenalis infection of immunocompetent suckling rats elicits the appearance of post-infectious visceral hypersensitivity in both the jejunum and rectum, in correlation with nociceptive activation (characterized by c-fos expression in the spinal cord of the infected animals) during the acute, clearance and post-infectious stage of the disease.

Giardia-infection induces mucosal modifications (characterized by an increase in intraepithelial lymphocytes and mast cell numbers in the jejunum of the infected rats) during the post-infectious stage of the disease. With this animal model of human enteropathy induced by Giardia we were able to show for the first time a cause-to-effect relationship between Giardia duodenalis and the development of post-infectious irritable syndrome-like symptoms. In addition, we were able to unravel a contributing mechanism to the appearance of post-giardiasis IBS. Giardia was able to induce the translocation of commensal bacteria starting during the acute stage of the disease, and that this phenomenon was persisting up to the post-infectious stage. We also showed that the in vitro Giardia-induced translocation of commensal bacteria does not occur via the transcellular route as Giardia was not able to induce the internalization of a non-invasive E. coli in Caco-2 monolayers. However it seems to occur via the paracellular route in conjunction with the degradation of the tight junctional proteins occludin and claudin-4.

4.2. Future Directions

The results from the present study answer several questions regarding the implication of Giardia duodenalis in the appearance of post-infectious irritable bowel syndrome, and the factors contributing to the development of this long-term consequence of the infection. However these

151

results also offer many more questions. Many paths could be followed in order to further investigate post-giardiasis IBS. Aims of future research could be as follow:

a. To further characterize the PI-IBS immunocompetent suckling rat model presented here. Indeed, although the major pathophysiological features of IBS have been described in this model, further studies could concentrate on the motility aspect that was not completely characterized in the present study. Other contributing factors regularly seen in IBS could also be explored such as the development of co-morbid chronic syndromes (Functional dyspepsia, fibromyalgia...).

b. To characterize cellular and molecular mechanisms responsible for intestinal hypersensitivity and pain in post-infectious IBS (TLRs, NLRs, Chemokines,...) and to assess the neuronal pathways involved inte development of pain (assess Substance P and CGRP expression in the intestinal mucosa and spinal cord)

c. To determine the digestion/absorption rates of nutrients and electrolytes in our animal model. In correlation with villus atrophy and crypt hyperplasia observed herein.

d. To assess the tight junctional alterations in our animal model. The results obtained in vitro on the permeability and the TJ proteins degradation should be reproduced in vivo to confirm the link established in this study between TJ degradation and bacterial translocation

e. To determine the mechanisms by which Giardia induces the degradation of the TJ proteins presented here as well as other TJ proteins. And identify the mechanisms involved in the maintenance of this barrier damage later in the disease (D50 PI).

 Determine if the TJ degradation observed here is strain-dependent or reproducible

with other assemblages and strains of Giardia

152

 Giardia-induced TJ degradation could be due to luminal cysteine proteases as

Giardia duodenalis possess and express cysteine proteases such as cathepsin B

and L. Indeed, cathepsin B has been recently involved in the degradation of

intestinal epithelial interleukin-8 [527]. We could then imagine a role of these

proteases in the degradation of TJ proteins.

 Altered host-microbe interaction could also play a role in Giardia-induced TJ

degradation. Intestinal pathogens have evolved mechanisms for the disruption of

AJC components such as E-cadherin [528,529] and could thus be involved in the

TJ degradation observed in presence of Giardia.

 Campylobacter jejuni has recently been shown to induce the expression of

virulence factor in non-invasive, non-pathogenic commensal E. coli [440], thus it

would be interesting to study the effect of Giardia on commensal bacteria as

induction of pathogenicity could also be a mechanism leading to TJ disruption

and increased permeability, as well as immune activation.

 Mast cell tryptase has recently been involved in the degradation of JAM-A [517],

and mast cell counts have been correlated with increased intestinal permeability

[526], suggesting another possible triggering factor of intestinal barrier

dysfunction and TJ degradation observed in our post-giardiasis IBS model.

153

5. Conclusions

The pathogenesis of giardiasis and irritable bowel syndrome are still incompletely understood and the topic of current and intense research. Infections with Giardia duodenalis may remain asymptomatic, or cause acute or chronic diarrheal disease. Long-term complications of giardiasis may present 2 to 3 years following the initial onset of infection. In some cases, they may last for a few weeks, and may be eliminated with anti-parasitic treatment. In others cases, long term consequences may be present for several years in the absence of any parasite, as it is the case for

IBS.

The results reported here showed a cause-to-effect relationship between Giardia duodenalis infection and the development of the major feature of IBS. Indeed, in the new animal model of post-giardiasis IBS presented here, we reported up to 63% of animals that go on to develop post- infectious intestinal hypersensitivity. 100% of the females tested developed visceral hypersensitivity in the rectum, a site distant from the small intestinal infection. More research will establish whether this model can investigate the tendency for females to be more prone to develop post-infectious consequences, as reported in the literature [109,111,381]. Results from these studies showed modifications of the mucosal surface in infected animals, with villus atrophy and crypt hyperplasia observed at day 50 PI. Although not evaluated in this study, modification in the mucosal surface could play an important role in malabsorption and maldigestion, and in the pathogenesis of bowel disorders [243–246,470]. We also reported mucosal immune activation as shown by the increase in jejunal IELs and mast cells at day 50 PI.

Increase in IELs and mast cell infiltration has been previously reported in IBS [189,211,303,304] and associated with the severity of IBS symptoms. In addition, activation of the nociceptive pathway was observed in our Giardia-infected animals, results consistent with the literature on

154

PI-IBS [200,202,203]. Taken together these results indicate a causal relationship between transient Giardia infections and the development of long lasting pathophysiological features consistent with post-infectious IBS.

The mechanisms responsible for post-infectious manifestations in giardiasis remain incompletely understood. Both parasitic and host factors have been implicated, indicative of a multifactorial pathogenic process. Results from this study showed the probable triggering role played by the translocation of commensal microbiota in the development of PI-IBS. The results presented here showed the induction of commensal bacterial translocation by Giardia both in vivo and in vitro.

Consistent with results recently published by Chen et al. [492], this translocation seems to be one of the mechanisms contributing to the appearance of post-infectious IBS. Bacteria were able to translocate through the intestinal epithelium via the paracellular route and more precisely, at least in part, via degradation of the tight junctional proteins occludin and claudin-4. These results suggest that the host's immune system reactivity toward its microbiota due to impaired epithelial barrier function could be one of the mechanisms leading to post-infectious intestinal disorders such as IBS. Further studies are required to determine the mechanisms by which Giardia induces the degradation of the tight junctions. Although some studies have recently implicated mast cell tryptase in the degradation of TJ [517], other mechanisms could be involved in the TJ proteins alteration [318,321,528,529].

As giardiasis can remain asymptomatic, the complex processes leading to post-infectious manifestations represent a challenging topic of research. Given the high prevalence of giardiasis in young children in developing countries, its rising prevalence in developed countries, and its significant extra-intestinal and long term consequences [531], giardiasis is of considerable public health importance. Diagnostic tests for giardiasis should routinely be done as this enteric

155

pathogen may be associated with the development of post-infectious FGID as showed by this study. Improved diagnostic methods, particularly in asymptomatic patients, as well as more- effective treatment and control strategies are sorely needed to help reduce the detrimental impact of infection on human societies.

156

6. References

1 Marques R, Boneca IG. Expression and functional importance of innate immune receptors by intestinal epithelial cells. Cell Mol Life Sci CMLS 2011;68:3661–73. doi:10.1007/s00018-011- 0829-9

2 Goto Y, Kiyono H. Epithelial barrier: an interface for the cross-communication between gut flora and immune system. Immunol Rev 2012;245:147–63. doi:10.1111/j.1600- 065X.2011.01078.x

3 Santaolalla R, Abreu MT. Innate immunity in the small intestine. Curr Opin Gastroenterol 2012;28:124–9. doi:10.1097/MOG.0b013e3283506559

4 Abreu MT, Fukata M, Arditi M. TLR signaling in the gut in health and disease. J Immunol Baltim Md 1950 2005;174:4453–60.

5 Sekirov I, Russell SL, Antunes LCM, et al. Gut microbiota in health and disease. Physiol Rev 2010;90:859–904. doi:10.1152/physrev.00045.2009

6 Ivanov II, Honda K. Intestinal commensal microbes as immune modulators. Cell Host Microbe 2012;12:496–508. doi:10.1016/j.chom.2012.09.009

7 Chinen T, Rudensky AY. The effects of commensal microbiota on immune cell subsets and inflammatory responses. Immunol Rev 2012;245:45–55. doi:10.1111/j.1600- 065X.2011.01083.x

8 Sommer F, Bäckhed F. The gut microbiota--masters of host development and physiology. Nat Rev Microbiol 2013;11:227–38. doi:10.1038/nrmicro2974

9 Diaz Heijtz R, Wang S, Anuar F, et al. Normal gut microbiota modulates brain development and behavior. Proc Natl Acad Sci U S A 2011;108:3047–52. doi:10.1073/pnas.1010529108

10 Sjögren K, Engdahl C, Henning P, et al. The gut microbiota regulates bone mass in mice. J Bone Miner Res Off J Am Soc Bone Miner Res 2012;27:1357–67. doi:10.1002/jbmr.1588

157

11 Evans JM, Morris LS, Marchesi JR. The gut microbiome: the role of a virtual organ in the endocrinology of the host. J Endocrinol 2013;218:R37–47. doi:10.1530/JOE-13-0131

12 Mändar R, Mikelsaar M. Transmission of mother’s microflora to the newborn at birth. Biol Neonate 1996;69:30–5.

13 Huurre A, Kalliomäki M, Rautava S, et al. Mode of delivery - effects on gut microbiota and humoral immunity. Neonatology 2008;93:236–40. doi:10.1159/111102

14 Guarino A, Wudy A, Basile F, et al. Composition and roles of intestinal microbiota in children. J Matern-Fetal Neonatal Med Off J Eur Assoc Perinat Med Fed Asia Ocean Perinat Soc Int Soc Perinat Obstet 2012;25 Suppl 1:63–6. doi:10.3109/14767058.2012.663231

15 Eckburg PB, Bik EM, Bernstein CN, et al. Diversity of the human intestinal microbial flora. Science 2005;308:1635–8. doi:10.1126/science.1110591

16 Swidsinski A, Loening-Baucke V, Lochs H, et al. Spatial organization of bacterial flora in normal and inflamed intestine: a fluorescence in situ hybridization study in mice. World J Gastroenterol WJG 2005;11:1131–40.

17 Gill SR, Pop M, Deboy RT, et al. Metagenomic analysis of the human distal gut microbiome. Science 2006;312:1355–9. doi:10.1126/science.1124234

18 Baquero F, Nombela C. The microbiome as a human organ. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis 2012;18 Suppl 4:2–4. doi:10.1111/j.1469- 0691.2012.03916.x

19 Castro GA. Digestion and absorption. In: Gastrointestinal physiology 3rd edition. 1985. chapter 11: 105–128.

20 Weisbrodt NW. Gastric motility. In: Gastrointestinal physiology 3rd edition. 1985. chapter 4: 31–38.

21 Weisbrodt NW. Motility of the small intestine. In: Gastrointestinal physiology 3rd edition. 1985. chapter 5: 39–45.

158

22 Weisbrodt NW. Motility of the large intestine. In: Gastrointestinal physiology 3rd edition. 1985. chapter 6: 46–52.

23 Jacobson ED. Salivary secretion. In: Gastrointestinal physiology 3rd edition. 1985. chapter 7: 53–62.

24 Johnson LR. Gastric secretion. In: Gastrointestinal physiology 3rd edition. 1985. chapter 8: 63–82.

25 Weisbrodt NW. Bile production, secretion and storage. In: Gastrointestinal physiology 3rd edition. 1985. chapter 10: 94–104.

26 Bizzozero G. Osservazioni sulla struttura degli epiteli pavimentosi stratificati. Rend Ist Lornbardo So e Lettere 1870;series II:675.

27 FARQUHAR MG, PALADE GE. Junctional complexes in various epithelia. J Cell Biol 1963;17:375–412.

28 Matter K, Balda MS. Signalling to and from tight junctions. Nat Rev Mol Cell Biol 2003;4:225–36. doi:10.1038/nrm1055

29 Stevenson BR, Siliciano JD, Mooseker MS, et al. Identification of ZO-1: a high molecular weight polypeptide associated with the tight junction (zonula occludens) in a variety of epithelia. J Cell Biol 1986;103:755–66.

30 Haskins J, Gu L, Wittchen ES, et al. ZO-3, a novel member of the MAGUK protein family found at the tight junction, interacts with ZO-1 and occludin. J Cell Biol 1998;141:199–208.

31 Jesaitis LA, Goodenough DA. Molecular characterization and tissue distribution of ZO-2, a tight junction protein homologous to ZO-1 and the Drosophila discs-large tumor suppressor protein. J Cell Biol 1994;124:949–61.

159

32 Furuse M, Itoh M, Hirase T, et al. Direct association of occludin with ZO-1 and its possible involvement in the localization of occludin at tight junctions. J Cell Biol 1994;127:1617–26.

33 Fanning AS, Jameson BJ, Jesaitis LA, et al. The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J Biol Chem 1998;273:29745–53.

34 Wittchen ES, Haskins J, Stevenson BR. Protein interactions at the tight junction. Actin has multiple binding partners, and ZO-1 forms independent complexes with ZO-2 and ZO-3. J Biol Chem 1999;274:35179–85.

35 Furuse M, Hirase T, Itoh M, et al. Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol 1993;123:1777–88.

36 Sakakibara A, Furuse M, Saitou M, et al. Possible involvement of phosphorylation of occludin in tight junction formation. J Cell Biol 1997;137:1393–401.

37 Nusrat A, von Eichel-Streiber C, Turner JR, et al. Clostridium difficile toxins disrupt epithelial barrier function by altering membrane microdomain localization of tight junction proteins. Infect Immun 2001;69:1329–36. doi:10.1128/IAI.69.3.1329-1336.2001

38 Wong V, Gumbiner BM. A synthetic peptide corresponding to the extracellular domain of occludin perturbs the tight junction permeability barrier. J Cell Biol 1997;136:399–409.

39 Saitou M, Fujimoto K, Doi Y, et al. Occludin-deficient embryonic stem cells can differentiate into polarized epithelial cells bearing tight junctions. J Cell Biol 1998;141:397– 408.

40 Saitou M, Furuse M, Sasaki H, et al. Complex phenotype of mice lacking occludin, a component of tight junction strands. Mol Biol Cell 2000;11:4131–42.

41 Morita K, Furuse M, Fujimoto K, et al. Claudin multigene family encoding four- transmembrane domain protein components of tight junction strands. Proc Natl Acad Sci U S A 1999;96:511–6.

160

42 Furuse M, Fujita K, Hiiragi T, et al. Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin. J Cell Biol 1998;141:1539–50.

43 Itoh M, Furuse M, Morita K, et al. Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of claudins. J Cell Biol 1999;147:1351–63.

44 Umeda K, Ikenouchi J, Katahira-Tayama S, et al. ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell 2006;126:741–54. doi:10.1016/j.cell.2006.06.043

45 Furuse M, Hata M, Furuse K, et al. Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J Cell Biol 2002;156:1099–111. doi:10.1083/jcb.200110122

46 Morita K, Sasaki H, Furuse M, et al. Endothelial claudin: claudin-5/TMVCF constitutes tight junction strands in endothelial cells. J Cell Biol 1999;147:185–94.

47 Nitta T, Hata M, Gotoh S, et al. Size-selective loosening of the blood-brain barrier in claudin-5-deficient mice. J Cell Biol 2003;161:653–60. doi:10.1083/jcb.200302070

48 Bazzoni G, Martinez-Estrada OM, Orsenigo F, et al. Interaction of junctional adhesion molecule with the tight junction components ZO-1, cingulin, and occludin. J Biol Chem 2000;275:20520–6. doi:10.1074/jbc.M905251199

49 Ebnet K, Schulz CU, Meyer Zu Brickwedde MK, et al. Junctional adhesion molecule interacts with the PDZ domain-containing proteins AF-6 and ZO-1. J Biol Chem 2000;275:27979–88. doi:10.1074/jbc.M002363200

50 Bazzoni G, Martinez-Estrada OM, Mueller F, et al. Homophilic interaction of junctional adhesion molecule. J Biol Chem 2000;275:30970–6. doi:10.1074/jbc.M003946200

51 Cunningham SA, Rodriguez JM, Arrate MP, et al. JAM2 interacts with alpha4beta1. Facilitation by JAM3. J Biol Chem 2002;277:27589–92. doi:10.1074/jbc.C200331200

161

52 Kostrewa D, Brockhaus M, D’Arcy A, et al. X-ray structure of junctional adhesion molecule: structural basis for homophilic adhesion via a novel dimerization motif. EMBO J 2001;20:4391–8. doi:10.1093/emboj/20.16.4391

53 Mandicourt G, Iden S, Ebnet K, et al. JAM-C regulates tight junctions and integrin- mediated cell adhesion and migration. J Biol Chem 2007;282:1830–7. doi:10.1074/jbc.M605666200

54 Monteiro AC, Sumagin R, Rankin CR, et al. JAM-A associates with ZO-2, afadin, and PDZ-GEF1 to activate Rap2c and regulate epithelial barrier function. Mol Biol Cell 2013;24:2849–60. doi:10.1091/mbc.E13-06-0298

55 Laukoetter MG, Nava P, Lee WY, et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med 2007;204:3067–76. doi:10.1084/jem.20071416

56 Turner JR. Intestinal mucosal barrier function in health and disease. Nat Rev Immunol 2009;9:799–809. doi:10.1038/nri2653

57 Nose A, Nagafuchi A, Takeichi M. Expressed recombinant cadherins mediate cell sorting in model systems. Cell 1988;54:993–1001.

58 Aberle H, Butz S, Stappert J, et al. Assembly of the cadherin-catenin complex in vitro with recombinant proteins. J Cell Sci 1994;107 ( Pt 12):3655–63.

59 Drees F, Pokutta S, Yamada S, et al. Alpha-catenin is a molecular switch that binds E- cadherin-beta-catenin and regulates actin-filament assembly. Cell 2005;123:903–15. doi:10.1016/j.cell.2005.09.021

60 Nagafuchi A. Molecular architecture of adherens junctions. Curr Opin Cell Biol 2001;13:600–3.

61 Rimm DL, Koslov ER, Kebriaei P, et al. Alpha 1(E)-catenin is an actin-binding and - bundling protein mediating the attachment of F-actin to the membrane adhesion complex. Proc Natl Acad Sci U S A 1995;92:8813–7.

162

62 Dusek RL, Godsel LM, Green KJ. Discriminating roles of desmosomal cadherins: Beyond desmosomal adhesion. J Dermatol Sci 2007;45:7–21. doi:10.1016/j.jdermsci.2006.10.006

63 Nekrasova O, Green KJ. Desmosome assembly and dynamics. Trends Cell Biol 2013;23:537–46. doi:10.1016/j.tcb.2013.06.004

64 Capaldo CT, Farkas AE, Nusrat A. Epithelial adhesive junctions. F1000Prime Rep 2014;6. doi:10.12703/P6-1

65 Ey B, Eyking A, Gerken G, et al. TLR2 mediates gap junctional intercellular communication through connexin-43 in intestinal epithelial barrier injury. J Biol Chem 2009;284:22332–43. doi:10.1074/jbc.M901619200

66 Bennett MV, Barrio LC, Bargiello TA, et al. Gap junctions: new tools, new answers, new questions. Neuron 1991;6:305–20.

67 Willecke K, Eiberger J, Degen J, et al. Structural and functional diversity of connexin genes in the mouse and human genome. Biol Chem 2002;383:725–37. doi:10.1515/BC.2002.076

68 Saez JC, Berthoud VM, Branes MC, et al. Plasma membrane channels formed by connexins: their regulation and functions. Physiol Rev 2003;83:1359–400. doi:10.1152/physrev.00007.2003

69 Jongen WM, Fitzgerald DJ, Asamoto M, et al. Regulation of connexin 43-mediated gap junctional intercellular communication by Ca2+ in mouse epidermal cells is controlled by E- cadherin. J Cell Biol 1991;114:545–55.

70 Martin CA, Homaidan FR, Palaia T, et al. Gap junctional communication between murine macrophages and intestinal epithelial cell lines. Cell Adhes Commun 1998;5:437–49.

71 Castellano P, Eugenin EA. Regulation of gap junction channels by infectious agents and inflammation in the CNS. Front Cell Neurosci 2014;8:122. doi:10.3389/fncel.2014.00122

163

72 Nishio J, Honda K. Immunoregulation by the gut microbiota. Cell Mol Life Sci CMLS 2012;69:3635–50. doi:10.1007/s00018-012-0993-6

73 Kinnebrew MA, Pamer EG. Innate immune signaling in defense against intestinal microbes. Immunol Rev 2012;245:113–31. doi:10.1111/j.1600-065X.2011.01081.x

74 Castro-Sánchez P, Martín-Villa JM. Gut immune system and oral tolerance. Br J Nutr 2013;109 Suppl 2:S3–11. doi:10.1017/S0007114512005223

75 Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997;388:394–7. doi:10.1038/41131

76 Sandor F, Buc M. Toll-like receptors. I. Structure, function and their ligands. Folia Biol (Praha) 2005;51:148–57.

77 Sandor F, Buc M. Toll-like receptors. II. Distribution and pathways involved in TLR signalling. Folia Biol (Praha) 2005;51:188–97.

78 Sandor F, Buc M. Toll-like receptors. III. Biological significance and impact for human medicine. Folia Biol (Praha) 2005;51:198–203.

79 Rock FL, Hardiman G, Timans JC, et al. A family of human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A 1998;95:588–93.

80 Parlato M, Yeretssian G. NOD-like receptors in intestinal homeostasis and epithelial tissue repair. Int J Mol Sci 2014;15:9594–627. doi:10.3390/ijms15069594

81 Chamaillard M, Hashimoto M, Horie Y, et al. An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat Immunol 2003;4:702–7. doi:10.1038/ni945

82 Girardin SE, Boneca IG, Viala J, et al. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J Biol Chem 2003;278:8869–72. doi:10.1074/jbc.C200651200

164

83 Muniz LR, Knosp C, Yeretssian G. Intestinal antimicrobial peptides during homeostasis, infection, and disease. Front Immunol 2012;3:310. doi:10.3389/fimmu.2012.00310

84 Yeretssian G. Effector functions of NLRs in the intestine: innate sensing, cell death, and disease. Immunol Res 2012;54:25–36. doi:10.1007/s12026-012-8317-3

85 Correa RG, Milutinovic S, Reed JC. Roles of NOD1 (NLRC1) and NOD2 (NLRC2) in innate immunity and inflammatory diseases. Biosci Rep 2012;32:597–608. doi:10.1042/BSR20120055

86 Broere F, Apasov SG, Sitkovsky MV, van Eden W. T cell subsets and T cell-mediated immunity. In: Principles of immunopharmacology. Springer 2011. 15–26.

87 Rijkers GT. Antibody diversity and B lymphocyte-mediated immunity. In: Principles of immunopharmacology. Springer 2011. 29–46.

88 Ford AC, Forman D, Bailey AG, et al. Effect of dyspepsia on survival: a longitudinal 10- year follow-up study. Am J Gastroenterol 2012;107:912–21. doi:10.1038/ajg.2012.69

89 Ford AC, Moayyedi P. Dyspepsia. Curr Opin Gastroenterol 2013;29:662–8. doi:10.1097/MOG.0b013e328365d45d

90 Kindt S, Van Oudenhove L, Mispelon L, et al. Longitudinal and cross-sectional factors associated with long-term clinical course in functional dyspepsia: a 5-year follow-up study. Am J Gastroenterol 2011;106:340–8. doi:10.1038/ajg.2010.406

91 Zanini B, Ricci C, Bandera F, et al. Incidence of post-infectious irritable bowel syndrome and functional intestinal disorders following a water-borne viral gastroenteritis outbreak. Am J Gastroenterol 2012;107:891–9. doi:10.1038/ajg.2012.102

92 Porter CK, Gormley R, Tribble DR, et al. The Incidence and gastrointestinal infectious risk of functional gastrointestinal disorders in a healthy US adult population. Am J Gastroenterol 2011;106:130–8. doi:10.1038/ajg.2010.371

165

93 Ford AC, Thabane M, Collins SM, et al. Prevalence of uninvestigated dyspepsia 8 years after a large waterborne outbreak of bacterial dysentery: a cohort study. Gastroenterology 2010;138:1727–1736; quiz e12. doi:10.1053/j.gastro.2010.01.043

94 Spiller R, Aziz Q, Creed F, et al. Guidelines on the irritable bowel syndrome: mechanisms and practical management. Gut 2007;56:1770–98. doi:10.1136/gut.2007.119446

95 Spiegel BMR. The burden of IBS: looking at metrics. Curr Gastroenterol Rep 2009;11:265–9.

96 Clarke G, Quigley EMM, Cryan JF, et al. Irritable bowel syndrome: towards biomarker identification. Trends Mol Med 2009;15:478–89. doi:10.1016/j.molmed.2009.08.001

97 Horwitz BJ, Fisher RS. The irritable bowel syndrome. N Engl J Med 2001;344:1846–50. doi:10.1056/NEJM200106143442407

98 Manning AP, Thompson WG, Heaton KW, et al. Towards positive diagnosis of the irritable bowel. Br Med J 1978;2:653–4.

99 Thompson WG, Longstreth GF, Drossman DA, et al. Functional bowel disorders and functional abdominal pain. Gut 1999;45 Suppl 2:II43–47.

100 Longstreth GF, Thompson WG, Chey WD, et al. Functional bowel disorders. Gastroenterology 2006;130:1480–91. doi:10.1053/j.gastro.2005.11.061

101 Törnblom H, Van Oudenhove L, Sadik R, et al. Colonic transit time and IBS symptoms: what’s the link? Am J Gastroenterol 2012;107:754–60. doi:10.1038/ajg.2012.5

102 Gaburri M, Bassotti G, Bacci G, et al. Functional gut disorders and health care seeking behavior in an Italian non-patient population. Recenti Prog Med 1989;80:241–4.

103 Olafsdottir LB, Gudjonsson H, Jonsdottir HH, et al. Stability of the irritable bowel syndrome and subgroups as measured by three diagnostic criteria - a 10-year follow-up study. Aliment Pharmacol Ther 2010;32:670–80. doi:10.1111/j.1365-2036.2010.04388.x

166

104 Lovell RM, Ford AC. Global prevalence of and risk factors for irritable bowel syndrome: a meta-analysis. Clin Gastroenterol Hepatol Off Clin Pract J Am Gastroenterol Assoc 2012;10:712–721.e4. doi:10.1016/j.cgh.2012.02.029

105 Krogsgaard LR, Engsbro AL, Bytzer P. The epidemiology of irritable bowel syndrome in Denmark. A population-based survey in adults ≤50 years of age. Scand J Gastroenterol 2013;48:523–9. doi:10.3109/00365521.2013.775328

106 Gwee K-A. Irritable bowel syndrome in developing countries--a disorder of civilization or colonization? Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2005;17:317–24. doi:10.1111/j.1365-2982.2005.00627.x

107 Gwee K-A, Lu C-L, Ghoshal UC. Epidemiology of irritable bowel syndrome in Asia: something old, something new, something borrowed. J Gastroenterol Hepatol 2009;24:1601– 7. doi:10.1111/j.1440-1746.2009.05984.x

108 Chang F-Y, Lu C-L, Chen T-S. The current prevalence of irritable bowel syndrome in Asia. J Neurogastroenterol Motil 2010;16:389–400. doi:10.5056/jnm.2010.16.4.389

109 Lovell RM, Ford AC. Effect of gender on prevalence of irritable bowel syndrome in the community: systematic review and meta-analysis. Am J Gastroenterol 2012;107:991–1000. doi:10.1038/ajg.2012.131

110 Canavan C, West J, Card T. The epidemiology of irritable bowel syndrome. Clin Epidemiol 2014;6:71–80. doi:10.2147/CLEP.S40245

111 Tang Y, Yang W, Wang Y-L, et al. Sex differences in the symptoms and psychological factors that influence quality of life in patients with irritable bowel syndrome. Eur J Gastroenterol Hepatol 2012;24:702–7. doi:10.1097/MEG.0b013e328351b2c2

112 Mulak A, Taché Y, Larauche M. Sex hormones in the modulation of irritable bowel syndrome. World J Gastroenterol WJG 2014;20:2433–48. doi:10.3748/wjg.v20.i10.2433

167

113 Rasquin A, Di Lorenzo C, Forbes D, et al. Childhood functional gastrointestinal disorders: child/adolescent. Gastroenterology 2006;130:1527–37. doi:10.1053/j.gastro.2005.08.063

114 Karabulut S, Beşer OF, Erginöz E, et al. The Incidence of Irritable Bowel Syndrome in Children Using the Rome III Criteria and the Effect of Trimebutine Treatment. J Neurogastroenterol Motil 2013;19:90–3. doi:10.5056/jnm.2013.19.1.90

115 Chogle A, Mintjens S, Saps M. Pediatric IBS: an overview on pathophysiology, diagnosis and treatment. Pediatr Ann 2014;43:e76–82. doi:10.3928/00904481-20140325-08

116 Tang Y-R, Yang W-W, Liang M-L, et al. Age-related symptom and life quality changes in women with irritable bowel syndrome. World J Gastroenterol WJG 2012;18:7175–83. doi:10.3748/wjg.v18.i48.7175

117 Drossman DA, Camilleri M, Mayer EA, et al. AGA technical review on irritable bowel syndrome. Gastroenterology 2002;123:2108–31. doi:10.1053/gast.2002.37095

118 Jones R, Lydeard S. Irritable bowel syndrome in the general population. BMJ 1992;304:87–90.

119 Thompson WG, Heaton KW, Smyth GT, et al. Irritable bowel syndrome in general practice: prevalence, characteristics, and referral. Gut 2000;46:78–82.

120 Mearin F, Balboa A, Badía X, et al. Irritable bowel syndrome subtypes according to bowel habit: revisiting the alternating subtype. Eur J Gastroenterol Hepatol 2003;15:165–72. doi:10.1097/01.meg.0000049985.90403.87

121 Walter SA, Skagerström E, Bodemar G. Subgroups of irritable bowel syndrome: a new approach. Eur J Gastroenterol Hepatol 2004;16:991–4.

122 Drossman DA, Morris CB, Hu Y, et al. A prospective assessment of bowel habit in irritable bowel syndrome in women: defining an alternator. Gastroenterology 2005;128:580– 9.

168

123 Tillisch K, Labus JS, Naliboff BD, et al. Characterization of the alternating bowel habit subtype in patients with irritable bowel syndrome. Am J Gastroenterol 2005;100:896–904. doi:10.1111/j.1572-0241.2005.41211.x

124 Spiegel BMR, Gralnek IM, Bolus R, et al. Clinical determinants of health-related quality of life in patients with irritable bowel syndrome. Arch Intern Med 2004;164:1773–80. doi:10.1001/archinte.164.16.1773

125 Tillisch K, Mayer EA. Pain perception in irritable bowel syndrome. CNS Spectr 2005;10:877–82.

126 Park M-I, Camilleri M. Is there a role of food allergy in irritable bowel syndrome and functional dyspepsia? A systematic review. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2006;18:595–607. doi:10.1111/j.1365-2982.2005.00745.x

127 Su AM, Shih W, Presson AP, et al. Characterization of symptoms in irritable bowel syndrome with mixed bowel habit pattern. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2014;26:36–45. doi:10.1111/nmo.12220

128 Whitehead WE, Palsson O, Jones KR. Systematic review of the comorbidity of irritable bowel syndrome with other disorders: what are the causes and implications? Gastroenterology 2002;122:1140–56.

129 Riedl A, Schmidtmann M, Stengel A, et al. Somatic comorbidities of irritable bowel syndrome: a systematic analysis. J Psychosom Res 2008;64:573–82. doi:10.1016/j.jpsychores.2008.02.021

130 Sperber AD, Dekel R. Irritable Bowel Syndrome and Co-morbid Gastrointestinal and Extra-gastrointestinal Functional Syndromes. J Neurogastroenterol Motil 2010;16:113–9. doi:10.5056/jnm.2010.16.2.113

131 Masand PS, Kaplan DS, Gupta S, et al. Major depression and irritable bowel syndrome: is there a relationship? J Clin Psychiatry 1995;56:363–7.

169

132 Tosic-Golubovic S, Miljkovic S, Nagorni A, et al. Irritable bowel syndrome, anxiety, depression and personality characteristics. Psychiatr Danub 2010;22:418–24.

133 Lackner JM, Ma C-X, Keefer L, et al. Type, rather than number, of mental and physical comorbidities increases the severity of symptoms in patients with irritable bowel syndrome. Clin Gastroenterol Hepatol Off Clin Pract J Am Gastroenterol Assoc 2013;11:1147–57. doi:10.1016/j.cgh.2013.03.011

134 Fond G, Loundou A, Hamdani N, et al. Anxiety and depression comorbidities in irritable bowel syndrome (IBS): a systematic review and meta-analysis. Eur Arch Psychiatry Clin Neurosci Published Online First: 6 April 2014. doi:10.1007/s00406-014-0502-z

135 Ford AC, Marwaha A, Lim A, et al. Systematic review and meta-analysis of the prevalence of irritable bowel syndrome in individuals with dyspepsia. Clin Gastroenterol Hepatol Off Clin Pract J Am Gastroenterol Assoc 2010;8:401–9. doi:10.1016/j.cgh.2009.07.020

136 Suzuki H, Hibi T. Overlap syndrome of functional dyspepsia and irritable bowel syndrome - are both diseases mutually exclusive? J Neurogastroenterol Motil 2011;17:360–5. doi:10.5056/jnm.2011.17.4.360

137 Perveen I, Rahman MM, Saha M, et al. Prevalence of irritable bowel syndrome and functional dyspepsia, overlapping symptoms, and associated factors in a general population of Bangladesh. Indian J Gastroenterol Off J Indian Soc Gastroenterol 2014;33:265–73. doi:10.1007/s12664-014-0447-1

138 Agréus L, Svärdsudd K, Nyrén O, et al. Irritable bowel syndrome and dyspepsia in the general population: overlap and lack of stability over time. Gastroenterology 1995;109:671– 80.

139 Kennedy TM, Jones RH, Hungin AP, et al. Irritable bowel syndrome, gastro-oesophageal reflux, and bronchial hyper-responsiveness in the general population. Gut 1998;43:770–4.

170

140 Talley NJ, Dennis EH, Schettler-Duncan VA, et al. Overlapping upper and lower gastrointestinal symptoms in irritable bowel syndrome patients with constipation or diarrhea. Am J Gastroenterol 2003;98:2454–9. doi:10.1111/j.1572-0241.2003.07699.x

141 Dickman R, Feroze H, Fass R. Gastroesophageal reflux disease and irritable bowel syndrome: a common overlap syndrome. Curr Gastroenterol Rep 2006;8:261–5.

142 Nastaskin I, Mehdikhani E, Conklin J, et al. Studying the overlap between IBS and GERD: a systematic review of the literature. Dig Dis Sci 2006;51:2113–20. doi:10.1007/s10620-006-9306-y

143 Lee SY, Lee KJ, Kim SJ, et al. Prevalence and risk factors for overlaps between gastroesophageal reflux disease, dyspepsia, and irritable bowel syndrome: a population-based study. Digestion 2009;79:196–201. doi:10.1159/000211715

144 Nojkov B, Rubenstein JH, Adlis SA, et al. The influence of co-morbid IBS and psychological distress on outcomes and quality of life following PPI therapy in patients with gastro-oesophageal reflux disease. Aliment Pharmacol Ther 2008;27:473–82. doi:10.1111/j.1365-2036.2008.03596.x

145 Whorwell PJ, McCallum M, Creed FH, et al. Non-colonic features of irritable bowel syndrome. Gut 1986;27:37–40.

146 Whorwell PJ, Lupton EW, Erduran D, et al. Bladder smooth muscle dysfunction in patients with irritable bowel syndrome. Gut 1986;27:1014–7.

147 Azpiroz F, Dapoigny M, Pace F, et al. Nongastrointestinal disorders in the irritable bowel syndrome. Digestion 2000;62:66–72. doi:7780

148 Veale D, Kavanagh G, Fielding JF, et al. Primary fibromyalgia and the irritable bowel syndrome: different expressions of a common pathogenetic process. Br J Rheumatol 1991;30:220–2.

171

149 Chang L, Berman S, Mayer EA, et al. Brain responses to visceral and somatic stimuli in patients with irritable bowel syndrome with and without fibromyalgia. Am J Gastroenterol 2003;98:1354–61. doi:10.1111/j.1572-0241.2003.07478.x

150 Lubrano E, Iovino P, Tremolaterra F, et al. Fibromyalgia in patients with irritable bowel syndrome. An association with the severity of the intestinal disorder. Int J Colorectal Dis 2001;16:211–5.

151 Sperber AD, Carmel S, Atzmon Y, et al. Use of the Functional Bowel Disorder Severity Index (FBDSI) in a study of patients with the irritable bowel syndrome and fibromyalgia. Am J Gastroenterol 2000;95:995–8. doi:10.1111/j.1572-0241.2000.01977.x

152 Fukuda K, Straus SE, Hickie I, et al. The chronic fatigue syndrome: a comprehensive approach to its definition and study. International Chronic Fatigue Syndrome Study Group. Ann Intern Med 1994;121:953–9.

153 Gomborone JE, Gorard DA, Dewsnap PA, et al. Prevalence of irritable bowel syndrome in chronic fatigue. J R Coll Physicians Lond 1996;30:512–3.

154 Aaron LA, Herrell R, Ashton S, et al. Comorbid clinical conditions in chronic fatigue: a co-twin control study. J Gen Intern Med 2001;16:24–31.

155 Frissora CL, Koch KL. Symptom overlap and comorbidity of irritable bowel syndrome with other conditions. Curr Gastroenterol Rep 2005;7:264–71.

156 Dansie EJ, Furberg H, Afari N, et al. Conditions comorbid with chronic fatigue in a population-based sample. Psychosomatics 2012;53:44–50. doi:10.1016/j.psym.2011.04.001

157 Hamilton WT, Gallagher AM, Thomas JM, et al. Risk markers for both chronic fatigue and irritable bowel syndromes: a prospective case-control study in primary care. Psychol Med 2009;39:1913–21. doi:10.1017/S0033291709005601

158 Walker EA, Gelfand AN, Gelfand MD, et al. Chronic pelvic pain and gynecological symptoms in women with irritable bowel syndrome. J Psychosom Obstet Gynaecol 1996;17:39–46.

172

159 Zondervan KT, Yudkin PL, Vessey MP, et al. The prevalence of chronic pelvic pain in women in the United Kingdom: a systematic review. Br J Obstet Gynaecol 1998;105:93–9.

160 Harrop-Griffiths J, Katon W, Walker E, et al. The association between chronic pelvic pain, psychiatric diagnoses, and childhood sexual abuse. Obstet Gynecol 1988;71:589–94.

161 Fass R, Fullerton S, Naliboff B, et al. Sexual dysfunction in patients with irritable bowel syndrome and non-ulcer dyspepsia. Digestion 1998;59:79–85.

162 Chao C-H, Lin C-L, Wang H-Y, et al. Increased subsequent risk of erectile dysfunction in patients with irritable bowel syndrome: a nationwide population-based cohort study. Andrology 2013;1:793–8. doi:10.1111/j.2047-2927.2013.00120.x

163 Langeluddecke PM. Psychological aspects of irritable bowel syndrome. Aust N Z J Psychiatry 1985;19:218–26.

164 Drossman DA, McKee DC, Sandler RS, et al. Psychosocial factors in the irritable bowel syndrome. A multivariate study of patients and nonpatients with irritable bowel syndrome. Gastroenterology 1988;95:701–8.

165 North CS, Hong BA, Alpers DH. Relationship of functional gastrointestinal disorders and psychiatric disorders: implications for treatment. World J Gastroenterol WJG 2007;13:2020– 7.

166 Garakani A, Win T, Virk S, et al. Comorbidity of irritable bowel syndrome in psychiatric patients: a review. Am J Ther 2003;10:61–7.

167 McKee DP, Quigley EM. Intestinal motility in irritable bowel syndrome: is IBS a motility disorder? Part 1. Definition of IBS and colonic motility. Dig Dis Sci 1993;38:1761–72.

168 McKee DP, Quigley EM. Intestinal motility in irritable bowel syndrome: is IBS a motility disorder? Part 2. Motility of the small bowel, esophagus, stomach, and gall-bladder. Dig Dis Sci 1993;38:1773–82.

173

169 Caballero-Plasencia AM, Valenzuela-Barranco M, Herrerías-Gutiérrez JM, et al. Altered gastric emptying in patients with irritable bowel syndrome. Eur J Nucl Med 1999;26:404–9.

170 Stanghellini V, Tosetti C, Barbara G, et al. Dyspeptic symptoms and gastric emptying in the irritable bowel syndrome. Am J Gastroenterol 2002;97:2738–43. doi:10.1111/j.1572- 0241.2002.07062.x

171 Kellow JE, Phillips SF, Miller LJ, et al. Dysmotility of the small intestine in irritable bowel syndrome. Gut 1988;29:1236–43.

172 Simrén M, Castedal M, Svedlund J, et al. Abnormal propagation pattern of duodenal pressure waves in the irritable bowel syndrome (IBS) [correction of (IBD)]. Dig Dis Sci 2000;45:2151–61.

173 Cann PA, Read NW, Brown C, et al. Irritable bowel syndrome: relationship of disorders in the transit of a single solid meal to symptom patterns. Gut 1983;24:405–11.

174 Fukudo S, Kanazawa M, Kano M, et al. Exaggerated motility of the descending colon with repetitive distention of the sigmoid colon in patients with irritable bowel syndrome. J Gastroenterol 2002;37 Suppl 14:145–50.

175 Azpiroz F. Dimensions of gut dysfunction in irritable bowel syndrome: altered sensory function. Can J Gastroenterol J Can Gastroenterol 1999;13 Suppl A:12A–14A.

176 Lembo T, Naliboff B, Munakata J, et al. Symptoms and visceral perception in patients with pain-predominant irritable bowel syndrome. Am J Gastroenterol 1999;94:1320–6. doi:10.1111/j.1572-0241.1999.01009.x

177 Mertz H, Naliboff B, Munakata J, et al. Altered rectal perception is a biological marker of patients with irritable bowel syndrome. Gastroenterology 1995;109:40–52.

178 Ritchie J. Pain from distension of the pelvic colon by inflating a balloon in the irritable colon syndrome. Gut 1973;14:125–32.

174

179 Ohman L, Simrén M. New insights into the pathogenesis and pathophysiology of irritable bowel syndrome. Dig Liver Dis Off J Ital Soc Gastroenterol Ital Assoc Study Liver 2007;39:201–15. doi:10.1016/j.dld.2006.10.014

180 Ohman L, Simrén M. Pathogenesis of IBS: role of inflammation, immunity and neuroimmune interactions. Nat Rev Gastroenterol Hepatol 2010;7:163–73. doi:10.1038/nrgastro.2010.4

181 Azpiroz F, Bouin M, Camilleri M, et al. Mechanisms of hypersensitivity in IBS and functional disorders. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2007;19:62– 88. doi:10.1111/j.1365-2982.2006.00875.x

182 Bueno L, Fioramonti J, Delvaux M, et al. Mediators and pharmacology of visceral sensitivity: from basic to clinical investigations. Gastroenterology 1997;112:1714–43.

183 Mertz H. Role of the brain and sensory pathways in gastrointestinal sensory disorders in humans. Gut 2002;51 Suppl 1:i29–33.

184 Castagliuolo I, Keates AC, Qiu B, et al. Increased substance P responses in dorsal root ganglia and intestinal macrophages during Clostridium difficile toxin A enteritis in rats. Proc Natl Acad Sci U S A 1997;94:4788–93.

185 Bourdu S, Dapoigny M, Chapuy E, et al. Rectal instillation of butyrate provides a novel clinically relevant model of noninflammatory colonic hypersensitivity in rats. Gastroenterology 2005;128:1996–2008.

186 Wang WF, Yang YS, Peng LH, et al. Alternation of substance P-containing neural pathways in a rat model of irritable bowel syndrome with rectal distension. Chin J Dig Dis 2006;7:211–8. doi:10.1111/j.1443-9573.2006.00273.x

187 Feng B, La JH, Schwartz ES, et al. Irritable bowel syndrome: methods, mechanisms, and pathophysiology. Neural and neuro-immune mechanisms of visceral hypersensitivity in irritable bowel syndrome. Am J Physiol Gastrointest Liver Physiol 2012;302:G1085–1098. doi:10.1152/ajpgi.00542.2011

175

188 Park CH, Joo YE, Choi SK, et al. Activated mast cells infiltrate in close proximity to enteric nerves in diarrhea-predominant irritable bowel syndrome. J Korean Med Sci 2003;18:204–10.

189 Barbara G, Stanghellini V, De Giorgio R, et al. Activated mast cells in proximity to colonic nerves correlate with abdominal pain in irritable bowel syndrome. Gastroenterology 2004;126:693–702.

190 Steinhoff M, Vergnolle N, Young SH, et al. Agonists of proteinase-activated receptor 2 induce inflammation by a neurogenic mechanism. Nat Med 2000;6:151–8. doi:10.1038/72247

191 Vergnolle N. Modulation of visceral pain and inflammation by protease-activated receptors. Br J Pharmacol 2004;141:1264–74. doi:10.1038/sj.bjp.0705750

192 Boesmans W, Owsianik G, Tack J, et al. TRP channels in neurogastroenterology: opportunities for therapeutic intervention. Br J Pharmacol 2011;162:18–37. doi:10.1111/j.1476-5381.2010.01009.x

193 Lapointe TK, Altier C. The role of TRPA1 in visceral inflammation and pain. Channels Austin Tex 2011;5:525–9. doi:10.4161/chan.5.6.18016

194 Caterina MJ, Julius D. The vanilloid receptor: a molecular gateway to the pain pathway. Annu Rev Neurosci 2001;24:487–517. doi:10.1146/annurev.neuro.24.1.487

195 Akbar A, Yiangou Y, Facer P, et al. Increased capsaicin receptor TRPV1-expressing sensory fibres in irritable bowel syndrome and their correlation with abdominal pain. Gut 2008;57:923–9. doi:10.1136/gut.2007.138982

196 Jones RCW 3rd, Xu L, Gebhart GF. The mechanosensitivity of mouse colon afferent fibers and their sensitization by inflammatory mediators require transient receptor potential vanilloid 1 and acid-sensing ion channel 3. J Neurosci Off J Soc Neurosci 2005;25:10981–9. doi:10.1523/JNEUROSCI.0703-05.2005

176

197 Miranda A, Nordstrom E, Mannem A, et al. The role of transient receptor potential vanilloid 1 in mechanical and chemical visceral hyperalgesia following experimental colitis. Neuroscience 2007;148:1021–32. doi:10.1016/j.neuroscience.2007.05.034

198 Winston J, Shenoy M, Medley D, et al. The vanilloid receptor initiates and maintains colonic hypersensitivity induced by neonatal colon irritation in rats. Gastroenterology 2007;132:615–27. doi:10.1053/j.gastro.2006.11.014

199 Mönnikes H, Lauer G, Arnold R. Peripheral administration of cholecystokinin activates c-fos expression in the locus coeruleus/subcoeruleus nucleus, dorsal vagal complex and paraventricular nucleus via capsaicin-sensitive vagal afferents and CCK-A receptors in the rat. Brain Res 1997;770:277–88.

200 Traub RJ, Pechman P, Iadarola MJ, et al. Fos-like proteins in the lumbosacral spinal cord following noxious and non-noxious colorectal distention in the rat. Pain 1992;49:393–403.

201 Traub RJ, Herdegen T, Gebhart GF. Differential expression of c-fos and c-jun in two regions of the rat spinal cord following noxious colorectal distention. Neurosci Lett 1993;160:121–5.

202 Traub RJ, Silva E, Gebhart GF, et al. Noxious colorectal distention induced-c-Fos protein in limbic brain structures in the rat. Neurosci Lett 1996;215:165–8.

203 Zhang R, Zou N, Li J, et al. Elevated expression of c-fos in central nervous system correlates with visceral hypersensitivity in irritable bowel syndrome (IBS): a new target for IBS treatment. Int J Colorectal Dis 2011;26:1035–44. doi:10.1007/s00384-011-1153-4

204 Gibney SM, Gosselin R-D, Dinan TG, et al. Colorectal distension-induced prefrontal cortex activation in the Wistar-Kyoto rat: implications for irritable bowel syndrome. Neuroscience 2010;165:675–83. doi:10.1016/j.neuroscience.2009.08.076

205 Matricon J, Gelot A, Etienne M, et al. Spinal cord plasticity and acid-sensing ion channels involvement in a rodent model of irritable bowel syndrome. Eur J Pain Lond Engl 2011;15:335–43. doi:10.1016/j.ejpain.2010.08.005

177

206 Chadwick VS, Chen W, Shu D, et al. Activation of the mucosal immune system in irritable bowel syndrome. Gastroenterology 2002;122:1778–83.

207 Collins SM. A case for an immunological basis for irritable bowel syndrome. Gastroenterology 2002;122:2078–80.

208 Gonsalkorale WM, Perrey C, Pravica V, et al. Interleukin 10 genotypes in irritable bowel syndrome: evidence for an inflammatory component? Gut 2003;52:91–3.

209 Guilarte M, Santos J, de Torres I, et al. Diarrhoea-predominant IBS patients show mast cell activation and hyperplasia in the jejunum. Gut 2007;56:203–9. doi:10.1136/gut.2006.100594

210 Weston AP, Biddle WL, Bhatia PS, et al. Terminal ileal mucosal mast cells in irritable bowel syndrome. Dig Dis Sci 1993;38:1590–5.

211 Walker MM, Talley NJ, Prabhakar M, et al. Duodenal mastocytosis, eosinophilia and intraepithelial lymphocytosis as possible disease markers in the irritable bowel syndrome and functional dyspepsia. Aliment Pharmacol Ther 2009;29:765–73. doi:10.1111/j.1365- 2036.2009.03937.x

212 Aerssens J, Camilleri M, Talloen W, et al. Alterations in mucosal immunity identified in the colon of patients with irritable bowel syndrome. Clin Gastroenterol Hepatol Off Clin Pract J Am Gastroenterol Assoc 2008;6:194–205. doi:10.1016/j.cgh.2007.11.012

213 Cenac N, Andrews CN, Holzhausen M, et al. Role for protease activity in visceral pain in irritable bowel syndrome. J Clin Invest 2007;117:636–47. doi:10.1172/JCI29255

214 Macsharry J, O’Mahony L, Fanning A, et al. Mucosal cytokine imbalance in irritable bowel syndrome. Scand J Gastroenterol 2008;43:1467–76. doi:10.1080/00365520802276127

215 Barbara G, Wang B, Stanghellini V, et al. Mast cell-dependent excitation of visceral- nociceptive sensory neurons in irritable bowel syndrome. Gastroenterology 2007;132:26–37. doi:10.1053/j.gastro.2006.11.039

178

216 Buhner S, Li Q, Vignali S, et al. Activation of human enteric neurons by supernatants of colonic biopsy specimens from patients with irritable bowel syndrome. Gastroenterology 2009;137:1425–34. doi:10.1053/j.gastro.2009.07.005

217 Törnblom H, Lindberg G, Nyberg B, et al. Full-thickness biopsy of the jejunum reveals inflammation and enteric neuropathy in irritable bowel syndrome. Gastroenterology 2002;123:1972–9. doi:10.1053/gast.2002.37059

218 Spiller RC, Jenkins D, Thornley JP, et al. Increased rectal mucosal enteroendocrine cells, T lymphocytes, and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome. Gut 2000;47:804–11.

219 Remes-Troche JM, Adames K, Castillo-Rodal AI, et al. Intraepithelial gammadelta+ lymphocytes: a comparative study between celiac disease, small intestinal bacterial overgrowth, and irritable bowel syndrome. J Clin Gastroenterol 2007;41:671–6. doi:10.1097/01.mcg.0000247994.34957.ae

220 Ahn JY, Lee KH, Choi CH, et al. Colonic mucosal immune activity in irritable bowel syndrome: comparison with healthy controls and patients with ulcerative colitis. Dig Dis Sci 2014;59:1001–11. doi:10.1007/s10620-013-2930-4

221 Ohman L, Isaksson S, Lindmark A-C, et al. T-cell activation in patients with irritable bowel syndrome. Am J Gastroenterol 2009;104:1205–12. doi:10.1038/ajg.2009.116

222 Dinan TG, Quigley EMM, Ahmed SMM, et al. Hypothalamic-pituitary-gut axis dysregulation in irritable bowel syndrome: plasma cytokines as a potential biomarker? Gastroenterology 2006;130:304–11. doi:10.1053/j.gastro.2005.11.033

223 Parkes GC, Brostoff J, Whelan K, et al. Gastrointestinal microbiota in irritable bowel syndrome: their role in its pathogenesis and treatment. Am J Gastroenterol 2008;103:1557– 67. doi:10.1111/j.1572-0241.2008.01869.x

224 Pimentel M, Chow EJ, Lin HC. Eradication of small intestinal bacterial overgrowth reduces symptoms of irritable bowel syndrome. Am J Gastroenterol 2000;95:3503–6. doi:10.1111/j.1572-0241.2000.03368.x

179

225 Collins SM, Denou E, Verdu EF, et al. The putative role of the intestinal microbiota in the irritable bowel syndrome. Dig Liver Dis Off J Ital Soc Gastroenterol Ital Assoc Study Liver 2009;41:850–3. doi:10.1016/j.dld.2009.07.023

226 Mättö J, Maunuksela L, Kajander K, et al. Composition and temporal stability of gastrointestinal microbiota in irritable bowel syndrome--a longitudinal study in IBS and control subjects. FEMS Immunol Med Microbiol 2005;43:213–22.

227 Kassinen A, Krogius-Kurikka L, Mäkivuokko H, et al. The fecal microbiota of irritable bowel syndrome patients differs significantly from that of healthy subjects. Gastroenterology 2007;133:24–33. doi:10.1053/j.gastro.2007.04.005

228 Codling C, O’Mahony L, Shanahan F, et al. A molecular analysis of fecal and mucosal bacterial communities in irritable bowel syndrome. Dig Dis Sci 2010;55:392–7. doi:10.1007/s10620-009-0934-x

229 Carroll IM, Ringel-Kulka T, Siddle JP, et al. Alterations in composition and diversity of the intestinal microbiota in patients with diarrhea-predominant irritable bowel syndrome. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2012;24:521–530, e248. doi:10.1111/j.1365-2982.2012.01891.x

230 Durbán A, Abellán JJ, Jiménez-Hernández N, et al. Structural alterations of faecal and mucosa-associated bacterial communities in irritable bowel syndrome. Environ Microbiol Rep 2012;4:242–7. doi:10.1111/j.1758-2229.2012.00327.x

231 ABRAMS GD, BAUER H, SPRINZ H. Influence of the normal flora on mucosal morphology and cellular renewal in the ileum. A comparison of germ-free and conventional mice. Lab Investig J Tech Methods Pathol 1963;12:355–64.

232 Shanahan F. The host-microbe interface within the gut. Best Pract Res Clin Gastroenterol 2002;16:915–31.

233 Di Mauro A, Neu J, Riezzo G, et al. Gastrointestinal function development and microbiota. Ital J Pediatr 2013;39:15. doi:10.1186/1824-7288-39-15

180

234 Ashida H, Ogawa M, Kim M, et al. Bacteria and host interactions in the gut epithelial barrier. Nat Chem Biol 2012;8:36–45. doi:10.1038/nchembio.741

235 Verdú EF, Bercik P, Verma-Gandhu M, et al. Specific probiotic therapy attenuates antibiotic induced visceral hypersensitivity in mice. Gut 2006;55:182–90. doi:10.1136/gut.2005.066100

236 Collins SM, Bercik P. The relationship between intestinal microbiota and the central nervous system in normal gastrointestinal function and disease. Gastroenterology 2009;136:2003–14. doi:10.1053/j.gastro.2009.01.075

237 Collins J, Borojevic R, Verdu EF, et al. Intestinal microbiota influence the early postnatal development of the enteric nervous system. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2014;26:98–107. doi:10.1111/nmo.12236

238 Camilleri M, Di Lorenzo C. Brain-gut axis: from basic understanding to treatment of IBS and related disorders. J Pediatr Gastroenterol Nutr 2012;54:446–53. doi:10.1097/MPG.0b013e31823d34c3

239 Bravo JA, Julio-Pieper M, Forsythe P, et al. Communication between gastrointestinal bacteria and the nervous system. Curr Opin Pharmacol 2012;12:667–72. doi:10.1016/j.coph.2012.09.010

240 Fichna J, Storr MA. Brain-Gut Interactions in IBS. Front Pharmacol 2012;3:127. doi:10.3389/fphar.2012.00127

241 Forsythe P, Kunze WA. Voices from within: gut microbes and the CNS. Cell Mol Life Sci CMLS 2013;70:55–69. doi:10.1007/s00018-012-1028-z

242 Ducrotté P. [Irritable bowel syndrome: dietary and pharmacological therapeutic options]. Gastroentérologie Clin Biol 2009;33 Suppl 1:S68–78. doi:10.1016/S0399-8320(09)71527-1

243 Böhmer CJ, Tuynman HA. The clinical relevance of lactose malabsorption in irritable bowel syndrome. Eur J Gastroenterol Hepatol 1996;8:1013–6.

181

244 Evans PR, Piesse C, Bak YT, et al. Fructose-sorbitol malabsorption and symptom provocation in irritable bowel syndrome: relationship to enteric hypersensitivity and dysmotility. Scand J Gastroenterol 1998;33:1158–63.

245 Goldstein R, Braverman D, Stankiewicz H. Carbohydrate malabsorption and the effect of dietary restriction on symptoms of irritable bowel syndrome and functional bowel complaints. Isr Med Assoc J IMAJ 2000;2:583–7.

246 Di Stefano M, Miceli E, Mazzocchi S, et al. Visceral hypersensitivity and intolerance symptoms in lactose malabsorption. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2007;19:887–95. doi:10.1111/j.1365-2982.2007.00973.x

247 Jones VA, McLaughlan P, Shorthouse M, et al. Food intolerance: a major factor in the pathogenesis of irritable bowel syndrome. Lancet 1982;2:1115–7.

248 Atkinson W, Sheldon TA, Shaath N, et al. Food elimination based on IgG antibodies in irritable bowel syndrome: a randomised controlled trial. Gut 2004;53:1459–64. doi:10.1136/gut.2003.037697

249 Zar S, Mincher L, Benson MJ, et al. Food-specific IgG4 antibody-guided exclusion diet improves symptoms and rectal compliance in irritable bowel syndrome. Scand J Gastroenterol 2005;40:800–7. doi:10.1080/00365520510015593

250 Heizer WD, Southern S, McGovern S. The role of diet in symptoms of irritable bowel syndrome in adults: a narrative review. J Am Diet Assoc 2009;109:1204–14. doi:10.1016/j.jada.2009.04.012

251 Whitehead WE, Crowell MD, Robinson JC, et al. Effects of stressful life events on bowel symptoms: subjects with irritable bowel syndrome compared with subjects without bowel dysfunction. Gut 1992;33:825–30.

252 Blanchard EB, Greene B, Scharff L, et al. Relaxation training as a treatment for irritable bowel syndrome. Biofeedback Self-Regul 1993;18:125–32.

182

253 Payne A, Blanchard EB. A controlled comparison of cognitive therapy and self-help support groups in the treatment of irritable bowel syndrome. J Consult Clin Psychol 1995;63:779–86.

254 Drossman DA, Toner BB, Whitehead WE, et al. Cognitive-behavioral therapy versus education and desipramine versus placebo for moderate to severe functional bowel disorders. Gastroenterology 2003;125:19–31.

255 Zomorodi S, Abdi S, Tabatabaee SKR. Comparison of long-term effects of cognitive- behavioral therapy versus mindfulness-based therapy on reduction of symptoms among patients suffering from irritable bowel syndrome. Gastroenterol Hepatol Bed Bench 2014;7:118–24.

256 Tan G, Hammond DC, Joseph G. Hypnosis and irritable bowel syndrome: a review of efficacy and mechanism of action. Am J Clin Hypn 2005;47:161–78.

257 Gonsalkorale WM, Miller V, Afzal A, et al. Long term benefits of hypnotherapy for irritable bowel syndrome. Gut 2003;52:1623–9.

258 Shah E, Pimentel M. Placebo Effect in Clinical Trial Design for Irritable Bowel Syndrome. J Neurogastroenterol Motil 2014;20:163–70. doi:10.5056/jnm.2014.20.2.163

259 Jailwala J, Imperiale TF, Kroenke K. Pharmacologic treatment of the irritable bowel syndrome: a systematic review of randomized, controlled trials. Ann Intern Med 2000;133:136–47.

260 Poynard T, Regimbeau C, Benhamou Y. Meta-analysis of smooth muscle relaxants in the treatment of irritable bowel syndrome. Aliment Pharmacol Ther 2001;15:355–61.

261 Ruepert L, Quartero AO, de Wit NJ, et al. Bulking agents, antispasmodics and antidepressants for the treatment of irritable bowel syndrome. Cochrane Database Syst Rev 2011;:CD003460. doi:10.1002/14651858.CD003460.pub3

262 Lavö B, Stenstam M, Nielsen AL. Loperamide in treatment of irritable bowel syndrome-- a double-blind placebo controlled study. Scand J Gastroenterol Suppl 1987;130:77–80.

183

263 Efskind PS, Bernklev T, Vatn MH. A double-blind placebo-controlled trial with loperamide in irritable bowel syndrome. Scand J Gastroenterol 1996;31:463–8. doi:10.3109/00365529609006766

264 Dunlop SP, Coleman NS, Blackshaw E, et al. Abnormalities of 5-hydroxytryptamine metabolism in irritable bowel syndrome. Clin Gastroenterol Hepatol Off Clin Pract J Am Gastroenterol Assoc 2005;3:349–57.

265 Atkinson W, Lockhart S, Whorwell PJ, et al. Altered 5-hydroxytryptamine signaling in patients with constipation- and diarrhea-predominant irritable bowel syndrome. Gastroenterology 2006;130:34–43. doi:10.1053/j.gastro.2005.09.031

266 Houghton LA, Foster JM, Whorwell PJ. Alosetron, a 5-HT3 receptor antagonist, delays colonic transit in patients with irritable bowel syndrome and healthy volunteers. Aliment Pharmacol Ther 2000;14:775–82.

267 McLaughlin J, Houghton LA. The rationale, efficacy and safety evidence for tegaserod in the treatment of irritable bowel syndrome. Expert Opin Drug Saf 2006;5:313–27. doi:10.1517/14740338.5.2.313

268 Lacy BE, Weiser K, De Lee R. The treatment of irritable bowel syndrome. Ther Adv Gastroenterol 2009;2:221–38. doi:10.1177/1756283X09104794

269 Pimentel M, Chow EJ, Lin HC. Normalization of lactulose breath testing correlates with symptom improvement in irritable bowel syndrome. a double-blind, randomized, placebo- controlled study. Am J Gastroenterol 2003;98:412–9. doi:10.1111/j.1572-0241.2003.07234.x

270 Sen S, Mullan MM, Parker TJ, et al. Effect of Lactobacillus plantarum 299v on colonic fermentation and symptoms of irritable bowel syndrome. Dig Dis Sci 2002;47:2615–20.

271 Kajander K, Hatakka K, Poussa T, et al. A probiotic mixture alleviates symptoms in irritable bowel syndrome patients: a controlled 6-month intervention. Aliment Pharmacol Ther 2005;22:387–94. doi:10.1111/j.1365-2036.2005.02579.x

184

272 Currie MG, Fok KF, Kato J, et al. Guanylin: an endogenous activator of intestinal guanylate cyclase. Proc Natl Acad Sci U S A 1992;89:947–51.

273 Forte LR. Uroguanylin and guanylin peptides: pharmacology and experimental therapeutics. Pharmacol Ther 2004;104:137–62. doi:10.1016/j.pharmthera.2004.08.007

274 Johnston JM, Kurtz CB, Macdougall JE, et al. Linaclotide improves abdominal pain and bowel habits in a phase IIb study of patients with irritable bowel syndrome with constipation. Gastroenterology 2010;139:1877–1886.e2. doi:10.1053/j.gastro.2010.08.041

275 Eutamene H, Bradesi S, Larauche M, et al. Guanylate cyclase C-mediated antinociceptive effects of linaclotide in rodent models of visceral pain. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2010;22:312–e84. doi:10.1111/j.1365-2982.2009.01385.x

276 Spiller RC. Role of infection in irritable bowel syndrome. J Gastroenterol 2007;42 Suppl 17:41–7. doi:10.1007/s00535-006-1925-8

277 Spiller R, Garsed K. Postinfectious irritable bowel syndrome. Gastroenterology 2009;136:1979–88. doi:10.1053/j.gastro.2009.02.074

278 Dupont HL. Gastrointestinal infections and the development of irritable bowel syndrome. Curr Opin Infect Dis 2011;24:503–8. doi:10.1097/QCO.0b013e32834a962d

279 Rodríguez LA, Ruigómez A. Increased risk of irritable bowel syndrome after bacterial gastroenteritis: cohort study. BMJ 1999;318:565–6.

280 Beatty JK, Bhargava A, Buret AG. Post-infectious irritable bowel syndrome: Mechanistic insights into chronic disturbances following enteric infection. World J Gastroenterol WJG 2014;20:3976–85. doi:10.3748/wjg.v20.i14.3976

281 Stark D, van Hal S, Marriott D, et al. Irritable bowel syndrome: a review on the role of intestinal protozoa and the importance of their detection and diagnosis. Int J Parasitol 2007;37:11–20. doi:10.1016/j.ijpara.2006.09.009

185

282 Grover M. Role of gut pathogens in development of irritable bowel syndrome. Indian J Med Res 2014;139:11–8.

283 Akiho H, Deng Y, Blennerhassett P, et al. Mechanisms underlying the maintenance of muscle hypercontractility in a model of postinfective gut dysfunction. Gastroenterology 2005;129:131–41.

284 Khaldi S, Gargala G, Le Goff L, et al. Cryptosporidium parvum isolate-dependent postinfectious jejunal hypersensitivity and mast cell accumulation in an immunocompetent rat model. Infect Immun 2009;77:5163–9. doi:10.1128/IAI.00220-09

285 Kanazawa M, Palsson OS, van Tilburg MAL, et al. Motility response to colonic distention is increased in postinfectious irritable bowel syndrome (PI-IBS). Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2014;26:696–704. doi:10.1111/nmo.12318

286 Thabane M, Marshall JK. Post-infectious irritable bowel syndrome. World J Gastroenterol WJG 2009;15:3591–6.

287 Han W, Wang Z, Lu X, et al. Protease activated receptor 4 status of mast cells in post infectious irritable bowel syndrome. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2012;24:113–119, e82. doi:10.1111/j.1365-2982.2011.01841.x

288 Bhuiyan MR, Majumder TK, Raihan AA, et al. Histopathological alterations in post- infectious irritable bowel syndrome in Bangladeshi population. Mymensingh Med J MMJ 2010;19:275–81.

289 Kim HS, Lim JH, Park H, et al. Increased immunoendocrine cells in intestinal mucosa of postinfectious irritable bowel syndrome patients 3 years after acute Shigella infection--an observation in a small case control study. Yonsei Med J 2010;51:45–51. doi:10.3349/ymj.2010.51.1.45

290 Wheatcroft J, Wakelin D, Smith A, et al. Enterochromaffin cell hyperplasia and decreased serotonin transporter in a mouse model of postinfectious bowel dysfunction.

186

Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2005;17:863–70. doi:10.1111/j.1365-2982.2005.00719.x

291 Gwee K-A, Collins SM, Read NW, et al. Increased rectal mucosal expression of interleukin 1beta in recently acquired post-infectious irritable bowel syndrome. Gut 2003;52:523–6.

292 Choudhury BK, Shi X-Z, Sarna SK. Gene plasticity in colonic circular smooth muscle cells underlies motility dysfunction in a model of postinfective IBS. Am J Physiol Gastrointest Liver Physiol 2009;296:G632–642. doi:10.1152/ajpgi.90673.2008

293 Savioli L, Smith H, Thompson A. Giardia and Cryptosporidium join the ‘Neglected Diseases Initiative’. Trends Parasitol 2006;22:203–8. doi:10.1016/j.pt.2006.02.015

294 World Health Organization. WHO guidelines for drinking water quality launched in 2004. 2004.http://www.who.int/water_sanitation_health/dwq/gdwq3/en/

295 Roxström-Lindquist K, Palm D, Reiner D, et al. Giardia immunity--an update. Trends Parasitol 2006;22:26–31. doi:10.1016/j.pt.2005.11.005

296 Jensen LA, Marlin JW, Dyck DD, et al. Prevalence of multi-gastrointestinal infections with helminth, protozoan and Campylobacter spp. in Guatemalan children. J Infect Dev Ctries 2009;3:229–34.

297 Thompson RCA. Echinococcus, Giardia and Cryptosporidium: observational studies challenging accepted dogma. Parasitology 2009;136:1529–35. doi:10.1017/S0031182009005897

298 Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev 2011;24:110–40. doi:10.1128/CMR.00033-10

299 Buret A, denHollander N, Wallis PM, et al. Zoonotic potential of giardiasis in domestic ruminants. J Infect Dis 1990;162:231–7.

187

300 Solaymani-Mohammadi S, Singer SM. Giardia duodenalis: the double-edged sword of immune responses in giardiasis. Exp Parasitol 2010;126:292–7. doi:10.1016/j.exppara.2010.06.014

301 McDowall RM, Peregrine AS, Leonard EK, et al. Evaluation of the zoonotic potential of Giardia duodenalis in fecal samples from dogs and cats in Ontario. Can Vet J Rev Vét Can 2011;52:1329–33.

302 Cotton JA, Beatty JK, Buret AG. Host parasite interactions and pathophysiology in Giardia infections. Int J Parasitol 2011;41:925–33. doi:10.1016/j.ijpara.2011.05.002

303 Gillon J, Al Thamery D, Ferguson A. Features of small intestinal pathology (epithelial cell kinetics, intraepithelial lymphocytes, disaccharidases) in a primary Giardia muris infection. Gut 1982;23:498–506.

304 Vinayak VK, Khanna R, Kum K. Kinetics of intraepithelium and lamina propria lymphocyte responses during Giardia lamblia infection in mice. Microb Pathog 1991;10:343– 50.

305 Scott KG-E, Yu LCH, Buret AG. Role of CD8+ and CD4+ T lymphocytes in jejunal mucosal injury during murine giardiasis. Infect Immun 2004;72:3536–42. doi:10.1128/IAI.72.6.3536-3542.2004

306 Beatty JK, Akierman S, Rioux K, Beck P, McKnight W, Feener T, Wallace J, Buret A. Gut microbiota biofilm disruptions by Giardia: pathology in human enterocytes and germ-free mice. The FASEB Journal 2013. 131.1.

307 Robertson LJ, Hanevik K, Escobedo AA, et al. Giardiasis--why do the symptoms sometimes never stop? Trends Parasitol 2010;26:75–82. doi:10.1016/j.pt.2009.11.010

308 Buret A, Gall DG, Olson ME. Growth, activities of enzymes in the small intestine, and ultrastructure of microvillous border in gerbils infected with Giardia duodenalis. Parasitol Res 1991;77:109–14.

188

309 Buret AG. Pathophysiology of enteric infections with Giardia duodenalius. Parasite Paris Fr 2008;15:261–5.

310 Chin AC, Teoh DA, Scott KG-E, et al. Strain-dependent induction of enterocyte apoptosis by Giardia lamblia disrupts epithelial barrier function in a caspase-3-dependent manner. Infect Immun 2002;70:3673–80.

311 Troeger H, Epple H-J, Schneider T, et al. Effect of chronic Giardia lamblia infection on epithelial transport and barrier function in human duodenum. Gut 2007;56:328–35. doi:10.1136/gut.2006.100198

312 Koot BGP, ten Kate FJW, Juffrie M, et al. Does Giardia lamblia cause villous atrophy in children?: A retrospective cohort study of the histological abnormalities in giardiasis. J Pediatr Gastroenterol Nutr 2009;49:304–8. doi:10.1097/MPG.0b013e31818de3c4

313 Ankarklev J, Jerlström-Hultqvist J, Ringqvist E, et al. Behind the smile: cell biology and disease mechanisms of Giardia species. Nat Rev Microbiol 2010;8:413–22. doi:10.1038/nrmicro2317

314 Buret AG, Bhargava A. Modulatory mechanisms of enterocyte apoptosis by viral, bacterial and parasitic pathogens. Crit Rev Microbiol 2014;40:1–17. doi:10.3109/1040841X.2012.746952

315 Panaro MA, Cianciulli A, Mitolo V, et al. Caspase-dependent apoptosis of the HCT-8 epithelial cell line induced by the parasite Giardia intestinalis. FEMS Immunol Med Microbiol 2007;51:302–9. doi:10.1111/j.1574-695X.2007.00304.x

316 O’Hara JR, Buret A . Mechanisms of intestinal tight junctional disruption during infection. Front Biosci J Virtual Libr 2008;13:7008–21.

317 Stadelmann B, Merino MC, Persson L, et al. Arginine consumption by the intestinal parasite Giardia intestinalis reduces proliferation of intestinal epithelial cells. PloS One 2012;7:e45325. doi:10.1371/journal.pone.0045325

189

318 Scott KG-E, Meddings JB, Kirk DR, et al. Intestinal infection with Giardia spp. reduces epithelial barrier function in a myosin light chain kinase-dependent fashion. Gastroenterology 2002;123:1179–90.

319 Maia-Brigagão C, Morgado-Díaz JA, De Souza W. Giardia disrupts the arrangement of tight, adherens and desmosomal junction proteins of intestinal cells. Parasitol Int 2012;61:280–7. doi:10.1016/j.parint.2011.11.002

320 Teoh DA, Kamieniecki D, Pang G, et al. Giardia lamblia rearranges F-actin and alpha- actinin in human colonic and duodenal monolayers and reduces transepithelial electrical resistance. J Parasitol 2000;86:800–6. doi:10.1645/0022- 3395(2000)086[0800:GLRFAA]2.0.CO;2

321 Buret AG, Mitchell K, Muench DG, et al. Giardia lamblia disrupts tight junctional ZO-1 and increases permeability in non-transformed human small intestinal epithelial monolayers: effects of epidermal growth factor. Parasitology 2002;125:11–9.

322 Erlandsen SL, Chase DG. Morphological alterations in the microvillous border of villous epithelial cells produced by intestinal microorganisms. Am J Clin Nutr 1974;27:1277–86.

323 Jonas A, Flanagan PR, Forstner GG. Pathogenesis of mucosal injury in the blind loop syndrome. Brush border enzyme activity and glycoprotein degradation. J Clin Invest 1977;60:1321–30. doi:10.1172/JCI108891

324 Torres MF, Uetanabaro AP, Costa AF, et al. Influence of bacteria from the duodenal microbiota of patients with symptomatic giardiasis on the pathogenicity of Giardia duodenalis in gnotoxenic mice. J Med Microbiol 2000;49:209–15.

325 Kohli A, Bushen OY, Pinkerton RC, et al. Giardia duodenalis assemblage, clinical presentation and markers of intestinal inflammation in Brazilian children. Trans R Soc Trop Med Hyg 2008;102:718–25. doi:10.1016/j.trstmh.2008.03.002

326 LoGalbo PR, Sampson HA, Buckley RH. Symptomatic giardiasis in three patients with X-linked agammaglobulinemia. J Pediatr 1982;101:78–80.

190

327 Hacker VL, Stark D, Thomas S. Validation of the stroke aphasic depression questionnaire using the brief assessment schedule depression cards in an acute stroke sample. Br J Clin Psychol Br Psychol Soc 2010;49:123–7. doi:10.1348/014466509X467440

328 Farthing MJ, Mata L, Urrutia JJ, et al. Natural history of Giardia infection of infants and children in rural Guatemala and its impact on physical growth. Am J Clin Nutr 1986;43:395– 405.

329 Berkman DS, Lescano AG, Gilman RH, et al. Effects of stunting, diarrhoeal disease, and parasitic infection during infancy on cognition in late childhood: a follow-up study. Lancet 2002;359:564–71. doi:10.1016/S0140-6736(02)07744-9

330 Niehaus MD, Moore SR, Patrick PD, et al. Early childhood diarrhea is associated with diminished cognitive function 4 to 7 years later in children in a northeast Brazilian shantytown. Am J Trop Med Hyg 2002;66:590–3.

331 Ettehad GH, Daryani A, Nemati A. Effect of Giardia infection on nutritional status in primary schoolchildren, in northwest Iran. Pak J Biol Sci PJBS 2010;13:229–34.

332 Ignatius R, Gahutu JB, Klotz C, et al. High prevalence of Giardia duodenalis Assemblage B infection and association with underweight in Rwandan children. PLoS Negl Trop Dis 2012;6:e1677. doi:10.1371/journal.pntd.0001677

333 Olson ME, McAllister TA, Deselliers L, et al. Effects of giardiasis on production in a domestic ruminant (lamb) model. Am J Vet Res 1995;56:1470–4.

334 Geurden T, Vercruysse J, Claerebout E. Field testing of a fenbendazole treatment combined with hygienic and management measures against a natural Giardia infection in calves. Vet Parasitol 2006;142:367–71. doi:10.1016/j.vetpar.2006.07.019

335 Geurden T, Vandenhoute E, Pohle H, et al. The effect of a fenbendazole treatment on cyst excretion and weight gain in calves experimentally infected with Giardia duodenalis. Vet Parasitol 2010;169:18–23. doi:10.1016/j.vetpar.2009.12.027

191

336 Sweeny JPA, Ryan UM, Robertson ID, et al. Cryptosporidium and Giardia associated with reduced lamb carcase productivity. Vet Parasitol 2011;182:127–39. doi:10.1016/j.vetpar.2011.05.050

337 Cantey PT, Roy S, Lee B, et al. Study of nonoutbreak giardiasis: novel findings and implications for research. Am J Med 2011;124:1175.e1–8. doi:10.1016/j.amjmed.2011.06.012

338 Barraquer I. Sur la coïncidence de la lambliase et de certaines lésions du fond de l’œil. Bulletin de la Société de Pathologie Exotique 1938;:séance du 12 janvier 1938 : 55–58.

339 Pettoello Mantovani M, Giardino I, Magli A, et al. Intestinal giardiasis associated with ophthalmologic changes. J Pediatr Gastroenterol Nutr 1990;11:196–200.

340 Corsi A, Nucci C, Knafelz D, et al. Ocular changes associated with Giardia lamblia infection in children. Br J Ophthalmol 1998;82:59–62.

341 Carlson DW, Finger DR. Beaver fever arthritis. J Clin Rheumatol Pract Rep Rheum Musculoskelet Dis 2004;10:86–8. doi:10.1097/01.rhu.0000120979.11380.16

342 Borman P, Seçkin U, Ozoran K. Beaver fever--a rare cause of reactive arthritis. J Rheumatol 2001;28:683.

343 Hill Gaston JS, Lillicrap MS. Arthritis associated with enteric infection. Best Pract Res Clin Rheumatol 2003;17:219–39.

344 Gaston JS, Cox C, Granfors K. Clinical and experimental evidence for persistent Yersinia infection in reactive arthritis. Arthritis Rheum 1999;42:2239–42. doi:10.1002/1529- 0131(199910)42:10<2239::AID-ANR29>3.0.CO;2-L

345 Giacometti A, Cirioni O, Antonicelli L, et al. Prevalence of intestinal parasites among individuals with allergic skin diseases. J Parasitol 2003;89:490–2. doi:10.1645/0022- 3395(2003)089[0490:POIPAI]2.0.CO;2

346 Di Prisco MC, Hagel I, Lynch NR, et al. Association between giardiasis and allergy. Ann Allergy Asthma Immunol Off Publ Am Coll Allergy Asthma Immunol 1998;81:261–5.

192

347 Hardin JA, Buret AG, Olson ME, et al. Mast cell hyperplasia and increased macromolecular uptake in an animal model of giardiasis. J Parasitol 1997;83:908–12.

348 Pietrzak A, Chodorowska G, Urban J, et al. Cutaneous manifestation of giardiasis - case report. Ann Agric Environ Med AAEM 2005;12:299–303.

349 Nenoff P, Domula E, Willing U, et al. [Giardia lamblia--cause of urticaria and pruritus or accidental association?]. Hautarzt Z Für Dermatol Venerol Verwandte Geb 2006;57:518–20, 521–2. doi:10.1007/s00105-005-0959-9

350 Cervelló A, Alfaro A, Chumillas MJ. Hypokalemic myopathy induced by Giardia lamblia. N Engl J Med 1993;329:210–1. doi:10.1056/NEJM199307153290318

351 Genovese A, Spadaro G, Santoro L, et al. Giardiasis as a cause of hypokalemic myopathy in congenital immunodeficiency. Int J Clin Lab Res 1996;26:132–5.

352 Addiss DG, Lengerich EJ. Hypokalemic myopathy induced by Giardia lamblia. N Engl J Med 1994;330:66–7. doi:10.1056/NEJM199401063300115

353 Araújo NS, Mundim MJS, Gomes MA, et al. Giardia duodenalis: pathological alterations in gerbils, Meriones unguiculatus, infected with different dosages of trophozoites. Exp Parasitol 2008;118:449–57. doi:10.1016/j.exppara.2007.10.007

354 Simsek Z, Zeyrek FY, Kurcer MA. Effect of Giardia infection on growth and psychomotor development of children aged 0-5 years. J Trop Pediatr 2004;50:90–3.

355 Botero-Garcés JH, García-Montoya GM, Grisales-Patiño D, et al. Giardia intestinalis and nutritional status in children participating in the complementary nutrition program, Antioquia, Colombia, May to October 2006. Rev Inst Med Trop São Paulo 2009;51:155–62.

356 Thompson RC, Reynoldson JA, Mendis AH. Giardia and giardiasis. Adv Parasitol 1993;32:71–160.

357 Lengerich EJ, Addiss DG, Juranek DD. Severe giardiasis in the United States. Clin Infect Dis Off Publ Infect Dis Soc Am 1994;18:760–3.

193

358 Koruk I, Simsek Z, Tekin Koruk S, et al. Intestinal parasites, nutritional status and physchomotor development delay in migratory farm worker’s children. Child Care Health Dev 2010;36:888–94. doi:10.1111/j.1365-2214.2010.01126.x

359 Guerrant DI, Moore SR, Lima AA, et al. Association of early childhood diarrhea and cryptosporidiosis with impaired physical fitness and cognitive function four-seven years later in a poor urban community in northeast Brazil. Am J Trop Med Hyg 1999;61:707–13.

360 Veenemans J, Mank T, Ottenhof M, et al. Protection against diarrhea associated with Giardia intestinalis Is lost with multi-nutrient supplementation: a study in Tanzanian children. PLoS Negl Trop Dis 2011;5:e1158. doi:10.1371/journal.pntd.0001158

361 Bergman P, raham J. An approach to ‘failure to thrive’. Aust Fam Physician 2005;34:725–9.

362 Loewenson R, Mason PR, Patterson BA. Giardiasis and the nutritional status of Zimbabwean schoolchildren. Ann Trop Paediatr 1986;6:73–8.

363 Fraser D, Bilenko N, Deckelbaum RJ, et al. Giardia lamblia carriage in Israeli Bedouin infants: risk factors and consequences. Clin Infect Dis Off Publ Infect Dis Soc Am 2000;30:419–24. doi:10.1086/313722

364 Heyman M, Boudraa G, Sarrut S, et al. Macromolecular transport in jejunal mucosa of children with severe malnutrition: a quantitative study. J Pediatr Gastroenterol Nutr 1984;3:357–63.

365 Springer SC, Key JD. Vitamin B12 deficiency and subclinical infection with Giardia lamblia in an adolescent with agammaglobulinemia of Bruton. J Adolesc Health Off Publ Soc Adolesc Med 1997;20:58–61. doi:10.1016/S1054-139X(96)00171-1

366 Olness K. Effects on brain development leading to cognitive impairment: a worldwide epidemic. J Dev Behav Pediatr JDBP 2003;24:120–30.

367 Ajjampur SSR, Koshy B, Venkataramani M, et al. Effect of cryptosporidial and giardial diarrhoea on social maturity, intelligence and physical growth in children in a semi-urban

194

slum in south India. Ann Trop Paediatr 2011;31:205–12. doi:10.1179/1465328111Y.0000000003

368 Celiksöz A, Aciöz M, Değerli S, et al. Effects of giardiasis on school success, weight and height indices of primary school children in Turkey. Pediatr Int Off J Jpn Pediatr Soc 2005;47:567–71. doi:10.1111/j.1442-200x.2005.02110.x

369 Quihui L, Morales GG, Méndez RO, et al. Could giardiasis be a risk factor for low zinc status in schoolchildren from northwestern Mexico? A cross-sectional study with longitudinal follow-up. BMC Public Health 2010;10:85. doi:10.1186/1471-2458-10-85

370 Quihui-Cota L, Méndez Estrada RO, Astiazarán-García H, et al. Changes in serum zinc levels associated with giardiasis and dietary zinc intake in mice. Biol Trace Elem Res 2012;145:396–402. doi:10.1007/s12011-011-9208-5

371 De Deungria M, Rao R, Wobken JD, et al. Perinatal iron deficiency decreases cytochrome c oxidase (CytOx) activity in selected regions of neonatal rat brain. Pediatr Res 2000;48:169–76. doi:10.1203/00006450-200008000-00009

372 Veenemans J, Schouten LRA, Ottenhof MJ, et al. Effect of preventive supplementation with zinc and other micronutrients on non-malarial morbidity in Tanzanian pre-school children: a randomized trial. PloS One 2012;7:e41630. doi:10.1371/journal.pone.0041630

373 Naess H, Nyland M, Hausken T, et al. Chronic fatigue syndrome after Giardia enteritis: clinical characteristics, disability and long-term sickness absence. BMC Gastroenterol 2012;12:13. doi:10.1186/1471-230X-12-13

374 Mørch K, Hanevik K, Rortveit G, et al. Severity of Giardia infection associated with post-infectious fatigue and abdominal symptoms two years after. BMC Infect Dis 2009;9:206. doi:10.1186/1471-2334-9-206

375 Mørch K, Hanevik K, Rortveit G, et al. High rate of fatigue and abdominal symptoms 2 years after an outbreak of giardiasis. Trans R Soc Trop Med Hyg 2009;103:530–2. doi:10.1016/j.trstmh.2009.01.010

195

376 Wood NJ. Infection: Giardia lamblia is associated with an increased risk of both IBS and chronic fatigue that persists for at least 3 years. Nat Rev Gastroenterol Hepatol 2011;8:597. doi:10.1038/nrgastro.2011.176

377 Wensaas K-A, Langeland N, Hanevik K, et al. Irritable bowel syndrome and chronic fatigue 3 years after acute giardiasis: historic cohort study. Gut 2012;61:214–9. doi:10.1136/gutjnl-2011-300220

378 Hanevik K, Kristoffersen EK, Sørnes S, et al. Immunophenotyping in post-giardiasis functional gastrointestinal disease and chronic fatigue syndrome. BMC Infect Dis 2012;12:258. doi:10.1186/1471-2334-12-258

379 Natelson BH, Haghighi MH, Ponzio NM. Evidence for the presence of immune dysfunction in chronic fatigue syndrome. Clin Diagn Lab Immunol 2002;9:747–52.

380 Dizdar V, Gilja OH, Hausken T. Increased visceral sensitivity in Giardia-induced postinfectious irritable bowel syndrome and functional dyspepsia. Effect of the 5HT3- antagonist ondansetron. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2007;19:977–82. doi:10.1111/j.1365-2982.2007.00988.x

381 Hanevik K, Dizdar V, Langeland N, et al. Development of functional gastrointestinal disorders after Giardia lamblia infection. BMC Gastroenterol 2009;9:27. doi:10.1186/1471- 230X-9-27

382 Farthing MJ. Giardiasis. Gastroenterol Clin North Am 1996;25:493–515.

383 D’Anchino M, Orlando D, De Feudis L. iardia lamblia infections become clinically evident by eliciting symptoms of irritable bowel syndrome. J Infect 2002;45:169–72.

384 Grazioli B, Matera G, Laratta C, et al. Giardia lamblia infection in patients with irritable bowel syndrome and dyspepsia: a prospective study. World J Gastroenterol WJG 2006;12:1941–4.

196

385 Hanevik K, Hausken T, Morken MH, et al. Persisting symptoms and duodenal inflammation related to Giardia duodenalis infection. J Infect 2007;55:524–30. doi:10.1016/j.jinf.2007.09.004

386 Dizdar V, Spiller R, Singh G, et al. Relative importance of abnormalities of CCK and 5- HT (serotonin) in Giardia-induced post-infectious irritable bowel syndrome and functional dyspepsia. Aliment Pharmacol Ther 2010;31:883–91. doi:10.1111/j.1365-2036.2010.04251.x

387 Ghoshal UC, Ranjan P. Post-infectious irritable bowel syndrome: the past, the present and the future. J Gastroenterol Hepatol 2011;26 Suppl 3:94–101. doi:10.1111/j.1440- 1746.2011.06643.x

388 Kalischuk LD, Buret AG. A role for Campylobacter jejuni-induced enteritis in inflammatory bowel disease? Am J Physiol Gastrointest Liver Physiol 2010;298:G1–9. doi:10.1152/ajpgi.00193.2009

389 Kurita A, Maguchi H, Takahashi K, et al. Small pancreatic cancer with giardiasis: a case report. Pancreas 2010;39:943–5. doi:10.1097/MPA.0b013e3181d7883c

390 Furukawa M, Lee L, Ikegami T, et al. Giardiasis in the pancreas accompanied by pancreatic cancer. Pancreas 2011;40:168–9. doi:10.1097/MPA.0b013e3181f6a1b9

391 Mitchell CM, Bradford CM, Kapur U. Giardia lamblia trophozoites in an ultrasound- guided fine-needle aspiration of a pancreatic mucinous neoplasm. Diagn Cytopathol 2011;39:352–3. doi:10.1002/dc.21425

392 Nagasaki T, Komatsu H, Shibata Y, et al. [A rare case of gallbladder cancer with giardiasis]. Nihon Shokakibyo Gakkai Zasshi Jpn J Gastro-Enterol 2011;108:275–9.

393 Shaw PK, Brodsky RE, Lyman DO, et al. A communitywide outbreak of giardiasis with evidence of transmission by a municipal water supply. Ann Intern Med 1977;87:426–32.

394 Osterholm MT, Forfang JC, Ristinen TL, et al. An outbreak of foodborne giardiasis. N Engl J Med 1981;304:24–8. doi:10.1056/NEJM198101013040106

197

395 Centers for Disease Control (CDC). Outbreak of diarrheal illness associated with a natural disaster--Utah. MMWR Morb Mortal Wkly Rep 1983;32:662–4.

396 Weniger BG, Blaser MJ, Gedrose J, et al. An outbreak of waterborne giardiasis associated with heavy water runoff due to warm weather and volcanic ashfall. Am J Public Health 1983;73:868–72.

397 Jephcott AE, Begg NT, Baker IA. Outbreak of giardiasis associated with mains water in the United Kingdom. Lancet 1986;1:730–2.

398 Neringer R, Andersson Y, Eitrem R. A water-borne outbreak of giardiasis in Sweden. Scand J Infect Dis 1987;19:85–90.

399 Moorehead WP, Guasparini R, Donovan CA, et al. Giardiasis outbreak from a chlorinated community water supply. Can J Public Health Rev Can Santé Publique 1990;81:358–62.

400 Porter JD, Gaffney C, Heymann D, et al. Food-borne outbreak of Giardia lamblia. Am J Public Health 1990;80:1259–60.

401 Ljungström I, Castor B. Immune response to Giardia lamblia in a water-borne outbreak of giardiasis in Sweden. J Med Microbiol 1992;36:347–52.

402 De Lalla F, Rinaldi E, Santoro D, et al. Outbreak of Entamoeba histolytica and Giardia lamblia infections in travellers returning from the tropics. Infection 1992;20:78–82.

403 Isaac-Renton JL, Lewis LF, Ong CS, et al. A second community outbreak of waterborne giardiasis in Canada and serological investigation of patients. Trans R Soc Trop Med Hyg 1994;88:395–9.

404 Hadjichristodoulou C, Achileas G, Yianis P, et al. Outbreak of giardiasis among English tourists in Crete. Lancet 1998;351:65–6. doi:10.1016/S0140-6736(05)78057-0

405 Ang LH. Outbreak of giardiasis in a daycare nursery. Commun Dis Public Health PHLS 2000;3:212–3.

198

406 Nygård K, Schimmer B, Søbstad Ø, et al. A large community outbreak of waterborne giardiasis-delayed detection in a non-endemic urban area. BMC Public Health 2006;6:141. doi:10.1186/1471-2458-6-141

407 Rimhanen-Finne R, Hänninen M-L, Vuento R, et al. Contaminated water caused the first outbreak of giardiasis in Finland, 2007: a descriptive study. Scand J Infect Dis 2010;42:613–9. doi:10.3109/00365541003774608

408 Daly ER, Roy SJ, Blaney DD, et al. Outbreak of giardiasis associated with a community drinking-water source. Epidemiol Infect 2010;138:491–500. doi:10.1017/S0950268809990744

409 Razzolini MTP, Weir MH, Matte MH, et al. Risk of Giardia infection for drinking water and bathing in a peri-urban area in Sao Paulo, Brazil. Int J Environ Health Res 2011;21:222– 34. doi:10.1080/09603123.2010.533367

410 Cheun H-I, Kim C-H, Cho S-H, et al. The first outbreak of giardiasis with drinking water in Korea. Osong Public Health Res Perspect 2013;4:89–92. doi:10.1016/j.phrp.2013.03.003

411 Heaton KW, O’Donnell LJ, Braddon FE, et al. Symptoms of irritable bowel syndrome in a British urban community: consulters and nonconsulters. Gastroenterology 1992;102:1962– 7.

412 Kettell J, Jones R, Lydeard S. Reasons for consultation in irritable bowel syndrome: symptoms and patient characteristics. Br J Gen Pract J R Coll Gen Pract 1992;42:459–61.

413 Sulaiman IM, Fayer R, Bern C, et al. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg Infect Dis 2003;9:1444–52. doi:10.3201/eid0911.030084

414 Geurden T, Geldhof P, Levecke B, et al. Mixed Giardia duodenalis assemblage A and E infections in calves. Int J Parasitol 2008;38:259–64. doi:10.1016/j.ijpara.2007.07.016

415 Levecke B, Geldhof P, Claerebout E, et al. Molecular characterisation of Giardiaduodenalis in captive non-human primates reveals mixed assemblage A and B

199

infections and novel polymorphisms. Int J Parasitol 2009;39:1595–601. doi:10.1016/j.ijpara.2009.05.013

416 Jawed H, Jamall S, Shah SUA, et al. N-(2-hydroxy phenyl) acetamide produces profound inhibition of c-Fos protein and mRNA expression in the brain of adjuvant-induced arthritic rats. Mol Cell Biochem 2014;387:81–90. doi:10.1007/s11010-013-1873-6

417 Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3:1101–8.

418 McLean PG, Picard C, Garcia-Villar R, et al. Effects of nematode infection on sensitivity to intestinal distension: role of tachykinin NK2 receptors. Eur J Pharmacol 1997;337:279–82.

419 Marion R, Baishanbo A, Gargala G, et al. Transient neonatal Cryptosporidium parvum infection triggers long-term jejunal hypersensitivity to distension in immunocompetent rats. Infect Immun 2006;74:4387–9. doi:10.1128/IAI.02055-05

420 Pimentel M, Chatterjee S, Chang C, et al. A new rat model links two contemporary theories in irritable bowel syndrome. Dig Dis Sci 2008;53:982–9. doi:10.1007/s10620-007- 9977-z

421 Barbara G, Vallance BA, Collins SM. Persistent intestinal neuromuscular dysfunction after acute nematode infection in mice. Gastroenterology 1997;113:1224–32.

422 Bercík P, Wang L, Verdú EF, et al. Visceral hyperalgesia and intestinal dysmotility in a mouse model of postinfective gut dysfunction. Gastroenterology 2004;127:179–87.

423 Venkova K, Greenwood-van Meerveld B. Long-lasting changes in small intestinal transport following the recovery from Trichinella spiralis infection. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2006;18:234–42. doi:10.1111/j.1365-2982.2005.00753.x

424 McLean PG, Picard C, Garcia-Villar R, et al. Role of kinin B1 and B2 receptors and mast cells in post intestinal infection-induced hypersensitivity to distension. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 1998;10:499–508.

200

425 Qin H-Y, Wu JCY, Tong X-D, et al. Systematic review of animal models of post- infectious/post-inflammatory irritable bowel syndrome. J Gastroenterol 2011;46:164–74. doi:10.1007/s00535-010-0321-6

426 Liebregts T, Adam B, Bertel A, et al. Effect of E. coli Nissle 1917 on post-inflammatory visceral sensory function in a rat model. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2005;17:410–4. doi:10.1111/j.1365-2982.2005.00638.x

427 Traub RJ, Tang B, Ji Y, et al. A rat model of chronic postinflammatory visceral pain induced by deoxycholic acid. Gastroenterology 2008;135:2075–83. doi:10.1053/j.gastro.2008.08.051

428 Ness TJ, Gebhart GF. Visceral pain: a review of experimental studies. Pain 1990;41:167– 234.

429 Saleh TM, Connell BJ, Allen GV. Visceral afferent activation-induced changes in sympathetic nerve activity and baroreflex sensitivity. Am J Physiol 1999;276:R1780–1791.

430 Li WM, Suzuki A, Cui KM. Responses of blood pressure and renal sympathetic nerve activity to colorectal distension in anesthetized rats. J Physiol Sci JPS 2006;56:153–6. doi:10.2170/physiolsci.RP001106

431 Buret A, Hardin JA, Olson ME, et al. Pathophysiology of small intestinal malabsorption in gerbils infected with Giardia lamblia. Gastroenterology 1992;103:506–13.

432 Farthing MJ. The molecular pathogenesis of giardiasis. J Pediatr Gastroenterol Nutr 1997;24:79–88.

433 Müller N, von Allmen N. Recent insights into the mucosal reactions associated with Giardia lamblia infections. Int J Parasitol 2005;35:1339–47. doi:10.1016/j.ijpara.2005.07.008

434 Kalischuk LD, Leggett F, Inglis GD. Campylobacter jejuni induces transcytosis of commensal bacteria across the intestinal epithelium through M-like cells. Gut Pathog 2010;2:14. doi:10.1186/1757-4749-2-14

201

435 Romero-Calvo I, Ocón B, Martínez-Moya P, et al. Reversible Ponceau staining as a loading control alternative to actin in Western blots. Anal Biochem 2010;401:318–20. doi:10.1016/j.ab.2010.02.036

436 Bouin M. Hypersensitivity: a complex marker for a complex disease. J Pain Off J Am Pain Soc 2006;7:536–538; discussion 542–543. doi:10.1016/j.jpain.2006.05.002

437 Munakata J, Naliboff B, Harraf F, et al. Repetitive sigmoid stimulation induces rectal hyperalgesia in patients with irritable bowel syndrome. Gastroenterology 1997;112:55–63.

438 Ludidi S, Conchillo JM, Keszthelyi D, et al. Rectal hypersensitivity as hallmark for irritable bowel syndrome: defining the optimal cutoff. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2012;24:729–733, e345–346. doi:10.1111/j.1365-2982.2012.01926.x

439 Fent J, Balázs L, Buzás G, et al. Colonic sensitivity in irritable bowel syndrome and normal subjects according to their hemispheric preference and cognitive style. Integr Physiol Behav Sci Off J Pavlov Soc 1999;34:54–62.

440 Drewes AM, Petersen P, Rössel P, et al. Sensitivity and distensibility of the rectum and sigmoid colon in patients with irritable bowel syndrome. Scand J Gastroenterol 2001;36:827– 32.

441 Kanazawa M, Palsson OS, Thiwan SIM, et al. Contributions of pain sensitivity and colonic motility to IBS symptom severity and predominant bowel habits. Am J Gastroenterol 2008;103:2550–61. doi:10.1111/j.1572-0241.2008.02066.x

442 Evans PR, Bennett EJ, Bak YT, et al. Jejunal sensorimotor dysfunction in irritable bowel syndrome: clinical and psychosocial features. Gastroenterology 1996;110:393–404.

443 Evans PR, Kellow JE. Physiological modulation of jejunal sensitivity in health and in irritable bowel syndrome. Am J Gastroenterol 1998;93:2191–6. doi:10.1111/j.1572- 0241.1998.00534.x

444 Costantini M, Sturniolo GC, Zaninotto G, et al. Altered esophageal pain threshold in irritable bowel syndrome. Dig Dis Sci 1993;38:206–12.

202

445 Trimble KC, Farouk R, Pryde A, et al. Heightened visceral sensation in functional gastrointestinal disease is not site-specific. Evidence for a generalized disorder of gut sensitivity. Dig Dis Sci 1995;40:1607–13.

446 Bouin M, Lupien F, Riberdy M, et al. Intolerance to visceral distension in functional dyspepsia or irritable bowel syndrome: an organ specific defect or a pan intestinal dysregulation? Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2004;16:311–4. doi:10.1111/j.1365-2982.2004.00511.x

447 Larsson M, Arvidsson S, Ekman C, et al. A model for chronic quantitative studies of colorectal sensitivity using balloon distension in conscious mice -- effects of opioid receptor agonists. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2003;15:371–81.

448 Tabosa A, Yamamura Y, Forno ER, et al. A comparative study of the effects of electroacupuncture and moxibustion in the gastrointestinal motility of the rat. Dig Dis Sci 2004;49:602–10.

449 Coutinho SV, Plotsky PM, Sablad M, et al. Neonatal maternal separation alters stress- induced responses to viscerosomatic nociceptive stimuli in rat. Am J Physiol Gastrointest Liver Physiol 2002;282:G307–316. doi:10.1152/ajpgi.00240.2001

450 Gareau MG, Jury J, Yang PC, et al. Neonatal maternal separation causes colonic dysfunction in rat pups including impaired host resistance. Pediatr Res 2006;59:83–8. doi:10.1203/01.pdr.0000190577.62426.45

451 Gareau MG, Jury J, Perdue MH. Neonatal maternal separation of rat pups results in abnormal cholinergic regulation of epithelial permeability. Am J Physiol Gastrointest Liver Physiol 2007;293:G198–203. doi:10.1152/ajpgi.00392.2006

452 Chung EKY, Zhang X, Li Z, et al. Neonatal maternal separation enhances central sensitivity to noxious colorectal distention in rat. Brain Res 2007;1153:68–77. doi:10.1016/j.brainres.2007.03.047

203

453 Barreau F, Salvador-Cartier C, Houdeau E, et al. Long-term alterations of colonic nerve- mast cell interactions induced by neonatal maternal deprivation in rats. Gut 2008;57:582–90. doi:10.1136/gut.2007.126680

454 Van den Wijngaard RM, Klooker TK, Welting O, et al. Essential role for TRPV1 in stress-induced (mast cell-dependent) colonic hypersensitivity in maternally separated rats. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2009;21:1107–e94. doi:10.1111/j.1365-2982.2009.01339.x

455 Tsang SW, Zhao M, Wu J, et al. Nerve growth factor-mediated neuronal plasticity in spinal cord contributes to neonatal maternal separation-induced visceral hypersensitivity in rats. Eur J Pain Lond Engl 2012;16:463–72. doi:10.1016/j.ejpain.2011.07.005

456 Ohtani S, Iwafuchi M, Homma S. Development of the motor activity of the rat gastrointestinal tract by in vitro measurement. Jpn J Physiol 1994;44:501–8.

457 Reeder MM. Radiological diagnosis of giardiasis. Semin Roentgenol 1997;32:291–300.

458 Deselliers LP, Tan DT, Scott RB, et al. Effects of Giardia lamblia infection on gastrointestinal transit and contractility in Mongolian gerbils. Dig Dis Sci 1997;42:2411–9.

459 Andersen YS, Gillin FD, Eckmann L. Adaptive immunity-dependent intestinal hypermotility contributes to host defense against Giardia spp. Infect Immun 2006;74:2473–6. doi:10.1128/IAI.74.4.2473-2476.2006

460 Buret A, Gall DG, Olson ME. Effects of murine giardiasis on growth, intestinal morphology , and disaccharidase activity. J Parasitol 1990;76:403–9.

461 Cevallos A, Carnaby S, James M, et al. Small intestinal injury in a neonatal rat model of giardiasis is strain dependent. Gastroenterology 1995;109:766–73.

462 Ortiz-Lucas M, Saz-Peiró P, Sebastián-Domingo JJ. Irritable bowel syndrome immune hypothesis. Part one: the role of lymphocytes and mast cells. Rev Esp Enfermedades Dig Organo Of Soc Esp Patol Dig 2010;102:637–47.

204

463 Ortiz-Lucas M, Saz-Peiró P, Sebastián-Domingo JJ. Irritable bowel syndrome immune hypothesis. Part two: the role of cytokines. Rev Esp Enfermedades Dig Organo Of Soc Esp Patol Dig 2010;102:711–7.

464 Martínez C, Vicario M, Ramos L, et al. The jejunum of diarrhea-predominant irritable bowel syndrome shows molecular alterations in the tight junction signaling pathway that are associated with mucosal pathobiology and clinical manifestations. Am J Gastroenterol 2012;107:736–46. doi:10.1038/ajg.2011.472

465 Theoharides TC. Mast cells in irritable bowel syndrome and ulcerative colitis: function not numbers is what makes all the difference. Dig Dis Sci 2014;59:897–8. doi:10.1007/s10620-013-2988-z

466 Arévalo F, Aragon V, Montes P, et al. [Increase of intraepithelial lymphocytes in patients with irritable bowel syndrome]. Rev Gastroenterol Perú Órgano Of Soc Gastroenterol Perú 2011;31:315–8.

467 Dewar DH, Ciclitira PJ. Clinical features and diagnosis of celiac disease. Gastroenterology 2005;128:S19–24.

468 Arikan C, Zihni C, Cakir M, et al. Morphometric analysis of small-bowel mucosa in Turkish children with celiac disease and relationship with the clinical presentation and laboratory findings. Dig Dis Sci 2007;52:2133–9. doi:10.1007/s10620-006-9606-2

469 Pohjanen V-M, Kokkonen TS, Arvonen M, et al. Decreased expression of protease inhibitor 9, a granzyme B inhibitor, in celiac disease: a potential mechanism in enterocyte destruction and villous atrophy. Int J Immunopathol Pharmacol 2013;26:897–905.

470 Fernández-Bañares F, Esteve M, Viver JM. Fructose-sorbitol malabsorption. Curr Gastroenterol Rep 2009;11:368–74.

471 Park JH, Rhee P-L, Kim HS, et al. Mucosal mast cell counts correlate with visceral hypersensitivity in patients with diarrhea predominant irritable bowel syndrome. J Gastroenterol Hepatol 2006;21:71–8. doi:10.1111/j.1440-1746.2005.04143.x

205

472 La J-H, Kim T-W, Sung T-S, et al. Role of mucosal mast cells in visceral hypersensitivity in a rat model of irritable bowel syndrome. J Vet Sci 2004;5:319–24.

473 Balestra B, Vicini R, Cremon C, et al. Colonic mucosal mediators from patients with irritable bowel syndrome excite enteric cholinergic motor neurons. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2012;24:1118–e570. doi:10.1111/nmo.12000

474 Sohn W, Lee OY, Lee SP, et al. Mast cell number, substance P and vasoactive intestinal peptide in irritable bowel syndrome with diarrhea. Scand J Gastroenterol 2014;49:43–51. doi:10.3109/00365521.2013.857712

475 Morgan JI, Curran T. Inducible proto-oncogenes of the nervous system: their contribution to transcription factors and neuroplasticity. Prog Brain Res 1990;86:287–94.

476 Hughes P, Dragunow M. Induction of immediate-early genes and the control of neurotransmitter-regulated gene expression within the nervous system. Pharmacol Rev 1995;47:133–78.

477 Herrera DG, Robertson HA. Activation of c-fos in the brain. Prog Neurobiol 1996;50:83– 107.

478 Levy D, Kainz V, Burstein R, et al. Mast cell degranulation distinctly activates trigemino-cervical and lumbosacral pain pathways and elicits widespread tactile pain hypersensitivity. Brain Behav Immun 2012;26:311–7. doi:10.1016/j.bbi.2011.09.016

479 Flint HJ, Scott KP, Louis P, et al. The role of the gut microbiota in nutrition and health. Nat Rev Gastroenterol Hepatol 2012;9:577–89. doi:10.1038/nrgastro.2012.156

480 Macfarlane GT, Macfarlane S. Bacteria, colonic fermentation, and gastrointestinal health. J AOAC Int 2012;95:50–60.

481 Natividad JMM, Verdu EF. Modulation of intestinal barrier by intestinal microbiota: pathological and therapeutic implications. Pharmacol Res Off J Ital Pharmacol Soc 2013;69:42–51. doi:10.1016/j.phrs.2012.10.007

206

482 Nicholson JK, Holmes E, Kinross J, et al. Host-gut microbiota metabolic interactions. Science 2012;336:1262–7. doi:10.1126/science.1223813

483 Collins SM. A role for the gut microbiota in IBS. Nat Rev Gastroenterol Hepatol Published Online First: 22 April 2014. doi:10.1038/nrgastro.2014.40

484 Verdu EF. Differences in intestinal microbial composition in children with IBS-what does it all mean? Am J Gastroenterol 2012;107:1752–4. doi:10.1038/ajg.2012.291

485 Chassard C, Dapoigny M, Scott KP, et al. Functional dysbiosis within the gut microbiota of patients with constipated-irritable bowel syndrome. Aliment Pharmacol Ther 2012;35:828– 38. doi:10.1111/j.1365-2036.2012.05007.x

486 Duboc H, Rainteau D, Rajca S, et al. Increase in fecal primary bile acids and dysbiosis in patients with diarrhea-predominant irritable bowel syndrome. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2012;24:513–520, e246–247. doi:10.1111/j.1365- 2982.2012.01893.x

487 Simrén M. IBS with intestinal microbial dysbiosis: a new and clinically relevant subgroup? Gut Published Online First: 25 February 2014. doi:10.1136/gutjnl-2013-306434

488 Posserud I, Stotzer P-O, Björnsson ES, et al. Small intestinal bacterial overgrowth in patients with irritable bowel syndrome. Gut 2007;56:802–8. doi:10.1136/gut.2006.108712

489 Jalanka-Tuovinen J, Salojärvi J, Salonen A, et al. Faecal microbiota composition and host-microbe cross-talk following gastroenteritis and in postinfectious irritable bowel syndrome. Gut Published Online First: 5 December 2013. doi:10.1136/gutjnl-2013-305994

490 Piche T, Barbara G, Aubert P, et al. Impaired intestinal barrier integrity in the colon of patients with irritable bowel syndrome: involvement of soluble mediators. Gut 2009;58:196– 201. doi:10.1136/gut.2007.140806

491 Martínez C, González-Castro A, Vicario M, et al. Cellular and molecular basis of intestinal barrier dysfunction in the irritable bowel syndrome. Gut Liver 2012;6:305–15. doi:10.5009/gnl.2012.6.3.305

207

492 Chen T-L, Chen S, Wu H-W, et al. Persistent gut barrier damage and commensal bacterial influx following eradication of Giardia infection in mice. Gut Pathog 2013;5:26. doi:10.1186/1757-4749-5-26

493 Png CW, Lindén SK, Gilshenan KS, et al. Mucolytic bacteria with increased prevalence in IBD mucosa augment in vitro utilization of mucin by other bacteria. Am J Gastroenterol 2010;105:2420–8. doi:10.1038/ajg.2010.281

494 Crost EH, Tailford LE, Le Gall G, et al. Utilisation of Mucin Glycans by the Human Gut Symbiont Ruminococcus gnavus Is Strain-Dependent. PLoS ONE 2013;8:e76341. doi:10.1371/journal.pone.0076341

495 Moncada D, Keller K, Chadee K. Entamoeba histolytica-secreted products degrade colonic mucin oligosaccharides. Infect Immun 2005;73:3790–3. doi:10.1128/IAI.73.6.3790- 3793.2005

496 Lidell ME, Moncada DM, Chadee K, et al. Entamoeba histolytica cysteine proteases cleave the MUC2 mucin in its C-terminal domain and dissolve the protective colonic mucus gel. Proc Natl Acad Sci U S A 2006;103:9298–303. doi:10.1073/pnas.0600623103

497 Motta JP, Flannigan KL, Agbor TA, Beatty JK, Blacker RW, Workentine ML, Da Silva GJ, Wang R, Buret AG, Wallace JL. Hydrogen sulfide protects from colitis and restores intestinal microbiota biofilm and mucus production. 2014.

498 Cummins AG, Steele TW, LaBrooy JT, et al. Maturation of the rat small intestine at weaning: changes in epithelial cell kinetics, bacterial flora, and mucosal immune activity. Gut 1988;29:1672–9. doi:10.1136/gut.29.12.1672

499 Clarke RM. The effects of age on mucosal morphology and epithelial cell production in rat small intestine. J Anat 1977;123:805–11.

500 Cheng H, Bjerknes M. Whole population cell kinetics and postnatal development of the mouse intestinal epithelium. Anat Rec 1985;211:420–6. doi:10.1002/ar.1092110408

208

501 Smith HW. The development of the flora of the alimentary tract in young animals. J Pathol Bacteriol 1965;90:495–513.

502 Dunlop SP, Hebden J, Campbell E, et al. Abnormal intestinal permeability in subgroups of diarrhea-predominant irritable bowel syndromes. Am J Gastroenterol 2006;101:1288–94. doi:10.1111/j.1572-0241.2006.00672.x

503 Shulman RJ, Eakin MN, Czyzewski DI, et al. Increased gastrointestinal permeability and gut inflammation in children with functional abdominal pain and irritable bowel syndrome. J Pediatr 2008;153:646–50. doi:10.1016/j.jpeds.2008.04.062

504 Zhou Q, Zhang B, Verne GN. Intestinal membrane permeability and hypersensitivity in the irritable bowel syndrome. Pain 2009;146:41–6. doi:10.1016/j.pain.2009.06.017

505 Lee JW, Park JH, Park DIL, et al. Subjects with diarrhea-predominant IBS have increased rectal permeability responsive to tryptase. Dig Dis Sci 2010;55:2922–8. doi:10.1007/s10620-009-1094-8

506 Gecse K, Róka R, Séra T, et al. Leaky gut in patients with diarrhea-predominant irritable bowel syndrome and inactive ulcerative colitis. Digestion 2012;85:40–6. doi:10.1159/000333083

507 Turcotte J-F, Kao D, Mah SJ, et al. Breaks in the wall: increased gaps in the intestinal epithelium of irritable bowel syndrome patients identified by confocal laser endomicroscopy (with videos). Gastrointest Endosc 2013;77:624–30. doi:10.1016/j.gie.2012.11.006

508 Shulman RJ, Jarrett ME, Cain KC, et al. Associations among gut permeability, inflammatory markers, and symptoms in patients with irritable bowel syndrome. J Gastroenterol Published Online First: 17 January 2014. doi:10.1007/s00535-013-0919-6

509 Piche T. Tight junctions and IBS--the link between epithelial permeability, low-grade inflammation, and symptom generation? Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2014;26:296–302. doi:10.1111/nmo.12315

209

510 Goto R, Panter-Brick C, Northrop-Clewes CA, et al. Poor intestinal permeability in mildly stunted Nepali children: associations with weaning practices and Giardia lamblia infection. Br J Nutr 2002;88:141–9.

511 Campbell DI, McPhail G, Lunn PG, et al. Intestinal inflammation measured by fecal neopterin in Gambian children with enteropathy: association with growth failure, Giardia lamblia, and intestinal permeability. J Pediatr Gastroenterol Nutr 2004;39:153–7.

512 Buret AG. Mechanisms of epithelial dysfunction in giardiasis. Gut 2007;56:316–7. doi:10.1136/gut.2006.107771

513 Coëffier M, Gloro R, Boukhettala N, et al. Increased proteasome-mediated degradation of occludin in irritable bowel syndrome. Am J Gastroenterol 2010;105:1181–8. doi:10.1038/ajg.2009.700

514 Bertiaux-Vandaële N, Youmba SB, Belmonte L, et al. The expression and the cellular distribution of the tight junction proteins are altered in irritable bowel syndrome patients with differences according to the disease subtype. Am J Gastroenterol 2011;106:2165–73. doi:10.1038/ajg.2011.257

515 Camilleri M, Lasch K, Zhou W. Irritable bowel syndrome: methods, mechanisms, and pathophysiology. The confluence of increased permeability, inflammation, and pain in irritable bowel syndrome. Am J Physiol Gastrointest Liver Physiol 2012;303:G775–785. doi:10.1152/ajpgi.00155.2012

516 Annaházi A, Ferrier L, Bézirard V, et al. Luminal cysteine-proteases degrade colonic tight junction structure and are responsible for abdominal pain in constipation-predominant IBS. Am J Gastroenterol 2013;108:1322–31. doi:10.1038/ajg.2013.152

517 Wilcz-Villega EM, McClean S, O’Sullivan MA. Mast cell tryptase reduces junctional adhesion molecule-A (JAM-A) expression in intestinal epithelial cells: implications for the mechanisms of barrier dysfunction in irritable bowel syndrome. Am J Gastroenterol 2013;108:1140–51. doi:10.1038/ajg.2013.92

210

518 Wilcz-Villega E, McClean S, O’Sullivan M. Reduced E-cadherin expression is associated with abdominal pain and symptom duration in a study of alternating and diarrhea predominant IBS. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2014;26:316–25. doi:10.1111/nmo.12262

519 Koh WH, Geurden T, Paget T, et al. Giardia duodenalis assemblage-specific induction of apoptosis and tight junction disruption in human intestinal epithelial cells: effects of mixed infections. J Parasitol 2013;99:353–8. doi:10.1645/GE-3021.1

520 Humen MA, Pérez PF, Liévin-Le Moal V. Lipid raft-dependent adhesion of Giardia intestinalis trophozoites to a cultured human enterocyte-like Caco-2/TC7 cell monolayer leads to cytoskeleton-dependent functional injuries. Cell Microbiol 2011;13:1683–702. doi:10.1111/j.1462-5822.2011.01647.x

521 Vicario M, Martínez C, Santos J. Role of microRNA in IBS with increased gut permeability. Gut 2010;59:710–2. doi:10.1136/gut.2009.203695

522 Zhou Q, Souba WW, Croce CM, et al. MicroRNA-29a regulates intestinal membrane permeability in patients with irritable bowel syndrome. Gut 2010;59:775–84. doi:10.1136/gut.2009.181834

523 Gecse K, Róka R, Ferrier L, et al. Increased faecal serine protease activity in diarrhoeic IBS patients: a colonic lumenal factor impairing colonic permeability and sensitivity. Gut 2008;57:591–9. doi:10.1136/gut.2007.140210

524 Róka R, Ait-Belgnaoui A, Salvador-Cartier C, et al. Dexamethasone prevents visceral hyperalgesia but not colonic permeability increase induced by luminal protease-activated receptor-2 agonist in rats. Gut 2007;56:1072–8. doi:10.1136/gut.2006.115352

525 Róka R, Demaude J, Cenac N, et al. Colonic luminal proteases activate colonocyte proteinase-activated receptor-2 and regulate paracellular permeability in mice. Neurogastroenterol Motil Off J Eur Gastrointest Motil Soc 2007;19:57–65. doi:10.1111/j.1365-2982.2006.00851.x

211

526 Lee H, Park JH, Park DI, et al. Mucosal mast cell count is associated with intestinal permeability in patients with diarrhea predominant irritable bowel syndrome. J Neurogastroenterol Motil 2013;19:244–50. doi:10.5056/jnm.2013.19.2.244

527 Cotton JA, Bhargava A, Ferraz JG, et al. Giardia duodenalis cathepsin B proteases degrade intestinal epithelial interleukin-8 and attenuate interleukin-8-induced neutrophil chemotaxis. Infect Immun Published Online First: 14 April 2014. doi:10.1128/IAI.01771-14

528 Frank CF, Hostetter MK. Cleavage of E-cadherin: a mechanism for disruption of the intestinal epithelial barrier by Candida albicans. Transl Res J Lab Clin Med 2007;149:211–22. doi:10.1016/j.trsl.2006.11.006

529 Wu S, Rhee K-J, Zhang M, et al. Bacteroides fragilis toxin stimulates intestinal epithelial cell shedding and gamma-secretase-dependent E-cadherin cleavage. J Cell Sci 2007;120:1944–52. doi:10.1242/jcs.03455

530 Reti K, Tymensen L, Buret A. Campylobacter jejuni induces virulence in non-invasive commensal Escherichia coli: new mechanism for post-infectious intestinal inflammation. Toronto, ON: 2014.

531 Halliez MCM, Buret AG. Extra-intestinal and long term consequences of Giardia duodenalis infections. World J Gastroenterol WJG 2013;19:8974–85. doi:10.3748/wjg.v19.i47.8974

212

7. Appendices

Appendix I: TYI-S-33 Giardia culture media

Dry ingredients:

 30 g/L BBL biosate peptone (Becton Dickinson)

 10 g/L glucose

 2 g/L NaCl

 0.6 g/L KH2PO4

 1.0 g/L K2HPO4

 2.0 g/L L-cysteine

 0.2 g/L ascorbic acid

 0.8 g/L bovine bile

1/- Add dry ingredients to 870 mL of distilled water

2/- Add 500 µL of 0.5% ferric ammonium citrate solution

3/- Adjust pH to 6.8

4/- Filter sterilize the solution using 1L filter units (Nalgene®, Rapid-flowTM 90 mm, 0.2 µm filter units)

5/- Under aseptic conditions add:

 108 mL of Heat Inactivated FBS (Gibco)

 30 mL of MEM vitamin solution (Gibco)

 10 mL of Penicillin/Streptomycin (100U/mL penicillin, 100U/mL streptomycin; Gibco)

6/- Aliquot 14 mL of media in 15 mL polystyrene tubes

213