POPULATION STRUCTURE OF THE BLACK-LIP PEARL OYSTER (PINCTADA MARGARITIFERA) Candace Martin
Introduction The Black-lip pearl oyster (Pinctada margaritifera) is a marine bivalve stocks from these centrally located hatcheries. The farm and the hatch- mollusk native to the Indo-PaciÞc. Their natural habitat are the lagoons ery can be very distant from one another, resulting in stock transfers and shallow coastal areas of the region. In the adult phase, they attach between distant populations. During the culture of these farm raised themselves by byssal threads to their rocky habitat and can be found oysters, they spawn in the lagoons and can genetically contaminate the from 1 to 40 meters in depth (Wada 1991). These adults are broad- wildstocks in the farm area. cast spawners, and as such, the females release millions of eggs into In the Republic of the Marshall Islands (RMI) and the Federated the water column to mix randomly with the sperm of males. Upon ex- States of Micronesia (FSM), farmers and marine ofÞcials want to know ternal fertilization, the eggs develop into free-swimming larvae. After if these characteristics are directly related to speciÞc populations and if approximately a month, these larvae attach themselves to the substrate so, how best to manage the farm stocks so as not to interfere with wild and metamorphose into small juvenile oysters (known as ÒspatÓ). Each stocks. In general, pearls from Majuro lagoon (RMI) are a silver-gray in oyster begins its life as a male. After a few years, they undergo an- color, while pearls from the island of Nukuoro in the FSM are more of a other transformation which leaves them sexually female (Ellis and Haws blue-green hue (Maria Haws, pers. comm.). If these various morpholo- 1999). The lifespan of these organisms can be as long as 60 years. gies can be attributed solely to genetic differences between populations, The Black-Lip pearl oyster has been valued by people in the Indo- and these characteristics are to be maintained in their separate popula- PaciÞc region for centuries. Its shell was used for making jewelry, deco- tions, then it will be necessary to operate hatcheries in a manner which rations, and tools, such as Þsh hooks and knives (Ellis and Haws 1999). addresses these issues. Upon contact with the Òwestern worldÓ, demand for the shell increased. My project has addressed this issue directly, by asking how closely Westerners found the shell useful for buttons and decorative inlays and related geographically distant populations are. We will look at various as a result, the oyster was severely over-harvested in several areas of the individuals from different locations in RMI, FSM, and the Hawaiian region. Later, the dark iridescent pearl produced by these oysters also Islands to determine if there are genetically distinct local strains, how became a desired jewelry item. much if any gene ßow is occurring between these geographically sepa- Naturally formed pearls are a result of a small foreign object that rated populations, and what effect the cultured oyster stocks may have becomes lodged in the mantle tissue, usually a grain of sand or small on these wild populations . The answer to these questions will pro- rock. The oyster attempts to rid itself of the irritant by coating it with the vide a basis for further inquiry into the population structure of Pinctada iridescent nacre found on the inside of its shell. The result is a naturally margaritifera (P. margaritifera) and provide much needed information to formed pearl. These pearls are very rare, only about 1 in 2000 oysters stakeholders allowing them to make more informed decisions regarding will have one (Ellis and Haws 1999). management of this species. As time progressed, the likelihood of Þnding an oyster with a sizable pearl decreased. Methods were soon developed for culturing Methodology pearls. The popularity of this Òblack pearlÓ as a jewelry item has driven This project utilizes two molecular methods for investigating the ques- the development of culture methods for this organism. Pearl-farming tion proposed. The Þrst method is sequencing of the mitochondrial gene is currently becoming a major industry in developing island nations of responsible for cytochrome oxidase C subunit 1 (CO1). Because se- the PaciÞc. lective pressure on this gene is low, it is subject to a consistent, high In the past, a pearl could be associated with the area from which mutation rate. We can gauge the genetic distance between individuals it grew based on its color, luster, iridescence and shape. This was true by summing the number of mutations they share. In this way we work of the Tahitian black pearls of twenty years ago (Benzi and Ballment, backwards to show the evolutionary path between populations. 1994). In the present, it is difÞcult to differentiate between pearls grown The second method is AmpliÞed Fragment Length Polymorphism in different lagoons in Tahiti. This is believed to be due to massive stock (AFLP). This method employs restriction enzymes to splice the entire transfers between the various islands (Benzie and Ballment, 1994). genome into fragments. These fragments are then sorted according to Current hatchery operations collect broodstock or spat from geo- length. Analysis of the individuals sharing these same size fragments graphic localities close to the hatchery. Farms purchase their culture can reveal relationships between them. 27 DNA Extractions Automated DNA sequencing is performed in the LI-COR Gene Genomic DNA was extracted from adductor and mantle tissues of P. Reader 4200 (NEN). A 5.5% acrylamide gel of 0.25mm in thickness margaritifera using QiagenÕs DNeasy tissue kit¨ following the manu- and 41cm in length is used. The wells are loaded with 1.5L of product facturerÕs suggested Òanimal tissue protocolÓ with a modiÞcation to al- and the machine is set to run for 9 hours. low an overnight initial cell lyses. The expectation being that the longer digestion period would produce more products. AFLP experiments Extraction products were checked for quantity and quality using Digestion/Ligation a 0.9% agarose gel electrophoresis. This gel gives an indication of the The intact chromosomes of genomic DNA were digested using the re- yield obtained from the extraction and can also give an indication of the striction enzymes EcoR1 and Pst1. T4 DNA ligase was used to attach quality of the products obtained. For example, if the DNA is sheared the double stranded adaptors for EcoR1 and Pst1. This was carried out (broken into incomplete lengths), the bands will appear smeared. This is in a total reaction volume of 20L consisting of; 2.0L of 10x React 2 a result of the different lengths (and therefore different masses) of DNA buffer, 0.5L BSA, 1.0L EcoR1, 1.0L Pst1, 4.4L Þltered water, 1.0L migrating through the gel to various distances from the well. If the T4 DNA ligase, 0.1L ATP, 1.0L double stranded EcoR1 adaptor, 2.0L bands are tight without smearing, this indicates a yield of good product double stranded Pst1 adaptor, and 6.0L DNA template. This reaction is or at least pieces of DNA that are fairly uniform in length. allowed to incubate in a water bath at 37¡C overnight. This process selectively cuts double-stranded DNA at enzyme spe- Sequencing experiments ciÞc loci along the genome. The EcoR1 enzyme cuts at the sequence Polymerase Chain Reaction (PCR) GAATTC and the Pst1 enzyme cuts at the sequence CTGCAG. The AmpliÞcation of the mitochondrial gene, cytochrome c oxidase subunit resulting products are various lengths of DNA with known sequences 1 (CO1), was performed in a PTC-100 Programmable Thermal Con- at each end. troller DNA ampliÞer. This 708bp product was obtained using primers HCO1490 (GTTCAACAAATCATAAAGATATTGG) and LCO2198 Pre-AmpliÞcation (TAAACTTCAGGGTGACCAAAAAATCA). A cocktail with a 28µL The Þrst ampliÞcation of genomic DNA is done using a cocktail of total reaction volume was mixed as follows; 2.5L 10x Buffer, 2.8L 25L total reaction volume consisting of; 2.5L MgCl2 (25mM), 2.5L 10x buffer, 2.0L dNTPs (2.5mM), 0.5L Taq, 1.0L EcoR1+A primer, MgCl2 (25mM), 2.5L dNTPs (2.5mM), 0.2L BSA, 1.5L of each primer, 13.25L of Þltered water, 3.0L of DNA template, and 0.25L 1.0L Pst 1+A primer, 13.5L Þltered water, and 2.0L DNA template. of TAQ. This process will only allow the ampliÞcation of products which have a Samples were heated at 95¡C for 3 minutes followed by 35 cycles nucleotide base A next to the priming site. This is because these primers of; denaturation at 95¡C for 30 sec., annealing at 42¡C for 30 sec., and only recognize the adaptor sequence plus the nucleotide base A. The extension at 72¡C for 1 min. with a Þnal extension at 72¡C for 3 min. result will be a decrease in the amount of products, which is necessary because we will have too much DNA to get a clear signal during the Þnal Isolation and Gene Clean AFLP gel run. AmpliÞcation products were isolated using a 0.9% agarose gel. The tar- This reaction is processed in a MJ Research PTC-100 Program- get bands were excised from the gel and the Gene Clean (removal of mable Thermal Controller DNA ampliÞer. the agarose) was performed using QiagenÕs QIA quick PCR puriÞcation The Pre-Amp products are checked for quality using gel electro- kit¨, according to manufacturers suggested protocol. The gene clean phoresis. Unlike the extraction gel, a high quality product will appear as products are checked for quantity and quality again using gel electro- a bright long smear across the gel. This indicates many DNA products phoresis. of varying lengths. The longer the smear is, the greater variation in length you have. Sequencing Sequencing of the CO1 gene was conducted with the Thermo Seque- Selective AmpliÞcation nase Cycle Sequencing Kit (USB) using the ßuorescently labeled primer The selective ampliÞcation step is performed using a cocktail of 10L to-
LCO21490 (GGTCAACAAATCATAAAGATATTGG). A cocktail with tal reaction volume consisting of; 1.0L 10x buffer, 1.0L MgCl2 (25mM), an 18L total reaction volume was mixed as follows; 2.0 L sequenase 0.8L dNTPs (2.5mM), 1.0L EcoR1 AGA labeled primer, 1.0L Pst 1 buffer, 1.5L dNTPs (2.5mM), 1.25L labeled primer, 8.0L DNA tem- AGG primer, 0.2L Taq, 3.0L Þltered water, and 2.0L DNA template. plate, 0.5L BSA, 2.0L thermo-sequenase, 2.75L Þltered water. Then This step will further reduce the amount of products by selectively prim- 4.0L of cocktail is aliquoted into each of four tubes. After which 4.0L ing only those pieces of DNA that contain the adaptor sequence plus 3 of ddGTP is added to tube #1. The same amount of ddATP, ddTTP, and speciÞc nucleotide bases. ddCTP are successively added to the remaining tubes (one per tube). This reaction is also processed in a MJ Research PTC-100 Pro- This produces a controlled interruption of the polymerase replication. grammable Thermal Controller DNA ampliÞer. These dideoxy nucleotides are used during replication in place of nor- mal nucleotides. During successive replications, they will not allow AFLP acrylamide gel the continued replication of the strand and result in products of varying The selective ampliÞcation products are denatured for 3 minutes. AFLP lengths. For example, all products from tube #1 will end in the base is conducted in the LI-COR Gene Reader 4200 (NEN) using a 6.5% G. When sequenced on an acrylamide gel, these products will sort ac- acrylamide gel with a thickness of 0.25mm and a length of 23cm. The cording to size. By running the products of all four tubes on the same wells are loaded with 1.5L of product and the machine is set to run for gel you can determine the sequence of the gene because the migration 5 hours. through the gel is determined by the length of the piece of DNA. AmpliÞcation of these sequence reactions is processed in a MJ Re- search PTC-100 Programmable Thermal Controller DNA ampliÞer. 28 Sample Collection Various parameters were used to analyze the relationships between Samples were obtained through the efforts of Simon Ellis, Maria Haws, these individuals. One method forced the Tahiti sample as an outgroup. and Matang Ueanimatang. Seven samples were obtained from Majuro However, the results were the same. The samples from Majuro cluster Lagoon in the Republic of the Marshall Islands (denoted M1-M7). Two together, which shows they share some genetic commonality. However, samples were obtained from both Chuuk and Pohnpei in the Federated the supposition was that the Tahiti sample would be genetically distant States of Micronesia (denoted C1, C2, D1, & D2 respectively). One from all the other samples. This is not necessarily the case. What we sample was obtained from Tahiti (denoted T1). see is that one of the samples from Chuuk is clustering relatively close to the Tahiti sample. This could be representative of Tahitian stock which Preliminary Results and Discussion has been transferred to Chuuk, making it appear as if the Chuuk oysters are similar to Tahitian oysters. It should be noted that samples M5-M7 are tissues obtained from the gut The other Chuuk sample and the Pohnpei samples are clustering region of the organism and as such may contain foreign DNA fragments. closer to the Majuro samples, which could indicate they are more close- These samples are being omitted from future sample sets. ly related to the Majuro samples. However, this is probably more likely due to the small sample size obtained from these areas. Only 2 samples Sequencing Experiment were collected from each of these sites, which is far too small a sample To date we have accumulated incomplete sequencing data on 5 of 12 size to be representative of the local populations in these areas. Analysis individuals. These are in the process of being aligned and reviewed for of more samples from these areas may reveal a more distinctive cluster- population information. The remaining samples are being processed for ing of these areas. sequence. In the near future we hope to have sequence for all samples obtained. Conclusion The preliminary results show some localized genetic differences among AFLP Experiment the 4 observed populations. However, the small sample size of the Ta- We ran a total of 4 successful gels, each using 3 primer pairs. Each set hiti, Chuuk, and Pohnpei sample sets, provide little baseline information of primer pairs revealed approximately 25-50 polymorphisms between for these areas. individuals of the set. This is a fairly large number and is representative The omission of sequencing data has contributed to the lack of data of some diversity within the population. for in-depth analysis. With future sequencing data, Þrmer conclusions The gels were hand scored and converted to binary code. Data was may be drawn. input to the PAUP program and visualized using Treeview. The follow- It is quite obvious that more samples from each area are needed. ing are the best Þt trees for the 10 samples available: With the information gained from these sites, greater conclusions can be drawn. SufÞce it to say that in the interim, some local genetic clustering is observed. It may be a result of local strains, but it may also be a result of small sample sets. With the continuance of this project throughout the next year, more samples will be obtained and these answers may be revealed.
Acknowledgements This student research was conducted under the direction of Dr. Cedric C. Muir, Visiting Assistant Professor of Biology at the University of Ha- waii at Hilo, and Dr. Teresa Lewis, Assistant Researcher at the Hawaii Institute of Marine Biology, as part of the UH-Hilo Research Experience for Undergraduates in Tropical Conservation Biology, a program funded by the National Science Foundation (NSF) aimed at increasing research opportunities for undergraduates. Figure 1: Relationship tree for Tahiti, Chuuk, Pohnpei, and Þve of the Majuro
References Benzie, J.A.H., and Ballment, E. 1994. Genetic differences among black-lipped pearl oyster (Pinctada margaritifera) populations in the western PaciÞc. Aquaculture 127:145-156.
Ellis, S. and Haws, M. 1999. Producing pearls using the Black-lip Pearl Oyster (Pinctada margaritifera). Center for Tropical and Subtropical Aquaculture Publication Number 141.
Wada, K.T. 1991. The Pearl Oyster, Pinctada Fucata (Gould) (Family Pteriidae). Chapter 18 In: Estuarine and marine bivalve mollusk culture / editor, Winston Menzel. CRC Press: Boca Raton, FL. Figure 2: Distance Relationship. Each horizontal length compares to the genetic distance between individuals. 29