• Abstract and Figures
• Public Full-text

POPULATION STRUCTURE OF THE BLACK-LIP PEARL OYSTER (PINCTADA MARGARITIFERA) Candace Martin Introduction The Black-lip pearl oyster (Pinctada margaritifera) is a marine bivalve stocks from these centrally located hatcheries. The farm and the hatch- mollusk native to the Indo-PaciÞc. Their natural habitat are the lagoons ery can be very distant from one another, resulting in stock transfers and shallow coastal areas of the region. In the adult phase, they attach between distant populations. During the culture of these farm raised themselves by byssal threads to their rocky habitat and can be found oysters, they spawn in the lagoons and can genetically contaminate the from 1 to 40 meters in depth (Wada 1991). These adults are broad- wildstocks in the farm area. cast spawners, and as such, the females release millions of eggs into In the Republic of the Marshall Islands (RMI) and the Federated the water column to mix randomly with the sperm of males. Upon ex- States of Micronesia (FSM), farmers and marine ofÞcials want to know ternal fertilization, the eggs develop into free-swimming larvae. After if these characteristics are directly related to speciÞc populations and if approximately a month, these larvae attach themselves to the substrate so, how best to manage the farm stocks so as not to interfere with wild and metamorphose into small juvenile oysters (known as ÒspatÓ). Each stocks. In general, pearls from Majuro lagoon (RMI) are a silver-gray in oyster begins its life as a male. After a few years, they undergo an- color, while pearls from the island of Nukuoro in the FSM are more of a other transformation which leaves them sexually female (Ellis and Haws blue-green hue (Maria Haws, pers. comm.). If these various morpholo- 1999). The lifespan of these organisms can be as long as 60 years. gies can be attributed solely to genetic differences between populations, The Black-Lip pearl oyster has been valued by people in the Indo- and these characteristics are to be maintained in their separate popula- PaciÞc region for centuries. Its shell was used for making jewelry, deco- tions, then it will be necessary to operate hatcheries in a manner which rations, and tools, such as Þsh hooks and knives (Ellis and Haws 1999). addresses these issues. Upon contact with the Òwestern worldÓ, demand for the shell increased. My project has addressed this issue directly, by asking how closely Westerners found the shell useful for buttons and decorative inlays and related geographically distant populations are. We will look at various as a result, the oyster was severely over-harvested in several areas of the individuals from different locations in RMI, FSM, and the Hawaiian region. Later, the dark iridescent pearl produced by these oysters also Islands to determine if there are genetically distinct local strains, how became a desired jewelry item. much if any gene ßow is occurring between these geographically sepa- Naturally formed pearls are a result of a small foreign object that rated populations, and what effect the cultured oyster stocks may have becomes lodged in the mantle tissue, usually a grain of sand or small on these wild populations . The answer to these questions will pro- rock. The oyster attempts to rid itself of the irritant by coating it with the vide a basis for further inquiry into the population structure of Pinctada iridescent nacre found on the inside of its shell. The result is a naturally margaritifera (P. margaritifera) and provide much needed information to formed pearl. These pearls are very rare, only about 1 in 2000 oysters stakeholders allowing them to make more informed decisions regarding will have one (Ellis and Haws 1999). management of this species. As time progressed, the likelihood of Þnding an oyster with a sizable pearl decreased. Methods were soon developed for culturing Methodology pearls. The popularity of this Òblack pearlÓ as a jewelry item has driven This project utilizes two molecular methods for investigating the ques- the development of culture methods for this organism. Pearl-farming tion proposed. The Þrst method is sequencing of the mitochondrial gene is currently becoming a major industry in developing island nations of responsible for cytochrome oxidase C subunit 1 (CO1). Because se- the PaciÞc. lective pressure on this gene is low, it is subject to a consistent, high In the past, a pearl could be associated with the area from which mutation rate. We can gauge the genetic distance between individuals it grew based on its color, luster, iridescence and shape. This was true by summing the number of mutations they share. In this way we work of the Tahitian black pearls of twenty years ago (Benzi and Ballment, backwards to show the evolutionary path between populations. 1994). In the present, it is difÞcult to differentiate between pearls grown The second method is AmpliÞed Fragment Length Polymorphism in different lagoons in Tahiti. This is believed to be due to massive stock (AFLP). This method employs restriction enzymes to splice the entire transfers between the various islands (Benzie and Ballment, 1994). genome into fragments. These fragments are then sorted according to Current hatchery operations collect broodstock or spat from geo- length. Analysis of the individuals sharing these same size fragments graphic localities close to the hatchery. Farms purchase their culture can reveal relationships between them. 27 DNA Extractions Automated DNA sequencing is performed in the LI-COR Gene Genomic DNA was extracted from adductor and mantle tissues of P. Reader 4200 (NEN). A 5.5% acrylamide gel of 0.25mm in thickness margaritifera using QiagenÕs DNeasy tissue kit¨ following the manu- and 41cm in length is used. The wells are loaded with 1.5L of product facturerÕs suggested Òanimal tissue protocolÓ with a modiÞcation to al- and the machine is set to run for 9 hours. low an overnight initial cell lyses. The expectation being that the longer digestion period would produce more products. AFLP experiments Extraction products were checked for quantity and quality using Digestion/Ligation a 0.9% agarose gel electrophoresis. This gel gives an indication of the The intact chromosomes of genomic DNA were digested using the re- yield obtained from the extraction and can also give an indication of the striction enzymes EcoR1 and Pst1. T4 DNA ligase was used to attach quality of the products obtained. For example, if the DNA is sheared the double stranded adaptors for EcoR1 and Pst1. This was carried out (broken into incomplete lengths), the bands will appear smeared. This is in a total reaction volume of 20L consisting of; 2.0L of 10x React 2 a result of the different lengths (and therefore different masses) of DNA buffer, 0.5L BSA, 1.0L EcoR1, 1.0L Pst1, 4.4L Þltered water, 1.0L migrating through the gel to various distances from the well. If the T4 DNA ligase, 0.1L ATP, 1.0L double stranded EcoR1 adaptor, 2.0L bands are tight without smearing, this indicates a yield of good product double stranded Pst1 adaptor, and 6.0L DNA template. This reaction is or at least pieces of DNA that are fairly uniform in length. allowed to incubate in a water bath at 37¡C overnight. This process selectively cuts double-stranded DNA at enzyme spe- Sequencing experiments ciÞc loci along the genome. The EcoR1 enzyme cuts at the sequence Polymerase Chain Reaction (PCR) GAATTC and the Pst1 enzyme cuts at the sequence CTGCAG. The AmpliÞcation of the mitochondrial gene, cytochrome c oxidase subunit resulting products are various lengths of DNA with known sequences 1 (CO1), was performed in a PTC-100 Programmable Thermal Con- at each end. troller DNA ampliÞer. This 708bp product was obtained using primers HCO1490 (GTTCAACAAATCATAAAGATATTGG) and LCO2198 Pre-AmpliÞcation (TAAACTTCAGGGTGACCAAAAAATCA). A cocktail with a 28µL The Þrst ampliÞcation of genomic DNA is done using a cocktail of total reaction volume was mixed as follows; 2.5L 10x Buffer, 2.8L 25L total reaction volume consisting of; 2.5L MgCl2 (25mM), 2.5L 10x buffer, 2.0L dNTPs (2.5mM), 0.5L Taq, 1.0L EcoR1+A primer, MgCl2 (25mM), 2.5L dNTPs (2.5mM), 0.2L BSA, 1.5L of each primer, 13.25L of Þltered water, 3.0L of DNA template, and 0.25L 1.0L Pst 1+A primer, 13.5L Þltered water, and 2.0L DNA template. of TAQ. This process will only allow the ampliÞcation of products which have a Samples were heated at 95¡C for 3 minutes followed by 35 cycles nucleotide base A next to the priming site. This is because these primers of; denaturation at 95¡C for 30 sec., annealing at 42¡C for 30 sec., and only recognize the adaptor sequence plus the nucleotide base A. The extension at 72¡C for 1 min. with a Þnal extension at 72¡C for 3 min. result will be a decrease in the amount of products, which is necessary because we will have too much DNA to get a clear signal during the Þnal Isolation and Gene Clean AFLP gel run. AmpliÞcation products were isolated using a 0.9% agarose gel. The tar- This reaction is processed in a MJ Research PTC-100 Program- get bands were excised from the gel and the Gene Clean (removal of mable Thermal Controller DNA ampliÞer. the agarose) was performed using QiagenÕs QIA quick PCR puriÞcation The Pre-Amp products are checked for quality using gel electro- kit¨, according to manufacturers suggested protocol. The gene clean phoresis. Unlike the extraction gel, a high quality product will appear as products are checked for quantity and quality again using gel electro- a bright long smear across the gel.

Load more

  3

Copy Link