Phylogenetic Analysis of Prevotella Nigrescens, Prevotella Intermedia

Total Page:16

File Type:pdf, Size:1020Kb

Load more

International Journal of Systematic and Evolutionary Microbiology (2002), 52, 1391–1395 DOI: 10.1099/ijs.0.02021-0 Phylogenetic analysis of Prevotella nigrescens, NOTE Prevotella intermedia and Porphyromonas gingivalis clinical strains reveals a clear species clustering Institute of Veterinary Peter Kuhnert,1 Joachim Frey,1 Niklaus P. Lang2 and Lisa Mayfield2 Bacteriology1 and School of Dental Medicine2 , University of Bern, Switzerland Author for correspondence: Peter Kuhnert. Tel: j41 31 6312485. Fax: j41 31 6312634. e-mail: peter.kuhnert!vbi.unibe.ch Prevotella nigrescens, Prevotella intermedia and Porphyromonas gingivalis are oral pathogens from the family Bacteroidaceae, regularly isolated from cases of gingivitis and periodontitis. In this study, the phylogenetic variability of these three bacterial species was investigated by means of 16S rRNA (rrs) gene sequence comparisons of a set of epidemiologically and geographically diverse isolates. For each of the three species, the rrs gene sequences of 11 clinical isolates as well as the corresponding type strains was determined. Comparison of all rrs sequences obtained with those of closely related species revealed a clear clustering of species, with only a little intraspecies variability but a clear difference in the rrs gene with respect to the next related taxon. The results indicate that the three species form stable, homogeneous genetic groups, which favours an rrs-based species identification of these oral pathogens. This is especially useful given the 7% sequence divergence between Prevotella intermedia and Prevotella nigrescens, since phenotypic distinction between the two Prevotella species is inconsistent or involves techniques not applicable in routine identification. Keywords: phylogeny, variation, 16S rRNA, oral pathogens The periodontal pocket provides a unique habitat for parison, these periodontal pathogens are found rela- over 500 species of micro-organisms. These micro- tively infrequently and at low proportions within organisms are organized in a biofilm such that specific plaque samples from periodontally healthy individ- groups of bacteria are associated with one another in uals. Further evidence of the role of these pathogens complexes (Socransky et al., 1988). It is evident that a in destructive periodontal disease is provided by limited number of species of the oral microflora are studies demonstrating that the treatment aimed at associated with periodontal disease and may be identi- suppression of these species results in clinical im- fied in high proportions at sites with periodontal provement registered as reduced bleeding, reduced inflammation and destruction (Slots et al., 1986; Dzink pocket depth and gains in probing attachment level et al., 1988). (Slots et al., 1985; van Winkelhoff et al., 1988; Loos et al., 1988; Renvert et al., 1990). Microbial monitoring Prevotella intermedia and Porphyromonas gingivalis in dental practice may be an adjunct to diagnosis, are frequently isolated from subgingival plaque of choice of therapy, treatment evaluation, and risk individuals with periodontal disease. Prevotella nigres- evaluation and prognosis (Greenstein, 1988; Listgar- cens has been found to occur less frequently in ten, 1988; Maiden et al., 1990). Thus, a simple, reliable periodontal sites compared with Prevotella intermedia and reproducible method for identification of the (Dahlen et al., 1990; Haffajee et al., 1992). In com- bacterial species is desirable. ................................................................................................................................................. The three periodontal pathogens investigated in this Published online ahead of print on 28 January 2002 as DOI 10.1099/ study are all from the family Bacteroidaceae. Por- ijs.0.02021-0. phyromonas gingivalis (formerly Bacteroides gingivalis) The GenBank accession numbers for the 16S rRNA sequences from the has been recognized for some time as a single species family Bacteroidaceae are listed in Table 1. and can be relatively easily identified by phenotypic 02021 # 2002 IUMS Printed in Great Britain 1391 P. Kuhnert and others Table 1. List of strains used for rrs gene sequence comparison Strain* Original name Geographical origin† Clinical origin‡ Accession no. Porphyromonas gingivalis Type strain ATCC 33277T ATCC Gingival sulcus AF414809 1-PGI OMGS 945 Sweden Periodontitis AF414810 2-PGI OMGS 2101 Kenya Periodontitis AF414811 3-PGI PFG 83 Indonesia AF414812 40-PGI OMGS 716 Sweden AF414813 42-PGI OMGS 789 Sweden AF414814 25-PGI P02-2 Switzerland Periodontitis AF414815 26-PGI P06-2 Switzerland Periodontitis AF414816 27-PGI P06-3 Switzerland Periodontitis AF414817 28-PGI P10-1 Switzerland Periodontitis AF414818 29-PGI P11-6rough Switzerland Periodontitis AF414819 30-PGI P12-1 Switzerland Periodontitis AF414820 Prevotella intermedia Type strain ATCC 25611T ATCC Empyema AF414821 5-PIN MH 7 UK AF414822 6-PIN MH 16 UK AF414823 32-PIN HG 1674 The Netherlands AF414824 35-PIN OMGS 874 Sweden Periodontitis AF414825 36-PIN OMGS 1277 Sweden Periodontitis AF414826 10-PIN P02-1 Switzerland Periodontitis AF414827 15-PIN P05-6 Switzerland Periodontitis AF414828 16-PIN P05-7 Switzerland Periodontitis AF414829 22-PIN P09-14 Switzerland Periodontitis AF414830 23-PIN P09-15 Switzerland Periodontitis AF414831 24-PIN P09-16 Switzerland Periodontitis AF414832 Prevotella nigrescens Type strain ATCC 33563T UK Gingivitis AF414833 7-PNIG MHS 1-18 Denmark Periodontitis AF414834 8-PNIG MH 20 UK AF414835 9-PNIG MH 11 UK AF414836 31-PNIG HG 1672 The Netherlands AF414837 37-PNIG OMGS 865 Sweden AF414838 11-PNIG P03-2 Switzerland Periodontitis AF414839 13-PNIG P04-4 Switzerland Periodontitis AF414840 17-PNIG P06-9 Switzerland Periodontitis AF414841 18-PNIG P07-10 Switzerland Periodontitis AF414842 20-PNIG P08-12 Switzerland Periodontitis AF414843 21-PNIG P08-13 Switzerland Periodontitis AF414844 * Strain acronyms: PGI for Porphyromonas gingivalis, PIN for Prevotella intermedia, PNIG for Prevotella nigrescens. † ATCC, American Type Culture Collection, Manassas, VA, USA. ‡ The strains were isolated from human individuals; , not determined. means (Krieg & Holt, 1984). Prevotella intermedia is groups representing the two species (Frandsen et al., an anaerobic, black-pigmented, Gram-negative rod 1995). and was recently split into two distinct species – Prevotella intermedia and Prevotella nigrescens –on Several methods have since been utilized to distinguish the basis of biochemical and DNA reassociation Prevotella intermedia from Prevotella nigrescens in the studies (Shah & Gharbia, 1992). The two species were clinical laboratory, with varying reliability. Phenotypic later confirmed by a polyphasic approach including identification and discrimination of Prevotella nigres- multilocus enzyme electrophoresis, ribotyping, and cens and Prevotella intermedia based on lipase pro- SDS-PAGE profiles. These different approaches car- duction, as originally described by Shah & Gharbia ried out with a representative sample number of (1992), proved to be problematic and was not repro- isolates produced clustering in the same two distinct ducible in different laboratories (Frandsen et al., 1995). 1392 International Journal of Systematic and Evolutionary Microbiology 52 Phylogeny of Prevotella and Porphyromonas spp. Table 2. PCR and sequencing primers used for rrs amplification and sequence determination ..................................................................................................................................................................................................................................... The optimized primer set was adapted from Kuhnert et al. (1996). Name Sequence Position* 16SUNI-L AGAGTTTGATCATGGCTCAG 8–27 16SUNI-R GTGTGACGGGCGGTGTGTAC 1410–1391 16SRNAI-S CTACGGGAGGCAGCAGTGGGG 341–361 16SRNA1-S CTACGGGAGGCAGCAGTGAGG 341–361 16SRNAII-S GTGTAGCGGTGAAATGCGTAG 682–702 16SRNA2-S GTGTAGGGGTAAAATCCGTAG 682–702 16SRNAIV-S GGTTAAGTCCCGCAACGAGCGC 1087–1108 16SRNA4-S GCTTAAGTGCCATAACGAGCGC 1087–1108 16SRNAV-S CCCCACTGCTGCCTCCCGTAG 361–341 16SRNAVI-S CTACGCATTTCACCGCTACAC 702–682 16SRNA6-S CTACGGATTTTACCCCTACAC 702–682 16SRNAVIII-S GCGCTCGTTGCGGGACTTAACC 1108–1087 16SRNA8-S GCGCTCGTTATGGCACTTAAGC 1108–1087 * Relative to the Escherichia coli sequence (J01859). The usefulness of separation of whole-cell proteins by of the rrs gene and to evaluate published PCR assays, SDS-PAGE was also questioned (Premaraj et al., we carried out a study on the rrs gene sequences of 1999), and the ultimate comparison of genomic DNA clinical isolates of the three species Porphyromonas is time-consuming. Therefore, to distinguish the two gingivalis, Prevotella intermedia and Prevotella nigres- species, several methods are normally used in parallel. cens in comparison to their corresponding type A simple and robust identification method, however, is strains. For that purpose, we selected a representative needed for the clinical laboratory. sample of different geographically and epidemiologi- cally unrelated strains. They are listed in Table 1 and Paster et al. (1994) did a comprehensive study to included strains from individual patients, with perio- determine the phylogenetic relationships within the dontal disease, from Sweden, the UK, Denmark, The family Bacteroidaceae, using sequence analysis of the Netherlands, Kenya, Indonesia and Switzerland. In 16S rRNA. They found Porphyromonas gingivalis in addition, the type strains of the three species were the Porphyromonas cluster, and Prevotella intermedia
Recommended publications
  • Probiotic Alternative to Chlorhexidine in Periodontal Therapy: Evaluation of Clinical and Microbiological Parameters

    Probiotic Alternative to Chlorhexidine in Periodontal Therapy: Evaluation of Clinical and Microbiological Parameters

    microorganisms Article Probiotic Alternative to Chlorhexidine in Periodontal Therapy: Evaluation of Clinical and Microbiological Parameters Andrea Butera , Simone Gallo * , Carolina Maiorani, Domenico Molino, Alessandro Chiesa, Camilla Preda, Francesca Esposito and Andrea Scribante * Section of Dentistry–Department of Clinical, Surgical, Diagnostic and Paediatric Sciences, University of Pavia, 27100 Pavia, Italy; [email protected] (A.B.); [email protected] (C.M.); [email protected] (D.M.); [email protected] (A.C.); [email protected] (C.P.); [email protected] (F.E.) * Correspondence: [email protected] (S.G.); [email protected] (A.S.) Abstract: Periodontitis consists of a progressive destruction of tooth-supporting tissues. Considering that probiotics are being proposed as a support to the gold standard treatment Scaling-and-Root- Planing (SRP), this study aims to assess two new formulations (toothpaste and chewing-gum). 60 patients were randomly assigned to three domiciliary hygiene treatments: Group 1 (SRP + chlorhexidine-based toothpaste) (control), Group 2 (SRP + probiotics-based toothpaste) and Group 3 (SRP + probiotics-based toothpaste + probiotics-based chewing-gum). At baseline (T0) and after 3 and 6 months (T1–T2), periodontal clinical parameters were recorded, along with microbiological ones by means of a commercial kit. As to the former, no significant differences were shown at T1 or T2, neither in controls for any index, nor in the experimental
  • Periodontal Health, Gingival Diseases and Conditions 99 Section 1 Periodontal Health

    Periodontal Health, Gingival Diseases and Conditions 99 Section 1 Periodontal Health

    CHAPTER Periodontal Health, Gingival Diseases 6 and Conditions Section 1 Periodontal Health 99 Section 2 Dental Plaque-Induced Gingival Conditions 101 Classification of Plaque-Induced Gingivitis and Modifying Factors Plaque-Induced Gingivitis Modifying Factors of Plaque-Induced Gingivitis Drug-Influenced Gingival Enlargements Section 3 Non–Plaque-Induced Gingival Diseases 111 Description of Selected Disease Disorders Description of Selected Inflammatory and Immune Conditions and Lesions Section 4 Focus on Patients 117 Clinical Patient Care Ethical Dilemma Clinical Application. Examination of the gingiva is part of every patient visit. In this context, a thorough clinical and radiographic assessment of the patient’s gingival tissues provides the dental practitioner with invaluable diagnostic information that is critical to determining the health status of the gingiva. The dental hygienist is often the first member of the dental team to be able to detect the early signs of periodontal disease. In 2017, the American Academy of Periodontology (AAP) and the European Federation of Periodontology (EFP) developed a new worldwide classification scheme for periodontal and peri-implant diseases and conditions. Included in the new classification scheme is the category called “periodontal health, gingival diseases/conditions.” Therefore, this chapter will first review the parameters that define periodontal health. Appreciating what constitutes as periodontal health serves as the basis for the dental provider to have a stronger understanding of the different categories of gingival diseases and conditions that are commonly encountered in clinical practice. Learning Objectives • Define periodontal health and be able to describe the clinical features that are consistent with signs of periodontal health. • List the two major subdivisions of gingival disease as established by the American Academy of Periodontology and the European Federation of Periodontology.
  • Prevotella Intermedia

    Prevotella Intermedia

    The principles of identification of oral anaerobic pathogens Dr. Edit Urbán © by author Department of Clinical Microbiology, Faculty of Medicine ESCMID Online University of Lecture Szeged, Hungary Library Oral Microbiological Ecology Portrait of Antonie van Leeuwenhoek (1632–1723) by Jan Verkolje Leeuwenhook in 1683-realized, that the film accumulated on the surface of the teeth contained diverse structural elements: bacteria Several hundred of different© bacteria,by author fungi and protozoans can live in the oral cavity When these organisms adhere to some surface they form an organizedESCMID mass called Online dental plaque Lecture or biofilm Library © by author ESCMID Online Lecture Library Gram-negative anaerobes Non-motile rods: Motile rods: Bacteriodaceae Selenomonas Prevotella Wolinella/Campylobacter Porphyromonas Treponema Bacteroides Mitsuokella Cocci: Veillonella Fusobacterium Leptotrichia © byCapnophyles: author Haemophilus A. actinomycetemcomitans ESCMID Online C. hominis, Lecture Eikenella Library Capnocytophaga Gram-positive anaerobes Rods: Cocci: Actinomyces Stomatococcus Propionibacterium Gemella Lactobacillus Peptostreptococcus Bifidobacterium Eubacterium Clostridium © by author Facultative: Streptococcus Rothia dentocariosa Micrococcus ESCMIDCorynebacterium Online LectureStaphylococcus Library © by author ESCMID Online Lecture Library Microbiology of periodontal disease The periodontium consist of gingiva, periodontial ligament, root cementerum and alveolar bone Bacteria cause virtually all forms of inflammatory
  • Comparative Evaluation of Citrus Sinensis Extract on Porphyromonas

    Comparative Evaluation of Citrus Sinensis Extract on Porphyromonas

    IOSR Journal of Dental and Medical Sciences (IOSR-JDMS) e-ISSN: 2279-0853, p-ISSN: 2279-0861.Volume 20, Issue 6 Ser.7 (June. 2021), PP 19-23 www.iosrjournals.org Comparative Evaluation of citrus sinensis extract on Porphyromonas Gingivalis, Aggregatibacter Actinomycetemcomitans and Prevotella Intermedia with Chlorhexidine: an In-Vitro Study 1 2 Dr.Nikee D. Upadhyay , Dr. Monali A. Shah 1(3rd MDS Periodontology, Department of Periodontology,K. M. Shah Dental College and Hospital, Sumandeep Vidyapeeth, Piparia, Vadodara, Gujarat,India) 2(Professor and Head,Department of Periodontology,K. M. Shah Dental College and Hospital, Sumandeep Vidyapeeth, Piparia, Vadodara, Gujarat,India) Abstract: Background: Periodontal pathogens like Aggregatibactor Actinomycetemcomitans, Porphyromonas Gingivalis, and Prevotella Intermedia etc. are considered to be the primary etiologic factors for the periodontal diseases. Chlorhexidine is an antimicrobial agent considered to be gold standard which has a broad antibacterial activity and is normally used for chemical plaque control. But chlorhexidine is known to cause staining when used for a longer time. Hence other agents with herbal contents are being researched that can be used on regular basis. Materials and Methods: Minimum inhibitory concentration (MIC), Minimum bactericidal concentration (MBC) and Zone of Inhibition (ZOI) were used to assess the antibacterial effect of citrus sinensis extract against periodontal pathogens and it was compared to chlorhexidine using the micro dilution process and the culture method. Results: For Citrus Sinensis extract, MIC and MBC value of P.Gingivalis was 50ug/ml and of A. Actinomycetemcomitans & P. Intermedia was 100ug/ml. ZOI of P.Gingivalis was 15mm at 50ug/ml, and A. actinomycetumcomitans and P.
  • Jemds.Com Original Research Article

    Jemds.Com Original Research Article

    Jemds.com Original Research Article CHARACTERISATION OF PORPHYROMONAS-PREVOTELLA GROUP ISOLATED FROM ORODENTAL INFECTIONS AND ANTIMICROBIAL ACTION OF HERBAL EXTRACTS Beena Antony1, Chinu Maria Cyriac2, Jinsha K3, Ramanath Karicheri4 1Professor, Department of Microbiology, Fr. Muller Medical College, Mangalore. 2Postgraduate Student, Department of Endodontics and Conservative Dentistry, AJ Institute of Dental Sciences, Mangalore. 3Postgraduate Student (M.Sc), Department of Microbiology, School of Health Sciences, Kannur University. 4Research Scholar, Fr. Muller Medical College, Mangalore. ABSTRACT BACKGROUND Porphyromonas–Prevotella group includes non-motile, non-sporing, black pigmented Gram-negative coccobacilli. Even though they are commensals of oral cavity, many species are associated with a variety of orodental as well as invasive human infections. As these isolates are exhibiting resistance to many antibiotics, an attempt is done in this study to evaluate antimicrobial activity of various herbal extracts from natural sources. Objectives- To characterise Porphyromonas-Prevotella group isolated from orodental infections by biochemical reactions and to screen the antimicrobial action of various herbal extracts against these isolates. MATERIALS & METHODS Clinical samples such as subgingival plaques, paper points, saliva were directly inoculated in Reduced Transport Fluid and Robertson’s Cooked Meat Medium, subcultured onto culture media using a semiquantitation technique under anaerobic conditions employing BD GasPak system. After incubation,
  • Chlorhexidine: a Multi-Functional Antimicrobial Drug a Peer-Reviewed Publication Written by Gary J

    Chlorhexidine: a Multi-Functional Antimicrobial Drug a Peer-Reviewed Publication Written by Gary J

    Earn 4 CE credits This course was written for dentists, dental hygienists, and assistants. Chlorhexidine: A Multi-Functional Antimicrobial Drug A Peer-Reviewed Publication Written by Gary J. Kaplowitz, D.D.S., M.A., M.Ed and Marilyn Cortell, RDH, MS PennWell is an ADA CERP Recognized Provider Go Green, Go Online to take your course This course has been made possible through an unrestricted educational grant. The cost of this CE course is $59.00 for 4 CE credits. Cancellation/Refund Policy: Any participant who is not 100% satisfied with this course can request a full refund by contacting PennWell in writing. Educational Objectives in Europe in the early 1970s. It received FDA approval Upon completion of this course, the clinician will be able to in 1986 under the brand name PERIDEX® (Zila Phar- do the following: maceuticals) based on studies showing that it reduced 1. Explain the mechanism of action of chlorhexidine gingivitis by up to 41%. Soon after,1 PERIDEX®‚ was the gluconate. first mouthrinse to receive the ADA Seal of Acceptance. 2. Identify the unique property that allows for a Generic rinses have been available since 1994 and are prolonged effect. available from many different companies. In order to 3. Describe the clinical indications for use. qualify as a generic, the medication must prove to have 4. Understand the mechanism by which chlorhexidine may 80–120% of the bioavailability of the name brand to be cause extrinsic stain and the recommended home care considered bioequivalent. To date, there have been no strategies to reduce its occurrence.
  • Comparison of Efficacy of Herbal Solutions in Chronic Gingivitis Patients- a Microbiological Study 1 2 3 4 5 C

    Comparison of Efficacy of Herbal Solutions in Chronic Gingivitis Patients- a Microbiological Study 1 2 3 4 5 C

    Scholars Academic Journal of Biosciences (SAJB) ISSN 2321-6883 (Online) Sch. Acad. J. Biosci., 2017; 5(10):708-712 ISSN 2347-9515 (Print) ©Scholars Academic and Scientific Publisher (An International Publisher for Academic and Scientific Resources) www.saspublisher.com Comparison of Efficacy of Herbal Solutions in Chronic Gingivitis Patients- A Microbiological Study 1 2 3 4 5 C. Hemachandra Babu , G. Sindhu , Vinay Chavan , E. Manaswini , Laxman Boyapati Department of Periodontics, Meghna Institute of Dental Sciences, Nizamabad, Telangana State Abstract: The common etiology for initiation of gingival or periodontal disease is Original Research Article plaque accumulation. Plaque induced gingivitis is due to interaction between host inflammatory cells and microorganisms present in dental plaque. The present study *Corresponding author includes the aloevera and ocimum disinfectants as oral hygiene aids to reduce plaque C. Hemachandra Babu formation and to know their efficacy over chlorhexidine mouthwash. Supragingival plaque samples were collected from patients between the age groups 18-55yrs with Article History chronic generalized gingivitis (CGG) .15 plaque samples were collected and transferred Received: 28.09.2017 to anaerobic culture media for culturing prevotella intermedia spicies, then samples were Accepted: 05.10.2017 immersed in disinfectants randomly which are divided into 3groups: GroupI: aloevera Published:30.10.2017 juice, Group II: ocimum juice, Group III: Chlorhexidine and assessed for colony forming units with digital colony counter. The results showed that the bacterial count of P. DOI: intermedia reduced after rinsing the plaque sample with the disinfectants. All the three groups were statistically significant before and after treatment. The results of the study 10.21276/sajb.2017.5.10.3 concluded that ocimum, aloevera showed significant reduction in bacterial count in plaque samples but not suprerior to chlorhexidine.
  • A Guide to the Endodontic Literature Success & Failure

    A Guide to the Endodontic Literature Success & Failure

    A Guide to the Endodontic Literature Success & Failure: Authors Description European Soc. Definition of Success: Clinical symptoms originating from an endodontically-induced apical periodontitis should neither persist nor develop after RCT Endodontology (1994 IEJ): and the contours of the PDL space around the root should radiographically be normal. AAE Quality Assurance Objectives of NSRCT (= nonsurgical root canal treatment) Guidelines · Prevent adverse signs or symptoms · Remove RC contents · Create radiographic appearance of well obturated RC system · Promote healing and repair of periradicular tissues · Prevent further breakdown of periradicular tissues The Mantra: · Apical periodontitis (=AP; = periapical radiolucency =PARL) is caused primarily by bacteria in RC systems (Sundqvist 1976; Kakehashi 1965; Moller 1981) · If bacteria in canal systems are reduced to levels that are not detected by culturing, then high success rates are observed (Bystrom 1987; Sjogren 1997) · Best documented results for canal disinfection are chemomechanical debridement with Ca(OH)2 for at least 1week (Sjogren 1991) · Mechanical instrumentation alone (C&S) reduces bacteria by 100-1,000 fold. But only 20-43% of cases show complete elimination (Bystrom 1981; Bystrom & Sundqvist 1985) · Do C&S and add 0.5% NaOCl produces complete disinfection in 40-60% of cases (Bystrom 1983) · Do C&S with 0.5% NaOCl and add one week Ca(OH)2: get complete disinfection in 90-100% of cases (Bystrom 1985; Sjogren 1991). Problems with the Mantra · Koch’s postulates cannot be applied
  • Quantification of Bacteria in Mouth-Rinsing Solution For

    Quantification of Bacteria in Mouth-Rinsing Solution For

    Journal of Clinical Medicine Article Quantification of Bacteria in Mouth-Rinsing Solution for the Diagnosis of Periodontal Disease Jeong-Hwa Kim 1,†, Jae-Woon Oh 1,†, Young Lee 2, Jeong-Ho Yun 3 , Seong-Ho Choi 4 and Dong-Woon Lee 1,* 1 Department of Periodontology, Dental Hospital, Veterans Health Service Medical Center, Seoul 05368, Korea; [email protected] (J.-H.K.); [email protected] (J.-W.O.) 2 Veterans Medical Research Institute, Veterans Health Service Medical Center, Seoul 05368, Korea; [email protected] 3 Department of Periodontology, College of Dentistry and Institute of Oral Bioscience, Jeonbuk National University, Jeonju 54896, Korea; [email protected] 4 Department of Periodontology, College of Dentistry and Research Institute for Periodontal Regeneration, Yonsei University, Seoul 03722, Korea; [email protected] * Correspondence: [email protected]; Tel.: +82-2-2225-1928; Fax: +82-2-2225-1659 † These authors contributed equally to this work. Abstract: This study aimed to evaluate the feasibility of diagnosing periodontitis via the identification of 18 bacterial species in mouth-rinse samples. Patients (n = 110) who underwent dental examinations in the Department of Periodontology at the Veterans Health Service Medical Center between 2018 and 2019 were included. They were divided into healthy and periodontitis groups. The overall number of bacteria, and those of 18 specific bacteria, were determined via real-time polymerase chain reaction in 92 mouth-rinse samples. Differences between groups were evaluated through logistic regression after adjusting for sex, age, and smoking history. There was a significant difference in the prevalence (healthy vs. periodontitis group) of Aggregatibacter actinomycetemcomitans (2.9% vs.
  • Propolis: a Natural Biomaterial for Dental and Oral Health Care Zohaib Khurshid1 • Mustafa Naseem2 • Muhammad S

    Propolis: a Natural Biomaterial for Dental and Oral Health Care Zohaib Khurshid1 • Mustafa Naseem2 • Muhammad S

    Journal of Dental Research, Dental Clinics, Dental Prospects Review Propolis: A natural biomaterial for dental and oral health care 1 2 3,4 5 6 Zohaib Khurshid • Mustafa Naseem • Muhammad S. Zafar * • Shariq Najeeb • Sana Zohaib 1Department of Fixed Prosthodontics, College of Dentistry,King Faisal University, Hofuf, Saudi Arabia 2Department of Preventive dental Sciences, College of Dentistry, Dar-Al-Uloom University, Riyadh, Saudi Arabia 3Department of Restorative Dentistry, College of Dentistry, Taibah University, Madinah, Al Munawwarah, Saudi Arabia 4Adjunct Faculty, Department of Dental Materials, Islamic International Dental College, Riphah International University, Islamabad, Pakistan 5Private Dental Practitioner, Restorative Dental Sciences, Canada 6Department of Biomedical Engineering, King Faisal University, Al-Hofuf, Saudi Arabia *Corresponding Author; E-mail: [email protected] Received: 13 July 2017; Accepted: 14 August 2017 J Dent Res Dent Clin Dent Prospect 2017; 11(4):265-274 | doi: 10.15171/joddd.2017.046 This article is available from: http://joddd.tbzmed.ac.ir © 2017 Khurshid et al. This is an Open Access article published and distributed by Tabriz University of Medical Sciences under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract The field of health has always emphasized on the use of natural products for curing diseases. There is a wide variety of nat- ural products (such as silk, herbal tea, chitosan) used today in the biomedical application for treating a large array of sys- temic diseases. The natural product “propolis” is a non-toxic resinous material with beneficial properties such as antimi- crobial, anticancer, antifungal, antiviral and anti-inflammatory; hence it has gained the attention of researchers for its poten- tial for bio-dental applications.
  • Unculturable and Culturable Periodontal-Related Bacteria Are

    Unculturable and Culturable Periodontal-Related Bacteria Are

    www.nature.com/scientificreports OPEN Unculturable and culturable periodontal‑related bacteria are associated with periodontal infammation during pregnancy and with preterm low birth weight delivery Changchang Ye1, Zhongyi Xia1, Jing Tang1, Thatawee Khemwong2, Yvonne Kapila3, Ryutaro Kuraji4, Ping Huang1, Yafei Wu1 & Hiroaki Kobayashi2,5* Recent studies revealed culturable periodontal keystone pathogens are associated with preterm low birth weight (PLBW). However, the oral microbiome is also comprised of hundreds of ‘culture-difcult’ or ‘not-yet-culturable’ bacterial species. To explore the potential role of unculturable and culturable periodontitis-related bacteria in preterm low birth weight (PLBW) delivery, we recruited 90 pregnant women in this prospective study. Periodontal parameters, including pocket probing depth, bleeding on probing, and clinical attachment level were recorded during the second trimester and following interviews on oral hygiene and lifestyle habits. Saliva and serum samples were also collected. After delivery, birth results were recorded. Real-time PCR analyses were performed to quantify the levels of periodontitis-related unculturable bacteria (Eubacterium saphenum, Fretibacterium sp. human oral taxon(HOT) 360, TM7 sp. HOT 356, and Rothia dentocariosa), and cultivable bacteria (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Fusobacterium nucleatum and Prevotella intermedia) in saliva samples. In addition, ELISA analyses were used to determine the IgG titres against periodontal pathogens in serum samples. Subjects were categorized into a Healthy group (H, n = 20) and periodontitis/gingivitis group (PG, n = 70) according to their periodontal status. The brushing duration was signifcantly lower in the PG group compared to the H group. Twenty-two of 90 subjects delivered PLBW infants. There was no signifcant diference in periodontal parameters and serum IgG levels for periodontal pathogens between PLBW and healthy delivery (HD) groups.
  • Association of Time Under Immunosuppression and Different

    Association of Time Under Immunosuppression and Different

    Med Oral Patol Oral Cir Bucal. 2018 May 1;23 (3):e326-34. Periodontal bacteria and immunosuppression Journal section: Medically compromised patients in Dentistry doi:10.4317/medoral.22238 Publication Types: Research http://dx.doi.org/doi:10.4317/medoral.22238 Association of time under immunosuppression and different immunosuppressive medication on periodontal parameters and selected bacteria of patients after solid organ transplantation Gerhard Schmalz 1, Lisa Berisha 1, Horst Wendorff 1, Florian Widmer 1, Anna Marcinkowski 1, Helmut Tes- chler 2, Urte Sommerwerck 2, Rainer Haak 1, Otto Kollmar 3, Dirk Ziebolz 1 1 Department of Cariology, Endodontology and Periodontology, University of Leipzig 2 Department of Pneumology, Ruhrlandklinik, West German Lung Center, University Hospital Essen, University Duisburg- Essen, Germany 3 Department of General and Visceral Surgery, HELIOS Dr. Horst Schmidt-Kliniken, Wiesbaden, Germany Correspondence: Schmalz G, Berisha L, Wendorff H, Widmer F, Marcinkowski A, Tes- University Leipzig chler H, Sommerwerck U, Haak R, Kollmar O, Ziebolz D. Association of Dept. of Cariology time under immunosuppression and different immunosuppressive medi- Endodontology and Periodontology cation on periodontal parameters and selected bacteria of patients after Liebigstr. 12 solid organ transplantation. Med Oral Patol Oral Cir Bucal. 2018 May D 04103 Leipzig, Germany 1;23 (3):e326-34. [email protected] http://www.medicinaoral.com/medoralfree01/v23i3/medoralv23i3p326.pdf Article Number: 22238 http://www.medicinaoral.com/