Mouse Smchd1 Conditional Knockout Project (CRISPR/Cas9)

Total Page:16

File Type:pdf, Size:1020Kb

Load more

https://www.alphaknockout.com Mouse Smchd1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Smchd1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Smchd1 gene (NCBI Reference Sequence: NM_028887 ; Ensembl: ENSMUSG00000024054 ) is located on Mouse chromosome 17. 48 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 48 (Transcript: ENSMUST00000127430). Exon 5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Smchd1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-238I21 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. Exon 5 starts from about 8.44% of the coding region. The knockout of Exon 5 will result in frameshift of the gene. The size of intron 4 for 5'-loxP site insertion: 682 bp, and the size of intron 5 for 3'-loxP site insertion: 6758 bp. The size of effective cKO region: ~1042 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 4 5 48 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Smchd1 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7131bp) | A(26.77% 1909) | C(20.33% 1450) | T(31.95% 2278) | G(20.95% 1494) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr17 - 71455986 71458985 3000 browser details YourSeq 630 1 808 3000 93.5% chr10 + 128085588 128090273 4686 browser details YourSeq 270 1196 2174 3000 95.4% chr5 + 30979551 31270506 290956 browser details YourSeq 197 279 790 3000 90.0% chrX + 58225235 58225928 694 browser details YourSeq 166 1177 1369 3000 95.5% chr8 - 105816427 105816618 192 browser details YourSeq 166 1196 1386 3000 95.2% chr3 + 127582044 127582296 253 browser details YourSeq 164 1204 1383 3000 97.2% chr17 - 88249451 88249701 251 browser details YourSeq 164 1196 1371 3000 95.4% chr12 + 56237339 56237512 174 browser details YourSeq 162 1196 1374 3000 96.0% chr6 - 32865813 32865997 185 browser details YourSeq 162 1063 1380 3000 84.4% chr14 - 26464721 26464937 217 browser details YourSeq 160 1195 1371 3000 96.0% chr2 - 150529654 150529832 179 browser details YourSeq 160 1196 1370 3000 96.6% chr10 - 115895233 115895408 176 browser details YourSeq 160 1196 1390 3000 90.9% chr15 + 91688454 91688629 176 browser details YourSeq 159 1196 1370 3000 97.1% chr2 + 80611606 80611780 175 browser details YourSeq 159 1201 1371 3000 95.3% chr15 + 100525734 100525903 170 browser details YourSeq 159 1196 1373 3000 95.5% chr10 + 24777267 24777444 178 browser details YourSeq 158 1197 1377 3000 94.9% chr18 - 58758208 58758388 181 browser details YourSeq 158 1196 1371 3000 94.3% chr4 + 33309559 33309733 175 browser details YourSeq 158 1196 1375 3000 94.9% chr2 + 84973345 84973551 207 browser details YourSeq 157 1204 1377 3000 95.4% chr4 + 108613779 108613955 177 Note: The 3000 bp section upstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr17 - 71452355 71455354 3000 browser details YourSeq 196 1104 3000 3000 91.9% chr1 + 37055570 37087001 31432 browser details YourSeq 150 1051 1233 3000 93.1% chr5 + 149391024 149391207 184 browser details YourSeq 149 1050 1235 3000 88.4% chr12 - 72699382 72699563 182 browser details YourSeq 145 1066 1234 3000 92.9% chr12 + 33446349 33446517 169 browser details YourSeq 143 1052 1237 3000 89.6% chr1 + 136448461 136448714 254 browser details YourSeq 142 671 1210 3000 86.4% chr19 - 50455860 50456375 516 browser details YourSeq 139 1049 1218 3000 92.2% chr4 - 126718776 126718946 171 browser details YourSeq 139 1048 1226 3000 86.7% chr10 - 59660939 59661110 172 browser details YourSeq 137 2441 3000 3000 82.9% chrX + 169893308 169893476 169 browser details YourSeq 132 1047 1211 3000 87.9% chr7 - 29904865 29905023 159 browser details YourSeq 132 2835 3000 3000 92.0% chr4 + 34134969 34135131 163 browser details YourSeq 131 1086 1233 3000 94.6% chr10 - 78016026 78016174 149 browser details YourSeq 129 1086 1233 3000 94.0% chr10 - 116200634 116200784 151 browser details YourSeq 129 2835 2999 3000 93.0% chr13 + 37325067 37325229 163 browser details YourSeq 128 1086 1233 3000 91.8% chr3 - 96468572 96468717 146 browser details YourSeq 127 2848 3000 3000 95.8% chr5 + 20203386 20203546 161 browser details YourSeq 127 1050 1235 3000 88.7% chr4 + 139932418 139932598 181 browser details YourSeq 127 2837 3000 3000 91.2% chr11 + 21831894 21832055 162 browser details YourSeq 126 2840 3000 3000 91.7% chr2 - 115413285 115413449 165 Note: The 3000 bp section downstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Smchd1 SMC hinge domain containing 1 [ Mus musculus (house mouse) ] Gene ID: 74355, updated on 8-Oct-2019 Gene summary Official Symbol Smchd1 provided by MGI Official Full Name SMC hinge domain containing 1 provided by MGI Primary source MGI:MGI:1921605 See related Ensembl:ENSMUSG00000024054 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as MommeD1; AW554188; mKIAA0650; 4931400A14Rik Expression Ubiquitous expression in CNS E11.5 (RPKM 9.1), placenta adult (RPKM 7.4) and 24 other tissues See more Orthologs human all Genomic context Location: 17; 17 E1.3 See Smchd1 in Genome Data Viewer Exon count: 48 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 17 NC_000083.6 (71344489..71475366, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 17 NC_000083.5 (71693829..71824683, complement) Chromosome 17 - NC_000083.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 12 transcripts Gene: Smchd1 ENSMUSG00000024054 Description SMC hinge domain containing 1 [Source:MGI Symbol;Acc:MGI:1921605] Gene Synonyms 4931400A14Rik, MommeD1 Location Chromosome 17: 71,344,489-71,475,343 reverse strand. GRCm38:CM001010.2 About this gene This gene has 12 transcripts (splice variants), 227 orthologues, is a member of 1 Ensembl protein family and is associated with 6 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Smchd1- ENSMUST00000127430.1 7052 2007aa ENSMUSP00000121835.1 Protein coding CCDS28958 Q6P5D8 TSL:5 201 GENCODE basic APPRIS P1 Smchd1- ENSMUST00000233839.1 595 119aa ENSMUSP00000156815.1 Nonsense mediated - A0A3B2W494 CDS 5' 211 decay incomplete Smchd1- ENSMUST00000233872.1 381 87aa ENSMUSP00000156880.1 Nonsense mediated - A0A3B2WD81 CDS 5' 212 decay incomplete Smchd1- ENSMUST00000182107.1 4107 No - Retained intron - - TSL:NA 206 protein Smchd1- ENSMUST00000182747.1 2790 No - Retained intron - - TSL:NA 208 protein Smchd1- ENSMUST00000182205.1 2510 No - Retained intron - - TSL:NA 207 protein Smchd1- ENSMUST00000182049.1 2497 No - Retained intron - - TSL:NA 205 protein Smchd1- ENSMUST00000147111.1 871 No - Retained intron - - TSL:5 204 protein Smchd1- ENSMUST00000183046.1 820 No - Retained intron - - TSL:NA 209 protein Smchd1- ENSMUST00000136071.1 411 No - Retained intron - - TSL:3 202 protein Smchd1- ENSMUST00000138193.7 1485 No - lncRNA - - TSL:1 203 protein Smchd1- ENSMUST00000232914.1 680 No - lncRNA - - - 210 protein Page 6 of 8 https://www.alphaknockout.com 150.85 kb Forward strand 71.34Mb 71.36Mb 71.38Mb 71.40Mb 71.42Mb 71.44Mb 71.46Mb 71.48Mb Genes 4930471L23Rik-201 >lncRNA Gm49916-201 >processed pseudogene Gm18738-201 >processed pseudogene (Comprehensive set... Contigs AC126942.4 > AC107664.8 > Genes (Comprehensive set... < Gm4566-202lncRNA < Smchd1-206retained intron < Smchd1-202retained intron < Gm4707-201translated processed pseudogene < Gm4566-201lncRNA <
Recommended publications
  • Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of Cpg Island Methylation on The

    Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of Cpg Island Methylation on The

    Edinburgh Research Explorer Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of CpG Island Methylation on the Inactive X Chromosome Citation for published version: Gendrel, AV, Apedaile, A, Coker, H, Termanis, A, Zvetkova, I, Godwin, J, Montana, G, Taylor, S, Giannoulatou, E, Heard, E, Stancheva, I & Brockdorff, N 2012, 'Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of CpG Island Methylation on the Inactive X Chromosome', Developmental Cell, vol. 23, no. 2, pp. 265–279. https://doi.org/10.1016/j.devcel.2012.06.011 Digital Object Identifier (DOI): 10.1016/j.devcel.2012.06.011 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Developmental Cell General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 07. Oct. 2021 Developmental Cell Article Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of CpG Island Methylation on the Inactive X Chromosome Anne-Valerie Gendrel,1,7,8 Anwyn Apedaile,3,8 Heather Coker,1 Ausma Termanis,4 Ilona Zvetkova,3,9 Jonathan Godwin,1 Y.
  • VU Research Portal

    VU Research Portal

    VU Research Portal Genetic architecture and behavioral analysis of attention and impulsivity Loos, M. 2012 document version Publisher's PDF, also known as Version of record Link to publication in VU Research Portal citation for published version (APA) Loos, M. (2012). Genetic architecture and behavioral analysis of attention and impulsivity. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. E-mail address: [email protected] Download date: 28. Sep. 2021 Genetic architecture and behavioral analysis of attention and impulsivity Maarten Loos 1 About the thesis The work described in this thesis was performed at the Department of Molecular and Cellular Neurobiology, Center for Neurogenomics and Cognitive Research, Neuroscience Campus Amsterdam, VU University, Amsterdam, The Netherlands. This work was in part funded by the Dutch Neuro-Bsik Mouse Phenomics consortium. The Neuro-Bsik Mouse Phenomics consortium was supported by grant BSIK 03053 from SenterNovem (The Netherlands).
  • Myopia in African Americans Is Significantly Linked to Chromosome 7P15.2-14.2

    Myopia in African Americans Is Significantly Linked to Chromosome 7P15.2-14.2

    Genetics Myopia in African Americans Is Significantly Linked to Chromosome 7p15.2-14.2 Claire L. Simpson,1,2,* Anthony M. Musolf,2,* Roberto Y. Cordero,1 Jennifer B. Cordero,1 Laura Portas,2 Federico Murgia,2 Deyana D. Lewis,2 Candace D. Middlebrooks,2 Elise B. Ciner,3 Joan E. Bailey-Wilson,1,† and Dwight Stambolian4,† 1Department of Genetics, Genomics and Informatics and Department of Ophthalmology, University of Tennessee Health Science Center, Memphis, Tennessee, United States 2Computational and Statistical Genomics Branch, National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, United States 3The Pennsylvania College of Optometry at Salus University, Elkins Park, Pennsylvania, United States 4Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, United States Correspondence: Joan E. PURPOSE. The purpose of this study was to perform genetic linkage analysis and associ- Bailey-Wilson, NIH/NHGRI, 333 ation analysis on exome genotyping from highly aggregated African American families Cassell Drive, Suite 1200, Baltimore, with nonpathogenic myopia. African Americans are a particularly understudied popula- MD 21131, USA; tion with respect to myopia. [email protected]. METHODS. One hundred six African American families from the Philadelphia area with a CLS and AMM contributed equally to family history of myopia were genotyped using an Illumina ExomePlus array and merged this work and should be considered co-first authors. with previous microsatellite data. Myopia was initially measured in mean spherical equiv- JEB-W and DS contributed equally alent (MSE) and converted to a binary phenotype where individuals were identified as to this work and should be affected, unaffected, or unknown.
  • Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders

    Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders

    Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2021 © 2021 Andrew H. Chiang All Rights Reserved Abstract Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Autism spectrum disorders (ASD) are a group of related neurodevelopmental diseases displaying significant genetic and phenotypic heterogeneity. Despite recent progress in ASD genetics, the nature of phenotypic heterogeneity across probands is not well understood. Notably, likely gene- disrupting (LGD) de novo mutations affecting the same gene often result in substantially different ASD phenotypes. We find that truncating mutations in a gene can result in a range of relatively mild decreases (15-30%) in gene expression due to nonsense-mediated decay (NMD), and show that more severe autism phenotypes are associated with greater decreases in expression. We also find that each gene with recurrent ASD mutations can be described by a parameter, phenotype dosage sensitivity (PDS), which characteriZes the relationship between changes in a gene’s dosage and changes in a given phenotype. Using simple linear models, we show that changes in gene dosage account for a substantial fraction of phenotypic variability in ASD. We further observe that LGD mutations affecting the same exon frequently lead to strikingly similar phenotypes in unrelated ASD probands. These patterns are observed for two independent proband cohorts and multiple important ASD-associated phenotypes. The observed phenotypic similarities are likely mediated by similar changes in gene dosage and similar perturbations to the relative expression of splicing isoforms.
  • A Quantitative Telomeric Chromatin Isolation Protocol Identifies Different Telomeric States

    A Quantitative Telomeric Chromatin Isolation Protocol Identifies Different Telomeric States

    ARTICLE Received 20 Aug 2013 | Accepted 31 Oct 2013 | Published 25 Nov 2013 DOI: 10.1038/ncomms3848 A quantitative telomeric chromatin isolation protocol identifies different telomeric states Larissa Grolimund1,2,*, Eric Aeby1,2,*, Romain Hamelin1,3, Florence Armand1,3, Diego Chiappe1,3, Marc Moniatte1,3 & Joachim Lingner1,2 Telomere composition changes during tumourigenesis, aging and in telomere syndromes in a poorly defined manner. Here we develop a quantitative telomeric chromatin isolation protocol (QTIP) for human cells, in which chromatin is cross-linked, immunopurified and analysed by mass spectrometry. QTIP involves stable isotope labelling by amino acids in cell culture (SILAC) to compare and identify quantitative differences in telomere protein com- position of cells from various states. With QTIP, we specifically enrich telomeric DNA and all shelterin components. We validate the method characterizing changes at dysfunctional tel- omeres, and identify and validate known, as well as novel telomere-associated polypeptides including all THO subunits, SMCHD1 and LRIF1. We apply QTIP to long and short telomeres and detect increased density of SMCHD1 and LRIF1 and increased association of the shel- terins TRF1, TIN2, TPP1 and POT1 with long telomeres. Our results validate QTIP to study telomeric states during normal development and in disease. 1 EPFL-Ecole Polytechnique Fe´de´rale de Lausanne, School of Life Sciences, CH-1015 Lausanne, Switzerland. 2 ISREC-Swiss Institute fro Experimental Cancer Research at EPFL, CH-1015 Lausanne, Switzerland. 3 Proteomics Core Facility at EPFL, CH-1015 Lausanne, Switzerland. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to J.L.
  • Conservation and Innovation in the DUX4-Family Gene Network

    Conservation and Innovation in the DUX4-Family Gene Network

    © Copyright 2016 Jennifer L. Whiddon i Conservation and Innovation in the DUX4-family Gene Network Jennifer L. Whiddon A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2016 Reading Committee: Stephen J. Tapscott, Chair Michael Emerman Edith H. Wang Program Authorized to Offer Degree: Molecular and Cellular Biology ii University of Washington Abstract Conservation and Innovation in the DUX4-family Gene Network Jennifer L. Whiddon Chair of the Supervisory Committee: Professor Stephen J. Tapscott Department of Neurology Facioscapulohumeral dystrophy (FSHD) is caused by the mis-expression of the DUX4 transcription factor in skeletal muscle. Animal models of FSHD have been hampered by incomplete knowledge of the conservation of the DUX4 transcriptional program in other species besides humans. We demonstrate that both mouse Dux and human DUX4 activate repetitive elements and genes associated with cleavage-stage embryos when expressed in muscle cells of their respective species. Specifically, mouse DUX activated the transcription of MERV-L retrotransposons and genes such as Gm4340 (a.k.a. Gm6763), Slc34a2, Tcstv1/3, Tdpoz 3/4, Usp17la-e and Zfp352, all of which are characteristic of mouse two-cell embryos. Human DUX4 activated transcription of orthologs of mouse DUX-induced genes, including orthologs of genes characteristic of mouse two-cell embryos. Despite functional conservation, we found that the binding motifs of mouse DUX and human DUX4 have diverged. To better understand the extent of conservation or divergence between these factors and to assess current mouse models of FSHD, we expressed human DUX4 in mouse muscle cells.
  • SMCHD1 Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP57717

    SMCHD1 Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP57717

    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 SMCHD1 Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP57717 Specification SMCHD1 Polyclonal Antibody - Product Information Application IHC-P Primary Accession A6NHR9 Reactivity Rat, Pig, Dog, Cow Host Rabbit Clonality Polyclonal Calculated MW 226374 SMCHD1 Polyclonal Antibody - Additional Information Paraformaldehyde-fixed, paraffin embedded Gene ID 23347 (Rat testis); Antigen retrieval by boiling in sodium citrate buffer (pH6.0) for 15min; Other Names Block endogenous peroxidase by 3% Structural maintenance of chromosomes hydrogen peroxide for 20 minutes; Blocking flexible hinge domain-containing protein 1, buffer (normal goat serum) at 37°C for 3.6.1.-, SMCHD1 (<a href="http://www.gen enames.org/cgi-bin/gene_symbol_report?hg 30min; Antibody incubation with (SMCHD1) nc_id=29090" Polyclonal Antibody, Unconjugated target="_blank">HGNC:29090</a>) (bs-19929R) at 1:400 overnight at 4°C, followed by operating according to SP Format Kit(Rabbit) (sp-0023) instructionsand DAB 0.01M TBS(pH7.4) with 1% BSA, 0.09% staining. (W/V) sodium azide and 50% Glyce Storage Store at -20 ℃ for one year. Avoid repeated freeze/thaw cycles. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 ℃. SMCHD1 Polyclonal Antibody - Protein Information Name SMCHD1 (HGNC:29090) Paraformaldehyde-fixed, paraffin embedded (Mouse brain); Antigen retrieval by boiling in Function sodium citrate buffer (pH6.0) for 15min; Non-canonical member of the structural Block endogenous peroxidase by 3% maintenance of chromosomes (SMC) hydrogen peroxide for 20 minutes; Blocking protein family that plays a key role in buffer (normal goat serum) at 37°C for epigenetic silencing by regulating 30min; Antibody incubation with (SMCHD1) chromatin architecture (By similarity).
  • Remotely Acting SMCHD1 Gene Regulatory Elements: in Silico Prediction and Identification of Potential Regulatory Variants in Patients with FSHD Mary B

    Remotely Acting SMCHD1 Gene Regulatory Elements: in Silico Prediction and Identification of Potential Regulatory Variants in Patients with FSHD Mary B

    Mayes et al. Human Genomics (2015) 9:25 DOI 10.1186/s40246-015-0047-x PRIMARY RESEARCH Open Access Remotely acting SMCHD1 gene regulatory elements: in silico prediction and identification of potential regulatory variants in patients with FSHD Mary B. Mayes1, Taniesha Morgan2, Jincy Winston2, Daniel S. Buxton1, Mihir Anant Kamat1,5, Debbie Smith3, Maggie Williams3, Rebecca L. Martin1, Dirk A. Kleinjan4, David N. Cooper2, Meena Upadhyaya2 and Nadia Chuzhanova1* Abstract Background: Facioscapulohumeral dystrophy (FSHD) is commonly associated with contraction of the D4Z4 macro-satellite repeat on chromosome 4q35 (FSHD1) or mutations in the SMCHD1 gene (FSHD2). Recent studies have shown that the clinical manifestation of FSHD1 can be modified by mutations in the SMCHD1 gene within a given family. The absence of either D4Z4 contraction or SMCHD1 mutations in a small cohort of patients suggests that the disease could also be due to disruption of gene regulation. In this study, we postulated that mutations responsible for exerting a modifier effect on FSHD might reside within remotely acting regulatory elements that have the potential to interact at a distance with their cognate gene promoter via chromatin looping. To explore this postulate, genome-wide Hi-C data were used to identify genomic fragments displaying the strongest interaction with the SMCHD1 gene. These fragments were then narrowed down to shorter regions using ENCODE and FANTOM data on transcription factor binding sites and epigenetic marks characteristic of promoters, enhancers and silencers. Results: We identified two regions, located respectively ~14 and ~85 kb upstream of the SMCHD1 gene, which were then sequenced in 229 FSHD/FSHD-like patients (200 with D4Z4 repeat units <11).
  • Role of the Chromosome Architectural Factor SMCHD1 in X-Chromosome Inactivation, Gene Regulation, and Disease in Humans

    Role of the Chromosome Architectural Factor SMCHD1 in X-Chromosome Inactivation, Gene Regulation, and Disease in Humans

    HIGHLIGHTED ARTICLE | INVESTIGATION Role of the Chromosome Architectural Factor SMCHD1 in X-Chromosome Inactivation, Gene Regulation, and Disease in Humans Chen-Yu Wang,*,† Harrison Brand,‡,§,**,†† Natalie D. Shaw,‡‡,§§ Michael E. Talkowski,‡,§,**,†† and Jeannie T. Lee*,†,1 *Department of Molecular Biology, ††Center for Human Genetic Research, and ‡‡Department of Medicine, Massachusetts General Hospital, Boston, Massachusetts 02114, †Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115, ‡Department of Neurology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114, §Program in Medical and Population Genetics and **Center for Mendelian Genomics, Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02142, §§National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina 27709 ORCID IDs: 0000-0002-3912-5113 (C.-Y.W.); 0000-0001-7786-8850 (J.T.L.) ABSTRACT Structural maintenance of chromosomes flexible hinge domain-containing 1 (SMCHD1) is an architectural factor critical for X-chromosome inactivation (XCI) and the repression of select autosomal gene clusters. In mice, homozygous nonsense mutations in Smchd1 cause female-specific embryonic lethality due to an XCI defect. However, although human mutations in SMCHD1 are associated with congenital arhinia and facioscapulohumeral muscular dystrophy type 2 (FSHD2), the diseases do not show a sex- specific bias, despite the essential nature of XCI in humans. To investigate whether there is a dosage imbalance for the sex chromo- somes, we here analyze transcriptomic data from arhinia and FSHD2 patient blood and muscle cells. We find that X-linked dosage compensation is maintained in these patients. In mice, SMCHD1 controls not only protocadherin (Pcdh) gene clusters, but also Hox genes critical for craniofacial development.
  • (SMCHD1) Regulates Gene Expression

    (SMCHD1) Regulates Gene Expression

    Structural Maintenance of Chromosome Hinge Domain Containing 1 (SMCHD1) regulates gene expression by Shabnam Massah B.Sc. (Microbiology and Immunology), Azad University, 2006 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Doctor of Philosophy Program Faculty of Health Sciences Ó Shabnam Massah 2017 SIMON FRASER UNIVERSITY Fall 2017 Approval Name: Shabnam Massah Degree: Doctor of Philosophy (Health Sciences) Title: Structural Maintenance of Chromosome Hinge Domain Containing 1 (SMCHD1) Regulates Gene Expression Examining Committee: Chair: Tania Bubela Professor Gratien Prefontaine Senior Supervisor Associate Professor Tim Beischlag Co-Supervisor Professor Esther Verheyen Supervisor Professor Department of Molecular Biology and Biochemistry Michel Leroux Supervisor Professor Department of Molecular Biology and Biochemistry Colby Zaph Supervisor Professor Department of Biochemistry and Molecular Biology Monash University Nadine Provencal Internal Examiner Assistant Professor Carolyn Brown External Examiner Professor Department of Medical Genetics University of British Columbia Date Defended/Approved: November 17, 2017 ii Abstract Eukaryotic cells evolved by packaging genomic DNA into chromatin where DNA is wrapped around histones. This significantly reduces random transcriptional events by providing a barrier for gene expression. In addition, chemical modifications of histones and cytosine residues on DNA greatly impact regulation of gene expression. Structural maintenance of chromosome hinge domain containing 1 (SMCHD1) is a chromatin modifier. SMCHD1 was originally recognized as essential for X chromosome inactivation and survival in female mice where it plays a critical role in methylation of a subset of CpG islands. Structural studies suggest that SMCHD1 interaction with HP1 binding protein, HBiX1, mediates heterochromatin formation over the X chromosome by linking two chromatin domains enriched for repressive histone marks.
  • Double SMCHD1 Variants in FSHD2: the Synergistic Effect of Two SMCHD1 Variants on D4Z4 Hypomethylation and Disease Penetrance in FSHD2

    Double SMCHD1 Variants in FSHD2: the Synergistic Effect of Two SMCHD1 Variants on D4Z4 Hypomethylation and Disease Penetrance in FSHD2

    European Journal of Human Genetics (2016) 24, 78–85 & 2016 Macmillan Publishers Limited All rights reserved 1018-4813/16 www.nature.com/ejhg ARTICLE Double SMCHD1 variants in FSHD2: the synergistic effect of two SMCHD1 variants on D4Z4 hypomethylation and disease penetrance in FSHD2 Marlinde L van den Boogaard1, Richard JFL Lemmers1, Pilar Camaño2, Patrick J van der Vliet1, Nicol Voermans3, Baziel GM van Engelen3, Adolfo Lopez de Munain2, Stephen J Tapscott4, Nienke van der Stoep5, Rabi Tawil6 and Silvère M van der Maarel*,1 Facioscapulohumeral muscular dystrophy (FSHD) predominantly affects the muscles in the face, trunk and upper extremities and is marked by large clinical variability in disease onset and progression. FSHD is associated with partial chromatin relaxation of the D4Z4 repeat array on chromosome 4 and the somatic expression of the D4Z4 encoded DUX4 gene. The most common form, FSHD1, is caused by a contraction of the D4Z4 repeat array on chromosome 4 to a size of 1–10 units. FSHD2, the less common form of FSHD, is most often caused by heterozygous variants in the chromatin modifier SMCHD1, which is involved in the maintenance of D4Z4 methylation. We identified three families in which the proband carries two potentially damaging SMCHD1 variants. We investigated whether these variants were located in cis or in trans and determined their functional consequences by detailed clinical information and D4Z4 methylation studies. In the first family, both variants in trans were shown to act synergistically on D4Z4 hypomethylation and disease penetrance, in the second family both SMCHD1 function- affecting variants were located in cis while in the third family one of the two variants did not affect function.
  • Smchd1 (NM 028887) Mouse Untagged Clone Product Data

    Smchd1 (NM 028887) Mouse Untagged Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC225114 Smchd1 (NM_028887) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Smchd1 (NM_028887) Mouse Untagged Clone Tag: Tag Free Symbol: Smchd1 Synonyms: 4931400A14Rik; AW554188; mKIAA0650; MommeD1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC225114 representing NM_028887 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCGGAGGGCGCCAGCGATCCCGCCGGCCTCTCGGAGGGATCTGGGAGAGATGGCGCCGTCGACG GCTGTAGGACGGTGTACTTGTTTGACCGGCGCGGGAAGGACTCGGAGCTAGGGGATCGCGCACTGCAGGT CTCGGAGCACGCGGACTACGCGGGGTTCCGCGCTTCTGTGTGTCAGACAATTGGCATTTCATCTGAAGAA AAGTTTGTTATTACAACTACAAGTAGGAAAGAAATTACCTGTAATAATTTTGACCACACTGTTAAAGATG GAGTCACTCTGTACCTGCTGCAGTCAGTTGACCAGTCACTACTGACGGCGACGAAAGAAAGAATTGACTT TCTACCTCACTACGACACTCTAGTTAAAAGTGGCATGTATGAGTATTATGCGAGTGAAGGACAGAATCCT TTGCCATTTGCTCTTGCAGAGTTAATCGACAATTCATTGTCAGCTACTTCTCGAAATAATGGTGTTAGGA GAATACAGATCAAATTGCTTTTTGATGAAACACAAGGAAAACCTGCTGTCGCAGTGGTAGATAATGGAAG AGGAATGACCTCTAAGCAGCTTAACAACTGGGCTGTGTATAGGCTGTCAAAATTTACAAGACAAGGTGAC TTTGAAAGTGATCACTCAGGGTATGTCCGGCCATTACCAGTACCACGCAGTTTGAACAGTGACATTTCCT ATTTTGGTGTTGGAGGCAAACAGGCTGTTTTCTTTGTTGGGCAATCAGCCAGAATGATAAGCAAGCCTAT CGACTCCAAGGATGTTCATGAGCTGGTGCTTTCTAAAGAAGATTTTGAGAAGAAGGAAAAAAATAAAGAG