DOCSLIB.ORG

Double SMCHD1 Variants in FSHD2: the Synergistic Effect of Two SMCHD1 Variants on D4Z4 Hypomethylation and Disease Penetrance in FSHD2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Double SMCHD1 Variants in FSHD2: the Synergistic Effect of Two SMCHD1 Variants on D4Z4 Hypomethylation and Disease Penetrance in FSHD2 European Journal of Human Genetics (2016) 24, 78–85 & 2016 Macmillan Publishers Limited All rights reserved 1018-4813/16 www.nature.com/ejhg ARTICLE Double SMCHD1 variants in FSHD2: the synergistic effect of two SMCHD1 variants on D4Z4 hypomethylation and disease penetrance in FSHD2 Marlinde L van den Boogaard1, Richard JFL Lemmers1, Pilar Camaño2, Patrick J van der Vliet1, Nicol Voermans3, Baziel GM van Engelen3, Adolfo Lopez de Munain2, Stephen J Tapscott4, Nienke van der Stoep5, Rabi Tawil6 and Silvère M van der Maarel*,1 Facioscapulohumeral muscular dystrophy (FSHD) predominantly affects the muscles in the face, trunk and upper extremities and is marked by large clinical variability in disease onset and progression. FSHD is associated with partial chromatin relaxation of the D4Z4 repeat array on chromosome 4 and the somatic expression of the D4Z4 encoded DUX4 gene. The most common form, FSHD1, is caused by a contraction of the D4Z4 repeat array on chromosome 4 to a size of 1–10 units. FSHD2, the less common form of FSHD, is most often caused by heterozygous variants in the chromatin modifier SMCHD1, which is involved in the maintenance of D4Z4 methylation. We identified three families in which the proband carries two potentially damaging SMCHD1 variants. We investigated whether these variants were located in cis or in trans and determined their functional consequences by detailed clinical information and D4Z4 methylation studies. In the first family, both variants in trans were shown to act synergistically on D4Z4 hypomethylation and disease penetrance, in the second family both SMCHD1 function- affecting variants were located in cis while in the third family one of the two variants did not affect function. This study demonstrates that having two SMCHD1 missense variants that affect function is compatible with life in males and females, which is remarkable considering its role in X inactivation in mice. The study also highlights the variability in SMCHD1 variants underlying FSHD2 and the predictive value of D4Z4 methylation analysis in determining the functional consequences of SMCHD1 variants of unknown significance. European Journal of Human Genetics (2016) 24, 78–85; doi:10.1038/ejhg.2015.55; published online 18 March 2015 INTRODUCTION facilitates the production of stable DUX4 mRNA due to the presence Facioscapulohumeral muscular dystrophy (FSHD; OMIM 158900) is a of a polymorphic DUX4 polyadenylation signal distal to the D4Z4 common myopathy in adults, with a recently reported prevalence of repeat array.8,13 D4Z4 chromatin relaxation on non-permissive ~ 1:8000.1 FSHD is clinically characterized by weakness of the facial, chromosomes lacking a DUX4 polyadenylation signal do not cause shoulder girdle, trunk and upper arm muscles, which can be FSHD in the absence of detectable levels of DUX4 mRNA.8,14 asymmetric, and progresses to involve humeral, anterior lower leg Autosomal dominant FSHD1 is the most common form of FSHD muscles and pelvic girdle muscles.2 The onset of the disease is typically (495%), in which D4Z4 chromatin relaxation and DUX4 expression in the second decade of life, but the disease progression and severity are caused by a contraction of the D4Z4 repeat array to a size of 1–10 are highly variable.3 units.15,16 In the uncommon form of FSHD (FSHD2), D4Z4 The genetic forms identified thus far, FSHD1 and FSHD2, are chromatin relaxation occurs in the absence of D4Z4 repeat array clinically indistinguishable.4 Both forms are associated with partial contraction.5 In FSHD1, chromatin relaxation and CpG hypomethyla- chromatin relaxation of the D4Z4 macrosatellite repeat array on the tion are restricted to the contracted allele, whereas in FSHD2 subtelomere of the long arm of chromosome 4 and transcriptional chromatin relaxation and CpG hypomethylation occur at the D4Z4 derepression of the D4Z4 unit-encoded DUX4 retrogene in skeletal repeat arrays of both copies of chromosome 4 and in the highly muscle.5–9 DUX4 is a germ line transcription factor that is normally homologous repeat arrays on chromosome 10.4,9 repressed in somatic cells.7 Its expression in skeletal muscle activates Heterozygous variants in the structural maintenance of chromosomes genes involved in germ line and early stem cell development, as well as flexible hinge domain containing 1 (SMCHD1) gene on chromosome 18 specific classes of repeat elements, and overexpression of DUX4 in account for the majority of FSHD2 cases.14 SMCHD1 is an atypical somatic cells causes cell death.10–12 member of the SMC gene superfamily, a family of proteins which is To cause FSHD, D4Z4 chromatin relaxation must occur on a involved in chromosome condensation and cohesion, genome main- specific genetic background of chromosome 4 (most often 4A161) that tenance and gene regulation.17–19 Chromatin immunoprecipitation 1Department of Human Genetics, Leiden University Medical Center, Leiden, The Netherlands; 2Neurosciences, BioDonostia Health Research Institute, Hospital Donostia, San Sebastián, Spain; 3Department of Neurology, Radboud University Medical Centre, Nijmegen, The Netherlands; 4Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, WA, USA; 5Department of Clinical Genetics, Leiden University Medical Center, Leiden, The Netherlands; 6Department of Neurology, University of Rochester Medical Center, Rochester, MN, USA *Correspondence: Professor SM van der Maarel, Department of Human Genetics, Leiden University Medical Center, Albinusdreef 2, Leiden 2333ZA, The Netherlands. Tel: +31 715269481; Fax: +31 715268285; E-mail: [email protected] Received 30 October 2014; revised 17 February 2015; accepted 20 February 2015; published online 18 March 2015 Double SMCHD1 variants in FSHD2 ML van den Boogaard et al 79 studies showed the presence of SMCHD1 on the D4Z4 array and its For D4Z4 methylation analysis genomic DNA was double digested with reduced binding to D4Z4 in SMCHD1 mutation carriers.14 SMCHD1 EcoRI (Thermo Fisher Scientific Inc., Waltham, MA, USA) and BglII variants can also modify the disease severity in FSHD1 families, (Fermentas, Thermo Fisher Scientific) overnight at 37 °C, and cleaved DNA explaining some of the clinical variability seen in FSHD.20 was purified using PCR extraction columns (NucleoSpin Gel and PCR Clean- fi As a measure of D4Z4 chromatin relaxation, often D4Z4 methylation up, Machery-Nagel/BIOKÉ, Leiden, The Netherlands). Puri ed DNA was then ≥ is used. We have established a reliable and informative measure of digested with FseI (New England Biolabs/BIOKÉ) for 4 h, separated by size on 0.8% agarose gels, transferred to a nylon membrane (Hybond XL, D4Z4 methylation by measuring the methylation of all D4Z4 arrays Amersham, GE Healthcare, Diegem, Belgium) by Southern blotting and probed simultaneously at a unique methylation-sensitive restriction site (FseI) using the p13E-11 32P-labeled probe. Probe signals were quantified using 14 fi in the D4Z4 unit. The methylation level at this site is signi cantly the Storm 820 Phosphorimager (Amersham) and ImageQuant TL software lower in FSHD2 compared with both FSHD1 and controls, and a (Amersham). The signal from the 4061-bp fragment (methylated) was divided threshold of 25% was established for FSHD2.14 Recently, we showed by the total amount of hybridizing fragments at 4061 bp and 3387 bp that D4Z4 methylation level at this site is repeat array size (unmethylated) to yield the average percentage of methylated FseI sites within dependent.21 We introduced a new methylation parameter, Delta1, the most proximal D4Z4 unit on all four D4Z4 arrays. The Delta1 and Delta2 which represents the difference between the experimentally observed scores were calculated as described in Lemmars et al.21 methylation and the predicted methylation level based on repeat size in controls. In SMCHD1 mutation carriers, the average Delta1 score is SMCHD1 variant analysis highly negative ranging between − 20 and − 45, suggesting a strong For the index cases, SMCHD1 variant analysis was performed by Sanger fi contribution of the variant to D4Z4 hypomethylation.21 Accordingly, a sequencing after PCR ampli cation of all coding exons using intronic primers second model was then fitted to predict the methylation in SMCHD1 at a position of at least 50 nucleotides from the splice donor or acceptor site. The SMCHD1 genomic sequence was obtained from Ensemble (build 37) variant carriers, which resulted in the Delta2 score. For SMCHD1 (GRCh37:18:2655286:2805615) (Genomic Refseq: NG_031972.1, Transcript variants that preserve the open-reading frame (ORF), a mean Delta2 Refseq: NM_015295.2). Exons were numbered like in NG_031972.1 and − fi score of 1.8% was found, which is signi cantly lower than the mean primers were published previously.21 The functional consequences of variants Delta2 of ORF-disrupting variants (mean 2.7%). This suggests that were predicted using Alamut Visual version 2.4 (Interactive Biosoftware, ORF-preserving variants are more deleterious for the maintenance of a Rouen, France). Identified variants are submitted to the Leiden Open Variation repressed D4Z4 chromatin state in somatic cells.21 Database (http://databases.lovd.nl/shared/individuals/SMCHD1: submission Several studies have so far identified disease-causing variants in IDs 00028967–00028973) SMCHD1 in approximately 70 FSHD2 families. Heterozygous disease- For individual 385–203, Sanger sequencing of exons 24 and 45 in relatives causing SMCHD1 variants are distributed over the entire SMCHD1 was used to identify whether the two SMCHD1 variants
Load more

Recommended publications
  • Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of Cpg Island Methylation on The
    Edinburgh Research Explorer Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of CpG Island Methylation on the Inactive X Chromosome Citation for published version: Gendrel, AV, Apedaile, A, Coker, H, Termanis, A, Zvetkova, I, Godwin, J, Montana, G, Taylor, S, Giannoulatou, E, Heard, E, Stancheva, I & Brockdorff, N 2012, 'Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of CpG Island Methylation on the Inactive X Chromosome', Developmental Cell, vol. 23, no. 2, pp. 265–279. https://doi.org/10.1016/j.devcel.2012.06.011 Digital Object Identifier (DOI): 10.1016/j.devcel.2012.06.011 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Developmental Cell General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 07. Oct. 2021 Developmental Cell Article Smchd1-Dependent and -Independent Pathways Determine Developmental Dynamics of CpG Island Methylation on the Inactive X Chromosome Anne-Valerie Gendrel,1,7,8 Anwyn Apedaile,3,8 Heather Coker,1 Ausma Termanis,4 Ilona Zvetkova,3,9 Jonathan Godwin,1 Y.
    [Show full text]
  • VU Research Portal
    VU Research Portal Genetic architecture and behavioral analysis of attention and impulsivity Loos, M. 2012 document version Publisher's PDF, also known as Version of record Link to publication in VU Research Portal citation for published version (APA) Loos, M. (2012). Genetic architecture and behavioral analysis of attention and impulsivity. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. E-mail address: [email protected] Download date: 28. Sep. 2021 Genetic architecture and behavioral analysis of attention and impulsivity Maarten Loos 1 About the thesis The work described in this thesis was performed at the Department of Molecular and Cellular Neurobiology, Center for Neurogenomics and Cognitive Research, Neuroscience Campus Amsterdam, VU University, Amsterdam, The Netherlands. This work was in part funded by the Dutch Neuro-Bsik Mouse Phenomics consortium. The Neuro-Bsik Mouse Phenomics consortium was supported by grant BSIK 03053 from SenterNovem (The Netherlands).
    [Show full text]
  • Myopia in African Americans Is Significantly Linked to Chromosome 7P15.2-14.2
    Genetics Myopia in African Americans Is Significantly Linked to Chromosome 7p15.2-14.2 Claire L. Simpson,1,2,* Anthony M. Musolf,2,* Roberto Y. Cordero,1 Jennifer B. Cordero,1 Laura Portas,2 Federico Murgia,2 Deyana D. Lewis,2 Candace D. Middlebrooks,2 Elise B. Ciner,3 Joan E. Bailey-Wilson,1,† and Dwight Stambolian4,† 1Department of Genetics, Genomics and Informatics and Department of Ophthalmology, University of Tennessee Health Science Center, Memphis, Tennessee, United States 2Computational and Statistical Genomics Branch, National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, United States 3The Pennsylvania College of Optometry at Salus University, Elkins Park, Pennsylvania, United States 4Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, United States Correspondence: Joan E. PURPOSE. The purpose of this study was to perform genetic linkage analysis and associ- Bailey-Wilson, NIH/NHGRI, 333 ation analysis on exome genotyping from highly aggregated African American families Cassell Drive, Suite 1200, Baltimore, with nonpathogenic myopia. African Americans are a particularly understudied popula- MD 21131, USA; tion with respect to myopia. [email protected]. METHODS. One hundred six African American families from the Philadelphia area with a CLS and AMM contributed equally to family history of myopia were genotyped using an Illumina ExomePlus array and merged this work and should be considered co-first authors. with previous microsatellite data. Myopia was initially measured in mean spherical equiv- JEB-W and DS contributed equally alent (MSE) and converted to a binary phenotype where individuals were identified as to this work and should be affected, unaffected, or unknown.
    [Show full text]
  • Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders
    Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2021 © 2021 Andrew H. Chiang All Rights Reserved Abstract Mechanisms Underlying Phenotypic Heterogeneity in Simplex Autism Spectrum Disorders Andrew H. Chiang Autism spectrum disorders (ASD) are a group of related neurodevelopmental diseases displaying significant genetic and phenotypic heterogeneity. Despite recent progress in ASD genetics, the nature of phenotypic heterogeneity across probands is not well understood. Notably, likely gene- disrupting (LGD) de novo mutations affecting the same gene often result in substantially different ASD phenotypes. We find that truncating mutations in a gene can result in a range of relatively mild decreases (15-30%) in gene expression due to nonsense-mediated decay (NMD), and show that more severe autism phenotypes are associated with greater decreases in expression. We also find that each gene with recurrent ASD mutations can be described by a parameter, phenotype dosage sensitivity (PDS), which characteriZes the relationship between changes in a gene’s dosage and changes in a given phenotype. Using simple linear models, we show that changes in gene dosage account for a substantial fraction of phenotypic variability in ASD. We further observe that LGD mutations affecting the same exon frequently lead to strikingly similar phenotypes in unrelated ASD probands. These patterns are observed for two independent proband cohorts and multiple important ASD-associated phenotypes. The observed phenotypic similarities are likely mediated by similar changes in gene dosage and similar perturbations to the relative expression of splicing isoforms.
    [Show full text]
  • A Quantitative Telomeric Chromatin Isolation Protocol Identifies Different Telomeric States
    ARTICLE Received 20 Aug 2013 | Accepted 31 Oct 2013 | Published 25 Nov 2013 DOI: 10.1038/ncomms3848 A quantitative telomeric chromatin isolation protocol identifies different telomeric states Larissa Grolimund1,2,*, Eric Aeby1,2,*, Romain Hamelin1,3, Florence Armand1,3, Diego Chiappe1,3, Marc Moniatte1,3 & Joachim Lingner1,2 Telomere composition changes during tumourigenesis, aging and in telomere syndromes in a poorly defined manner. Here we develop a quantitative telomeric chromatin isolation protocol (QTIP) for human cells, in which chromatin is cross-linked, immunopurified and analysed by mass spectrometry. QTIP involves stable isotope labelling by amino acids in cell culture (SILAC) to compare and identify quantitative differences in telomere protein com- position of cells from various states. With QTIP, we specifically enrich telomeric DNA and all shelterin components. We validate the method characterizing changes at dysfunctional tel- omeres, and identify and validate known, as well as novel telomere-associated polypeptides including all THO subunits, SMCHD1 and LRIF1. We apply QTIP to long and short telomeres and detect increased density of SMCHD1 and LRIF1 and increased association of the shel- terins TRF1, TIN2, TPP1 and POT1 with long telomeres. Our results validate QTIP to study telomeric states during normal development and in disease. 1 EPFL-Ecole Polytechnique Fe´de´rale de Lausanne, School of Life Sciences, CH-1015 Lausanne, Switzerland. 2 ISREC-Swiss Institute fro Experimental Cancer Research at EPFL, CH-1015 Lausanne, Switzerland. 3 Proteomics Core Facility at EPFL, CH-1015 Lausanne, Switzerland. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to J.L.
    [Show full text]
  • Conservation and Innovation in the DUX4-Family Gene Network
    © Copyright 2016 Jennifer L. Whiddon i Conservation and Innovation in the DUX4-family Gene Network Jennifer L. Whiddon A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2016 Reading Committee: Stephen J. Tapscott, Chair Michael Emerman Edith H. Wang Program Authorized to Offer Degree: Molecular and Cellular Biology ii University of Washington Abstract Conservation and Innovation in the DUX4-family Gene Network Jennifer L. Whiddon Chair of the Supervisory Committee: Professor Stephen J. Tapscott Department of Neurology Facioscapulohumeral dystrophy (FSHD) is caused by the mis-expression of the DUX4 transcription factor in skeletal muscle. Animal models of FSHD have been hampered by incomplete knowledge of the conservation of the DUX4 transcriptional program in other species besides humans. We demonstrate that both mouse Dux and human DUX4 activate repetitive elements and genes associated with cleavage-stage embryos when expressed in muscle cells of their respective species. Specifically, mouse DUX activated the transcription of MERV-L retrotransposons and genes such as Gm4340 (a.k.a. Gm6763), Slc34a2, Tcstv1/3, Tdpoz 3/4, Usp17la-e and Zfp352, all of which are characteristic of mouse two-cell embryos. Human DUX4 activated transcription of orthologs of mouse DUX-induced genes, including orthologs of genes characteristic of mouse two-cell embryos. Despite functional conservation, we found that the binding motifs of mouse DUX and human DUX4 have diverged. To better understand the extent of conservation or divergence between these factors and to assess current mouse models of FSHD, we expressed human DUX4 in mouse muscle cells.
    [Show full text]
  • SMCHD1 Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP57717
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 SMCHD1 Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP57717 Specification SMCHD1 Polyclonal Antibody - Product Information Application IHC-P Primary Accession A6NHR9 Reactivity Rat, Pig, Dog, Cow Host Rabbit Clonality Polyclonal Calculated MW 226374 SMCHD1 Polyclonal Antibody - Additional Information Paraformaldehyde-fixed, paraffin embedded Gene ID 23347 (Rat testis); Antigen retrieval by boiling in sodium citrate buffer (pH6.0) for 15min; Other Names Block endogenous peroxidase by 3% Structural maintenance of chromosomes hydrogen peroxide for 20 minutes; Blocking flexible hinge domain-containing protein 1, buffer (normal goat serum) at 37°C for 3.6.1.-, SMCHD1 (<a href="http://www.gen enames.org/cgi-bin/gene_symbol_report?hg 30min; Antibody incubation with (SMCHD1) nc_id=29090" Polyclonal Antibody, Unconjugated target="_blank">HGNC:29090</a>) (bs-19929R) at 1:400 overnight at 4°C, followed by operating according to SP Format Kit(Rabbit) (sp-0023) instructionsand DAB 0.01M TBS(pH7.4) with 1% BSA, 0.09% staining. (W/V) sodium azide and 50% Glyce Storage Store at -20 ℃ for one year. Avoid repeated freeze/thaw cycles. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 ℃. SMCHD1 Polyclonal Antibody - Protein Information Name SMCHD1 (HGNC:29090) Paraformaldehyde-fixed, paraffin embedded (Mouse brain); Antigen retrieval by boiling in Function sodium citrate buffer (pH6.0) for 15min; Non-canonical member of the structural Block endogenous peroxidase by 3% maintenance of chromosomes (SMC) hydrogen peroxide for 20 minutes; Blocking protein family that plays a key role in buffer (normal goat serum) at 37°C for epigenetic silencing by regulating 30min; Antibody incubation with (SMCHD1) chromatin architecture (By similarity).
    [Show full text]
  • Remotely Acting SMCHD1 Gene Regulatory Elements: in Silico Prediction and Identification of Potential Regulatory Variants in Patients with FSHD Mary B
    Mayes et al. Human Genomics (2015) 9:25 DOI 10.1186/s40246-015-0047-x PRIMARY RESEARCH Open Access Remotely acting SMCHD1 gene regulatory elements: in silico prediction and identification of potential regulatory variants in patients with FSHD Mary B. Mayes1, Taniesha Morgan2, Jincy Winston2, Daniel S. Buxton1, Mihir Anant Kamat1,5, Debbie Smith3, Maggie Williams3, Rebecca L. Martin1, Dirk A. Kleinjan4, David N. Cooper2, Meena Upadhyaya2 and Nadia Chuzhanova1* Abstract Background: Facioscapulohumeral dystrophy (FSHD) is commonly associated with contraction of the D4Z4 macro-satellite repeat on chromosome 4q35 (FSHD1) or mutations in the SMCHD1 gene (FSHD2). Recent studies have shown that the clinical manifestation of FSHD1 can be modified by mutations in the SMCHD1 gene within a given family. The absence of either D4Z4 contraction or SMCHD1 mutations in a small cohort of patients suggests that the disease could also be due to disruption of gene regulation. In this study, we postulated that mutations responsible for exerting a modifier effect on FSHD might reside within remotely acting regulatory elements that have the potential to interact at a distance with their cognate gene promoter via chromatin looping. To explore this postulate, genome-wide Hi-C data were used to identify genomic fragments displaying the strongest interaction with the SMCHD1 gene. These fragments were then narrowed down to shorter regions using ENCODE and FANTOM data on transcription factor binding sites and epigenetic marks characteristic of promoters, enhancers and silencers. Results: We identified two regions, located respectively ~14 and ~85 kb upstream of the SMCHD1 gene, which were then sequenced in 229 FSHD/FSHD-like patients (200 with D4Z4 repeat units <11).
    [Show full text]
  • Role of the Chromosome Architectural Factor SMCHD1 in X-Chromosome Inactivation, Gene Regulation, and Disease in Humans
    HIGHLIGHTED ARTICLE | INVESTIGATION Role of the Chromosome Architectural Factor SMCHD1 in X-Chromosome Inactivation, Gene Regulation, and Disease in Humans Chen-Yu Wang,*,† Harrison Brand,‡,§,**,†† Natalie D. Shaw,‡‡,§§ Michael E. Talkowski,‡,§,**,†† and Jeannie T. Lee*,†,1 *Department of Molecular Biology, ††Center for Human Genetic Research, and ‡‡Department of Medicine, Massachusetts General Hospital, Boston, Massachusetts 02114, †Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115, ‡Department of Neurology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114, §Program in Medical and Population Genetics and **Center for Mendelian Genomics, Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02142, §§National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina 27709 ORCID IDs: 0000-0002-3912-5113 (C.-Y.W.); 0000-0001-7786-8850 (J.T.L.) ABSTRACT Structural maintenance of chromosomes flexible hinge domain-containing 1 (SMCHD1) is an architectural factor critical for X-chromosome inactivation (XCI) and the repression of select autosomal gene clusters. In mice, homozygous nonsense mutations in Smchd1 cause female-specific embryonic lethality due to an XCI defect. However, although human mutations in SMCHD1 are associated with congenital arhinia and facioscapulohumeral muscular dystrophy type 2 (FSHD2), the diseases do not show a sex- specific bias, despite the essential nature of XCI in humans. To investigate whether there is a dosage imbalance for the sex chromo- somes, we here analyze transcriptomic data from arhinia and FSHD2 patient blood and muscle cells. We find that X-linked dosage compensation is maintained in these patients. In mice, SMCHD1 controls not only protocadherin (Pcdh) gene clusters, but also Hox genes critical for craniofacial development.
    [Show full text]
  • (SMCHD1) Regulates Gene Expression
    Structural Maintenance of Chromosome Hinge Domain Containing 1 (SMCHD1) regulates gene expression by Shabnam Massah B.Sc. (Microbiology and Immunology), Azad University, 2006 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Doctor of Philosophy Program Faculty of Health Sciences Ó Shabnam Massah 2017 SIMON FRASER UNIVERSITY Fall 2017 Approval Name: Shabnam Massah Degree: Doctor of Philosophy (Health Sciences) Title: Structural Maintenance of Chromosome Hinge Domain Containing 1 (SMCHD1) Regulates Gene Expression Examining Committee: Chair: Tania Bubela Professor Gratien Prefontaine Senior Supervisor Associate Professor Tim Beischlag Co-Supervisor Professor Esther Verheyen Supervisor Professor Department of Molecular Biology and Biochemistry Michel Leroux Supervisor Professor Department of Molecular Biology and Biochemistry Colby Zaph Supervisor Professor Department of Biochemistry and Molecular Biology Monash University Nadine Provencal Internal Examiner Assistant Professor Carolyn Brown External Examiner Professor Department of Medical Genetics University of British Columbia Date Defended/Approved: November 17, 2017 ii Abstract Eukaryotic cells evolved by packaging genomic DNA into chromatin where DNA is wrapped around histones. This significantly reduces random transcriptional events by providing a barrier for gene expression. In addition, chemical modifications of histones and cytosine residues on DNA greatly impact regulation of gene expression. Structural maintenance of chromosome hinge domain containing 1 (SMCHD1) is a chromatin modifier. SMCHD1 was originally recognized as essential for X chromosome inactivation and survival in female mice where it plays a critical role in methylation of a subset of CpG islands. Structural studies suggest that SMCHD1 interaction with HP1 binding protein, HBiX1, mediates heterochromatin formation over the X chromosome by linking two chromatin domains enriched for repressive histone marks.
    [Show full text]
  • Smchd1 (NM 028887) Mouse Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC225114 Smchd1 (NM_028887) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Smchd1 (NM_028887) Mouse Untagged Clone Tag: Tag Free Symbol: Smchd1 Synonyms: 4931400A14Rik; AW554188; mKIAA0650; MommeD1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC225114 representing NM_028887 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCGGAGGGCGCCAGCGATCCCGCCGGCCTCTCGGAGGGATCTGGGAGAGATGGCGCCGTCGACG GCTGTAGGACGGTGTACTTGTTTGACCGGCGCGGGAAGGACTCGGAGCTAGGGGATCGCGCACTGCAGGT CTCGGAGCACGCGGACTACGCGGGGTTCCGCGCTTCTGTGTGTCAGACAATTGGCATTTCATCTGAAGAA AAGTTTGTTATTACAACTACAAGTAGGAAAGAAATTACCTGTAATAATTTTGACCACACTGTTAAAGATG GAGTCACTCTGTACCTGCTGCAGTCAGTTGACCAGTCACTACTGACGGCGACGAAAGAAAGAATTGACTT TCTACCTCACTACGACACTCTAGTTAAAAGTGGCATGTATGAGTATTATGCGAGTGAAGGACAGAATCCT TTGCCATTTGCTCTTGCAGAGTTAATCGACAATTCATTGTCAGCTACTTCTCGAAATAATGGTGTTAGGA GAATACAGATCAAATTGCTTTTTGATGAAACACAAGGAAAACCTGCTGTCGCAGTGGTAGATAATGGAAG AGGAATGACCTCTAAGCAGCTTAACAACTGGGCTGTGTATAGGCTGTCAAAATTTACAAGACAAGGTGAC TTTGAAAGTGATCACTCAGGGTATGTCCGGCCATTACCAGTACCACGCAGTTTGAACAGTGACATTTCCT ATTTTGGTGTTGGAGGCAAACAGGCTGTTTTCTTTGTTGGGCAATCAGCCAGAATGATAAGCAAGCCTAT CGACTCCAAGGATGTTCATGAGCTGGTGCTTTCTAAAGAAGATTTTGAGAAGAAGGAAAAAAATAAAGAG
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]