Downloaded From

Home , Nyctophilus major, Trypanosoma irwini

RESEARCH REPOSITORY

This is the author’s final version of the work, as accepted for publication following peer review but without the publisher’s layout or pagination. The definitive version is available at:

https://doi.org/10.1017/S0031182020001845

Austen, J.M., Van Kampen, E., Egan, S.L., O'Dea, M.A., Jackson, B., Ryan, U.M., Irwin, P.J. and Prada, D. (2020) First report of Trypanosoma dionisii (Trypanosomatidae) identified in Australia. Parasitology

https://researchrepository.murdoch.edu.au/id/eprint/58241

First report of Trypanosoma dionisii (Trypanosomatidae) identified in Australia

Jill M. Austen1, Esther Van Kampen2, Siobhon L. Egan1, Mark A. O‟Dea2, Bethany Jackson2,

Una M. Ryan1, Peter J. Irwin1, Diana Prada2

Author affiliations

1Vector and Waterborne Pathogens Research Group, College of Science, Health, Engineering

and Education, Murdoch University, Perth 6150, Australia

2School of Veterinary Medicine, Murdoch University, Perth, WA 6150, Australia

Correspondence: Dr. Jill M. Austen; ORCID ID: https://orcid.org/0000-0002-1826-1634

Vector and Waterborne Pathogens Research Group, College of Science, Health, Education

and Engineering, Murdoch University, Perth, WA, 6150, Australia

Email: [email protected]

Tel: +61 8 9360 6314. Fax: +61 8 9310 4144.

Running title: Trypanosoma dionisii identified and characterised in native Australian bats

This is an Accepted Manuscript for Parasitology. This version may be subject to change during the production process. DOI: 10.1017/S0031182020001845

Downloaded from https://www.cambridge.org/core. Murdoch University, on 19 Oct 2020 at 05:31:09, subject to the Cambridge Core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0031182020001845

Abstract

Trypanosomes are blood-borne parasites that can infect a variety of different vertebrates,

including animals and humans. This study aims to broaden scientific knowledge about the

presence and biodiversity of trypanosomes in Australian bats. Molecular and morphological

analysis was performed on 86 blood samples collected from seven different species of

microbats in Western Australia. Phylogenetic analysis on 18S rDNA and glycosomal

glyceraldehyde phosphate dehydrogenase (gGAPDH) sequences identified Trypanosoma

dionisii in five different Australian native species of microbats; Chalinolobus gouldii,

Chalinolobus morio, Nyctophilus geoffroyi, Nyctophilus major and Scotorepens balstoni. In

addition, two novel, genetically distinct T. dionisii genotypes were detected and named T.

dionisii genotype Aus 1 and T. dionisii genotype Aus 2. Genotype Aus 2 was the most

prevalent and infected 20.9% (18/86) of bats in the present study, while genotype Aus 1 was

less prevalent and was identified in 5.8% (5/86) of Australian bats. Morphological analysis

was conducted on trypomastigotes identified in blood films, with morphological parameters

consistent with trypanosome species in the subgenus Schizotrypanum. This is the first report

of T. dionisii in Australia and in Australian native bats, which further contributes to the global

distribution of this cosmopolitan bat trypanosome.

Key words

Australia, Trypanosoma dionisii, microbats, Chalinolobus gouldii, Chalinolobus morio,

Nyctophilus geoffroyi, Nyctophilus major, Scotorepens balstoni

Introduction

Since the 1900s, numerous trypanosome species have been identified worldwide, infecting all

classes of vertebrates, with the majority appearing to cause no disease to their hosts (Hoare,

1972; Tyler and Engman, 2001; Hamilton et al., 2007). Bats (order: Chiroptera) evolved ~50-

52 million years ago during the early Eocene period and comprise ~20% of extant mammals

(Teeling et al., 2005). Bats are among the most common hosts of a large variety of

trypanosome species worldwide, with the subgenus Schizotrypanum comprising the majority

of the trypanosomes reported in bats throughout South America, Europe, Africa and Asia,

(Hamilton et al., 2012b; Lima et al., 2013; Mafie et al., 2018; Wang et al., 2019).

Trypanosomes in Chiroptera were first described in Miniopterus schreibersii from Italy by

Dionisi in 1899 (Baker et al., 1972). Since then over 30 species of trypanosomes have been

reported in more than 100 bat species, including well defined Trypanosoma cruzi,

Trypanosoma vespertilionis, Trypanosoma rangeli and the globally distributed Trypanosoma

dionisii (Beltz, 2017).

Relatively little is known about Trypanosoma species in native Australian bat species.

Trypanosoma pteropi was the first described trypanosome in Pteropus sp. from north

Queensland (Breinl, 1913). Similar trypanosomes were characterised by Mackerras (1959) in

Pteropus gouldii, however they were described as smaller in length, had a pointed anterior

and a rounded kinetoplast, similar to T. vespertilionis from European bats, which shares

biological characteristics with T. cruzi with both species having the ability to reproduce in

organs (Mackerras, 1959). Mackerras (1959) also described a very tiny and slender

trypanosome named Trypanosoma hipposideri from Hipposideros ater captured in northern

Queensland. It was reported to be smaller than T. vespertilionis and T. pteropi, with a large

distinctive kinetoplast and delicate short free flagellum. More recently, the first molecular

study identified a high prevalence of Trypanosoma vegrandis in two species of pteropid bats

(Pteropus alecto and Pteropus scapulatus) and two species of microbats (Chalinolobus

gouldii and Nyctophilus geoffroyi) from Western Australian (Austen et al., 2015).

Trypanosoma teixeirae from a native Australian bat, P. scapulatus was also recently

described by Mackie et al. (2017) and further characterized by Barbosa et al. (2016). This

trypanosome is longer in length than both T. pteropi and T. hipposideri and genetically similar

to Trypanosoma rangeli and Trypanosoma minasense (Mackie et al., 2017). Interestingly T.

teixeirae is the first bat trypanosome in Australia to cause clinical disease in its host, with

descriptions of icterus and anaemia (Mackie et al., 2017).

The aim of the present study was to investigate trypanosome species in seven species

of microbats from the South-West Botanical Province of Western Australia, to gain insight

into the prevalence and genetic diversity of trypanosomes in these species.

Methods

Field sample collection

Animal work was performed with approval from the Murdoch University Animal Ethics

Committee under permit #R2882/16. Field work was conducted between the 30th of

November to the 9th of December 2016 at Charles Darwin Reserve (-29.581817, 117.001820)

and Mount Gibson Wildlife Sanctuary (-29.630577, 117.277211), located within the south-

west region of Western Australia, a globally recognised biodiversity hotspot (Myers et al.,

2000). Bats were caught using harp traps (Faunatech, Australia) and mist nets (Ecotone,

Australia) set over water points at sunset. The mist nets were monitored constantly with bats

removed from the nets immediately after capture. Harp traps were left unmonitored for

approximately three hours and then checked for individuals captured in the protective

bagging.

Sampling occurred at the capture site with no individuals being held for greater than

two hours and handling limited to 5 minutes per individual to minimise stress. Palpably

pregnant females were released without sampling. Bats were identified to species level using

published keys (Churchill, 2008). Blood samples were collected from 86 microbats

representing 7 known species; Chalinolobus gouldii (n=53), Chalinolobus morio (n=3),

Nyctophilus geoffroyi (n=16), Nyctophilus major (n=1), Ozimops sp. (n=2), Scotorepens

balstoni (n=7) and Vespadelus baverstocki (n=4). Ten microlitres of blood was collected from

the uropatagial vein using a 25 gauge needle and a micropipette, and then diluted in sterile

1:10 phosphate buffered saline. Individual blood smears were made, air dried, and fixed in

100% methanol. Blood samples were stored at 4°C in the field and later stored at − 20 °C

until use.

DNA extraction and molecular analysis

DNA was extracted from ethylene diamine tetraacetic acid (EDTA)-preserved whole blood

using a NucleoMag VET kit (Macherey-Nagel, Germany) on an automated MagMax 96

processor (Life Technologies Corporation, U.S.A.) according to the manufacturer‟s

instructions. Partial fragments of Trypanosoma spp. DNA were amplified from the 18S rDNA

and gGAPDH loci using primers previously described by Maslov et al. (1996) and McInnes et

al. (2009), (Table 1). Initially, samples were screened using a single round PCR to amplify a

small fragment (~350bp) of Trypanosoma DNA using the 18S rDNA primer set S825F and

S662R. Once sequences were obtained, a subsample of positives representing different

genotypes in the initial targeted PCR assay, were re-amplified to obtain a larger product size

using the nested and hemi nested 18S rDNA and gGAPDH primer sets respectively. In

addition, bats were also screened for T. vegrandis as previously described by Austen et al.

(2015).

The 18S rDNA PCR assays were performed in 25 µl volumes and contained

approximately 50 ng of gDNA, 0.4 µM of each primer, and 12.5 µl GoTaq® Green master

mix (Promega, U.S.A.). A 1 µl aliquot of the primary PCR product was used as the DNA

template for the nested round of PCR. All PCR cycling conditions consisted of an initial cycle

of denaturation at 95°C for 5 min, 50°C for 2 min, 72°C for 4 min followed by 40 cycles of

denaturation at 94°C for 30 sec, annealing at 52°C (primary reaction) or 55°C (secondary

reaction) for 30 sec, and extension at 72°C for 2.20 min (primary reaction) or 1 min

(secondary), followed by a final extension at 72°C for 7 min. The PCR product was run on a

1.5% agarose gel stained with SYBR safe (Invitrogen, U.S.A.) and viewed under UV

illumination. Amplified PCR products of the appropriate size were excised from the gel using

a sterile scalpel blade for each band to prevent cross contamination and purified using an in-

house filter tip method and used for sequencing without any further purification as previously

described (Yang et al., 2013). All PCR amplicons were submitted to the Australian Genome

Research Facility (Perth, Western Australia) for unidirectional sequencing. Sequences were

imported and trimmed in Geneious v10 (Kearse et al., 2012) and then subject to BLAST

analysis using BLASTN 2.10.0+ (Zhang et al., 2002) against nucleotide collection (nt)

database (Morgulis et al., 2008) to identify most similar species and genotypes.

Prevalence

The prevalence of trypanosomes in bat blood samples from each host species was calculated

based on the number positive at the 18S rDNA locus, with 95% confidence intervals

calculated assuming a binomial distribution using the software Quantitative Parasitology 3.0

(Rozsa et al., 2000).

Phylogenetic analysis

Reference sequences for members within the T. cruzi clade were retrieved from GenBank

(Benson et al., 2017) (available in Supplementary Table 1) and aligned with sequences

obtained in the present study using MUSCLE (Edgar, 2004). The 18S rDNA alignment was

then curated using gblocks (Castresana, 2000) with less stringent parameters (only reference

sequences >1kb were retained for phylogenetic analysis). A 1,350 bp region of the 18S rDNA

locus and a 674 bp region of the gGAPDH locus were then used for phylogenetic purposes.

Phylogenies were inferred using the maximum likelihood (ML) and Bayesian inferences (BI).

The ML analysis was conducted in MEGA 7 (Kumar et al., 2016), the optimal model was

chosen using the model selection feature. ML phylogenies were conducted using the General

Time Reversible (GTR) (Nei and Kumar, 2000) + Gamma (G) (0.05) model for 18S rDNA

and concatenated 18S rDNA and GAPDH sequences (2024 bp) while the Tamura 3-parameter

(TN92) (Tamura, 1992) + G (0.29) model was used for gGAPDH, with 5,000 bootstrap

replicates. The BI analysis was conducted in MrBayes v3.2.6 (Ronquist et al., 2012), using

the GTR + G model for both genes with a MCMC length of 1,100,00, subsampling every 200

iterations, and a burn in rate of 25%. The reptile trypanosome, Trypanosoma varani was used

as an outgroup in all analyses.

Morphological analysis

Thin blood smears were stained with Modified Wright–Giemsa (Hematek® Stain Pak) using

a Hema-Tek SlideStainer (Ames Company Division, Miles Laboratories Pty Ltd., Springvale

Victoria, Australia) and examined for the presence of trypanosomes. The slides were mounted

using DPX neutral mounting medium (LabChem, Victoria, Australia) and a coverslip applied.

Digital light micrograph images of trypomastigotes were taken at ×1000 magnification using

Image-Pro Express software (Media Cybernetics, Inc., Bethesda, Maryland, U.S.A.).

Morphological measurements including total length (TL: length of body measured along the

mid-line including free flagellum), breadth (B: maximum breadth measured at the level of the

nucleus including undulating membrane), kinetoplast to nucleus (KN: distance between the

kinetoplast and posterior edge of the nucleus), nucleus to anterior (NA: distance between the

anterior edge of the nucleus and the anterior end of the body), posterior to kinetoplast (PK:

distance between the posterior end and the kinetoplast) and free flagellum (FF: length of the

free flagellum) were measured using Image J (Schneider et al., 2012) and the mean, standard

error (±) and range calculated.

Results

Prevalence of trypanosomes in microbats

Polymerase chain reaction (gel image provided in Supplementary material, Fig. S1),

sequencing and phylogenetic analysis of partial consensus DNA fragments of the 18S rDNA

and gGAPDH locus identified T. dionisii in Australian microbats. The overall prevalence of

T. dionisii in microbats was 26.7% (23/86) with T. dionisii detected in C. gouldii, C. morio, N.

geoffroyi, N. major and S. balstoni. No trypanosomes were detected in Ozimops. sp or V.

baverstocki. Sequencing and phylogenetic analysis identified two different genotypes named

T. dionisii genotype Aus 1 and T. dionisii genotype Aus 2 and were differentiated by the

presence of two single nucleotide polymorphisms (SNPs) over the V7 hypervariable region

(~350 bp) of the 18S rDNA loci. Genotype Aus 2 was the most prevalent with 20.9% (18/86)

of the bats infected, while genotype Aus 1 was less prevalent and infected 5.8% (5/86) of

bats. Chalinolobus morio, and N. geoffroyi were only infected with genotype Aus 1, while C.

gouldii, and N. major were only infected with genotype Aus 2. Both Aus genotypes 1 and 2

were detected in S. balstoni (Table 2). Trypanosoma vegrandis was not detected in any of the

bats screened by PCR and microscopy.

Phylogenetic analysis

The phylogenetic relationship of the Australian T. dionisii to other Trypanosoma species at

the 18S rDNA (Fig. 1), gGAPDH (Fig. 2) and concatenated 18S rDNA and gGAPDH (Fig. 3)

sequenced regions, showed similar tree topologies. The two Australian T. dionisii genotypes

at the 18S rDNA locus were 99.9 % percent similar to one another and exhibited 3 single

nucleotide polymorphisms (SNP‟s) across 1,459 bp of sequence. The Australian T. dionisii

genotypes clustered within the T. cruzi clade and grouped together with other T. dionisii

isolates including TryCC 211 (FJ001666) from Brazil, KTD (LC326397) from Japan, P3

(AJ009151) from United Kingdom (UK) and PJ (AJ009152) from Belgium. Both Australian

genotypes 1 and 2 showed a close association to the UK (P3) and Belgium (PJ) isolates,

clustering within the T. dionisii clade A. Trypanosoma dionisii genotype Aus 1 exhibited

99.9% similarity to trypanosome isolates PJ and P3 and T. dionisii genotype Aus 2 exhibited a

100% similarity to PJ and P3 isolates from Pipistrellus pipistrellus European bats. The partial

18S rDNA sequences generated in the present study have been submitted to GenBank under

accession MT533284 (T. dionisii genotype Aus 1) and MT533287 (T. dionisii genotypes Aus

2).

At the gGAPDH locus, the Australian T. dionisii genotypes exhibited a 97.6 %

homology to one another with 16 SNPs across 674 bp of gGAPDH sequence. The

Trypanosoma tree topology for gGAPDH, was similar to the 18S rDNA phylogeny, with the

Australian T. dionisii genotypes grouping together within the T. dionisii clade with isolates

from China (MH393936), United Kingdom (FN599056), Brazil (GQ140362), and Japan

(LC326399). The T. dionisii genotypes Aus 1 and Aus 2 were most homologous to T. dionisii

isolate Z3126 (FN599054) from an English bat (Pipistrellus pygmaeus) with genetic

similarities of 97.9% and 99.4% respectively. The partial gGAPDH sequences generated in

the present study have been submitted to GenBank under accession MT536207 (T. dionisii

genotype Aus 1) and MT536209 (T. dionisii genotypes Aus 2). The Trypanosoma tree

topology for the concatenated sequences produced similar results to both the 18S rDNA and

gGAPDH phylogenies, with the Australian T. dionisii genotypes grouping together within the

T. dionisii A clade, together with T. dionisii P3 isolate from the UK. Unfortunately, no 18S

rDNA and gGAPDH sequences were available for the T. dionisii European isolates Z3126

and PJ respectively.

Morphology

Out of the 23 bats positive for T. dionisii, trypomastigote stages were identified in only 3 bats

by blood film analysis. Bat isolate T1-2016-1031 from a S. balstoni microbat (sequence typed

as genotype Aus 1) and bat isolate T1-2016-2058 and T1-2016-2102 from C. gouldii

microbats (sequence typed as genotype Aus 2) presented with typical trypomastigote stages

(Fig. 4). T. dionisii showed similar morphology to previously described trypomastigotes from

Schizotrypanum bat species. The Australian T. dionisii isolates were slender with a clearly

defined rounded kinetoplast, positioned at the posterior end of the trypomastigote, while an

elongated nuclear region was located towards the anterior end. The nucleus was positioned at

the very anterior tip for T. dionisii genotype Aus 2 isolates and therefore nucleus to anterior

distance (NA) measurements could not be determined, as the anterior end was not clearly

visible. The undulating membrane was narrow for each of the Aus genotypes and a free

flagellum was present at the anterior end of the trypanosome. The morphological parameters

were measured for each T. dionisii Aus genotype and are presented in Table 3. Morphometric

analysis revealed that trypomastigotes of T. dionisii from Australia are similar to T.

hipposideri with overlaps in morphological measurements (Table 4.). There were no

significant differences between TL, KA, NA and FF, but T. hipposideri was larger in breadth

and PK compared to Australian T. dionisii (p<0.01).

Discussion

The present study reports the discovery of T. dionisii in Australia for the first time and is also

the first report of this parasite in native Australian bats. Trypanosoma dionisii was identified

in five different Australian microbat species, C. gouldii, C. morio, N. geoffroyi, N. major, and

S. balstoni from the southwest of Western Australia. Vespadelus baverstocki and Ozimops sp

were negative for T. dionisii although the small sample sizes of these species is a confounding

factor. The high prevalence of 5/7 Australian native bat species infected with T. dionisii

indicates low host specificity supporting the cosmopolitan nature of T. dionisii.

Interestingly two different genotypes of T. dionisii were detected in Australia; these

genotypes tended to be restricted to individual bat species with C. morio and N. geoffroyi

infected with genotype Aus 1 and C. gouldii and N. major infected with genotype Aus 2,

whereas S. balstoni was infected with both types. These differences may be due to the

opportunistic nature of the sampling since C. gouldii had the highest capture rate of 53

individuals out of the total 86 individuals (Table 2). To determine the true prevalence of T.

dionisii and its genotypes in native Australian bats, larger numbers are needed to reduce

sampling bias. Trypanosoma vegrandis was not detected in any of the bats sampled in this

study, which is surprising given the high prevalence detected previously by Austen et al.

(2015). These differences maybe a result of the geographical location and habitats from which

the bats were sourced. The bats from the present study were captured in the Northern

wheatbelt region within the Southwest Botanical Province of Western Australia, whereas the

T. vegrandis positive bats from Austen et al. (2015) were sampled from the semi-urban Perth

hills region of Western Australia. These two regions exhibit vastly different climatic

conditions and land use regimes with large areas of habitat fragmentation separating them.

Aside from potential environmental or landscape factors, the reason for this discrepancy in

prevalence is unknown.

Trypanosoma dionisii is globally distributed and has been described in Chiroptera

from North America, South America, Europe, Africa, and more recently Asia (Hamilton et

al., 2012b; Lima et al., 2013; Hodo et al., 2016; Espinosa-Alvarez et al., 2018; Mafie et al.,

2018; Wang et al., 2019). The discovery of T. dionisii in Australia now broadens its range to

include a sixth continent. The prevalence of T. dionisii in Australian bats in the present study

was 26.7%; much higher than 9.6% (16/154) reported in bat species from England (Hamilton

et al., 2012a) and also in Asia, where a 10.3% (13/126) prevalence was detected in E.

serotinus and Myotis pequinius bats from China (Wang et al., 2019), and 2.1 % (2/94) in

Miniopterus fuliginosus bats from Japan (Mafie et al., 2018). Only a small percentage of T.

dionisii (1.5% -9/593) has been detected in various bat species from Texas, USA (Hodo et al.,

2016).

The geographical origin of the T. cruzi clade is the subject of debate. Currently, the

clade is composed of two main sister phylogenetic lineages; one represented by the subgenus

Schizotrypanum, harbouring T. cruzi in bats and mammals, and other members of this group

(T. cruzi marinkellei, T. erneyi and T. dionisii), all of which are restricted to bats. The second

lineage consists of the species T. rangeli, which has a broad mammalian host range, including

humans, T. conorhini which infects rodents and T. vespertilionis, restricted to bats (Cavazzana

et al., 2010; Garcia et al., 2012; Lima et al., 2012; Espinosa-Alvarez et al., 2018; Wang et al.,

2019). The phylogenetic placement of an Australian marsupial trypanosome T. noyesi

(originally known as T. sp. H25) within the T. cruzi clade together with species predominately

from South America, prompted a “southern supercontinent” hypothesis by Stevens et al.

(1998) who proposed that ancestral T. c. cruzi speciated in marsupials after the separation of

South America from the Australian continent approximately 40 million years ago (Stevens et

al., 1998). In contrast, Hamilton et al. (2012b) proposed the “bat seeding hypothesis”, which

proposes that bats are the ancestral hosts of the T. cruzi clade and that ancestral trypanosomes

evolved into terrestrial placental mammalian and marsupial hosts over time, resulting in new

linages within the clades (Hamilton et al., 2012b; Lima et al., 2012). The close genetic

relationship of the Australian T. dionisii to T. dionisii isolates PJ, P3 and Z3126 from Europe

would seem to support Hamilton‟s bat seeding theory, with the likelihood that European Old

World trypanosomes seeded into Australian mammalian species.

Furthermore, recent studies also show a closer genetic relationship between Australian

trypanosomes and those found in other regions of the world, than with each other (Hamilton

et al., 2012b; Lima et al., 2012). For example, Trypanosoma copemani, which infects various

Australian marsupials shares genetic similarities with Trypanosoma pestanai from English

badgers (Noyes et al., 1999; Austen et al., 2009), while Trypanosoma lewisi isolated from an

Australian native rat shares a close genetic relationship to T. lewisi from England (Egan et al.,

2020). In addition, another trypanosome from an indigenous Australian bird, the currawong

(Strepera sp.) was closely related to trypanosomes isolated from European birds and their

vectors (Hamilton et al., 2005).

A study by Hamilton et al. (2012a) on T. dionisii from English bats detected two

different genotypes which were subdivided into two major clades, with type A found only in

English bats and type B identified in bats from Brazil and England. In the present study, the

Australian T. dionisii isolates grouped within the T. dionisii type A described by Hamilton et

al. (2012a), suggesting that T. dionisii from Australian bats has indeed descended from

European bat trypanosomes. In addition, the 100% homology of T. dionisii genotype Aus 2

(B2086) and the 99.9% homology of T. dionisii genotype Aus 1 to both PJ and P3 isolates

from Belgium and the UK respectively, at the 18S rDNA locus, suggest the movement of this

bat trypanosome when bat species began to diverge as the result of the continents breaking

away. Unfortunately, no sequence for PJ at the gGAPDH locus was available for phylogenetic

comparison, so isolate Z3125 from a UK bat (Pipistrellus pygmaeus) was used instead. As

with the 18S rDNA, phylogenetic analysis at the gGAPDH locus showed that genotype Aus 2

exhibited the greatest homology to English bat isolates with 99.4% homology to P3 and

Z3126. The T. dionisii genotype Aus 1 was less homologous at 97.9% to the same English

isolates. How these „English‟ bat trypanosomes have established in Australia is uncertain,

with the precise route of parasite movement unknown. The grouping of T. dionisii from Asian

bats into the T. dionisii B clade (in contrast to the T. dionisii A clade, in which both the

Australian T. dionisii genotypes Aus 1 and 2 grouped), complicates the rationale that ancestral

bats may have travelled over millennia from Europe via Asia and then into Australia. An

alternative scenario is the movement of infected bats across different continents by

anthropogenic transport (Hamilton et al., 2012a). For example, a study by Constantine (2003)

cited several reports in which bats have been inadvertently carried across landmasses by

humans, by roosting in aeroplanes and/or ships. Presently it is unclear how T. dionisii entered

Australia and established in native bat species. Additional sampling, analyses and

evolutionary clock modelling would be needed to build up a likely scenario.

From a morphological perspective, Trypanosoma species of the subgenus

Schizotrypanum are indistinguishable from each other. They all conform in morphology and

in their lifecycles to the type-specimen Trypanosoma (Schizotrypanum) cruzi (Hoare, 1972).

They are dimorphic parasites with both slender and broad forms. Typically, their

trypomastigotes are relatively small, curved, and have a distinctive round to oval kinetoplast.

Based on overall morphological characteristics, the trypanosomes of the Australian T. dionisii

aligns with the general descriptions of trypomastigotes previously described for the subgenus

Schizotrypanum. The Australian isolates have a large distinctive round kinetoplast, are small

and slender and range in total length between 13.43 – 19.44 µm. In comparison to other

described Australian bat trypanosomes, T. dionisii from native Australian bats, are smaller in

size than both T. teixeirae and T. pteropi, yet larger and phenotypically different to T.

vegrandis. Morphological parameters described for Australian T. dionisii were similar to

those of T. hipposideri and fell within or close to the range reported by Mackerras (1959).

General morphological comparisons between the Australian and Asian T. dionisii isolates

could not be determined, as no circulating blood trypomastigotes, (referred to as the true

diagnostic stage (Hoare, 1972)) were reported for the Asian isolates (Mafie et al., 2018; Wang

et al., 2019).

Bats are often parasitized by multiple species of micro - and macroparasites, given

their social behaviour, and lifestyle (Szentiványi et al., 2019). Trypanosomes are digenetic

parasites, with a life-cycle that involves two hosts (Hoare, 1972). As a rule, the geographical

distribution of the parasites coincides with that of their vectors and is determined by both

favourable ecological and climatic conditions (Hoare, 1972). Currently the only vectors

known to transmit T. dionisii are Cimicid (Cimicidae) bugs, flightless insects commonly

referred to as bed/bat bugs (Gardner and Molyneux, 1988; Hamilton et al., 2012a; Dario et

al., 2016). These insects are able to transmit various pathogens, including species of bat

trypanosomes with Stricticimex brevispinosus reported to transmit Trypanosoma leleupi

(Gardner and Molyneux, 1988). The bats in the present study were seen to be infested with

bat flies (Nycteribiids), which are common ectoparasites found on most species of bats

(Hornok et al., 2012; Szentiványi et al., 2019). These flies are obligate hematophagous

dipterans and play an important role in the transmission and maintenance of bat pathogens.

Bacteria, blood parasites (e.g. Polychromophilus spp.), fungi and viruses have all been

identified in bat flies, consistent with their vectorial potential (Szentiványi et al., 2019). The

route of transmission for Australian T. dionisii is currently unknown, however the bat fly is

the most common ectoparasite found on bats, a partial host and roost dweller, and is a

potential vectorial candidate for T. dionisii. Original studies into bat flies suggested a lack of

host specificity, however later research indicated the opposite, reporting that the majority of

bat flies are highly specific to a single or closely related bat species (Szentiványi et al., 2019).

In order to determine the vector of T. dionisii within Australia, transmission studies focusing

on known vectors of trypanosomes such as Acari (ticks and mites), Diptera (true flies),

Dermaptera (earwigs), Hemiptera (true bugs) and Siphonaptera (fleas) (Mackerras, 1959;

Molyneux, 1969; Hoare, 1972; Lukes et al., 1997; Noyes et al., 1999; Stevens et al., 1999;

Hamilton et al., 2005; Thekisoe et al., 2007), in addition to the bat fly, are required.

T. dionisii is generally considered non-pathogenic, however investigations performed

by Gardner and Molyneux (1988) reported cysts-like structures containing T. dionisii

amastigotes in sections of thoracic skeletal muscle from Pipistrellus pipistrellus. A study by

Maeda et al. (2012) demonstrated the ability of T. dionisii to invade and replicate in

mammalian cells in vitro, and its presence in human cardiac tissue together with T. cruzi

suggests that it may not only be restricted to bats (Dario et al., 2016). Given the potential for

T. dionisii to infect mammalian species other than bats, the need to understand its mode of

transmission is imperative, particularly as there have been documented cases of bat-specific

ectoparasites biting humans (Macphee and Greenwood, 2013). The health implications of T.

dionisii in Australian native mammals are unknown. However experimental infections of T.

cruzi, (Schizotrypanum), in Australian wildlife have demonstrated unfavourable outcomes,

resulting in high mortality in brush tailed possums (Trichosurus vulpecula) (Backhouse and

Bolliger, 1951). This is perhaps unsurprising as it is well documented that the introduction of

exotic trypanosomes into new geographical locations can have detrimental effects on naive

hosts. The extinction of native rats, Rattus macleari and Rattus nativitatis on Christmas Island

in the Indian Ocean is believed to have occurred due to the unforeseen introduction of T.

lewisi carried by black rats (Rattus rattus) which entered the Island via human transport

(Wyatt et al., 2008).

Future studies should focus on widespread next-generation amplicon sequencing of

trypanosomes from Australia native bats and their ectoparasites to enable a more detailed

investigation of the host parasite dynamics including the extent of mixed infections and the

identification of putative vectors. This is particularly important given T. dionisii‟s genetic

relationship with T. cruzi.

Acknowledgements

The authors wish to thank Bush Heritage and the Australian Wildlife Conservancy for access

to, and assistance within, the Charles Darwin Reserve, and Mt Gibson Wildlife Sanctuary,

respectively. Without their support the data for this study would not have been obtained.

Acknowledgement also to Nicholas Dunlop, Bob and Cath Bullen who demonstrated handling

and identification techniques of microbats and made preliminary explorations of the Charles

Darwin Reserve to identify capture sites. In addition, special thanks to Fiona Stewart, Luke

Bayley, Melissa Farelly and Noel Riessen for their support and guidance of the field work.

We also acknowledge the hard work and dedication of the skilled volunteers who attended the

capture ventures; Mikaylie Wilson, Kirsty Officer and Graeme Finlayson.

Financial Support

Murdoch University School of VLS small research grant funding. Sample collection was part

of broader project carried out by Diana Prada, for which she received financial support from

the Murdoch University Small Grants Scheme, Gunduwa Regional Conservation Association,

the Holsworth Wildlife Research Endowment, The Australian Wildlife Society University

Grants (2016), the Graduate Women (WA) Inc. Mary Walters Bursary, and the Alistair

Bursary (2017).

Ethics approval

Animals were collected by approval of the Murdoch University Animal Ethics Committee

under permit #R2882/16.

Data availability

Sequences generated in the present study have been deposited in GenBank under accession

numbers MT533281-MT533287 (18S rDNA) and MT536206-MT536212 (gGAPDH). The

datasets used and/or analysed during the current study are available from the corresponding

author on reasonable request. Supplementary material associated with this article can be

found, in the online version.

Author statement

All authors have read and approved to submit the manuscript to this journal. There is no

conflict of interest of any authors in relation to the submission. This paper has not been

submitted elsewhere for consideration of publication

References

Austen JM, Jefferies R, Friend JA, Ryan U, Adams P and Reid SA (2009) Morphological

and molecular characterization of Trypanosoma copemani n. sp (Trypanosomatidae)

isolated from Gilbert's potoroo (Potorous gilbertii) and quokka (Setonix brachyurus).

Parasitology, 136, 783-792. doi:10.1017/S0031182009005927

Austen JM, O'Dea M, Jackson B and Ryan U (2015) High prevalence of Trypanosoma

vegrandis in bats from Western Australia. Veterinary Parasitology, 214, 342-7.

https://doi.org/10.1016/j.vetpar.2015.10.016

Backhouse TC and Bolliger A (1951) Transmission of Chagas' disease to the Australian

marsupial Trichosurus Vulpecula. Transactions of the Royal Society of Tropical Medicine

and Hygiene, 44, 521-33.

Baker JR, Green SM, Chaloner LA and Gaborak M (1972) Trypanosoma

(Schizotrypanum) dionisii of Pipistrellus pipistrellus (chiroptera): intra-and extracellular

development in vitro. Parasitology, 65, 251-63.

https://doi.org/10.1017/S0031182000045030

Barbosa AD, Mackie JT, Stenner R, Gillett A, Irwin P and Ryan U (2016) Trypanosoma

teixeirae: A new species belonging to the T. cruzi clade causing trypanosomosis in an

Australian little red flying fox (Pteropus scapulatus). Veterinary Parasitology, 223, 214-

21. https://doi.org/10.1016/j.vetpar.2016.05.002

Beltz LA (2017) Kinetoplastids and bats. Bats and Human Health: Ebola, SARS, Rabies and

Beyond. New York, NY, USA: John Wiley & Sons.

Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J and

Sayers EW (2017). GenBank. Nucleic Acids Research, 45, D37-D42.

https://dx.doi.org/10.1093%2Fnar%2Fgks1195

Breinl A (1913) Parasite protozoa encountered in the blood of Australian native animals. The

Australian Institute of Tropical Medicine, 30-38.

Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in

phylogenetic analysis. Molecular Biology Evolution, 17, 540-52.

https://doi.org/10.1093/oxfordjournals.molbev.a026334

Cavazzana MJr, Marcili A, Lima L, da Silva FM, Junqueira ACV, Veludo HH, Viola

LB, Campaner M, Nunes VLB, Paiva F, Coura JR, Camargo EP and Teixeira MMG

(2010) Phylogeographical, ecological and biological patterns shown by nuclear (ssrRNA

and gGAPDH) and mitochondrial (Cyt b) genes of trypanosomes of the subgenus

Schizotrypanum parasitic in Brazilian bats. International Journal for Parasitology, 40,

345-55. https://doi.org/10.1016/j.ijpara.2009.08.015

Churchill S (2008) Australian Bats, 2nd edition, Crows Nest, N.S.W. : Allen & Unwin.

Constantine DG (2003) Geographic translocation of bats: known and potential problems.

Emerging Infectious Diseases, 9, 17-21.

Dario MA, Rodrigues MS, Barros JH, Xavier SC, D'Andrea PS, Roque AL and Jansen

AM (2016) Ecological scenario and Trypanosoma cruzi DTU characterization of a fatal

acute Chagas disease case transmitted orally (Espirito Santo state, Brazil). Parasite and

Vectors, 9, 477. doi: 10.1186/s13071-016-1754-4

Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Research, 32, 1792-7. https://doi.org/10.1093/nar/gkh340

Egan SL, Taylor CL, Austen JM, Banks PB, Ahlstrom LA, Ryan UM, Irwin PJ and

Oskam CL (2020) Molecular identification of the Trypanosoma (Herpetosoma) lewisi

clade in black rats (Rattus rattus) from Australia. Parasitology Research, 119, 1691–1696

https://doi.org/10.1007/s00436-020-06653-z

Espinosa-Alvarez O, Ortiz PA, Lima L, Costa-Martins AG, Serrano MG, Herder S,

Buck GA, Camargo EP, Hamilton PB, Stevens JR, and Teixeira MMG (2018)

Trypanosoma rangeli is phylogenetically closer to Old World trypanosomes than to

Trypanosoma cruzi. International Journal for Parasitology, 48, 569-584.

https://doi.org/10.1016/j.ijpara.2017.12.008

Garcia L, Ortiz S, Osorio G, Torrico MC, Torrico F and Solari A (2012) Phylogenetic

analysis of Bolivian bat trypanosomes of the subgenus Schizotrypanum based on

cytochrome b sequence and minicircle analyses. PLoS One, 7(5): e36578.

https://doi.org/10.1371/journal.pone.0036578

Gardner RA and Molyneux DH (1988) Trypanosoma (Megatrypanum) incertum from

Pipistrellus pipistrellus: development and transmission by cimicid bugs. Parasitology, 96

(Pt 3), 433-47. doi:10.1017/s0031182000080082

Hamilton PB, Cruickshank C, Stevens JR, Teixeira MMG and Mathews F (2012a)

Parasites reveal movement of bats between the New and Old Worlds. Molecular

Phylogenetics and Evolution, 63, 521-6. https://doi.org/10.1016/j.ympev.2012.01.007

Hamilton PB, Gibson WC and Stevens JR (2007) Patterns of co-evolution between

trypanosomes and their hosts deduced from ribosomal RNA and protein-coding gene

phylogenies. Molecular Phylogenetics and Evolution, 44, 15-25.

https://doi.org/10.1016/j.ympev.2007.03.023

Hamilton PB, Stevens JR, Gidley J, Holz P and Gibson WC (2005) A new lineage of

trypanosomes from Australian vertebrates and terrestrial bloodsucking leeches

(Haemadipsidae). International Journal for Parasitology, 35, 431-443.

https://doi.org/10.1016/j.ijpara.2004.12.005

Hamilton PB, Teixeira MMG and Stevens JR (2012b) The evolution of Trypanosoma cruzi

:the 'bat seeding' hypothesis. Trends in Parasitology, 28, 136-41.

https://doi.org/10.1016/j.pt.2012.01.006

Hoare C (1972) The trypanosomes of mammals. A zoological monograph. Blackwell

Scientific Publishing, Oxford, England.

Hodo CL, Goodwin CC, Mayes BC, Mariscal JA,Waldrup KA and Hamer SA (2016)

Trypanosome species, including Trypanosoma cruzi, in sylvatic and peridomestic bats of

Texas, USA. Acta Tropica, 164, 259-266. https://doi.org/10.1016/j.actatropica.2016.09.013

Hornok S, Kovacs R, Meli ML, Gonczi E, Hofmann-Lehmann R, Kontschan J,

Gyuranecz M, Dan A and Molnar V (2012) First detection of bartonellae in a broad

range of bat ectoparasites. Veterinary microbiology, 159, 541-3.

https://doi.org/10.1016/j.vetmic.2012.04.003

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper

A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P and Drummond A (2012)

Geneious Basic: an integrated and extendable desktop software platform for the

organization and analysis of sequence data. Bioinformatics 28,1647–9,

doi:10.1093/bioinformatics/bts199.

Kumar S, Stecher G and Tamura K (2016) MEGA7: Molecular Evolutionary Genetics

Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33, 1870-4.

https://doi.org/10.1093/molbev/msw054

Lima L, Espinosa-Alvarez O, Hamilton PB, Neves L,Takata CS, Campaner M, Attias

M, de Souza W, Camargo EP and Teixeira MMG (2013) Trypanosoma livingstonei: a

new species from African bats supports the bat seeding hypothesis for the Trypanosoma

cruzi clade. Parasites and Vectors, 6, 221. https://doi.org/10.1186/1756-3305-6-221

Lima L, Silva FM, Neves L, Attias M, Takata CS, Campaner M, de Souza W,Hamilton

PB and Teixeira MMG (2012) Evolutionary insights from bat trypanosomes:

morphological, developmental and phylogenetic evidence of a new species, Trypanosoma

(Schizotrypanum) erneyi sp. nov., in African bats closely related to Trypanosoma

(Schizotrypanum) cruzi and allied species. Protist, 163, 856-72. doi:

10.1016/j.protis.2011.12.003

Lukes J, Jirku M, Dolezel D, Kralova I, Hollar L and Maslov, DA (1997) Analysis of

ribosomal RNA genes suggests that trypanosomes are monophyletic. Journal of Molecular

Evolution, 44, 521-527. https://doi.org/10.1007/pl00006176

Mackerras MJ (1959) The haematozoa of Australian mammals. Australian Journal of

Zoology, 7, 105-135.

Mackie JT, Stenner R, Gillett AK, Barbosa A, Ryan U and Irwin PJ (2017)

Trypanosomiasis in an Australian little red flying fox (Pteropus scapulatus). Australian

Veterinary Journal, 95, 259-261. https://doi.org/10.1111/avj.12597

Macphee RD and Greenwood AD (2013) Infectious disease, endangerment, and extinction.

International Journal of Evolutionary Biology, 2013, 571939.

https://doi.org/10.1155/2013/571939

Maeda FY, Cortez C, Alves RM and Yoshida N (2012) Mammalian cell invasion by

closely related Trypanosoma species T. dionisii and T. cruzi. Acta Tropica, 121, 141-7.

https://doi.org/10.1016/j.actatropica.2011.10.017

Mafie E, Rupa FH, Takano A, Suzuki K, Maeda K and Sato H (2018) First record of

Trypanosoma dionisii of the T. cruzi clade from the Eastern bent-winged bat (Miniopterus

fuliginosus) in the Far East. Parasitology Research, 117, 673-680.

https://doi.org/10.1007/s00436-017-5717-2

Maslov DA, Lukes J, Jirku M and Simpson L (1996) Phylogeny of trypanosomes as

inferred from the small and large subunit rRNAs: Implications for the evolution of

parasitism in the trypanosomatid protozoa. Molecular and Biochemical Parasitology, 75,

197-205. https://doi.org/10.1016/0166-6851(95)02526-X

Mcinnes LM, Gillett A, Ryan UM, Austen J, Campbell RSF, Hanger J and Reid SA

(2009) Trypanosoma irwini n. sp (Sarcomastigophora: Trypanosomatidae) from the koala

(Phascolarctos cinereus). Parasitology, 136, 875-885.

https://doi.org/10.1017/S0031182009006313

Molyneux DH (1969) The fine-structure of the epimastigote forms of Trypanosoma lewisi in

the rectum of the flea, Nosopsyllus fasciatus. Parasitology, 59, 55-66. doi:

10.1017/s0031182000069821.

Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R, Schäffer AA

(2008)Database indexing for production MegaBLAST searches. Bioinformatics 24, 1757–

1764. https://doi.org/10.1093/bioinformatics/btn322

Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GA, Kent J (2000) Biodiversity

hotspots for conservation priorities. Nature, 403, 853-8. https://doi.org/10.1038/35002501

Nei M and Kumar S (2000) Molecular Evolution and Phylogenetics. New York, Oxford

University Press.

Noyes HA, Stevens JR,Teixeira M, Phelan J and Holz P (1999) A nested PCR for the

ssrRNA gene detects Trypanosoma binneyi in the platypus and Trypanosoma sp. in

wombats and kangaroos in Australia. International Journal for Parasitology, 29, 331-339.

doi: 10.1016/s0020-7519(98)00167-2.

Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu

L, Suchard MA and Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian

phylogenetic inference and model choice across a large model space. Systematic Biology,

61, 539-42. https://doi.org/10.1093/sysbio/sys029

Rozsa L, Reiczigel J and Majoros G (2000) Quantifying parasites in samples of hosts.

Journal for Parasitology, 86, 228-232. https://doi.org/10.1645/0022-

3395(2000)086[0228:QPISOH]2.0.CO;2

Stevens J, Noyes H and Gibson W (1998) The evolution of trypanosomes infecting humans

and primates. Memorias do Instituto Oswaldo Cruz, 93, 669-676.

https://doi.org/10.1590/S0074-02761998000500019

Stevens JR, Noyes H, Dover GA and Gibson WC (1999) The ancient and divergent origins

of the human pathogenic trypanosomes, Trypanosoma brucei and T. cruzi. Parasitology,

118, 107-116. https://doi.org/10.1017/s0031182098003473

Szentiványi T, Christe P and Glaizot O (2019) Bat flies and their microparasites:current

knowledge and distribution. Frontiers in Veterinary Science, 6.

https://doi.org/10.3389/fvets.2019.00115

Tamura K (1992) Estimation of the number of nucleotide substitutions when there are strong

transition-transversion and G+C-content biases. Molecular Biology and Evolution, 9, 678-

87. https://doi.org/10.1093/oxfordjournals.molbev.a040752

Teeling EC, Springer MS, Madsen O, Bates P, O'brien SJ and Murphy WJ (2005) A

molecular phylogeny for bats illuminates biogeography and the fossil record. Science, 307,

580-4. https://doi.org/10.1126/science.1105113

Thekisoe OM, Honda T, Fujita H, Battsetseg B, Hatta T, Fujisaki K, Sugimoto C and

Inoue N (2007) A trypanosome species isolated from naturally infected Haemaphysalis

hystricis ticks in Kagoshima Prefecture, Japan. Parasitology, 134, 967-974.

https://doi.org/10.1017/s0031182007002375

Tyler KM and Engman DM (2001) The life cycle of Trypanosoma cruzi revisited.

International Journal for Parasitology, 31, 472-81. https://doi.org/10.1016/s0020-

7519(01)00153-9

Wang LJ, Han HJ, Zhao M, Liu JW, Luo LM,Wen HL, Qin XR, Zhou CM, Qi R,Yu H,

and Yu XJ (2019) Trypanosoma dionisii in insectivorous bats from northern China. Acta

Tropica, 193, 124-128. https://doi.org/10.1016/j.actatropica.2019.02.028

Wyatt KB, Campos PF, Gilbert MT, Kolokotronis SO, Hynes, WH, Desalle R, Ball SJ,

Daszak P, Macphee RD, Greenwood AD (2008) Historical mammal extinction on

Christmas Island (Indian Ocean) correlates with introduced infectious disease. PLoS One,

3, e3602. https://doi.org/10.1371/journal.pone.0003602

Yang R, Murphy C, Song Y, Ng-Hublin J, Estcourt A, Hijjawi N, Chalmers R, Hadfield

S, Bath A, Gordon C and Ryan U (2013) Specific and quantitative detection and

identification of Cryptosporidium hominis and C. parvum in clinical and environmental

samples. Experimental Parasitology, 135, 142-7.

https://doi.org/10.1016/j.exppara.2013.06.014

Zhang Z, Schwartz S, Wagner L, Miller W (2000) A greedy algorithm for aligning DNA

sequences. Journal of Computational Biology, 7, 203–214.

https://doi.org/10.1089/10665270050081478

Table 1. Primers used for Trypanosoma PCR. *denotes primer combination used for initial

screening of the short 18S rRNA fragment.

Gene Primer Sequence (5`-3`) Reference

18S rRNA SLF GCTTGTTTCAAGGACTTAGC (McInnes et al., 2009)

S726R GACTTTTGCTTCCTCTAATG (Maslov et al., 1996)

S823F CGAACAACTGCCCTATCAGC (Maslov et al., 1996)

S662R* GACTACAATGGTCTCTAATC (Maslov et al., 1996)

S825F* ACCGTTTCGGCTTTTGTTGG (Maslov et al., 1996)

SLIR ACATTGTAGTGCGCGTGTC (McInnes et al., 2009)

gGAPDH GAPDHF CTYMTCGGNAMKGAGATYGAYG (McInnes et al., 2009)

GAPDHR GRTKSGARTADCCCCACTCG (McInnes et al., 2009)

G4a GTTYTGCAGSGTCGCCTTGG (Hamilton et al., 2004)

Table 2. Prevalence of T. dionisii in microbats from Charles Darwin Reserve and Mount Gibson Reserve, Western Australia.

Bat species Bat common name N T. dionisii Aus Genotype 1 T. dionisii Aus Genotype 2 Overall Aus T. dionisii Chalinolobus morio chocolate wattled bat 3 2 0 2 66.67 (9.4-99.2) % 0 (0-70.8) % 66.67 (9.4-99.2) % Chalinolobus gouldii Gould's wattled bat 53 0 16 16 0 (0-6.7) % 30.19 (18.3-44.3) % 30.19 (18.3-44.3) % Nyctophilus geoffroyi lesser long-eared bat 16 1 0 1 6.25 (0.2-30.2) % 0 (0-20.6) % 6.25 (0.2-30.2) % Nyctophilus major western long-eared bat 1 0 1 1 0 (0-97.5) % 100 (2.5 – 100) % 100 (2.5 – 100) % Ozimops sp. Ozimops 2 0 0 0 0 (0 – 84.2) % 0 (0 – 84.2) % 0 (0 – 84.2) % Scotorepens balstoni Western broad-nosed bat 7 2 1 3 28.57 (3.7-71.0) % 14.29 (0.4-57.9) 42.86 (9.9-81.6) % Vespadelus baverstocki Inland Forest Bat 4 0 0 0 0 (0-60.2) % 0 (0-60.2) % 0 (0-60.2) % Total 86 5.8 20.9 26.7 (1.9 – 13.0) (12.9 – 31.0) (17.8 – 37.4) 95% Confident intervals in brackets

Table 3. Mean dimensions and standard error (S.E.) of morphological features from

Australian Trypanosoma dionisii genotypes Aus 1 and Aus 2, identified in the blood of

Australian native microbats. Number of trypomastigotes measured represented by N, see

* legend for terminology.

Genotype T. dionisii Aus 1 T. dionisii Aus 2

Host Scotorepens balstoni Chalinolobus gouldii

N Observed range Mean ± SE N Observed range Mean ± SE (µm) (µm) (µm) (µm) TL 6 13.43 - 19.44 15.92 ± 0.671 1 14.38 -

B 6 0.82 - 1.30 1.05 ± 0.004 2 1.30 - 1.70 1.50 ± 0.282

PK 6 0.74 - 0.94 0.84 ± 0.004 2 0.70 - 0.75 0.72 ± 0.035

KN 6 4.80 - 7.40 6.36 ± 0.025 2 6.56 - 7.78 1.17 ± 0.862

NA 6 2.46 - 5.30 3.63 ± 0.028 0 - -

FF 6 3.95 - 6.76 5.66 ± 0.030 1 5.90 -

*Morphological abbreviations L, Length of body measured along the mid-line including free flagellum (total length). B, Maximum breadth measured at the level of the nucleus (including undulating membrane). PK, Distance between the posterior end and the kinetoplast. KN, Distance between the kinetoplast and posterior edge of the nucleus. NA, Distance between the anterior edge of the nucleus and the anterior end of the body. FF, Length of the free flagellum.

Table 4. Morphological comparison of Trypanosoma species isolated from native Australian

bats. Measurements recorded in µm of trypomastigotes, see legend* for terminology.

References: a Mackerras et al. 1959, b Austen et al. 2015, c Barbosa et al. 2016, d present

study.

Species T. pteropia T. hipposiderosa T. vegrandisb T. texeriaec T. dionisiid

Scotorepens balstoni Host Pteropus sp. Hipposideros ater Chalinolobus gouldii Pteropus scapulatus and C. gouldii

TL 18-22 10.5-13.0 6.7-13.8 20.4-30.8 13.0-19.4

B 2-4 1.5-2.0 1.0 1.3-2.3 0.8-1.4

PK 1.5-4 1.0-2.5 6.7 1.5-2.4 0.7-0.9

KN 4-5 4.0-6.0 0.7 3.3-6.2 4.8-7.7

NA 8-10 1.5-5.0 0.8 5.1-9.8 2.4-5.3

FF 8-12 4.0-8.0 2.8 10.0-12.9 3.9-6.7

T. dionisiiTryCC211 I Brazil a, T. dionisiiTryCC495 I Brazil T. dionisii X842 I United Kingdom ·i~ >-'

WIOO T. dionisiiPJ I Belgium < T. dlonlsll Aus 2 B2086 I Australia :i T. dionisiiP3 I United Kingdom -e >-' T. dlonls/1 Aus 1 B1031 I Australia ~----- T. cruzimarinkellei I Brazil t.. T. erneyi1946 I Mozambique l T. sp HochNdi1 I Cameroon ..,,oo T. vespertilionis P14 I United Kingdom I T. conothini BR1 I Brazil IM/100 J ~----- T. rangeli AMBD I Brazil

T. noyesi H25 I Australia

T. noyesiWC6218 I Australia

~------T. wauwauTCC1022 I Brazil

T. livingstonei Ban 2 I Mozambique

T. varani I Ghana

Fig. 1. Maximum likelihood (ML) phylogenetic reconstruction of the Trypanosoma cruzi

clade based on a 1,350 bp alignment of the 18S rDNA locus. Node numbers correspond to

ML and Bayesian Inference (BI) support values respectively (ML values <60 are hidden).

Number of substitutions per nucleotide position is represented by the scale bar. Sequences

generated in the present study in bold. GenBank accession numbers for sequences are

available in Supplementary Table 1.

T. dionsii TryCC211 I Brazil T. dionsiiTry CC495 I Brazil T. donsiiSD044 I China T. dionisii X842 I United Kingdom T. dionisii Kro I Japan IOCVIOO T. dionisii SD098 I China T. dionisiiGnash I United Kingdom

T. dlonls/1 Aus 1 B1031 I Australia

T. dlonls/1 Aus 2 B2086 I Australia IWIOO T. dionisii P3 I United Kingdom T. dionisii 23125 I United Kingdom I ~------T. erneyi1946 I Mozambique l nnoo T. cruzimarinkellei I Brazil T. fivlrgstonei Bat12 I Mozambique

T. noyesi H25 I Australia T. noyesi WC6218 I Australia I ,------T. teixeirae I Australia

""100 T. rangeli AMBO I Brazil T. conc.-hini BR1 I Brazil

T. vespertilionis P14 I United Kingdom T. sp HochNdi1 I Cameroon ~------T. wauwauTCC1022 I Brazil ~------T. varani I Ghana

Fig. 2. Maximum likelihood (ML) phylogenetic reconstruction of the Trypanosoma cruzi

clade based on a 674 bp alignment of the glycosomal glyceraldehyde phosphate

dehydrogenase (gGAPDH) gene. Node numbers correspond to ML and Bayesian Inference

(BI) support values respectively (ML values <60 are hidden). Number of substitutions per

nucleotide position is represented by the scale bar. Sequences generated in the present study

in bold. GenBank accession numbers for sequences are available in Supplementary Table 1.

T. dionisii TryCC211 I Bra zil T. dionisii TryCC495 I Brazil T. dionisii KTD I Japan 99/100 T. dionisii Aus 2 B2086 I Australia T. dionisii P3 I United Kingdom 99 100 GI 'ti T. dionisii Aus 1 B1031 I Australia ftl u ~--- T. erneyi 1946 I Mozambique -~ 881100 -/72 ~ ----- T. cruzi marinkellei I Bra zil "ftl ~-- T. vespertilionis Pl4 I United Kingdom g 100/100 ~-- T. ~ sp HochNdil I Cameroon C: 99/100 T. conorhini BRl I Brazil a ~------T. rangeli AMBO I Brazil t

T. noyesi H25 I Australia T. noyesi WC6218 I Australia ~------T. wauwau TCC1022 I Brazil ~------T. livingstonei Batl2 I Mozambique ~------T. varani I Ghana

0.02

Fig. 3. Maximum likelihood (ML) phylogenetic reconstruction of the Trypanosoma cruzi

clade based on a concatenated 18S rRNA and GAPDH sequences. Node numbers correspond

to ML and Bayesian Inference (BI) support values respectively (ML values <60 are hidden).

Number of substitutions per nucleotide position is represented by the scale bar. Sequences

generated in the present study in bold. GenBank accession numbers for sequences are

available in Supplementary Table 1.

Fig. 4. Trypanosoma dionisii trypomastigotes in Australian microbat blood films. (a-c)

Trypomastigotes in blood films from bat isolate T1-2016-1031, Scotorepens balstoni

representing genotype Aus 1. (d) Trypomastigote in a blood film from bat isolate T1-2016-

2058, Chalinolobus gouldii representing genotype Aus 2. Scale bar represents 10 µm.