(12) United States Patent (10) Patent No.: US 9,605,041 B2 Greengard Et Al

USOO9605041B2

(12) United States Patent (10) Patent No.: US 9,605,041 B2 Greengard et al. (45) Date of Patent: Mar. 28, 2017

(54) REGULATORY PROTEINS AND INHIBITORS 5,385,915 A 1/1995 Buxbaum et al. 5,393,755 A 2f1995 NeuStadt et al. 5,521, 184 A 5/1996 Zimmermann (75) Inventors: Paul Greengard, New York, NY (US); 5,543,520 A 8/1996 Zimmermann Wenjie Luo, New York, NY (US); Gen 5,719,283 A 2f1998 Bell et al. He, New York, NY (US); Peng Li, 5,733,914 A 3/1998 Blankley et al. New York, NY (US); Lawrence 5,744,346 A 4/1998 Chrysler et al. Wennogle, New York, NY (US) 5,777, 195 A 7/1998 Fienberg et al. 5,824,683 A 10, 1998 McKittrick et al. 5,849,770 A 12/1998 Head et al. (73) Assignees: INTRA-CELLULAR THERAPIES, 5,885,834 A 3/1999 Epstein INC., New York, NY (US): THE 5,939,419 A 8, 1999 Tulshian et al. ROCKEFELLER UNIVERSITY, 5,962,492 A 10, 1999 Warrellow New York, NY (US) 6,013,621 A 1/2000 Nishi et al. 6,107.301 A 8, 2000 Aldrich et al. 6,133,273 A 10/2000 Gilbert et al. (*) Notice: Subject to any disclaimer, the term of this 6,147,073. A 11/2000 Battistini et al. patent is extended or adjusted under 35 6,235,742 B1 5, 2001 Bell et al. U.S.C. 154(b) by 974 days. 6,235,746 B1 5, 2001 Davis et al. 6,316,444 B1 1 1/2001 Hunt et al. (21) Appl. No.: 13/367,049 6,333,167 B1 12/2001 Quinet et al. 6,423,716 B1 7/2002 Matsuno et al. 6,440,698 B1 8/2002 Gurney et al. (22) Filed: Feb. 6, 2012 6,451,838 B1 9, 2002 Moon et al. 6.492.371 B2 12/2002 Roylance (65) Prior Publication Data 6,498,165 B1 12/2002 Armstrong et al. 6,552,029 B1 4/2003 Davis et al. US 2013/O149309 A1 Jun. 13, 2013 6,586.423 B2 7/2003 Bilodeau et al. 6,599.908 B1 7/2003 Davis et al. Related U.S. Application Data 6,649.908 B2 11/2003 Apfel et al. (63) Continuation of application No. (Continued) PCT/US2010/002173, filed on Aug. 5, 2010. FOREIGN PATENT DOCUMENTS

(60) Provisional application No. 61/231.462, filed on Aug. AU 20052014.82 A1 5, 2005 5, 2009. DE 1993 1206 A1 1, 2001 (51) Int. Cl. (Continued) C07K 6/40 (2006.01) CI2N IS/IT3 (2010.01) OTHER PUBLICATIONS C07K I4/47 (2006.01) He et al (Nature 467: 95-98, 2010).* AIK 67/027 (2006.01) Chu et al (J Alz Dis 41: 729-737, 2014 abstract only).* A6 IK 39/00 (2006.01) Chu et al (Biol Psychiat 77: 720-728, 2015).* GOIN 33/68 (2006.01) Borchelt, et al., “Familial Alzheimer's Disease-Linked Presenilin 1 A6 IK3I/506 (2006.01) Variants Elevate AB1-42/1-40 Ratio In Vitro and In Vivo.” Neuron. (1996) 17: 1005-1013. C07K 6/8 (2006.01) Cancino, G., et al., “STI571 prevents apoptosis, tau phosphorylation CI2O I/68 (2006.01) and behavioral impairments induced by Alzheimer's B-amyloid A61 K 38/00 (2006.01) deposits”. Brain, 2008, vol. 131, p. 2425-2442. (52) U.S. Cl. De Strooper, et al., “A Presenilin-I-Depenedent B-Secretase-Like CPC ...... C07K 14/4705 (2013.01); A0IK 67/0275 Protease Mediates Release of Notch Intracellular Domain.” Nature (2013.01); A61 K3I/506 (2013.01); A61 K (1999) 398: 518-522. 39/0007 (2013.01); C07K 16/18 (2013.01); (Continued) CI2N 15/113 (2013.01); C12O I/686 (2013.01); C12O 1/6827 (2013.01); G0IN Primary Examiner — Daniel E. Kolker 33/6896 (2013.01); A0IK 2207/05 (2013.01); Assistant Examiner — Aditi Dutt A0IK 2217/058 (2013.01); A0IK 2217/15 (74) Attorney, Agent, or Firm — Hoxie & Associates LLC (2013.01); A0IK 22 17/203 (2013.01); A0IK 2227/105 (2013.01); A0IK 2267/0312 (57) ABSTRACT (2013.01); A6 IK 38/00 (2013.01); G0IN The invention provides a previously uncharacterized protein 2800/2821 (2013.01) (gamma secretase activating protein orgSAP) that activates (58) Field of Classification Search Y-secretase to produce B-amyloid protein (AB). Deposition None of AB has been associated with Alzheimer's disease and See application file for complete search history. other pathologies. The invention thus additionally provides, e.g., Screening methods and novel research tools, inhibitors (56) References Cited of this novel protein, and methods of diagnosis, treatment U.S. PATENT DOCUMENTS and control of Alzheimer's disease and other neurodegen erative conditions associated with deposition of AB. 5,272,055 A 12/1993 Haley 5,294,612 A 3, 1994 Bacon et al. 3 Claims, 9 Drawing Sheets US 9,605,041 B2 Page 2

(56) References Cited WO WO 2004/087906 A1 10, 2004 WO WO 2004f1 10452 12, 2004 U.S. PATENT DOCUMENTS WO WO 2005/O16962 2, 2005 WO WO 2005/0395.86 5, 2005 6,670,368 B1 12, 2003 Breault et al. WO WO 2005, O72826 8, 2005 6,693,099 B2 2, 2004 Degenhardt WO WO 2006,133261 A2 12/2006 6,756,373 B1 6, 2004 Allerton et al. WO WO 2007,025 103 A2 3, 2007 6,969,719 B2 11/2005 Asberom et al. WO WO 2007/143705 A2 12/2007 7,153,824 B2 12, 2006 Palmer et al. WO WO 2008/0575.99 5, 2008 7,320,785 B2 1, 2008 Greengard et al. WO WO 2008/063505 A1 5, 2008 7,910,586 B2 3, 2011 Netzar et al. WO WO 2008,153959 12/2008 8,598,171 B2 12, 2013 Netzar et al. WO WO 2008,153974 12/2008 9,157,906 B2 10, 2015 Greengard et al. WO WO 2009,073210 A1 6, 2009 2002fOO25540 A1 2, 2002 Roberts et al. WO WO 2009,075784 A1 6, 2009 20O2/OO77274 A1 6, 2002 Roylance 20O2/O128319 A1 9, 2002 Koo et al. OTHER PUBLICATIONS 2002fO1471.97 A1 10, 2002 Newman et al. 2003, OO69246 A1 4, 2003 Darrow et al. 2003/O162782 A1 8, 2003 Grossman et al. DeMattos, et al., “Peripheral anti-AB Antibody Alters CNS and 2003/O195205 A1 10, 2003 DeNinno Plasma AB Clearance and Decreases Brain AB Burden in a Mouse 2003/O198594 A1 10, 2003 Collins et al. Model of Alzheimer's Disease.” PNAS (2001) 98(15): 8850-8855. 2003/0211040 A1 11/2003 Greengard et al. Dominguez et al., Secretases as therapeutic targets for the treatment 2004/OO23989 A1 2, 2004 Fryburg 2004/OO87517 A1 5, 2004 Burnet et al. of Alzheimer's disease, Amyloid: J. Protein Folding Disord. 8, 2004/0171823 A1 9, 2004 Nadler et al. 124-142(2001). 2005/OO48573 A1 3, 2005 Artis et al. Dou, et al., “Chaperones Increase Association of the Tau Protein 2005/OO75795 A1 4, 2005 Pandit with Microtubules.” Proc. Natl Acad Sci USA (2003) 100(2): 2008/O17696.1 A1 T/2008 Greengard et al. 721-726-12449. 2008. O188492 A1 8, 2008 Li et al. Dumont et al. Synthesis and Study of the Anti-Leukaemic Activity 2008.0193964 A1 8, 2008 Greengard et al. 2008/O194592 A1 8, 2008 Mates et al. of N,N'-Substituted Amidines and Bis-Amidines, J. Pharm. Belg. 2009/O137549 A1 5/2009 Edward et al. 40.6, 373-386 (1985). 2010, 0087450 A1 4, 2010 Mates et al. Durkin, et al., “Rank-Order of Potencies for Inhibition of the 2010/0173878 A1 T/2010 Li et al. Secretion of AB340 and AB342 Suggests That Both Are Generated 2010/0173924 A1 T/2010 Li et al. by a Single Y-Secretase.” The Journal of Biological Chemistry 2010/O184778 A1 T/2010 Li et al. (1999) 274(29): 20499-20504. 2010.0323997 A1 12, 2010 Fienberg et al. Esler, et al., “Transition-State Analogue Inhibitors of Y-Secretase 2012.00531.90 A1 3/2012 Fienberg Bind Directly to Presenilin-I .” Nature Cell Biology (2000) 2: 428-434. FOREIGN PATENT DOCUMENTS Esler, W.P., et al. “A Portrait of Alzheimer Secretases—New Fea EP O063381 A1 10, 1982 tures and Familiar Faces.” Science, 2001, pp. 1449-1454, vol. 293. EP O2O1188 A2 12, 1986 Gasparini, et al., “Stimulation of B-Amyloid Precursor Protein EP O949242 10, 1999 Trafficking by Insulin Reduces Intraneuronal B-Amyloid and EP 1136485 9, 2001 Requires Mitogen-Activated Protein Kinase Signaling.” The Jour EP O911333 A1 4/2002 nal of Neuroscience (2001) 21 (8): 2561-2570. EP 1533 304 5, 2005 Gilman, S., et al. Clinical effects of AB Immunization (AN1792) in GB 2151629 A 7, 1985 JP 53031694 A 3, 1978 Patients with AD in an Interrupted Trial, Neurology, 2005, pp. JP A-11-043499 2, 1999 1553-1562, vol. 64. JP 2000-224992 8, 2000 Goodwin, et al., P3-215: "Inhibition of gamma-secretase activity WO WO 91/19717 A1 12/1991 induces cell cycle defects and chromosome missegregation'. WO WO 94/19351 A1 9, 1994 Alzheimer's & Dementia, vol. 4. No. I, p. T614 Jul. 1, 2008. WO WO 96/34867 11, 1996 Jin, S.M., et al. “DNA damage inducing agents elicity-secretase WO WO 97/35989 10, 1997 activation mediated by oxidative stress.” Cell Death and Differen WO WO 98.46.606 A1 10, 1998 tiation 2008, vol. 15, p. 1375-1384. WO WO 98.52568 A1 11, 1998 Kraker et al., Biochemical and Cellular Effects of c-Src Kinase WO WO 99.01439 1, 1999 Selective Pyrido2,3-dipyrimidine Tyrosine Kinase Inhibitors, Bio WO WO99, 19305 4f1999 chemical Pharmacology, vol. 60, pp. 885-898 (2000). WO WO99/20273 4f1999 WO WOOOf 17345 3, 2000 Moasser, et al., “Inhibition of Src Kinases by a Selective Tyrosine WO WOOOOO197 6, 2000 Kinase Inhibitor Causes Mitotic Arrest.” Cancer Research (1999) WO WO O1/OO851 4/2001 59: 6145-6152. WO WO O1? 46145 6, 2001 Nagar, et al., “Crystal Structures of the Kinase Domain of c-Abl in WO WO O1,56567 8, 2001 Complex with the Small Molecule Inhibitors PD173955 and WO WO O1? 64200 9, 2001 Imatinib (STI-571),” Cancer Research (2002) 62: 4236-4243. WO WOO1 77086 10, 2001 Petanceska, et al., The Phosphatidylinositol-3-Kinase Inhibitor WO WO O1.78721 10, 2001 Wortmannin Alters the Metabolism of the Alzheimer's Amyloid WO WO O1f85924 11 2001 Precursor Protein, Journal of Neurochemistry (1999) 73(6): 2316 WO WO O2/060428 A2 8, 2002 2320. WO WO O3,OO2567 A1 1, 2003 WO WO O3,O2O702 A2 3, 2003 Schenk, D., et al. Immunization with Amyloid-f Attenuates WO WO O3,O2O724 A1 3, 2003 Alzheimer-Disease-Like Pathology in the PDAPP Mouse, Nature, WO WO O3,O37432 A1 5, 2003 1999, pp. 173-177, vol. 400. WO WO O3,O37899 A1 5, 2003 Schindler, et al., “Structural Mechanism for STI-571 Inhibition of WO WO 03/042216 A1 5, 2003 Abelson Tyrosine Kinase,” Journal of Neurochemistry (2000) 289: WO WO O3,0571.65 T 2003 1938-1942. WO WO 2004/OO5281 1, 2004 Selkoe, D.J. Alzheimer's Disease: Genotypes, Phenotype, and WO WO 2004/056831 A1 T 2004 Treatments, Science, 1997, p. 630, vol. 275. US 9,605,041 B2 Page 3

(56) References Cited Davis et al. Mol. Cell. Biochem. 149/150: 271-278, 1995 (Ab stract only). OTHER PUBLICATIONS Dewald et al., J Med Chem (1988) 31:454-461. Dousa, Kidney Int 55: 29-62, 1999. Selkoe, Dennis J., “Deciphering the Genesis and Fate of Amyloid Du et al., “Minocycline Prevents Nigrostriatel Dopaminergic B-Protein Yields Novel Therapies for Alzheimer Disease,” J. Clin Neurodegeneration in the MPTP Model of Parkinson's Disease.” Invest 110: 1375-1381 (2002). (2001), PNAS, 98:14669-14674. Tsao, P-N., et al. “Y-secretase activation of Notch signaling regu Duplantier et al., “7-Oxo-4,5,6,7-Tetrahydro-1H-Pyrazolo 3,4-c) lates the balance of proximal and distal fates in progenitor cells of Pyridines as Novel Inhibitors of Hyman Eosinophil the developing lung.” J Biol Chem 2008, vol. 283, p. 29532-29544. Phosphodiesterase.” (1998), J. Med. Chem., 41:2268-2277. Uniprot A4D1B5, Gamma-secretase-activating protein, Protein Ehrman et al., “Phosphodiesterase 1B differentially modulates the pigeon homolog. Last modified Sep. 10, 2011 online). Retrieved effects of methamphetamine on locomotor activity and spatial Nov. 10, 2011 from the internet, http://www.uniprot.org/uniprot? learning through DARPP32-dependent pathways: evidence from A4D1B5. PDE 1 B-DARPP32 double-knockout mice', Genes Brain Behav. Oct. 2006; 5(7):540-51. Vandermeeren, et al., “The Functional -y-Secretase Inhibitor Pre Elvevaget al. Critical Reviews in Neurobiology (2000) 14(1):1-21 vents Production of Amyloid f 1-34 in Human and Murine Cell (abstract only). Lines.” Neuroscience Letters. (2001) 315: 145-148. Erneux et al., “A Mechanism in the Control of Intracellular cAMP Vassar, R., et al. B-Secretase Cleavage of Alzheimer's Amyloid Level: The Activation of a Calmodulin-Sensitive Phosphodiesterase Precursor Protein by the Transmembrane Aspartic Protease BACE, by a Rise of Intracellular Free Clacium.” (1985), Molecular and Science, 1999, pp. 735-741, vol. 286. Cellular Endocrinology, 43: 123-134. Weisberg, et al. “Mechanisms of resistance to imatinib (ST1571) in Escalera et al. Endo. 131 (6): 2965-2971, 1992. preclinical models and in leukemia patients'. Drug Resistance Esfahani et al. Iranian J of Pharmacol and Therapeutics (2002) Updates, vol. 4. Issue 1, p. 22-28 (2001) Abstract Only. 1:8-11. Williamson et al., Rapid Tyrosine Phosphorylation of Neuronal Fienberg et al. Brain Research 31(2-3): 313-319, 2000. Proteins Including Tau and Focal Adhesion Kinase in Response to Fienberg et al., “DARPP-32: Regulator of the Efficacy of Amyloid-fi Peptide Exposure: Involvement of Src Family Protein Dopaminergic Neurotransmission.” (1998), Science, 281: 838-842. Kinases, J. of Neuroscience, 22(1): 10-20 (Jan. 1, 2002). Furuyama et al. Mol. Brain Res. 26: 331-336, 1994—(Abstract Wolfe, M. Y-Secretase Inhibitors as Molecular Probes of Presenilin only). Function, J. Mol. Neuroscience, vol. 17, pp. 199-204 (2001). Gally et al. Proc. Natl. Acad. Sci. USA 87: 3547-3551, 1990. Wolfe, Michael S., “Secretase Targets for Alzheimer's Disease: Garthwaite, J. Trends Neurosci. 14: 60-67, 1991—(Abstract only). Identification and Therapeutic Potential.” Journal of Medicinal Goldman-Rakic et al. Psychopharmacology (2004) 174:3-16. Chemistry (2001) 44(13): 2039-2060. Greengard et al. Neuron 23: 435-447, 1999. Xu, et al., “Generation of Alzheimer B-Amyloid Protein in the Guzowski et al. Proc. Natl. Acad. Sci. USA 94: 2693-2698, 1997. Trans-Golgi Network in the Apparent Absence of Vesicle Forma Hamilton, et al., “Synthesis and Structure-Activity Relationships of tion.” Proc. Natl. Acad. Sci (1997) 94; 3748-3752. Pyrazolou4.3-d 3/4 Pyrimidin-7-Ones as Adenosine Receptor Zhang, et al., “Biochemical Characterization of the Y-Secretase Antagonists' Journal of Medicinal Chemistry, American Chemical Activity That Produces B-Amyloid Peptides.” Biochemistry (2001) Society, Washington, US, vol. 30, No. 1, pp. 91-96 (1987). 40: 5049-5055. Han, P. et al., “The Calcium/Calmodulin-Dependent Netzer, et al. Proc Natl. Acad. Sci., 100(21), pp. 12444-12449, Phosphodiesterase PDE1C Down-Regulates Glucose-Induced Insu (2003). lin Secretion'. The Journal of Biomedical Chemistry, vol. 274, No. Zimmermann, et al., Bioorganic & Medicinal Chem. Lett., 7(2), pp. 32, (1999), pp. 22337-22341. 187-192, (1997). Hebb et al. Neuroscience 123:967-981.2004. He, et al., Nature, 467(2), pp. 95-99, (2010). Houslay et al. “The Multienzyme PDE4 Cyclic Adenosine Abel et al. Cell 88: 615-626, 1997. Monophosphate-Specific Phosphodiesterase Family: Intracellular Ahn et al. J. Med. Chem. 40: 2196-2210, 1997. Targeting, Regulation, and Selective Inhibition by Compounds Allende et al. Comp Biochem Physiol (1987) 88(2):581-587. Exerting Anti-Inflammatory and Antidepressant Actions.” (1998), Alvarez & Davis, “A Semi automated Method for the Assay of Advances in Pharmacology, 44:225-342. Cyclic Adenosine 5'-Monophosphate Phosphodiesterase.” (1996), Jaber et al. Neuropharmacology 35: 1503-1519, 1996. Analytical Biochemistry, 236: 367-369. Jassen et al. Mol. Pharmacol. 70: 71-77, 2006. Bach, et al. Cell 81:905-915, 1995. Kakkar et al. Cellular and Molecular Life Sciences, 55: 1164-1186, Bastia et al. Neurosci Letters (2002) 328:241-244. 1999. Bender et al. Pharrmacol Rev (2006) 58: 488-520. Kotter, R. Prog. Neurobiol. 44; 163-196, 1994—(Abstract only). Bibb et al., “Severe Deficiencies in Dopamine Signaling in Kruuse, et al., “Phosphodiesterase 5 and effects of sildenafil on Presymptomatic Huntington's Disease Mice,” (2000), PNAS, cerebral arteries of man and guinea pig European Journal of 97:6809-6814. Pharmacology, Elsevier BV, NL, vol. 521. No. 1-3, 3, pp. 105-114 Bönöczk et al., Role of sodium channel inhibition in neuroprotec (Oct. 2005). tion: Effect of vinpocetine, Brain Research Bulletin, 2000, vol. 53, Lincoln, Molecular Pharmacol (2004) 66:11-13. No. 3, pp. 245-254. Lindskog et al. Neuroscience 88: 1005-1008, 1999. Borisy et al. J. Neurosci. 12:915-923, 1992. Livingstone et al. Cell 37: 205-215, 1984. Bourtchuladze et al. Cell 79: 56-68, 1994—(Abstract only). Lundqvist et al. Nature (2007) 447:817-822. Burnouf et al., “Synthesis, Structure-Activity Relationships, and Mani et al. Science (1994) 265:1246-1249. Pharmacological Profile of 9-Amino-4-0xo-I-Phenyl-3,4,5,6,7- Mani et al. Science (2000) 287: 1053-1056. TetrahydrolI.4JDiazepino.6.7.I-hiIndoles: Discovery of Potent, Mansuy et al. Cell 92: 39-49, 1998. Selective Phosphodiesterase Type 4 Inhibitors,” (2000), J. Med. Mayerhofer, et al. J. Clin. Endocrin. Metab. 84(1): 257-265, 1999. Chem., 43: 4850-4867. Mayford et al. Cell 81: 891-904, 1995. Chebib et al. Bioorg & Med Chem (2000) 8:2581-2590. Morissette et al. Advanced Drug Delivery Reviews (2004) 56:275 Chermat et al., Pharmacol (1986) 17:348-350. 300. Cummings, JL et al., “Metrifonate (Trichlorfon): a review of the Murray et al., JPET (2003) 306:752-762. pharmacology, pharmacokinetics and clinical experience with a new Nishi et al., Bidirectional Regulation of DARPP-32 acetylcholinesterase inhibitor for Alzheimer's disease'. Expert Opin Phosphorylation by Dopamine, (1997), The Journal of Neurosci Investig Drugs, 1999, vol. 8 (4), pp. 463-471 (doi:10.1517/ ence, 17: 8147-8155. 13543784.84.463). Polli & Kincaid. J. Neurosci. 14: 1251-1261, 1994. US 9,605,041 B2 Page 4

(56) References Cited Vatter, S. et al., “Differential Phosphodiesterase Expression and Cytosolic Ca" in Human CNSTumour Cells and in Non-Malignant OTHER PUBLICATIONS and Malignant Cells of Rat Origin”, Journal of Neurochemistry, (2005), vol. 93, pp. 321-329. Porsolt et al. Nature (1977) 266:730-732. Vippagunta et al. Advanced Drug Delivery Reviews (2001) 48:3-26. Poulsen et al. Bioorg & Med Chem Letter (2001) 11:191-193. Weisburger, JH. "Antimutagens, anticarcinogens, and effective worldwide cancer prevention”, J Environ Pathol Toxicol Oncol, Puckett et al., “Molecular Cloning and Chromosomal Localization 1999; vol. 18 (2), pp. 85-93. of one of the Human Glutamate Receptor Genes,” (1997), PNAS, Xia, et al., J Med Chem (1997) 40:4372-4377. 88: 7557-7561. Yan et al. J. Biol. Chem. 271: 25699-25706, 1996. Qiu & Davis. Genes Dev. 7: 1447-1458, 1993. Yan et al. J. Neurosci. 14:973-984, 1994. Reed et al. Jour of Neurosci 22:5188-5197, 2002. Yan et al. Proc. Natl. Acad. Sci. USA. 92: 9677-9681, 1995. Repaske et al., A Polymerase Chain Reaction Strategy to Identify Yin et al. Cell 79: 49-58, 1994 (Abstract only). and Clone Cyclic Nucleotide Phosphodiesterase cDNAS: (1992), Francis, et al., Developmental Cell. (2002)3(1): 85-97. The Journal of Biological Chemistry, 267: 18683-18688. Iwatsubo, T., et al., Neuron (1994) 13:45-53. Rozic, J. et al., “Cyclooxygenase inhibitors retard murine mammary Langman et al., Lancet. (1994) 343: 1075-1078. Li et al., J. Neurochem. (2002) 82(6): 1540-1548. tumor progression by reducing tumor cell migration, invasiveness Mann, et al., Am. J. Pathol. (1996) 148: 1257. and angiogenesis'. Int. J. Cancer, 2001; vol. 93 (4); pp. 497-506. Roher et al., Proc. Natl. Acad. Sci. USA. (1993) 90: 10836-10840. Rybalkin et al. Circ Res (2003) 93:280-291. Steiner et al., J. Biol. Chemistry. (2002) 277(42): 39062-39065. Sakakibara et al. Neuroendo. 68: 365-373, 1998. Yamaguchi et al., Amyloid Int. J. Clin. Invest. (1995) 2: 7-16 Sharma et al. J. of Biological Chemistry 255: 5916-5923, 1979. (Abstract Only). Shimizu, K. et al., "Calmodulin-Dependent Cyclic Nucleotide International Search Report for International Application No. PCT/ Phosphodiesterase (PDE1) is a Pharmalogical arget of Differentia US03/00249 mailed Jul. 30, 2003. tion-Inducing Factor-1, an Antitumor Agent Isolated from Cai J X et al: “Dose-dependent effects of the dopamine D1 receptor Dictyostelium”. Cancer Res., (Apr. 1, 2004), vol. 64, No. 7, pp. agonists A77636 or SKF81297 on spatial working memory in aged 2568-2571. monkeys”. J. Pharma. Exp. Therap., vol. 283 (1), p. 183-189 Skoulakis, et al. Neuron. 11: 197-208, 1993—(Abstract only). (1997). Snyder et al. J. Neurochem. 63: 1766-1771, 1994. RecName: Full-Gamma-secretase-activating protein; Svenningsson et al. Neuroscience 84(1): 223-228, 1998. Short=GSAP; AltName: Full=Protein pigeon homolog; Contains: Svenningsson et al. The AAPS Jour. 7: E353-E360, 2005. RecName: Full=Gamma-secretase-activating protein 16 kDa Traficante et al., “Dopamine-Sensitive Adenylate Cyclase and C-teminal form; Short=GSAP-16K, document states: created: May cAMP Phosphodiesterase in Substantia Nigra and Corpus Striatum 20, 2008, sequence updated: May 20, 2008, annotation updated: Jul. of Rat Brain.” (1976), Life Sciences, 19: 1061-1066. 28, 2009; 4 pages; obtained from http://www.ncbi.nlm.nih.gov/ Tsou et al., Nitric oxide/cGMP pathway stimulates phosphorylation protein? 189041192?sat=12&satkey=1918148 on Aug. 19, 2016. of DARPP-32, a dopamine- and cAMP-regulated phosphoprotein, Uncharacterized protein LOC392943 homolog, document states: in the substantia nigra, Proc. Natl. Acad. Sci USA, Apr. 1993, vol. created: May 20, 2008, sequence updated Oct. 11, 2005, annotation 90, pp. 3462-3465. updated: Jun. 10, 2008; 3 pages; obtained from http://www.ncbi. Turko et al. Mol Pharmacol (1999) 56: 124-130. nlm.nih.gov/protein? 123793106?sat=11&satkey=7563622 on Aug. Uckert et al., J Urology (2004) 171(4):428 (abstract). 19, 2016. Ungerstedt, Acta Physiol Scand Suppl (1971) 367: 1-48. Ungerstedt et al., Brain (1970) 24:485-493. * cited by examiner U.S. Patent Mar. 28, 2017 Sheet 1 of 9 US 9,605,041 B2

i. f : -

~~~~$${}*?$$$$$$Ávi?#?~--~~~~------~~~~~----Ç{}}:}{*';A(;*??}~~~~~~~~$?%. 4 -

3,3×{3$$----§§žÀ------~~-----~~~~------(A\;3,5}------?’5}}{{{3}}{{{?º).VÌÔ------~~------~~~~----{}^{..}.No.

------~~~~?ÅS'I??J,Ä------~~~~Hºë

U.S. Patent Mar. 28, 2017 Sheet 3 of 9 US 9,605,041 B2

C?IAIÕTIXXIX?£)AKÖTHR,THOIX{TÕVAW-~~~~~~~~~~-- -EIGIS'INHMETRINITIANNHKHTH?'??XXASEI'INSC?'IXI?MÃ?XISNÕ- U.S. Patent Mar. 28, 2017 Sheet 4 of 9 US 9,605,041 B2

CIIaanã, U.S. Patent Mar. 28, 2017. Sheet 5 of 9 US 9,605,041 B2

s & & sex

38:::::::::::883: 3:33:32:3:38 U.S. Patent Mar. 28, 2017. Sheet 6 of 9 US 9,605,041 B2

E. k i & w tiew tie is stupid) if

s w s 8x8 tie. q firgid sy U.S. Patent Mar. 28, 2017. Sheet 7 of 9 US 9,605,041 B2

x3 & ** is w i8 33x: 83.38: 8:8;x U.S. Patent Mar. 28, 2017. Sheet 8 of 9 US 9,605,041 B2

ii. it. w re

k x

US 9,605,041 B2 1. 2 REGULATORY PROTEINS AND INHIBITORS 42) form, each having a distinct COOH-terminus. The major histological lesions of AD are neuritic plaques and neuro CROSS REFERENCE TO RELATED fibrillary tangles occurring in affected brain regions. Neu APPLICATIONS ritic plaques consist of AB peptides, primarily AB40 and AB42. Although healthy neurons produce at least ten times This application is a continuation of PCT/US2010/ more A340 compared to AB42, plaques contain a larger 002173 filed on Aug. 5, 2010, which claims the benefit of proportion of the less soluble AB42. Patients with the most U.S. Provisional Application No. 61/231.462, filed Aug. 5, common form of familial Alzheimer's disease show an 2009, the contents of each of which are incorporated herein increase in the amount of the AB42 form. The AB40 form is by reference. 10 not associated with early deposits of amyloid plaques. In contrast, the A342 form accumulates early and predomi TECHNICAL FIELD nantly in the parenchymal plaques and there is strong evidence that AB42 plays a major role in amyloid plaque The field relates to a previously uncharacterized protein deposits in familial Alzheimer's disease patients. Neurofi that activates Y-secretase to produce 3-amyloid protein (AB). 15 brillary tangles consist of aggregated tau protein and their Deposition of AB has been associated with Alzheimer's role in AD pathology is less clear. AD symptoms are most disease and other pathologies. The invention provides, e.g., closely correlated with total brain AB rather than plaques. screening methods and novel research tools, inhibitors of About 10% of AD cases result from autosomal dominant this novel protein, and methods of treatment and control of inheritance of mutations in either the APP or the presenilin Alzheimer's disease and other neurodegenerative conditions 1 and presenilin 2 genes. In both cases, increased production associated with deposition of AB. of total AB or AB42 versus A340 results. The N2a cell system has been extensively studied as a BACKGROUND OF THE INVENTION model system of AB production relevant to neurodegenera tion in AD. Assays measuring production of AB in N2a cells Currently, over twelve million people worldwide suffer 25 are known, wherein AB-production activity is evaluated e.g., from Alzheimer's Disease (AD). This number is predicted to by AB ELISA assay and/or by Western blotting. Various quadruple over the next 40 years. As such, treatment of AD agents including compounds such as Gleevec (Imatinib, represents a major unmet medical need. Currently approved STI571) have previously been shown to be capable of medicines to treat AD may help ameliorate symptoms, but lowering AB levels in the N2a cell system at drug concen are not effective to stop progression of the disease. 30 trations of below 10 uM. Without being bound by a particular theory, it is believed International Patent Publication No. WO 03/057165 dis that the pathology of Alzheimer's disease (“AD) involves closes that certain previously known inhibitors of tyrosine amyloid- (“AR”) peptides, which are metabolites of kinases. Such as imatinib, are useful to inhibit the production B-amyloid precursor protein (Alzheimer's disease-associ of and accumulation of AB. Netzer et al., Proc Natl Acad ated precursor protein or “APP), and are believed to be 35 Sci., 100(21): 12444-9 (2003) showed that imatinib inhibits major pathological determinants of AD. These peptides exist production of AB without affecting Y-secretase cleavage of mainly in 40 or 42 amino acid forms, AB1-40 (“AB40') and Notch-1 and without unacceptable toxicity to the neurons. Af31-42 (“AB42), respectively. A?40 and AB42 are gener Imatinib is not an ideal drug for treating AD, however, ated by two enzymatic cleavages occurring close to the because it does not penetrate the blood brain barrier very C-terminus of APP subsequent to cleavage by beta secre 40 well, and it has other biological effects. The specific target tase. The enzymes responsible for the cleavage, B-secretase of imatinib for inhibition of production of and accumulation and Y-secretase, generate the N- and C-termini of AB, of AB has not been defined, so finding improved derivatives respectively. The amino terminus of A is formed by presents challenges. B-secretase cleavage between methionine residue 596 and aspartate residue 597 of APP (numbering based on APP 695 45 SUMMARY OF THE INVENTION isoform). Y-Secretase cleaves at varying positions 38-, 40- or 42-residues at the C-terminal of this f-secretase cleavage We have discovered a novel Y-secretase activating protein product to release the AB peptides. A third enzyme, C-Secre (gSAP) that selectively modulates AB production through a tase, cleaves the precursor protein between the B- and mechanism involving its interactions with both Y-secretase y-cleavage sites, thus precluding AB production and releas 50 and its substrate, amyloid precursor protein C-terminal frag ing an approximately 3 kDa peptide known as P3, which is ment (APP-CTF). gSAP does not interact with Notch nor non-pathological. Both B- and C-Secretase cleavage also affect its cleavage by Y-secretase. Recombinant gSAP stimu result in soluble, secreted-terminal fragments of APP, known lates A3 production in vitro and in intact cells. Reducing as SAPPB and SAPPC, respectively. The SAPPC fragment gSAP in cell lines decreases AB levels. Knockdown of gSAP has been Suggested to be neuroprotective. For example, 55 in mouse models of Alzheimer's disease reduces levels of Y-secretase also cleaves Notch-1 protein and is believed to AB and plaque development. gSAP represents a novel have other Substrates. Direct acting gamma-secretase inhibi therapeutic target for the treatment of Alzheimer's disease tors have substantial and unwanted side effects due to the and other AB-mediated conditions, as inhibition of gSAP effects on development pathways requiring Notch cleavage. results in significant reduction in AB formation. Little is known about the molecular mechanisms that confer 60 Applicants have synthesized compounds that inhibit the Substrate specificity on this potentially promiscuous gSAP and thus lead to decreased AB, but do not affect enzyme. Gamma Secretase enzyme is known to contain four NOTCH metabolism, which is a potential side effect with Subunits: presenilin, nicastrin, anterior pharynx-defective 1 use of Some gamma-secretase inhibitors. (APH-1), and presenilin enhancer 2 (PEN-2). Accordingly, the invention provides, e.g., methods of In normal individuals, the AB peptide is found in two 65 screening compounds for potential utility in reducing Af predominant forms, the majority A?8-40 (also known as comprising measuring their ability to selectively inhibit Af31-40) form and the minority AB42 (also known as AB1 gSAP, and methods of treating AB-mediated conditions, US 9,605,041 B2 3 4 Such as AD, comprising administering effective amounts of brane preparation followed by photolysis, none of the four a compound which selectively inhibit gSAP. components of Y-secretase are labeled. Rather, 'I-G01 labels a ~16 kDa protein, which co-immunoprecipitates with DESCRIPTION OF DRAWINGS the more slowly migrating 18 kDa presenilin-1-CTF. This result is confirmed by intact cell photolabeling using cell FIG. 1 depicts a sequence alignment for gSAP from permeable H-G01. Similar to 'I-G01, the H-imatinib various animal species: human, canine, bovine, murine, rat, derivative does not bind to any of the four Y-secretase and chicken. Residues in bold are identical across the six components, but does label a band of ~16 kDa that co species; residues in italics are conservatively substituted. immunoprecipitated with PS1. FIG. 2 depicts expression levels of gSAP in different 10 To purify the potential target protein, immobilized biotin tissues. Tissues from 3 month old wild type BL/6 mice are imatinib is incubated with solubilized membrane prepara harvested and gSAP levels are quantitated using real time tions and bound proteins are separated by SDS-PAGE. After PCR. Both actin and GAPDH serve as internal controls silver staining, a ~16 kDa band is observed. Peptide frag (n-6). Tissue extracts are adjusted to the same protein levels ments, derived from this band after trypsin digestion, and prior to analysis. 15 analyzed by tandem mass spectrometry, corresponded to the FIG. 3 shows inhibition of gSAP by shRNA reducing AB C-terminal region of an uncharacterized protein, pigeon production and plaque development in an AD mice model. homologue protein (PION) (human accession number: FIG. 4 shows effect of intrahippocampal injection of NP 059.135). The identification is made based on two AAV2-carrying shRNA against gSAP in reducing amyloid unique tryptic peptides (7LWDHPMSSNIISR77 and plaque development in double transgenic AD mice. 77NHVTRLLQNYKK') covering approximately 20% of FIG. 5 shows gSAP action on APP processing. Ternary the 16 KDa fragment. Its sequence, especially the C-termi complex of gSAP APP and Y-secretase (top) is associated nal region, is highly conserved among multiple species from with elevated Y-cleavage (AB-beta production) and reduced chicken to human. Expression pattern analysis indicates that e-cleavage (AICD production). In the absence of gSAP this gene is expressed in diverse tissues. We characterize (bottom), the binary complex of APP and e-secretase is 25 PION as a gamma-secretase activating protein (gSAP). associated with decreased Y-cleavage and increased e-cleav Based on its predicted sequence, the full opening reading age. frame of human gSAP encodes a protein of 854 amino acids FIG. 6 shows truncation of APP-CTF and immunopre (-98 kDa). To determine whether the 16 kDa fragment might cipitation using gSAP antibody through gSAP, demonstrat be derived from a high molecular weight precursor, the ing that gSAP interacts with the juxtamembrane region of 30 metabolism of endogenous gSAP in neuroblastoma cells is APP-CTF. APP-CTF-T1 is the truncated form of APP-B- monitored by pulse-chase analysis. The results showed that CTF spanning from its N-terminus to HHGV. APP-CTF gSAP is synthesized as a holo-protein (~98 kDa) and is T2 is the truncated form of APP-3-CTF spanning from its rapidly processed into a ~16 kDa C-terminal fragment N-terminus to VMLKK. Truncated forms are overex (gSAP-16K). In the steady state, the 16 kDa fragment is the pressed in HEK293 cells and immunoprecipitated with 35 predominant form. Incubation of neuroblastoma cells with gSAP antibody. 6E10 antibody is used for immuno-detec photoactivatable H-G01 followed by immunoprecipitation tion. with anti-gSAP antibody confirms that imatinib directly binds gSAP-16K. In presenilin 1/2 (-/-) embryonic stem DETAILED DESCRIPTION cells, imatinib also binds gSAP, indicating that its binding to 40 gSAP does not require presenilins. When gSAP levels are The examples and drawings provided in the detailed reduced using siRNA, the amount of Y-secretase associated description are merely examples, which should not be used with biotin-imatinib decreases significantly. This indicates to limit the scope of the claims in any claim construction or that the affinity of imatinib for the Y-secretase complex interpretation. depends on gSAP. Senile plaques composed predominantly of AB peptides 45 When siRNA is used to reduce gSAP level (by 72+15%) are a hallmark of Alzheimer's disease. A? is derived from in neuroblastoma cells overexpressing APP695, the level of APP-CTF upon cleavage by Y-secretase. Y-Secretase also A? decreases about 50%. The addition of imatinib has little cleaves many other type I membrane proteins (such as or no additional effect on AB levels. ShRNA-mediated gSAP Notch), leading to the release of intracellular domains with knockdown (by 65+12%) in HEK293 cells expressing APP critical cellular functions. As a result, non-selective y-secre 50 Swedish mutation also results in a decrease of AB40 and tase inhibitors may have detrimental side effects that prevent Af342 levels of 61% and 48%, respectively. Conversely, their clinical use. This laboratory previously demonstrated overexpression of gSAP in HEK293 cells expressing the that imatinib (STI571, GleevecR) can inhibit production of APP Swedish mutation stimulates AB production by all species of A? without influencing Notch cleavage. Netzer approximately 38%; the increase is abolished by imatinib et al., Proc Natl Acad Sci., 100(21):12444-9 (2003). We have 55 treatment. Together, these findings indicate that gSAP is the now determined that the AB-lowering activity of imatinib molecule through which imatinib and related molecules results from its interaction with a previously unknown lower AB. factor, which we designate Y-secretase activating protein One distinctive feature of imatinib is its selective inhibi (gSAP). tion of AB production while sparing Notch cleavage (Netzer To identify the target responsible for imatinib's selective 60 et al., 2003). The effect of gSAP on Notch cleavage is Af-lowering activity, we synthesized a biotinylated deriva evaluated using HEK293 cells stably expressing Notch AE tive of imatinib, “biotin-imatinib'. Solubilized Y-secretase (Notch without its extracellular domain), the Notch substrate components, including presenilin-1, PEN2, and nicastrin, for Y-secretase. The level of the Y-secretase cleavage prod are specifically captured by the immobilized biotin-imatinib. uct, the Notch intracellular domain (NICD), is not changed To identify the protein with which imatinib directly inter 65 either by reducing gSAP levels using shRNA or by overex acts, we synthesized a photoactivatable azido imatinib pressing gSAP. Thus, gSAP modulates the Y-secretase cleav derivative, G01. When 'I-G01 is incubated with a mem age of APP, but not of Notch. US 9,605,041 B2 5 6 To further test whether gSAP can modulate Y-secretase suppressed by 26+8% (p<0.001, n=4) as compared to the activity, the effect of purified gSAP on AB production is contralateral side after 1 month. These data indicate that examined in an in vitro Y-secretase assay. When recombinant gSAP plays a critical role in AB formation and plaque gSAP-16K (aa 733-854 of full length human gSAP), iso development in vivo. lated after expression in E. coli, is added to membrane To Summarize, gamma-secretase processes diverse Sub preparations from HEK293 cells containing overexpressed strates with low homology at their cleavage sites. The APP-3-CTF, AB production is stimulated 2.4+0.3 fold. various roles of Y-secretase during development and in tissue These in vitro results suggest that gSAP stimulates AB homeostasis require that its activity be tightly regulated. production by direct regulation of Y-secretase activity. Recent reports have shown the existence of biological To determine whether endogenous gSAP might be in a 10 complex with Y-secretase, we use gel filtration analysis of molecules that modify the selectivity of cleavage by Y-secre membrane proteins from neuroblastoma cells solubilized in tase. The discovery of gSAP, a novel protein the function of 1% CHAPSO. Endogenous gSAP-16K and Y-secretase co which is previously unknown, and its ability to selectively migrate as a high molecular weight complex. In addition, stimulate AB formation, enables new strategies for the endogenous gSAP co-immunoprecipitates with Y-secretase 15 development of drugs to address AD and other AB-mediated components, providing further evidence that these proteins diseases, such as Alzheimer's disease, progressive Supra exist in a complex in cells. These results, together with those nuclear palsy, Down Syndrome, memory and cognitive from the in vitro Y-secretase activity assay, strongly suggest disorders, dementia, amyloid neuropathies, brain inflamma that gSAP-16K is in a complex with Y-secretase and can tion, nerve and brain trauma, Vascular amyloidosis, cerebral activate the protease. hemorrhage with amyloidosis, Parkinson's disease, Hun In contrast to some other regulators of Y-secretase activity, tington's disease, prion disease and/or vascular, neurologi gSAP is selective and influences cleavage of APP but not of cal, and/or neurodegenerative disorders related to the abnor Notch. Although the mechanism of substrate selection by mal expression or accumulation of tau or amyloid proteins Y-secretase remains unclear, a number of other proteases and such as AB. Inhibitors of gSAP will selectively prevent B phosphatases with broad Substrate recognition can achieve 25 amyloid formation without affecting other key functions of specificity through auxiliary factors that couple the core Y-secretase. In Support of this view, we demonstrate that a enzyme to a subset of substrates. To determine the mecha widely used anti-cancer drug, imatinib, achieves its AB-low nism by which gSAP might confer such specificity, we ering effect by preventing gSAP activation of Y-secretase to analyze its binding to specific substrates in HEK293 cells. generate AB, but without affecting other Y-secretase func gSAP-16K immunoprecipitates with APP-CTF but not with 30 tions. The discovery of potent and direct pharmacological Notch AE. Addition of imatinib (10 uM) reduces the inter action between gSAP and APP-CTF by 47+14% (n=3). The inhibitors of gSAP should facilitate the development of binding ofgSAP to APP-CTF, but not to Notch, may account novel therapeutic reagents for the treatment of Alzheimer's for the selective effect of gSAP on APP processing. Disrup disease. tion of this interaction by imatinib seems likely to explain its 35 gSAP is found to exist in a variety of animal species, e.g., AB-lowering activity. as depicted in FIG. 1, and is highly conserved. A gSAP The site of interaction between gSAP and APP is deter peptide is a peptide which is mined to be in the juxtamembrane region of APP-CTF (FIG. a. at least 60%, preferably at least 70%, e.g., at least 80%, 6). APP-CTF is cleaved by Y-secretase in the middle of its for example at least 90% similar to a sequence selected transmembrane domain to generate AP (Y-cleavage) and near 40 from the sequences depicted in FIG. 1, using a BLAST its cytosolic membrane boundary to generate APP intracel algorithm (see e.g. blast.ncbi.nlm.nih.gov/Blast.) lular domain (AICD) (e-cleavage). The effect of gSAP on b. a peptide having residues corresponding to the con AICD production is examined in N2a cells overexpressing served residues in bold in FIG. 1, or APP695. Both gSAP knockdown and imatinib treatment c. a peptide comprising the sequence Seq ID No. 7 increases levels of AICD (supplementary FIG. 7a). gSAP 45 (LWDHPMSSNIISR) and/or Seq ID No. 8 overexpression in HEK293 cells reduces AICD production (NHVTRLLQNYKK), or (supplementary FIG. 7b). These results indicate that gSAP In one aspect the invention provides a gSAP peptide as differentially regulates Y- and e-cleavage of APP-CTF to defined above isolated and purified from its natural envi form AB and AICD respectively. ronment, for example a transgenic gSAP peptide, e.g. pro To determine whether our findings are relevant to AD 50 duced by a bacterial, baculovirus or mammalian cell. pathology, the effects of gSAP on soluble AB levels and on In another aspect, the invention provides a vector com plaque development are examined in vivo. A gSAP knock prising a gene for a gSAP peptide operably linked to a down mouse line is generated by integration of tetracycline heterologous promoter. inducible gSAP shRNA vector into the mouse genomic In another aspect, the invention provides a cell containing locus. Upon induction, gSAP mRNA level in the mice brain 55 a heterologous gene expressing a gSAP peptide. is reduced by -85%. To evaluate the effect of gSAP on AB In another aspect the invention provides inhibitory RNA levels in vivo, gSAP RNAi mice are cross-bred with an AD constructs capable of inhibiting gSAP expression in a mam mouse model with APPSwe and PS1A9 mutations (AD malian cell. 2xmice) (Jankowsky et al. 2001). After 1 month gSAP In another aspect, the invention provides shRNA induction, AB40 and AB42 levels in the cross-bred 60 a. monoclonal antibodies to gSAP, e.g., capable of inhib mice are lowered by ~28% and ~32%, respectively. To iting its interaction with gamma-secretase and so inhib evaluate the effect of gSAP on plaque development in AD iting or reducing as AB production and accumulation; 2xmice, recombinant adeno-associated virus 2 (AAV2) car b. Vaccines comprising an immunogenic fragment of rying gSAP shRNA is injected into plaque-developing hip gSAP in combination with a suitable adjuvant and/or pocampus on one side of the brain, while the contralateral 65 carrier, and side receives the AAV2 without snRNA. Amyloid plaque c. immunogenic conjugates comprising an immunogenic development on the ipsilateral side of gSAP knockdown is fragment of gSAP linked to an immunogenic carrier. US 9,605,041 B2 7 8 In another aspect, the invention provides gSAP knockout 2. radiolabeled derivatives, e.g., 4-azido-2-hydroxy mammals, e.g., mammals, for example mice, wherein their 5-iodo-N-(4-methyl-3-(4-(pyridin-3-yl)pyrimi gene for gSAP is disrupted. din-2-ylamino)phenyl)benzamide, or H-imatinib, In another aspect, the invention provides the use of a and gSAP peptide, e.g. as defined above, in an assay to identify compounds which inhibit AP-deposition, e.g., a method of 3. biotinylated derivatives, e.g., selected from identifying an inhibitor of AP-deposition, comprising one or IC339239 and IC2000001 (an inactive control more of the following: compound):

HN O NH H COrc s HN O S

IC339239: active

IC200001: inactive

40 a. measuring binding of test compounds to a gSAP The invention thus additionally provides labelled deriva peptide, e.g., as defined above, tives of imatinib, e.g., as described above. i. e.g., in a competitive binding assay, The invention additionally provides a method of identi ii. e.g., using labeled derivatives of imatinib: fying persons at risk of developing AD comprising checking 45 for elevated expression levels and/or mutations in gSAP relative to normal values as identified using a control N population. According to a further feature of this aspect of the 50 invention there is provided a method for producing an --- a NN inhibitory effect against the accumulation of abnormal pro CH N tein aggregates in a warm-blooded animal. Such as man, in need of Such treatment which comprises administering to said animal an effective amount of a compound of formula 55 (I), or a pharmaceutically acceptable salt thereof. Furthermore, the compounds of this invention are useful in the treatment, control and management of diseases char acterized by accumulation of abnormal protein aggregates, especially in the brain—for example, diseases such as 60 Alzheimer's disease, progressive Supranuclear palsy, Down Syndrome, memory and cognitive disorders, dementia, amy iii. e.g., labeled by substitution by or modification with loid neuropathies, brain inflammation, nerve and brain a labeling group at the methylpipirizinyl moiety, trauma, vascular amyloidosis, cerebral hemorrhage with iv. e.g., selected from amyloidosis, Parkinson's disease, Huntington's disease, 1. photolabeled derivatives, e.g., 4-azido-2-hydroxy 65 prion disease and/or vascular, neurological, and/or neurode N-(4-methyl-3-(4-(pyridin-3-yl)pyrimidin-2- generative disorders related to the abnormal expression or ylamino)phenyl)benzamide, accumulation of tau or amyloid proteins such as AB. Such US 9,605,041 B2 10 abnormal protein aggregates include, for example, i) amy carrier, e.g., conjugated to an immunogenic carrier, loid plaques and neurofibrillary tangles, and ii) precipitates e.g., a bacterial toxoid, e.g. diphtheria or tetanus toxoid, of tau or amyloid proteins such as AB. keyhole limpet hemocyanin (KLH), blue carrier pro tein, ovalbumin, or bovine serum albumin, and/or Accordingly, the present invention provides methods of 5 delivered together with an adjuvant, e.g. Freund's treatment of Alzheimer's disease, progressive Supranuclear adjuvant or alum adjuvant. palsy, Down Syndrome, memory and cognitive disorders, The invention provides, in a further embodiment, methods dementia, amyloid neuropathies, brain inflammation, nerve to identify candidates for treatment with gSAP-targeted and brain trauma, vascular amyloidosis, cerebral hemor 10 therapy, e.g., e.g. administration with gSAP inhibitors or rhage with amyloeiosis, Parkinson's disease, Huntington's vaccines as described above, the methods selected from, disease, prion disease and/or vascular, neurological, and/or C.9. neurodegenerative disorders related to the abnormal expres 1. Measuring gSAP expression, e.g., using antibodies to gSAP or quantitative PCR for gSAP expression, wherein sion or accumulation of tau or amyloid proteins such as AB, 15 elevated expression is seen in candidates for treatment with comprising administering an effective amount of a com gSAP targeted therapy; or pound to inhibit gSAP activity. 2. Identifying patients having mutations affecting gSAP or Compounds useful to inhibit gSAP activity include gSAP expression, e.g., having haplotypes comprising any of known Small molecules, e.g. the following groups of SNPs a. Imatinib and other compounds as disclosed in Interna tional Patent Publication No. WO 03/057165 and in a) rs6976567 rs1468682|rs 1819814, U.S. Pat. No. 5,521,184, the contents of which are b) rs1468682|rs1819814|rs4729535, incorporated herein by reference; b. Compounds as described in WO 05/072826; J. Zim c) rs1819814|rs4729535|rs4729540, mermann et al., Bioorganic & Medicinal Chem. Lett. 25 d) rs7781642|rs6955503 rs7776973 7(2): 187-192: EP 1533 304: WO 04/005281; WO wherein patients having Such mutations or haplotypes are 05/0395.86; U.S. Pat. No. 5,521, 184; and WO candidates for treatment with gSAP targeted therapy: 04/110452, the contents of which are incorporated 3. Identifying patients having mutations affecting gSAP herein by reference; and c. Compounds as disclosed in WO/2008/153974, 30 activity, e.g., mutations at the sequence encoding the jux WO/2008/153959, and WO/2008/057599, the contents tamembrane region of APP-CTF, wherein patients having of which are incorporated herein by reference. such mutations or haplotypes are candidates for treatment Compounds useful to inhibit gSAP activity also include with gSAP targeted therapy. novel biotherapeutics, as described herein, including The invention further provides diagnostic assay kits for a. Inhibitory RNA molecules, e.g., selected from double 35 use in Such methods, e.g., comprising monoclonal antibod stranded, hairpin, sense or antisense RNA correspond ies to gSAP or primers to the gSAP gene or fragments ing to a portion of the mRNA for gSAP and capable of thereof, and oligonucleotide probes to detect mutations in inhibiting gSAP transcription or translation; for the gSAP gene or in the juxtamembrane region of the gene example, for APP-CTF. i. siRNAS comprising sense sequence e.g., AUGCA 40 GAGCUGGACGACAUUU and antisense sequence e.g. 5'-PAUGUCGUCCAGCUCUGCAUUU; or Example 1 ii. hairpin transcripts produced by a gSAP shRNA coding sequence, e.g. 45 Synthesis of Labeled Imatinib Derivatives

TCCCGGAACTCCATGATTGACAAATTTCAAGAGAATTTGTCA 2,5-dioxopyrrolidin-1-yl 4-azido-2-hydroxybenzoate

ATCATGGAGTTCC TTTTTA (NHS-ASA) is purchased from ProChem. Inc (Rockford, o Ill.). 6-Methyl-N'-(4-(pyridin-3-yl)pyrimidin-2-yl)benzene 50 1,3-diamine and N-(4-methyl-3-(4-(pyridin-3-yl)pyrimidin TGCTGTTGACAGTGAGCGCGGAAATAGAGTGGTGATTAAAT 2-ylamino)phenyl)-4-(piperazin-1-ylmethyl)benzamide (N-desmethylimatinib) are purchased from ChemPacific Inc AGTGAAGCCACAGATGTATTTAATCACCACTCTATTTCCATG (Baltimore, Md.). 2,5-dioxopyrrolidin-1-yl 5-((3aS.4S, CCTACTGCCTCGGA; 6aR)-2-oxo-hexahydro-1H-thieno3,4-dimidazol-4-yl)pen 55 tanoate (Biotin-OSu), N-(chloro(dimethylamino)methyl b. Vectors and cells producing inhibitory RNA molecules, ene)-N-methylmethanaminium hexafluorophosphate e.g. recombinant adeno-associated virus 2 (AAV2) car (TCFH), trifluoroacetic acid (TFA), 1H-benzod 1.2.3 tri rying gSAP shRNA; azol-1-ol (HOBt) and N,N-diisopropylethylamine (DIPEA) c. Antibodies to gSAP, especially monoclonal antibodies, are purchased from Sigma-Aldrich (St. Louis, Mo.). Tert for example antibodies raised against fragments from 60 butyl 2-(piperazin-1-yl)ethylcarbamate is purchased from the C-terminal region, e.g., 16K-gSAP, for example antibodies raised against the peptide CFEGHDNV Astatech Inc (Bristol, Pa.). DAEFVEEAALKHT (corresponding to aa 829-848 of (a) Synthesis and Kinase Profiling of Biotin-Imatinib human gSAP with an N-terminal cysteine attached for (Active and Inactive Form): conjugation) as described more fully below: 65 Two forms of biotinimatinib are synthesized, one having d. Vaccines for gSAP, comprising a fragment of gSAP in the characteristic kinase activity of imatinib, and the other combination with an immunogenic adjuvant and/or lacking kinase activity. US 9,605,041 B2 11 12

H H N N N Ns O N 21

IC339239: active

IC200001: inactive

Inactive biotin-imatinib, (IC200001) is synthesized by mediates, tert-butyl 2-(piperazin-1-yl)ethylcarbamate and reacting N-desmethylimatinib with Biotin-OSu. Active bio- 6-methyl-N'-(4-(pyridin-3-yl)pyrimidin-2-yl)benzene-1,3- tin-imatinib, (IC339239) is synthesized from the key inter- diamine, via 4 steps: surr -(a) rr - OH (b)

21al r N - NH NH N HN ? O COONa2 . 21 US 9,605,041 B2 13 14 -continued

HN COrc

IC339239

Reagents and Conditions: (a) 4-(bromomethyl)benzoic acid, titled compound with a yield of 68%. The product, G01, KCO, DMF, r.t., 2 h. (b) 6-methyl-N'-(4-(pyridin-3-yl) 4-azido-2-hydroxy-N-(4-methyl-3-(4-(pyridin-3-yl)pyrimi pyrimidin-2-yl)benzene-1,3-diamine, TCFH, DIPEA, DMF, din-2-ylamino)phenyl)benzamide, is confirmed by mass rt., overnight. (c) TFA, CHCl, r.t., 30 min. (d) Biotin-OSu, spectral analysis using an ESI-MS in the positive mode HOBt, DIPEA, r.t., overnight, and then HPLC purification. M+H", demonstrating a m/z of 439.1. The kinase profiling is performed by Millipore Inc. using 25 (c) Radioiodination of G01 by 'I is performed without the standard assays for Abl kinase and PDGF receptor carrier using a modification of a Chloramine-T procedure (ATP-45 uM). Compound IC200001 shows no significant and the iodinated product is purified by HPLC. Specifically, inhibitory activity toward either kinase, while compound in a UV protected “V” vial, total volume 0.9 ml, ~10 mCi of IC339239 has an IC50 of 146 nM against Abl kinase 30 'I stock isotope (volume=25 ul) is added to 200ul of 0.2M (imatinib has an IC50 of 79 nM) and an IC50 of 6.6 uM phosphate buffer, pH 7.2. G01 is dissolved to 1 mg/ml in against PDGF receptor (imatinib has an IC50 of 4.8 LM). ethanol and 25ul of this solution is combined with chloram Thus, we refer to IC200001 as “inactive biotin-imatinib' ine-T at 1 mg/mL in water (50 ul) and then added to the and IC339239 as “active biotin-imatinib'. 35 V-vial. The reaction proceeded for 1 min and is terminated (b) Synthesis of an Imatinib Derived Photo-Affinity by the addition of 50 uL of 1 mg/ml meta-bisulfite. The Label, G01: reaction mixture is chromatographed on a 25 cm Waters An imatinib derivative, 4-azido-2-hydroxy-N-(4-methyl RP-C18 column, using 0.1% TFA in water as the “A” 3-(4-(pyridin-3-yl)pyrimidin-2-ylamino)phenyl)benzamide, solvent and 0.1% TFA in acetonitrile as the “B” solvent. A 40 is capable of being photoactivated. N,N-Diisopropylethyl gradient is run at 1 ml/min from 0% B to 50% B for 45 amine (DIPEA) (63 ul. 0.36 mmol) is added to a solution of minutes and held at 50% B for 15 minutes. The product NHS-ASA (50 mg, 0.18 mmol), HOBt (25 mg, 0.18 mmol), demonstrated a retention time of 54.5 min as followed by and 6-Methyl-N'-(4-(pyridin-3-yl)pyrimidin-2-yl)benzene radiochemical detection, and had a specific activity of 2000 1,3-diamine (50 mg, 0.18 mmol) in DMF (2 ml). The 45 Curies per millimole. The I labeling experiment is per reaction mixture is stirred at room temperature overnight formed by PerkinElmer Life and Analytical Sciences, Inc. under argon atmosphere. The generated crude product is The structures of G01, I-G01, as compared to imatinib purified by a semi-preparative HPLC to give 54 mg of the a.

2N a. HO N NaI 125 H H chloreamine-T NDO N Hos

imatinlb GO1 US 9,605,041 B2 15 16 -continued

HO N

I 125

125I-GO1

H-G01 is prepared by ViTrax Radiochemicals via catalytic tures solubilized Y-secretase components, including prese tritium exchange of G01. The labeled product is purified by nilin-1, PEN2, and nicastrin. To identify the protein with HPLC. The composition of the purified product is verified which imatinib directly interacts, we synthesized a photo by co-injection of the tritium labeled product with its cold activatable azido imatinib derivative, G01. When 'I-G01 precursor and both compounds co-chromatographed on an is incubated with a membrane preparation followed by analytical HPLC. photolysis, none of the four components of Y-secretase are (d) Cellular A? Production Assays and Incubation with 25 labeled. Rather, 'I-G01 labels a ~16 kDa protein, which GO1 co-immunoprecipitates with the more slowly migrating 18 Neuroblastoma 2a cells stably overexpressing human kDa presenilin-1-CTF. This result is confirmed by intact cell APP695 are treated with 10 uMG01 for 3 hr. Cells treated photolabeling using cell permeable H-G01. Similar to with DMSO, or DMSO plus imatinib are used as controls. 'I-G01, the H-imatinib derivative does not bind to any of After 3 hr, conditioned medium is collected and AB immu 30 the four Y-secretase components, but does label a band of noprecipitation is conducted using 4G8 antibody. The ~16 kDa that co-immunoprecipitated with PS1. immunoprecipitated AB is separated on 10-20% Tris-tricine To purify the potential target protein, immobilized active gel, transferred to PVDF membrane and detected by 6E 10 biotin-imatinib is incubated with solubilized membrane antibody. Although not as potent as imatinib, G01 signifi preparations and bound proteins are separated by SDS cantly reduces AB compared to the DMSO vehicle at levels 35 PAGE. After silver staining, a ~16 kDa band is observed. of 10 uM. Peptide fragments, derived from this band after trypsin digestion, and analyzed by tandem mass spectrometry, cor Example 2 responded to the C-terminal region of an uncharacterized protein, pigeon homologue protein (PION) (human acces Immobilization of Imatinib and Affinity Purification 40 sion number: NP 059.135). The identification is made based on two unique tryptic peptides (LWDHPMSSNIISR77 For affinity purification, HEK293 cells are homogenized and 77°NHVTRLLQNYKK') covering approximately with 10 mM Hepes, 250 mM sucrose, pH 7.4 in the presence 20% of the 16 KDa fragment. Its sequence, especially the of protease inhibitors. After cell debris is cleared by cen C-terminal region, is highly conserved among multiple trifugation at 1,000 g for 5 mins, the supernatant is subjected 45 species from chicken to human. Expression pattern analysis to ultracentrifugation at 100,000 g for 1 h. The membrane indicates that this gene is expressed in diverse tissues. We pellet is then solubilized on ice in 50 mM Hepes, 150 mM characterize PION as a gamma-secretase activating protein NaCl, 5 mM MgCl, 5 mM CaCl, and 1% CHAPSO (gSAP). containing protease inhibitors (Roche Inc. catio4 693 132 001) for 1 h and subject to ultracentrifugation for 1 h at 50 Example 3 100,000 g. The soluble membrane extracts are incubated with MyonenTM streptavidin T1 beads (cathé56-01, Invitro In Vitro and Intact Cell Photolabeling gen) containing bound active biotin-imatinib for 3 hr at 4°C. Subsequently, the beads are washed three times with lysate For in vitro labeling, membrane pellets are prepared as buffer. Bound proteins are eluted with tricine SDS-PAGE 55 described above and resuspended in 50 mM Hepes, pH 7.4, sample buffer and separated on 10-20% tris-tricine gels. For 150 mM NaCl, 5 mM MgCl, 5 mM CaCl. Resuspended immunoblotting, the gel is then transferred to PVDF mem membranes are incubated with 20 nM 'I-G01 for 3 hr at 4° brane and probed with Y-secretase antibodies: PS1 antibody C. prior to photolysis using a compact UV lamp (4 watt, (cati529592) and Pen-2 antibody (catiNE1008) are from model UVGL-25, UVP Inc.) at 254 nM for 2 mins. To EMD Biosciences and nicastrin antibody is from BD Trans 60 examine labeling specificity, 50 uM imatinib is added to a duction Laboratories (catió12290). Silver staining is used to parallel assay. After photolysis, membranes are pelleted by identify protein bands in SDS-PAGE gels. The -16 kDa ultracentrifugation at 100,000 g for 1 h and solubilized with band is excised, trypsinized, and sequenced by tandem 50 mM Hepes, 150 mM NaCl, 1% CHAPSO, 5 mM MgCl, MS/MS mass spectrometry. 5 mM CaCl. The supernatant is pre-cleared with protein G To identify the target responsible for imatinib's selective 65 plus/protein A beads (EMD Biosciences, cathi IP05) for 30 AB-lowering activity, we synthesize a biotinylated deriva min and proteins are precipitated using PS1 antibody (EMD tive of imatinib, “biotin-imatinib, which specifically cap Biosciences, catiS29592) coupled to protein G plus/protein US 9,605,041 B2 17 18 A beads for 2 h before washing with lysate buffer 4 times. Example 5 The bound material is eluted in SDS-tricine sample buffer and separated using 10-20% Tris-tricine gels, followed by Cellular Knockdown and Overexpression transfer to PVDF membrane. The membrane is dried and exposed to Kodak MS film for autoradiography. For intact 5 For cellular gSAP knockdown experiments, small inter cell labeling, human embryonic kidney cells (HEK293) fering RNA (siRNA) ofgSAP is purchased from Dharmacon grown to ~80% confluency (~10 cells) are incubated with Inc. The sequences of the siRNA used are as follow: sense 0.1 uMH-G01 in Opti-MEM for 2 hours in an incubator at sequence: AUGCAGAGCUGGACGACAUUU; antisense 37° C., with 5% CO, before being transferred to ice for an sequence: 5'-PAUGUCGUCCAGCUCUGCAUUU. Neuro additional hour. Medium is removed and cells are washed 10 blastoma 2a cell line stably overexpressing APP695 is twice with cold phosphate buffered saline (PBS), pH 7.4. transfected with siRNA using DharmaFect 2 reagent at a Photolysis is conducted on ice for 2 minusing a compact UV concentration of 50 nM following instructions provided by lamp (4 watt, model UVGL-25, UVP Inc.) at 254 nM. As the manufacturer. Non-targeting control siRNA (catiid controls, cells are incubated either without UV crosslinking 15 001810-01, Dharmacon Inc.) is transfected in parallel as or in the presence of 50 uM unlabeled imatinib. After control. Short hairpin RNA (shRNA) of gSAP is purchased photolysis, cells (~10 cells for each treatment) are imme from Open BioSystems and transfected into cells using diately homogenized in 1 ml 50 mM Hepes, pH 7.4, 150 mM lipofectamine 2000. The sequence of mouse gSAP shRNA NaCl, 1% CHAPSO, 5 mM MgCl, 5 mM CaCl with in pGIPZ shRNAmir-GFP vector is follows: TGCTGTT protease inhibitor mixture (Roche) on ice. After pre-clearing GACAGTGAGCGCGGGTATAGCCTTATTTGCATAT with protein G plus/protein A beads, proteins are immuno AGTGAAGCCACAGA TGTATATGCAAATAAGGC precipitated for 2 hr using 10 ul of the PS1-loop antibody TATACCCATGCCTACTGCCTCGGA. The sequence of (cati529592 EMD Biosciences). The immunoprecipitate is humangSAP shRNA in pGIPZ shRNAmir-GFP vector is as washed 3 times with lysis buffer. The immuno-purified (IP) follows: TGCTGTTGACAGTGAGCGCGGAAATA material is eluted with SDS sample buffer and product is 25 GAGTGGTGATTAAATAGTGAAGCCACAG ATGTATT separated using a 10-20% Tris-Tricine SDS-PAGE gel, TAATCACCACTCTATTTCCATGCCTACTGCCTCGGA. transferred to PVDF membrane, and the membrane dried The knockdown efficiencies are examined using a real time and exposed to Kodak MS film for autoradiography. RT-PCR kit (cath12183, Invitrogen). For gSAP overexpression in cells, mammalian expression Example 4 30 vector pReceiver-M07 with the full length and the 16 KDa C-terminal fragment (amino acid sequence 733-854) of gSAP Antibody Production and Metabolic Labeling gSAP coding a C-terminal HA tag is purchased from Genecopoeia Inc. The plasmid is transformed into XL 1 blue Rabbit polyclonal antiserum against gSAP is generated by competent cells (cati200249-11, Stratagene) and purified injecting New Zealand White rabbits with the peptide 35 using an EndoFree Maxi preparation kit (catil 12362, Qia gen). Plasmid is transfected into a stable HEK293 cell line CFEGHDNVDAEFVEEAALKHT (corresponding to aa overexpressing APP695, containing the Swedish mutation, 829-848 of human gSAP with an N-terminal cysteine using Fugene 6 (cathi 11815091001, Roche). attached for conjugation) coupled to keyhole limpet hemo To assay AB, the medium is removed after 48 h of cyanin (catipI-77563, Fisher Scientific). Rabbit injections, 40 transfection and replaced with Opti-MEM for 3 h incuba bleeds, and housing are performed by Cocalico Biologicals tion. A? is then immunoprecipitated from conditioned (Reamstown, Pa.). The antibody is purified by passing serum medium using the 4G8 antibody. Quantitation of A? levels through a Sulfolink resin (Thermo Scientific, cath44999) in the conditioned medium is also assessed using AB40 and with the antigenic peptide immobilized and eluted following Af342 ELISA kits (Invitrogen). The procedures are carried the company instructions. For pulse-chase labeling, neuro 45 out according to the manufacturers instructions. blastoma 2a cells are incubated for 30 min with DME When siRNA is used to reduce gSAP level (by 72+15%) minimal essential medium deficient in methionine and cys in neuroblastoma cells overexpressing APP695, the level of teine (Met-Cys-DMEM). Cell proteins are labeled with A? decreases about 50%. The addition of imatinib has little Met-Cys-DMEM containing EXPRESS S Protein Label or no additional effect on AB levels. ShRNA-mediated gSAP ing Mix (catiNEG772014MC, Perkin Elmer) for 15 min at 50 knockdown (by 65+12%) in HEK293 cells expressing APP 37° C. The chase periods are initiated by replacing the Swedish mutation also results in a decrease of AB40 and medium with full culture medium 50% DMEM/50% Opti Af342 levels of 61% and 48%, respectively. Conversely, MEM, 5% fetal bovine serum (FBS) and cells are incubated overexpression of gSAP in HEK293 cells expressing the at 37°C. for various times. For continuous labeling, cells are APP Swedish mutation stimulates AB production by labeled with S Protein Labeling Mix (Perkin Elmer) for 4 55 approximately 38%; the increase is abolished by imatinib hrs without chase, and washed with Dulbecco's Phosphate treatment. Buffered Saline (DPBS). Cell monolayers are lysed in RIPA buffer (10 mM Tris, 1% deoxycholate, 1% Triton X-100, Example 6 0.1% SDS, at pH 7.4) containing protease inhibitors. The lysates are clarified by centrifugation for 20 min at 13,000 60 Co-Immunoprecipitation rpm and the Supernatant is pre-cleared with protein G plus/protein A beads followed by immunoprecipitation using For co-immunoprecipitation, ~10 cells are lysed with 1 gSAP antibody for 2 hrs. The beads are incubated with ml of 50 mM Hepes, 150 mM NaCl, 1% CHAPSO, 5 mM Tris-tricine sample buffer to elute bound proteins which are MgCl, 5 mM CaCl, with protease inhibitors for 30 min on then separated by 10-20% Tris-tricine gel, transferred to 65 ice. Cell debris and nuclei are removed by centrifugation at PVDF membrane, and exposed to Kodak MR film for 13,000 rpm for 20 min. After pre-clearing with protein G autoradiography. plus/protein A beads for 30 min, immunoprecipitation is US 9,605,041 B2 19 20 performed using the corresponding antibody and 30 Jul beads liquid chromatography system (Amersham BioSciences). for 2 hr on ice. The beads are washed 4 times with the lysate Fractionation is performed in the lysate buffer at a flow rate buffer and eluted with 30 ul of SDS sample buffer at 95 of 0.5 ml/min and 1-ml fractions are collected for analysis. degree for 5 mins. Immunoprecipitated proteins are resolved Each fraction is analyzed by western blot against Y-secretase by SDS-PAGE and analyzed by immunoblot. Presenilin 1 antibodies. To detect endogenous gSAP, each fraction is loop antibody AB14 (EMD Biosciences #529594) is used to immunoprecipitated with gSAP antibody. The immunopre detect PS1-NTF, Pen-2 antibody is purchased from EMD cipitated materials are eluted with Tris-tricine sample buffer, Biosciences (#NE1008). Nicastrin antibody is from BD separated by 10-20% Tris-tricine gel, transferred to PVDF Biosciences (#612290). HA monoclonal antibody (#A0089) membrane, and exposed to Kodak MR film for autoradiog and Myc tag polyclonal antibody (#A00172) are from Gen 10 raphy. script Inc. APP-CTF is detected using the 369 antibody (Xu et al. 1998). 6E10 (#SIG39320) and 4G8 (#S1039220) Example 8 antibodies from Covance are used to detect AB. Solubilized Y-secretase components from HEK293 cell In Vitro Y-Secretase Assay membrane preparations are bound to the immobilized ima 15 tinib derivative, biotin-imatinib, and detected by immuno Membrane pellets are prepared from HEK293 cells trans blotting. Both biotin-coated beads and an inactive biotin fected with APP-R-CTF (CT-100) as described above, and imatinib derivative served as controls. Endogenous the membranes are washed with assay buffer (10 mM Hepes, Y-secretase components are detected by specific antibodies 140 mM KOAc, 2.5 mM MgOAc, 0.1 mM CaCl, 1 mM to Nicastrin, PS1-CTF and Pen-2. Photoactivatible 'I and ATP pH 7.2) and pelleted at 100,000 g for 30 min at 4° C. H-G01 are used to label membrane preparations or intact Recombinant gSAP-16K (aa733-854 of the human gSAP) is HEK293 cells, respectively. After lysis and immunoprecipi expressed and purified from BL21 DE3 E. coli. The mem tation with PS1 antibody, bound proteins are separated by branes are resuspended in 200 ul of assay buffer with 2 ug 10-20% Tris-tricine SDS-PAGE. A 16 kDa band is detected recombinant gSAP-16K or the same amount of BSA as by autoradiography in both photolabeling conditions. This 25 control. A parallel system with 1 uML685,458 (y-secretase labeling is eliminated by co-incubation with 50 uM unla inhibitor) is also used as a control. The membrane Suspen beled imatinib before photolysis. The same membranes sion is pre-incubated at 4°C. for 1 hr and then incubated for probed with PS1-CTF antibody show that PS1-CTF 2 hr at 37° C. to allow in vitro generation of AB. The migrates with a slower mobility than the 16 kDa band and membranes are solubilized in 4 volume of 200 mM Tris, pH is not labeled by G01. Proteins in HEK293 cell lysates that 30 7.8, 760 mM. NaCl, 24 mM EDTA, 10% Triton X-100, and bind biotin-imatinib beads are separated on SDS-PAGE and insoluble material is removed by centrifugation at 10,000 g visualized with silver staining. A ~16 kDa band is detected for 20 min. AB is immunoprecipitated from the lysate using (arrow and label “gSAP) that does not bind to biotin alone 4G8 antibody, separated on 10-20% Tris-tricine gel, trans or to inactive biotin-imatinib. After trypsinization, the 16 ferred to PVDF membrane, and subjected to autoradiogra kDa band is identified as the C-terminal domain of gSAP by 35 phy using Kodak MR film. MS/MS mass spectrometry. S-methionine pulse-chase labeling of endogenous gSAP Example 9 in N2a cells is followed by immunoprecipitation using a polyclonal antibody raised against the C-terminus of gSAP. Notch Cleavage Analysis gSAP is synthesized as the full length 98 kDa-precursor 40 protein and rapidly processed into a C-terminal fragment Plasmid coding NotchAE (truncated Notch-1, lacking migrating at 16 kDa. After 4 hrs of continuous S-methio most of the Notch extracellular domain, with a C-terminal nine labeling (steady-state conditions), the predominant myc tag) is described previously (Netzer et al. 2003). Cells cellular form of gSAP is the 16 kDa species. Intact N2a cell transfected with NotchAE are co-transfected with gSAP labeling is performed by incubation with H-G01. Cells are 45 shRNA or gSAP plasmids. After two days of transfection, lysed with RIPA buffer and proteins were immunoprecipi Notch expression and cleavage are detected with anti-myc tated with gSAP antibody. After separation on SDS-PAGE antibody. The cleaved Notch intracellular domain (NICD) is and radiography, gSAP-16K is found to be specifically detected with a cleavage-specific antibody (Notch1 Val labeled by H-G01; this labeling is quenched by pre-incu 1744, Cell Signaling Inc.). Cells treated with L-685,458 bation of cells with 50 uM imatinib. gSAP overexpressed 50 serve as controls. with or without PS1 in presenilin null embryonic stem cells gSAP regulates AB production but does not influence bound biotin-imatinib is detected by immunoblotting. Under Notch cleavage. siRNA-mediated knockdown of gSAP in gSAP siRNA knockdown conditions, PS1 no longer captures N2a cells overexpressing APP695 results in lowered AB biotin-imatinib. production. The AB-lowering effects of imatinib and of 55 siRNA are not additive. Transfection with gSAP shRNA of Example 7 HEK293 cells stably expressing human APP containing the Swedish mutation reduces the levels of both Af40 and Gel Filtration Chromatography Af342. gSAP overexpression in HEK293 cells increases AB levels and this effect is blocked by imatinib. Under either N2a cells are labeled with S. Protein Labeling Mix 60 gSAP knockdown or overexpression conditions, Notch pro (Perkin Elmer) for 4 hrs as described above. Solubilized cessing is not affected in HEK293 cells overexpressing membrane preparations (0.2 ml, ~ 1 mg of solubilized pro extracellular domain truncated Notch (NotchAE, with C-ter tein, in 50 mM Hepes, 150 mM. NaCl, 1% CHAPSO, 5 mM minal myc tag). NICD is detected using a myc antibody and MgCl, 5 mM CaCl) are centrifuged for 1 h at 100,000 g to a cleavage-product specific antibody (Notch1 Val-1744). remove potentially aggregated material. The resulting Super 65 Recombinant gSAP-16K purified from E. coli stimulates AB natant is loaded onto a Superdex 200 10/300 GL column production in an in vitro Y-secretase assay. The Y-secretase (Amersham Biosciences) of an AKTA fast performance inhibitor, L685,458 (1 uM) abolishes AB production. US 9,605,041 B2 21 22 gSAP interacts with Y-secretase and APP-CTF, but not AAV2-siln4.1-MCS-EGFP vector (Vector biolabs) via with Notch AE. Membrane preparations from N2a cells are BamHI and HindIII sites. The triple transgenic AD mice (6 prepared, lysated with 1% CHAPSO, subjected to gel fil months old) are analyzed for AB. The double transgenic AD tration, and detected by western blotting. Endogenous mice (13 months old) are analyzed for plaques. For each gSAP-16K co-migrates with Y-secretase components. Col 5 group, mice are deeply anesthesized with a mixture of umn Void fraction=6. Immunoprecipitation of endogenous ketamine (100 mg/kg) and Xylazine (10 mg/kg) and placed gSAP results in co-immunoprecipitation of Y-secretase com in a stereotaxic frame. AAV2 virus carrying AVV2-gSAP ponents. In HEK293 cells that co-express NotchAE-myc, shRNA-GFP or AVV2-GFP is bilaterally injected into right APP-CTF, and gSAP-16K-HA, immunoprecipitation of or left hippocampus. Stereotaxic coordinates are determined gSAP-16K is associated with co-immunoprecipitation of 10 according to Paxinos Atlas of the mouse brain: anteropos APP-CTF but not of NotchAE. Immunoprecipitation of terior 2.18 mm, mediolateral 1.97 mm and dorso-ventral 2 APP-CTF, but not of NotchAE, is associated with co mm. One ul of each AAV2 (shRNA for gSAP or GFP immunoprecipitation of gSAP-16K. Treatment with ima control) (3.3x10" vg/ml) is injected for 5 minata rate of 0.2 tinib reduces the association between gSAP-16K and APP ul/min with a 10 ul Hamilton Syringe equipped with a CTF. 15 motorized injection pump. The injection needle is allowed to remain in the brain for an additional 5 minto prevent fluid Example 10 extravasation. Mice are sacrificed 4 weeks after injection. To determine AB levels, the hippocampus is removed and gSAP RNAi Mice Line Generation and AB Level solubilized in 2% SDS containing protease inhibitors. The Measurement lysates are centrifuged at 13,000 rpm for 20 mins and the Supernatant is used for ELISA analysis using AB40 and RNAi mice are generated following the procedure as AB42 assay kits (Invitrogen Inc.). described before (Seibler et al. 2007). Specifically, exchange For immunolocalization studies, mice are Subjected to vector carrying gSAP shRNA coding sequence TCCCG intracardiac perfusion with 0.1M PBS followed by 4% GAACTCCATGATTGACAAATTTCAAGAGAATTTGT 25 paraformaldehyde/PBS. After perfusion, brains are removed CAAT CATGGAGTTCCTTTTTA is under the control of a and post-fixed with 4% paraformaldehyde/PBS at 4° C. H1-Tet promoter. Using the recombinase-mediated cassette overnight, followed by incubation with 15% sucrose and exchange (RMCE) technology, the vector is integrated into then 30% sucrose for 24 hours. Cryo-protected brains are cut the mouse ES cell genome (B6/129S6 background). Subse into 25-50 uM thick sections using a cryostat. Sections are quently, transfected ES cells are injected into tetraploid 30 labeled with the anti-AB antibody 6E10 (1:1000, Novus blastocyst to generated inducible RNAi mice. Heterozygous Biologicals) to visualize extracellular amyloid plaques and RNAi mice are then cross-bred with an AD mouse model anti-EGFP antibody (1:500. Invitrogen) to visualize neurons with APPSwe and PS1A9 mutations (AD 2xmice) to gener positively transduced with the shRNA coding AAV virus ate gSAP-RNAi AD mice. shRNA induction is conducted by using an M.O.M immunodetection kit (Vector laboratories, introducing 2 mg/ml doxycycline (Sigma D-9891) in drink 35 PK-2200). Imaging is performed using a Zeiss LSM510 ing water containing 10%. Sucrose. Control mice are fed with confocal microscope. drinking water containing 10% sucrose. Drinking water is Intrahippocampal injection of AAV2-carrying shRNA changed every second day and kept dark. gSAP knockdown against gSAP reduces amyloid plaque development in efficiency in mice is assayed using quantitative real time double transgenic AD mice. Areas showing GFP staining RT-PCR. Total RNA is isolated following standard proce 40 indicate regions of AAV2 vector expression, while red dure and cDNA is synthesized using the Reverse Transcrip fluorescence reveals amyloid plaques, showing that the tion Core Kit (Eurogentec). Real-time PCR reactions are vector expression coincides with the reduction in plaque performed using an iCycler Thermal cycler instrument (Bio formation. GFP-positive regions from five consecutive sec Rad). For mouse brain. A? level measurements, 2 month old tions are analyzed by confocal microscopy. Data is gSAP-RNAi AD mice are induced with doxycycline for 1 45 expressed as plaques per mm (n=4. ***: P-0.001) (FIG. 4). month and brain tissue is extracted with formic acid for ELISA assay. Example 12 Knockdown of gSAP reduces AB production and plaque development in AD mice models.gSAP RNAi-AD mice are N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino)pyri generated by cross-breeding of double transgenic AD mice 50 din-3-yl)-4-(1-methylpiperidin-4-yl)methyl)benz with inducible gSAP RNAi mice. gSAP shRNA expression amide binds gSAP and lowers AB (under doxycycline induction) reduces both AB40 and AB42 levels in the mice brain by ~28% and ~32%, respectively N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino)pyridin-3- (**: P<0.01. n=4) (FIG. 3). yl)-4-(1-methylpiperidin-4-yl)methyl)benzamide (WO/ 55 2008/153974, ex. 7) is selected as a representative imatinib Example 11 analogue having little kinase inhibitory activity when tested against a panel of 40 kinases (data not shown). Compared to Intra-Hippocampal Injections of AAV2-gSAP imatinib, which has a K Versus Abl kinase (its principal shRNA to PS/APP Transgenic Mice target for approved anti-cancer indications) of roughly 100 60 nM, N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino)pyridin Mouse GIPZ shRNAmir individual clone 3-yl)-4-(1-methylpiperidin-4-yl)methyl)benzamide has (V2LMM 88580: containing the hairpin sequence for 100-fold weaker activity, approximately 12,000 nM Ki mouse gSAP gene TGCTGTMACAGTGAGCGCGGG versus this kinase. This compound nevertheless inhibits AB TATAGCCTTATTTGCATATAGTGAAGCCACAGA in a manner similar to imatinib. This further supports that the TGTATATGCAAATAAGGCTATACCCATGCCTACTGC 65 kinase inhibitory activity of imatinib is not the basis for its CTCGGA) is purchased from Openbiosystems/Thermo Sci activity against gSAP but rather that it has a specific effect entific. The hairpin region is excised and inserted into on the interaction between gSAP and gamma secretase. US 9,605,041 B2 23 24 HEK293 cells are transfected with gSAP with a C-termi below, is disclosed in WO/2008/153974, but a synthesis is nal Hemaglutinin (HA) tag. A membrane pellet is prepared provided for convenience sake: the pellet and resuspended in 50 mM Hepes, 150 mM NaCl, 5 mM MgCl2, 5 mM CaCl2, and incubated with the indi cated amount of either imatinib or N-(6-methyl-5-(4-phe nylpyrimidin-2-ylamino)pyridin-3-yl)-4-(1-methylpiperi din-4-yl)methyl)benzamide for 2 hrs, followed by addition of 2 uM Biotin-NCG and incubated for 1 hr. The membrane is pelleted down, solubilized in 50 mM Hepes, 150 mM NaCl, 1% octyl B-D-glucopyranoside, and bound to Myone streptavidin T1 beads for 1 hr., then washed 3 times. The 10 captured protein is released by incubation with SDS sample buffer and detected by western blot. Total human AB in the N2a cell system is measured in a standard sandwich ELISA by using a specific monoclonal antibody (6E10, Signet Laboratories) to capture the AB40 15 and AB42 and an antibody to AB17-24 (4G8, Signet Labo ratories, Dedham, Mass.) for detection. Cell culture medium (5 uL/well) is diluted to 100 uL in phosphate-buffered a) (2-Methyl-5-nitro-pyridin-3-yl)-(4-phenyl-pyrimi saline/0.2% Tween 20 and loaded onto ELISA plates. For din-2-yl)-amine Western blot assays, cell medium is diluted with 2x tricine sodium dodecyl sulfate sample buffer, and heated at 95°C. To a mixture of 3-Bromo-2-methyl-5-nitro-pyridine (4.46 for 5 min. A? is separated by electrophoresis on 16% tricine g, 2.10 mmol) and 4-Phenyl-2-pyrimidinamine (1.3 g, 1.75 polyacrylamide gels (BioFad), proteins are transferred onto mmol) in thy toluene (25 mL) are added CsCO, (0.85g. nitrocellulose membranes and blocked overnight with LiCor 2.62 mmol), Pd(dba) (32 mg, 0.035 mmol) and Xantphos blocking buffer (LiCor, Lincoln, Nebr.). A? is detected with 25 (60 mg, 0.105 mmol). The mixture is evacuated and purged antibody 4G8 and an Alexa 680-conjugated rabbit anti mouse secondary and scanned with a LiCor Odyssey infra with N, heated to 90° C. under nitrogen for 24 h. The red scanner. N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino) reaction mixture is cooled to room temperature, diluted with pyridin-3-yl)-4-(1-methylpiperidin-4-yl)methyl)benzamide EtOAc and filtered. The filtrate is concentrated under significantly lowers AB at concentrations of <500 nM. reduced pressure, and the residue is purified by silica gel For detection of Notch cleavage, HEK293 human embry 30 column chromatography to afford product as yellow solids onic kidney cells are transfected with mouse AE-Notch (320 mg, yield 59%). "H NMR (200 MHz, CDC1): 8 2.75 cDNA with a C-terminal myc tag. For analysis of AE-Notch (s, 3H), 7.19 (s, 1H), 7.37 (d. J=4.0 Hz, 1H), 7.57-7.54 (m, cleavage, cells are incubated with test compounds for 4 h. 3H), 8.17-8.12 (m, 2H), 8.59 (d. J–4.0 Hz, 1H), 9.02 (d. Cell extracts are prepared by lysing cells in cell lysis buffer J=2.0 Hz, 1H), 9.87 (d. J=2.0 Hz, 1H); MS ESI) m/z 308 (50 mM Tris, pH7.5, 10 mM NaCl, 5 mM EGTA, 1 mM 35 M+H". EDTA and complete protease inhibitors (Roche Diagnostics, Indianapolis, Ind.). Protein concentration is determined (b) 2-methyl-N-(4-phenylpyrimidin-2-yl)pyridine using Bradford protein detection reagent. Volume is adjusted with cell lysis buffer, then 4x sample loading buffer (Tris 3,5-diamine Tricine gel loading buffer) is added, samples are heated 5 40 A mixture of catalytic ferric chloride (12 mg), (2-Methyl min at 95°C., and equivalent amounts of cell protein for 5-nitro-pyridin-3-yl)-(4-phenyl-pyrimidin-2-yl)-amine (320 each treatment are loaded onto a 10% Bis-Tris gel. C-ter minal Notch species are detected with monoclonal anti-c- mg, 1.04 mmol) in hydrazine hydrate (12 mL) and methanol myc antibody 9E10 (Roche Diagnostics) and fluorescent (20 mL) is refluxed for 15 min. The reaction mixture is goat anti-mouse secondary antibody. Fluorescent antibody is 45 cooled to room temperature, concentrated under reduced quantitated via LiCor Odyssey infrared fluorescence detec pressure and the crude residue is dissolved in water and tOr. extracted with EtOAc. The combined extracts are dried over N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino)pyridin-3- anhydrous NaSO, filtered, concentrated under reduced yl)-4-(1-methylpiperidin-4-yl)methyl)benzamide and ima pressure. The residue is stirred with EtO for 5 minutes, the tinib do not influence NOTCH metabolism in the cell system 50 ether layer is decanted and the residue is dried under vacuum outlined. The competitive and direct gamma-secretase to give product as yellow solids (270 mg, yield 93%). Mp: inhibitor DAPT is used as a positive control in the assay. 133.1-133.4° C.; H NMR (200 MHz, CDC1): 8 2.51 (s, Since inhibition of NOTCH processing could potentially 3H), 3.62 (bs, 2H), 6.93 (s, 1H), 7.20 (d. J=6.0 Hz, 1H), cause undesirable side-effects, compounds that prevent pro 7.52-749 (m, 3H), 7.74 (d, J-2.0 Hz, 1H), 8.08-8.03 (m, cessing of NOTCH are less desirable as drug candidates. 55 2H), 8.13 (d. J=2.4 Hz, 1H), 8.48 (d. J=4.0 Hz, 1H); MS N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino)pyridin-3- (ESI) m/z 278 M+H". yl)-4-(1-methylpiperidin-4-yl)methyl)benzamide is compa rable to imatinib in this assay. (c) 4-(1-methylpiperidin-4-yl)methyl)benzoic acid

Example 13 60 4-(piperidin-4-ylmethyl)benzoic acid (114 mg. 0.342 mmol) is dissolved in 2 mL of methanol, and then 37% Synthesis of N-(6-methyl-5-(4-phenylpyrimidin-2- formaldehyde aqueous solution (56 uL, 0.685 mmol) is ylamino)pyridin-3-yl)-4-(1-methylpiperidin-4-yl) added. The reaction mixture is stirred at room temperature methyl)benzamide for 5 min, and then NaBHCN (26 mg, 0.41 mmol) is added. 65 The mixture is stirred at room temperature for 2 h, quenched N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino)pyridin-3- with a small amount of water, and then evaporated to yl)-4-(1-methylpiperidin-4-yl)methyl)benzamide, depicted dryness under high vacuum to give white foamy solids, US 9,605,041 B2 25 26 which is used for the next reaction without further purifi Xantphos 4.5-Bis(diphenylphosphino)-9,9-dimethylxan cation. MS (ESC) m/Z 234.1 M+H". thene d) N-(6-methyl-5-(4-phenylpyrimidin-2-ylamino) Example 15 pyridin-3-yl)-4-(1-methylpiperidin-4-yl)methyl) benzamide Binding Assay In one example, an assay may be used to test for an DIEA (149 uL, 0.86 mmol) is added into a suspension of inhibitor of the gSAP protein. A selected sequence of the 2-methyl-N-(4-phenylpyrimidin-2-yl)pyridine-3,5-diamine gSAP protein may be used to detect binding with a potential (47 mg, 0.17 mmol), 4-(1-methylpiperidin-4-yl)methyl) 10 inhibitor. benzoic acid (40 mg, 0.17 mmol), BOP (91 mg, 0.21 mmol) in DMF. The reaction mixture is stirred at room temperature Example 16 under argon atmosphere overnight. The mixture is filtered Diagnostic Assays through a 0.45 um microfilter and the filtrate is purified by 15 a Waters semi-preparative HPLC to give 16 mg of the final a. A diagnostic assay is used to measure levels of the product as white powder. MS (ESI) m/z 493.1 M+H". gSAP protein. Elevated levels of the gSAP protein may be Temperatures are given in degrees Celsius (°C.); opera correlated with disease. tions are carried out at room or ambient temperature (“rt') b. Genetic analysis of variants in the gSAP region is used are at a temperature in the range of 18-25° C. Organic to identify candidates for therapy targeting gSAP. Nine Solutions are dried over anhydrous Sodium Sulphate; evapo SNPs in the region of the gene for gSAP are identified ration of solvent is carried out using a rotary evaporator (PION). In single marker analyses, none of the SNPs is under reduced pressure (600-4000 Pascals; 4.5-30 mmHg) associated with AD after correction for multiple testing. with a bath temperature of up to 60°C. In general, the course However, in sliding window haplotype analyses, 4 haplo of reactions is followed by TLC and reaction times are given 25 types are associated with AD: for illustration only; final products had satisfactory proton a) rs6976567 rs1468682|rs 1819814, nuclear magnetic resonance (NMR) spectra and/or mass b) rs1468682|rs1819814|rs4729535, spectral data. Yields are given for illustration only and are c) rs1819814|rs4729535|rs4729540, not necessarily those which can be obtained by diligent d) rs7781642|rs6955503 rs7776973 process development; preparations are repeated if more 30 Two of the SNPs in these haplotypes (rs4729540 and material is required. When given, NMR data is in the form rs7776973) are significantly associated with delayed recog of delta values for major diagnostic protons, given in parts nition test in the single marker analyses also. Patients per million (ppm) relative to tetramethylsilane (TMS) as an identified as having these haplotypes are thus candidates for internal standard. Chemical symbols have their usual mean treatment with gSAP inhibitors. ings; SI units and symbols are used. The following abbre 35 viations have been used: Example 17 CsCO cesium carbonate; HPLC high performance liquid chromatography; Identification of Region of Interaction Between NaSO, sodium sulfate; gSAP and APP NaBHCN sodium cyanoborohydride 40 BOP benzotriazol-1-yloxytris(dimethylamino)phosphonium Alternative combinations and variations of the examples hexafluorophosphate; provided will become apparent based on this disclosure. It is DMF N,N-dimethylformamide: not possible to provide specific examples for all of the many EtOAc ethyl acetate; possible combinations and variations of the embodiments DIEAN,N-diisopropylethylamine; described, but Such combinations and variations may be Pd(dba), tris(dibenzylideneacetone)dipalladium(0); and claims that eventually issue.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 8

<21 Os SEQ ID NO 1 &211s LENGTH: 854 212s. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs SEQUENCE: 1

Met Ala Lieu. Arg Lieu Val Ala Asp Phe Asp Lieu. Gly Asp Wall Lell 1. 5 15

Pro Trp Lieu. Arg Ala Glin Arg Ala Wal Ser Glu Ala Ser Gly Ala Gly 25 3 O

Ser Gly Gly Ala Asp Val Lieu. Glu Asn Asp Tyr Glu Ser Lieu. His Wall 35 4 O 45

Lieu. Asn. Wall Glu Arg Asn Gly Asn Ile Ile Tyr Thir Lys Asp Asp SO 55 60 US 9,605,041 B2 27 28 - Continued

Lys Gly Asn Wall Wall Phe Gly Luell Tyr Asp Cys Glin Thir Arg Glin Asn 65 70

Glu Luell Luell Tyr Thir Phe Glu Asp Luell Glin Wall Phe Ser Cys Ser 85 90 95

Wall Asn Ser Glu Arg Thir Lell Luell Ala Ala Ser Lell Wall Glin Ser Thir 105 11 O

Glu Gly Lys Arg Asn Glu Luell Glin Pro Gly Ser Lys Luell Thir 115 12 O 125

Lell Luell Wall Glu Ile His Pro Wall Asn Asn Wall Lys Wall Luell Ala 13 O 135 14 O

Wall Asp Ser Ile Trp Wall Glin Phe Luell Tyr Pro His Ile Glu Ser 145 150 155 160

His Pro Luell Pro Glu Asn His Luell Luell Luell Ile Ser Glu Glu Lys 1.65 17O 17s

Ile Glu Glin Phe Arg Ile His Wall Ala Glin Glu Asp Gly Asn Arg Wall 18O 185 19 O

Wall Ile Lys Asn Ser Gly His Luell Pro Arg Asp Arg Ile Ala Glu Asp 195

Phe Wall Trp Ala Glin Trp Asp Met Ser Glu Glin Arg Lell Tyr Ile 21 O 215

Asp Luell Ser Arg Ser Ile Luell Cys Ile Glin Phe Ala 225 23 O 235 24 O

Asp Glu Ser Asn Lell Met Phe Glu Wall Pro Lell Asp Ile Ser Luell 245 250 255

Ser Asn Ser Gly Phe Lell Wall Asn Phe Gly Asp Tyr His Glin 26 O 265 27 O

Arg Asp Phe Ser His Luell Thir Luell Wall Phe Thir Asn 28O 285

His Thir Gly Ser Lell Wall Ser Pro Lys Ala Ser Trp 29 O 295 3 OO

Gly Glin Ile Thir Ser Wall Phe Ile His Gly His Ser Lys 3. OS 310 315

Thir Phe Thir Thir Ser Lell Glu Asn Wall Gly Ser His Met Thir Lys Gly 3.25 330 335

Ile Thir Phe Luell Asn Lell Asp Tyr Wall Ala Wall Luell Pro Gly 34 O 345 35. O

His Phe Phe His Lell Lell Asn Wall Glin His Pro Asp Lell Ile His 355 360 365

Asn Luell Phe Luell Thir Gly Asn Asn Glu Met Ile Asp Met Luell Pro His 37 O 375

Cys Pro Luell Glin Ser Lell Ser Gly Ser Luell Wall Lell Asp Ser 385 390 395 4 OO

Gly Luell Tyr Arg Ala Lell Luell Ser Glin Ser Ser Lell Luell Glin Luell 4 OS 41O 415

Lell Glin Asn Thir Lell Asp Glu Met Ala Ala Luell His 42O 425 43 O

Ala Luell Tyr Gly Glin Gly Ala Glin Phe Luell Glu Ala Glin Ile Ile 435 44 O 445

Glin Trp Ile Ser Glu Asn Wall Ser Ala His Ser Phe Asp Luell Ile 450 45.5 460

Glin Glu Phe Ile Ile Ala Ser Ser Trp Ser Wall Ser Glu Thir 465 470 47s 48O US 9,605,041 B2 29 30 - Continued Ser Asn Met Asp Llys Lieu. Lieu Pro His Ser Ser Val Lieu. Thir Trp Asn 485 490 495 Thr Glu Ile Pro Gly Ile Thr Lieu Val Thr Glu Asp Ile Ala Leu Pro SOO 505 51O Lieu Met Llys Val Lieu. Ser Phe Lys Gly Tyr Trp Glu Lys Lieu. Asn. Ser 515 52O 525 Asn Lieu. Glu Tyr Val Llys Tyr Ala Lys Pro His Phe His Tyr Asn. Asn 53 O 535 54 O Ser Val Val Arg Arg Glu Trp His Asn Lieu. Ile Ser Glu Glu Lys Thr 5.45 550 555 560 Gly Lys Arg Arg Ser Ala Ala Tyr Val Arg Asn. Ile Lieu. Asp Asn Ala 565 st O sts Val Llys Val Ile Ser Asn Lieu. Glu Ala Arg Asn Lieu. Gly Pro Arg Lieu 58O 585 59 O Thr Pro Lieu. Lieu. Glin Glu Glu Asp Ser His Glin Arg Lieu. Lieu Met Gly 595 6OO 605 Lieu Met Val Ser Glu Lieu Lys Asp His Phe Lieu. Arg His Lieu. Glin Gly 610 615 62O Val Glu Lys Llys Lys Ile Glu Gln Met Val Lieu. Asp Tyr Ile Ser Lys 625 630 635 64 O Lieu. Lieu. Asp Lieu. Ile Cys His Ile Val Glu Thir Asn Trp Arg Llys His 645 650 655 Asn Lieu. His Ser Trp Val Lieu. His Phe Asin Ser Arg Gly Ser Ala Ala 660 665 67 O Glu Phe Ala Val Phe His Ile Met Thr Arg Ile Lieu. Glu Ala Thr Asn 675 68O 685 Ser Leu Phe Leu Pro Leu Pro Pro Gly Phe His Thr Lieu. His Thir Ile 69 O. 695 7 OO Lieu. Gly Val Glin Cys Lieu Pro Lieu. His Asn Lieu. Lieu. His Cys Ile Asp 7 Os 71O 71s 72O Ser Gly Val Lieu Lleu Lieu. Thr Glu Thir Ala Val Ile Arg Lieu Met Lys 72 73 O 73 Asp Lieu. Asp Asn Thr Glu Lys Asn. Glu Lys Lieu Lys Phe Ser Ile Ile 740 74. 7 O Val Arg Lieu Pro Pro Lieu. Ile Gly Glin Lys Ile Cys Arg Lieu. Trp Asp 7ss 760 765 His Pro Met Ser Ser Asn Ile Ile Ser Arg Asn His Val Thr Arg Lieu. 770 775 78O Lieu. Glin Asn Tyr Llys Lys Glin Pro Arg Asn. Ser Met Ile Asn Llys Ser 78s 79 O 79. 8OO Ser Phe Ser Val Glu Phe Leu Pro Leu. Asn Tyr Phe Ile Glu Ile Leu 805 810 815 Thr Asp Ile Glu Ser Ser Asn Glin Ala Leu Tyr Pro Phe Glu Gly His 82O 825 83 O

Asp Asn Val Asp Ala Glu Phe Val Glu Glu Ala Ala Lieu Lys His Thr 835 84 O 845

Ala Met Lieu. Lieu. Gly Lieu. 850

<210s, SEQ ID NO 2 &211s LENGTH: 808 212. TYPE: PRT <213> ORGANISM: Canis familiaris

<4 OOs, SEQUENCE: 2 US 9,605,041 B2 31 32 - Continued

Met Thir Glin Asn Lell Ser Trp Pro Gly His Ser Ser Asn Gly Ser 15

Ile Arg Phe Pro Wall Ala Gly Gly Thir Ala Wall Lell Trp Glin Gly Ala 2O 25

Wall Ser Ser Ile Glin Gly Lell Gly Thir Ala Asp His Glu Luell Pro Thir 35 4 O 45

Trp Arg Ala Glu Glin Lell Pro Ala Asp Lell Ala Ser Wall Asp SO 55 6 O

Lell Ile Glin Lell Lell Ile Pro Phe Ala Phe Ile Pro Thir Gly Ser 65 70

Luell Thir Lell Lell Wall Glu Ile His Pro Wall Asn Asn Wall 85 90 95

Wall Luell Ala Wall Asp Ser Ser Ile Trp Wall Glin Phe Luell Tyr Pro 105 11 O

Glin Wall Glu Ser His Pro Pro Pro Glu Asn His Lell Lell Luell Ile Ser 115 12 O 125

Glu Glu Ile Glu Lys Phe His Ile His Wall Ile Glin Glu Asp 13 O 135 14 O

Gly Asn Wall Wall Lell Arg Asp Ser Gly His Lell Pro Arg Glu Arg 145 150 155 160

Wall Ala Glu Asp Phe Wall Trp Ala Glin Trp Asp Met Ser Glu Glin Arg 1.65 17O 17s

Lell Tyr Ile Wall Lell Ser Arg Ser Ile Lell Lys Ile 18O 185 19 O

Glin Phe Ser Ala Asn Glu Phe Asn Luell Met Phe Glu Ala Pro Luell 195

Asp Ile Thir Luell Ser Ala Ser Gly Phe Glu Luell Wall Asn Phe Gly 21 O 215 22O

Asp Asp Luell Glin Asp Glin Gly Asn Luell Ser Lys His Lell Thir Luell Cys 225 23 O 235 24 O

Wall Phe Thir Asn His Thir Gly Ser Luell Cys Wall Ser Pro 245 250 255

Phe Asp Ser Trp Glu Ile Thir Tyr Ser Wall Phe Phe His 26 O 265 27 O

Gly His Ser Thir Phe Thir Ala Ala Luell Gly Ser Wall Asp Ser Luell 27s 285

Wall Thir Gly Lell Thir Phe Luell Asn Luell Asp Tyr Wall Ala Wall 29 O 295 3 OO

Tyr Luell Pro Gly His Phe Phe His Luell Luell ASn Ile Glin His Pro Asp 3. OS 310 315

Lell Ile His Ser Lell Phe Luell Thir Gly ASn Asn Glu Wall Wall Asp 3.25 330 335

Met Luell Pro His Ser Pro Lell Glin Ser Luell Ser Gly Ser Luell Wall Luell 34 O 345 35. O

Asp Trp Cys Ser Gly Lell Tyr Arg Ala Luell Lell Asn Glin Ser 355 360 365

Lell Luell Glin Phe Lell Trp Asn Thir Glin Luell Asp Cys Glu Met Ala 37 O 375 38O

Wall Luell His Wall Lell Ser Gly Arg Asp Pro Arg Phe Luell Glu 385 390 395 4 OO

Ala Ile Ile Glin Trp Ile Ser Glu Asn Ile Ser Thir His Ser 4 OS 41O 415 US 9,605,041 B2 33 34 - Continued

Phe Asp Luell Ile Glin Glu Phe Ile Ile Ala Ser Ser Tyr Trp Ser Ile 425 43 O

Pro Glu Thir Ser Asn Ile Asp Luell Luell Pro Tyr Ser Ser Wall 435 44 O 445

Lell Thir Trp Asn Thir Glu Ile Pro Gly Ile Thir Lell Wall Thir Glu Glu 450 45.5 460

Ile Thir Luell Pro Phe Met Wall His Ser Phe Gly Tyr Trp Glu 465 470

Luell Asn Ser Asn Lell Glu Wall Lys Ser Pro Cys Luell 485 490 495

Lell Tyr Asn Asn Ser Met Wall Arg Glu Trp His Ser Luell Ile Ser SOO 505

Glu Glu Lys Thir Gly Arg Arg Arg Ser Met Wall Wall Arg Asn Ile 515 52O 525

Phe Asp Asn Ala Met Wall Ile Ser Asn Luell Glu Ala Arg Asn Luell 53 O 535 54 O

Glu Pro Arg Luell Thir Pro Lell Phe Glin Glu Glu Asp His Glin Arg 5.45 550 555 560

Lell Luell Ile Gly Lell Met Wall Ser Glu Luell Arg Glu His Luell Luell Arg 565 st O sts

His Luell Glin Gly Ile Gly Lys Ile Glu Glin Met Wall Luell Asp 585 59 O

Ile Ser Lell Lell Asp Lel Ile Glin Ile Lell Glu Thir Ser 595 605

Trp Arg Thr His His Lieu His Pro Trp Wall Lieu. His Lieu Arg Ala Ser 610 615

Ala Ala Glu Phe Thir Wall Phe His Ile Met Thir Arg Ile Luell Glu Ala 625 630 635 64 O

Thir Met Ser Luell Phe Lell Pro Lel Pro Pro Gly Phe His Thir Luell His 645 650 655

Thir Ile Luell Gly Wall His Lel Pro Luell His Asn Lell Luell His 660 665 67 O

Ile Asp Ser Gly Wall Lell Lell Lel Thir Glu Thir Ala Wall Ile Arg Luell 675 685

Met Lys Asp Luell Asp Asn Ser Glu Asn Asn Glu Lys Lell Phe Ser 69 O. 695 7 OO

Ile Ile Wall Arg Lell Pro Pro His Ile Gly Glin Ile Arg Luell 7 Os

Trp Asp His Pro Met Ser Ser Asn Ile Ile Ser Arg Asn His Wall 72 73 O 73

Glin Luell Luell Luell Asn Tyr Glin Pro Glin Ser Ser Met Ile Asp 740 74. 7 O

Ser Pro Gly Ser Wall Glu Phe Luell Pro Luell Asn Tyr Phe Ile Glu 7ss 760 765

Ile Luell Thir Asp Ile Glu Ser Ser Asn Glin Ala Lell Ala Phe Glu 770 775 78O

Gly His Asp Asn Wall Asp Ala Phe Wall Glu Glu Ala Ala Luell Lys 78s 79 O 79. 8OO

His Thir Thir Met Lell Lell Gly Luell 805

<210s, SEQ ID NO 3 &211s LENGTH: 854 212. TYPE : PRT US 9,605,041 B2 35 36 - Continued

&213s ORGANISM: Bos primigenius

<4 OOs, SEQUENCE: 3

Met Ala Luell Arg Lell Ile Ala Asp Phe Asp Luell Glu Asp Wall Luell 1. 15

Pro Trp Luell Arg Wall Glin Lell Ala Ala Ser Ala Ala Ala Gly Ala Arg 25 3O

Gly Gly Gly Pro Gly Wall Lell Glu Asn Asn Glu Cys Luell Arg Wall 35 4 O 45

Lell Asn Wall Glu Arg Asn Arg Asn Ile Ile Thir Asp Asn SO 55 6 O

Lys Gly Asn Wall Phe Phe Gly Luell Asp Tyr Glin Thir Glin Asn 65 70

Glu His Luell Thir Phe Glu Asp Luell Glin Wall Wall Ser Cys Ser 85 90 95

Wall Asn Glu Thir Lell Luell Ala Thir Ser Lell Wall Glin Ala Ala 1OO 105 11 O

Glu Gly Arg Ser Asn Glu Luell Glin Pro Gly Ser Lys Luell Thir 115 12 O 125

Lell Luell Wall Glu Ile His Pro Ile Asn Asn Wall Lys Wall Luell Ala 13 O 135 14 O

Wall Asp Ser Ile Trp Wall Glin Phe Luell Tyr Pro His Wall Glu Ser 145 150 155 160

Pro Glin Pro Lys Asn His Luell Luell Luell Luell Ser Glu Glu Lys 1.65 17O 17s

Ile Glu Glin Phe His Ile Glin Wall Wall Glin Glu Asp Gly Asn Arg Wall 18O 185 19 O

Wall Ile Lys Asn Ser Gly His Luell Pro Arg Glu Arg Ile Ala Glu Asp 195

Phe Wall Trp Ala Glin Trp Asp Met Ser Glu Glin Arg Lell Tyr Ile 21 O 215

Asp Luell Ser Arg Ser Wall Luell Cys Ile Glin Phe Ala 225 23 O 235 24 O

Glu Glu His Phe Asn Lell Met Phe Glu Ala Pro Lell Asp Ile Ser Luell 245 250 255

Ser Asp Ser Gly Phe Lell Wall Asn Phe Gly Tyr Ser Asp Luell Glin 26 O 265 27 O

Asp Glu Glu Lell Ser Glu His Luell Thir Luell Wall Phe Thir Asn 28O 285

His Thir Gly Ser Lell Wall Pro Asn Phe Asp Ser Trp 29 O 295 3 OO

Glu Glin Ile Thir Ser Wall Phe Phe His Gly His Ser Lys 3. OS 310 315

Thir Phe Thir Thir Thir Lell Gly Ser Wall Asp Ser His Wall Thir Lys Gly 3.25 330 335

Ile Thir Phe Luell Asn Lell Asp Tyr Wall Ala Wall Luell Pro Gly 34 O 345 35. O

His Phe Phe His Lell Lell Asn Ile Glin His Pro Asp Lell Ile His 355 360 365

Ser Luell Phe Luell Thir Glu Asn Ser Glu Wall Ile Asp Met Luell Pro His 37 O 375

Ser Pro Luell Glin Ser Lell Ser Gly Ser Luell Wall Lell Asp Ser Arg Ser 385 390 395 4 OO US 9,605,041 B2 37 38 - Continued Gly Lys Lieu. Tyr Arg Val Lieu. Lieu. Asn Glin Ser Tyr Lieu Val Glu Phe 4 OS 41O 415 Lieu. Arg Ser Ala Arg Lieu. Asp Cys Glu Arg Met Ala Lieu. Lieu. His Cys 42O 425 43 O Ala Lieu. Ser His Gly Arg Asp Pro Arg Arg Lieu. Glu Ala Lys Ile Ile 435 44 O 445 Glin Trp Ile Ser Glu Asn. Ile Ser Ala Cys His Ser Phe Asp Lieu. Ile 450 45.5 460 Gln Glu Phe Ile Ile Ala Ser Ser Tyr Trp Ser Ile Tyr Pro Glu Thr 465 470 47s 48O Ser Asn Met Asp Llys Lieu. Lieu Pro Tyr Ser Ser Lieu. Lieu. Thir Trp Asp 485 490 495 Thr Glu Ile Pro Gly Ile Thr Lieu Val Thr Glu Glu Ile Pro Leu Pro SOO 505 51O Lieu Met Llys Val His Ser Phe Lys Gly Tyr Trp Glu Lys Lieu. Asn. Ser 515 52O 525 Asn Lieu. Glu Tyr Val Llys Tyr Ser Llys Pro His Lieu. His Tyr Asn. Asn 53 O 535 54 O Ser Val Val Arg Arg Glu Trp His Asn Lieu. Ile Ser Glu Glu Lys Thr 5.45 550 555 560 Gly Lys Arg Arg Ser Thr Val Tyr Val Arg Asn. Ile Lieu. Asp Asn Ala 565 st O sts Ile Llys Val Ile Ser Asn Val Glu Ala Lys Asn Lieu. Glu Pro Arg Lieu. 58O 585 59 O Thr Pro Leu Phe Glin Glu Glu Asp Thr His Gln Gln Lieu Lieu. Ile Gly 595 6OO 605 Lieu Met Val Ser Glu Lieu. Arg Glu. His Lieu. Lieu. Arg His Lieu. Glin Gly 610 615 62O Val Glu Lys Arg Lys Ile Glu Gln Met Val Lieu. Asp Tyr Val Ser Lys 625 630 635 64 O Lieu. Lieu. Asp Lieu. Ile Cys Glin Ile Lieu. Glu Ala Ser Trp Arg Llys His 645 650 655 Asn Lieu. His Pro Trp Ala Lieu. His Phe Asin Arg Glin Ala Ser Ala Ala 660 665 67 O Glu Phe Ala Val Phe His Ile Met Thr Arg Ile Lieu. Glu Ala Thr Asn 675 68O 685 Thr Lieu Phe Leu Pro Leu Pro Pro Gly Phe His Thr Lieu. His Met Ile 69 O. 695 7 OO Lieu. Gly Val Arg Cys Lieu Pro Lieu. His Asn Lieu. Lieu. His Tyr Ile Asp 7 Os 71O 71s 72O His Gly Val Lieu Lleu Lieu. Thr Glu Ala Ala Val Thr Arg Lieu Met Lys 72 73 O 73 Asp Lieu. Asp Asn Thr Glu Lys Asn. Glu Lys Lieu Lys Phe Ser Ile Ile 740 74. 7 O

Met Arg Lieu Pro Pro Lieu. Thr Gly Glin Lys Ile Cys Arg Lieu. Trp Asp 7ss 760 765

His Pro Val Ser Ser Asn. Ile Ile Ser Arg Asn His Val Lys Arg Lieu. 770 775 78O

Lieu. Glin Asn Tyr Asn Lys Glin Pro Trp Ser Ser Val Met Asp Llys Ser 78s 79 O 79. 8OO

Ser Phe Ser Val Glu Phe Leu Pro Leu. Asn Tyr Phe Ile His Ile Leu 805 810 815

Thr Asp Ile Glu Ser Ser Asn Pro Ala Leu Tyr Ala Phe Glu Gly His US 9,605,041 B2 39 40 - Continued

82O 825 83 O Asp Asn Val Asp Ala Lys Phe Val Glu Glu Ala Ala Lieu Lys His Thr 835 84 O 845 Ala Met Lieu. Lieu. Gly Lieu. 850

<210s, SEQ ID NO 4 &211s LENGTH: 858 212. TYPE: PRT <213s ORGANISM: Mus musculus

<4 OOs, SEQUENCE: 4 Met Ala Lieu. Arg Lieu Val Thr His Phe Asp Val Lieu. Glu Asp Val Lieu. 1. 5 1O 15 Pro Ser Lieu. Lieu. Thr Glin Ala Ala Thir Thr Asp Glu Gly Asp Arg Ala 2O 25 3O Gly Val Lieu. Glu Thir Thr Tyr Gly Ser Lieu. Arg Val Lieu. Asn. Ile Glu 35 4 O 45 Arg Asn Gly Asn. Ile Ile Tyr Thr Tyr Lys Asp Asn Lys Gly Asn Ala SO 55 6 O Val Phe Gly Lieu. Tyr Asp Cys Glin Thr Arg Glin Asn. Glu. His Lieu. Tyr 65 70 7s 8O Thr Phe Glu Lys Asp Met Glin Ala Val Ser Cys Ser Val Asin Ser Glu 85 90 95 Arg Thr Val Lieu Ala Ala Ser Phe Ile Glin Tyr Thr Thr Glu Gly Val 1OO 105 11 O Lys Asn Asp Lieu. Glin Pro Gly Ser Lys Cys Lieu. Thir Lieu. Lieu Val Glu 115 12 O 125 Ile His Pro Val Asn. Asn Val Llys Val Lieu Lys Ala Val Asp Ser Cys 13 O 135 14 O Val Trp Val Glin Phe Lieu. Tyr Pro Glin Ala Glu Ser His Lieu. Leu Pro 145 150 155 160 Glin Asn His Lieu Lleu Lieu. Ile Ser Glu Glu Lys Tyr Ile Glu Arg Phe 1.65 17O 17s His Ile Glin Ile Thr Arg Glu Asp Gly Asp Arg Val Val Ile Arg Asn 18O 185 19 O Ser Ser His Lieu Pro Arg Asp Arg Lieu Ala Glu Asp Phe Val Trp Ala 195 2OO 2O5 Glin Trp Asp Lieu. Ser Glu Glin Arg Lieu. Tyr Tyr Ile Glu Lieu Lys Glu 21 O 215 22O Ser Arg Ser Ile Lieu Lys Cys Ile Glin Phe Arg Ala Asp Glu Ser Phe 225 23 O 235 24 O Asn Lieu Met Phe Glu Met Pro Leu Asp Ile Thr Lieu. Thr Gly Lieu. Arg 245 250 255 Phe Llys Lieu Val Asn. Phe Gly Tyr Asp Tyr Arg Glin Asp Arg Glu Lys 26 O 265 27 O Lieu. Cys Asn Gln Pro Ser Lieu. Cys Ile Phe Thr Asn His Thr Gly Ser 27s 28O 285

Lieu. Cys Met Cys Tyr Ser Pro Llys Ser Asp Ser Arg Glu Glu Ile Thr 29 O 295 3 OO Tyr Ser Val Phe Tyr Lieu. His Lys Gly Tyr Arg Lys Ile Phe Thr Ala 3. OS 310 315 32O

Ala Pro Gly Ser Ala Asp Ser Glin Val Thr Asn Gly Ala Asp Ser Glin 3.25 330 335 US 9,605,041 B2 41 42 - Continued

Wall Thir Asp Gly Ile Ala Phe Luell Asn Luell Gly Tyr Phe Wall Ala Wall 34 O 345 35. O

Ser Pro Gly His Phe Lell His Luell Luell ASn Ile Glin His Pro Asp 355 360 365

Lell Wall His Ser Lell Phe Luell Thir Gly ASn Asn Ile Ala Ala 37 O 375

Wall Luell Pro Pro Ser Pro Lell Glin Ser Luell Pro Gly Ser Luell Wall Luell 385 390 395 4 OO

Asp Ser Gly Lys Wall Arg Wall Thir Lell Asp Glin Ser 4 OS 415

Lell Luell Arg Phe Lell Trp Asn Ala His Luell Asp Glu Arg Met Ala 425 43 O

Ala Luell His Ile Lell Ser Cys Ser Glin Asp Pro Gly Phe Pro Glu 435 44 O 445

Glu Glin Ile Ile Glin Trp Ile Ser Glu His Wall Ser Ala His Ser 450 45.5 460

Phe Asp Luell Ile Glin Glu Phe Luell Ile Ala Ser Ser Trp Ser Wall 465 470

Ala Glu Luell Asp Asp Met Gly Met Luell Luell Glin Ser Ser Wall 485 490 495

Lell Thir Trp Asn Thir Glu Ile Pro Gly Ile Phe Thir Thir Glu Glu SOO 505

Lell Pro Luell Pro Lell Met Wall Gly Luell Gly Trp Ala 515 525

Lieu Asn Ser Asn Lieu Glu Ile Thr Pro His Lieu 53 O 535 54 O

His His Asn Ser Wall Wall Arg Arg Glu Trp His Asn Luell Ile Ser 5.45 550 555 560

Glu Glu Arg Thir Gly Lys Arg Arg Ser Thir Met Wall Arg Asn Ile 565 st O sts

Lell Glu Asn Ala Met Wall Ile Ala Ser Met Glu Thir Arg Thir Luell 585 59 O

Glu Pro Arg Luell Ile Pro Phe Luell Glin Glu Glu Asp Arg His Glin Arg 595 605

Lell Luell Met Gly Lell Met Wall Ser Glu Luell Arg Asp His Luell Luell Arg 610 615

His Luell Glin Gly Wall Glu Ile Glu Glin Met Wall Luell Asp 625 630 635 64 O

Ile Ser Lell Lell Asp Luell Ile Trp Lell Lell Glu Thir Ser 645 650 655

Arg His Ser Met His Pro Luell Wall Luell His Lell Asn Ser His 660 665 67 O

Ser Ala Ala Asp Phe Glu Wall Phe His Luell Met Thir Arg Ile Luell 675 685

Asp Ala Ala Ser Ser Lell Cys Luell Pro Luell Pro Pro Gly Phe His Ser 69 O. 695 7 OO

Lell His Thir Ile Lell Gly Wall His Luell Pro Lell Ser Luell Luell 7 Os 72O

His Ile Asp Asn Gly Wall Luell Luell Luell Thir Glu Thir Ala Wall Thir 72 73 O 73

Arg Luell Met Lys Asp Lell Asp Asn Ser Glu Asn Glu Glin Luell 740 74. 7 O

Phe Ser Ile Ile Wall Arg Lell Pro Pro Luell Ile Gly Glin Wall US 9,605,041 B2 43 44 - Continued

760 765

Arg Luell Trp Asp His Pro Met Ser Ser Asn Ile Ile Ser Arg Asn His 770 775

Wall Ala Arg Luell Lell Lys Asn Tyr Arg Glu Pro Arg Asn Ser Met 79 O 79.

Ile Asp Ser Ser Phe Pro Wall Glu Phe Luell Pro Lell Asn Tyr Phe 805 810 815

Ile Glu Ile Luell Met Gly Lell Glu Ser Ser ASn Glin Ala Luell Tyr Gly 825 83 O

Phe Glu Gly His Asp Asn Wall Asp Ala Glu Phe Wall Glu Glu Ala Ala 835 84 O 845

Lell Lys His Thir Thir Met Lell Luell Gly Luell 850 855

SEO ID NO 5 LENGTH: 846 TYPE : PRT ORGANISM: Rattus norvegicus

< 4 OOs SEQUENCE: 5

Met Ala Lieu. Arg Lell Wall Thir His Phe Asp Wall Lell Ala Asp Wall Luell 1. 5 15

Pro Ser Luell Luell Wall Glin Ala Ala Thir Ala Asp Glu Gly Asp Glu Gly 25

Ala Glu Thir Thir Lell Gly Ser Luell Arg Wall Luell Asn Ile Glu Arg Asn 35 4 O 45

Gly Asp Ile Ile Thir Tyr Asp Asn Lys Gly Asn Ala Wall Phe SO 55 6 O

Gly Ile Phe Asp Glin Thir Arg Glu Asn Glu His Lell Tyr Thir Phe 65 70

Glu Asp Met Glin Ala Wall Ser Ser Wall Asn Ser Glu Arg Thir 85 90 95

Wall Luell Ala Ala Ser Phe Ile Glin Tyr Thir Glu Gly Wall Arg Ser Glu 105 11 O

Lell Glin Pro Gly Ser Luell Thir Luell Luell Wall Glu Ile His Pro 115 12 O 125

Wall Asn Asn Wall Thir Wall Lell Ala Wall Asp Ser Wall Trp Wall 13 O 135 14 O

Glin Phe Luell Tyr Pro Ala Glu Ser His Luell Lell Ala Glin Asn His 145 155 160

Lell Luell Luell Ile Ser Glu Ile Glu Arg Phe His Ile Glin 1.65 17O 17s

Ile Thir Arg Glu Asp Asn Arg Wall Wall Ile Arg Asn Ser Ser His 18O 185 19 O

Lell Pro Arg Glu Arg Ala Glu Asp Phe Wall Trp Ala Glin Trp Asp 195 2O5

Wall Ser Glu Glin Arg His Ile Glu Luell Glin Glu Ser Arg Ser 21 O 215 22O

Ile Luell Wall Phe Trp Ala Asp Glu Ser Phe Thir Ile Met 225 235 24 O

Phe Glu Met Pro Lell Asp Ile Ser Luell Ser Gly Lell Arg Phe Lys Luell 245 250 255

Wall Asn Phe Gly Asp Arg Glin Asp Glin Ala Luell His 26 O 265 27 O US 9,605,041 B2 45 46 - Continued

Glin Pro Ser Luell Ile Phe Thir Asn His Thir Gly Ser Luell Cys Wall 27s 285

Tyr Ser Pro Ser Asp Ser Trp Glu Ile Thir Tyr Ser Wall 29 O 295 3 OO

Phe Luell His Gly Tyr Arg Thir Phe Thir Wall Ala Pro Gly 3. OS 310 315

Ser Thir Asp Ser Glin Wall Ala Asn Gly Wall Thir Phe Lell Asn Luell Gly 3.25 330 335

Phe Wall Ala Wall Tyr Ser Pro Cys Arg Phe Lell His Luell Luell Asn 34 O 345 35. O

Ile Arg His Pro Asp Lell Ile Cys His Ser Luell Phe Lell Thir Gly Asn 355 360 365

Asn Lys Thir Ala Ala Wall Lell Pro Pro Ser Pro Lell Glin Ser Luell Pro 37 O 375

Gly Ser Luell Ile Lell Asp Ser Ser Gly Lys Wall Arg Ala Thir 385 390 395 4 OO

Lell Asp Glin Ser Tyr Lell Met Gly Phe Luell Trp Asn Ala Glin Luell Asp 4 OS 415

Glu Met Ala Ala Lell His Cys Ala Luell Ser Asp Ser Asp 425 43 O

Pro Gly Phe Pro Glu Glin Ile Wall Glin Trp Wall Ser Glu Arg Wall Ser 435 44 O 445

Ala Cys His Ser Phe Asp Lell Ile Glin Glu Phe Lell Ile Ala Ser Ser 450 45.5 460

Tyr Trp Ser Wall Pro Gly Lieu Asp Asp Wall Asp Lieu Luell Lieu Pro 465 470

Ser Ser Wall Lell Thir Trp Asp Thir Glu Ile Pro Gly Met Lys Luell 485 490 495

Wall Thir Glu Glu Lell Pro Lell Pro Luell Met Wall Ser Luell SOO 505

Gly Trp Ala Lell Asn Ser Asn Luell Glu Tyr Ile Thir 515 525

Pro His Luell His Tyr His Asn Ser Wall Wall Arg Arg Glu Trp His 53 O 535 54 O

Asn Luell Ile Ser Glu Glu Arg Thir Gly Arg Arg Ser Thir Met Tyr 5.45 550 555 560

Wall Arg Asn Ile Lell Asp Asn Ala Wall Lys Wall Ile Ser Asn Met Glu 565 st O sts

Met Thir Phe Glu Pro Arg Luell Ile Pro Luell Lell Glin Glu Glu Asp 585 59 O

Arg His Glin Arg Lell Lell Met Gly Luell Met Wall Ser Glu Luell Arg Asp 595 605

His Luell Luell Arg His Lell Glin Gly Wall Glu Lys Ile Glu Glin 610 615

Met Wall Luell Asp Ile Ser Luell Luell Asp Lell Wall Trp Luell 625 630 635 64 O

Lell Glu Thir Ser Trp Arg His Ser Wall His Pro Trp Wall Luell His 645 650 655

Lell Asn Glu His Gly Ser Pro Ala Asp Phe Glu Wall Phe His Luell Met 660 665 67 O

Thir Arg Ile Luell Asp Ala Ala Ser Ser Luell Phe Pro Luell Pro Pro 675 685

Gly Phe His Ser Lell His Thir Ile Luell Gly Wall His Luell Pro Luell US 9,605,041 B2 47 48 - Continued

69 O. 695 7 OO

Tyr Asn Luell Luell His Tyr Ile Asp Asn Gly Wall Lell Lell Luell Thir Glu 7 Os

Thir Wall Wall Thir Arg Lell Met Asp Luell Asp Asn Ser Glu Lys Asn 72 73 O 73

Glu Luell Lys Phe Ser Ile Ile Wall Arg Luell Pro Pro Luell Ile Gly 740 74. 7 O

Glin Wall Arg Lell Trp Asp His Pro Met Ser Ser Asn Ile Ile 760 765

Ser Arg Asn His Wall Ala Glin Luell Luell ASn Tyr Glu Pro 770 775

Glin Ser Ser Met Ile Asp Ser Ser Phe Pro Wall Glu Phe Luell Pro 79 O 79.

Lell Asn Phe Ile Glu Ile Luell Met His Luell Glu Ser Ser Asn Glin 805 810 815

Ala Luell His Gly Phe Glu Gly His Asp Asn Wall Asp Ala Glu Phe Wall 825 83 O

Glu Glu Ala Ala Lell His Thir Thir Ser Luell Lell Gly Luell 835 84 O 845

<210s, SEQ ID NO 6 &211s LENGTH: 857 212. TYPE : PRT <213> ORGANISM: Gallus gallus

<4 OOs, SEQUENCE: 6

Met Ala Wall Ala Ala Pro Glin Glin Pro Ala Arg Gly Gly Glin Arg 1. 5 15

Pro Pro Glu Cys Gly Arg Wall Gly Pro Arg Luell Arg Ala Luell Pro Ser 25

Gly Gly Arg Arg Ser Glin Ala Gly Arg Glu Ser Pro Arg Ala His 35 4 O 45

Gly Ala Ala Ser Pro Lell Lell Pro Ser Gly Pro Gly Arg Luell Ala SO 55 6 O

Thir Gly Gly Arg Gly Asn Gly Gly Gly Ala Ser Gly Arg Pro Luell 65 70 7s

Arg Gly Luell Ser Pro Pro Ala Pro Luell Pro Gly Gly Gly 85 90

Pro Glu Luell Arg Gly Lell Thir Luell Ser Luell Gly Gly Ser Luell 105 11 O

Asp Thir Ser Glu Ser Ser Ala Luell Tyr Ile Wall Asn Wall Arg 115 12 O 125

Asn Gly Ile Ile Tyr Thir Trp Gly ASn Glin Arg Ser Thir His 13 O 135 14 O

Ile Gly Lel Tyr Asp Lell Glin Thir Glu ASn Glu His Luell Tyr Thir 145 150 155 160

Phe Glu Asp Lell Arg Ile Ile Ser Cys Ser Wall Asn Ser Glu Arg 1.65 17O 17s

Thir Luell Lel Ala Wall Ser Phe Arg Glin Tyr Thir Glu Glu Glu Arg Wall 18O 185 19 O

Thir His Lel Luell Glin Ser Wall Ser Luell Ala Lell Luell Ile Glu 195 2OO 2O5

Ile His Ile Asn Asn Wall Wall Luell Ala Wall Asp Ser 21 O 215 22O US 9,605,041 B2 49 50 - Continued

Wall Arg Wall Glin Phe Lell Tyr Pro Wall Glu Asp Arg Asn. Ser Ser Thir 225 23 O 235 24 O

Glu Ser His Luell Lell Lell Wall Ser Glu Asp Tyr Ile Glu Glin Phe 245 250 255

Asp Ile His Wall Ala Glu Glu His Arg Wall Wall Ile Glin Asn Ser 26 O 265 27 O

Gly Glin Luell Pro Arg Arg Wall Ala Asp Asp Lell Ile Trp Ala Glin 285

Trp Asp Met Thir Glu Arg Luell Phe Ile Wall Pro Glu Ser 29 O 295 3 OO

Arg Ser Ile Luell Arg Wall Glin Phe Pro Asp Glu Asn Phe Asn 3. OS 315

Ser Thir Luell Glu Ser Lell Asp Ile Ser Wall Asn Asp Arg Wall 3.25 330 335

Luell Wall Asn Phe Asn Asp Glu Asp Arg Asp Wall Pro 34 O 345 35. O

Pro Ser Luell Asn Lell Glin Wall Phe Thir ASn Ala Gly Phe Ser 355 360 365

Thir Phe Thir Ala Ser Lell Glu Arg Pro Glu Thir Pro Glin Luell 37 O 375

Glu Wall Ala Phe Lell Asn Lell Asp Wall Ala Ala Luell Pro 385 390 395 4 OO

Gly Glin Phe Luell His Lell Lell Asn Ile Glin His Pro Asp Luell Luell 4 OS 415

Ser Lieu Phe Lieu Thr Gly Glu Asp Ala Arg Ile Asp Met Lieu Pro 425 43 O

Asn Ser Ile Glin Ser Pro Luell Wall Ser Thir Wall Lell Asp 435 44 O 445

Ile Gly Arg Luell Tyr Ala Met Ser Ile Ser Asp Ser Ala Luell Luell 450 45.5 460

Tyr Luell Glin Asn Ser Lys Arg Asp Ser Glu Arg Lell Ala Ala Luell His 465 470

Ala Luell Luell Cys Wall Arg Arg Thir Thir Asp Lell Glu Met Lys Ile 485 490 495

Ile Trp Trp Ile Ser Glu Asn Luell Ser Thir His Ser Phe Asp Pro SOO 505

Ile Glin Glu Phe Ile Ile Ala Ser Luell Tyr Arg Met Pro Glu 515 525

Thir Asn Asn Luell Asp Lell Luell Pro Thir Ser Lell Luell Asp Trp 53 O 535 54 O

Thir Gly Wall Ile Pro Gly Wall Ala Ala Thir Asp Ile Ile Ser Luell 5.45 550 555 560

Pro Wall Luell Glu Met Glin Asn Ser Gly Phe Trp Glu Luell Asp 565 st O sts

Ser Asn Luell Glu Ser Wall Ala Glu Pro His Lell His His 585 59 O

Asn Asn Wall Luell Arg Arg Glu Trp Arg Asn Luell Ser Glu Glu Met Wall 595 605

Ala Glin Luell Asp His Lell Met Arg His Luell Glin Tyr Wall Gly 610 615 62O

Lys Ile Asp Glin Ile Wall Luell Asp Wall Ala Asn Luell Luell Asn 625 630 635 64 O

Lell Wall His Arg Ile Met Glu Wall Trp Ile His Glin Luell His US 9,605,041 B2 51 - Continued

645 650 655

Ser Cys Ile Phe Cys Phe Asp Glu Arg Gly Ser Glu Ala Glu Phe Arg 660 665 67 O

Val Phe His Ile Met Ser Arg Ile Lieu. Glu Ala Ala Asn Gly Met Cys 675 68O 685

Met Pro Leu Pro Pro Gly Phe His Ser Lieu. His Leu Gly Lieu. Gly Val 69 O. 695 7 OO

Arg Cys Lieu Pro Lieu. His Thr Lieu. Lieu. His Tyr Ile Asp Asn Gly Val 7 Os 71O 71s 72O

Lieu. His Lieu. Thr Glu Thir Cys Val Arg Llys Lieu Lleu Lys Asp Lieu. Asp 72 73 O 73

Asp Asn. Glu Lys Asn. Glu Lys Lieu Lys Phe Ser Ile Val Thr Arg Lieu 740 74. 7 O

Pro Glu Val Thir Lieu. Asp Ala Lieu. Gly Lieu Lys Ala Arg Glin Phe Trp 7ss 760 765

Asp His Pro Val Asn Ala Asn. Phe Arg Ala Arg Llys Tyr Val Lys Lieu 770 775 78O

Lieu. Lieu. Glu Lys Lieu. Gly Asn Arg Glin Cys Ser Arg Pro Val Pro Glu 78s 79 O 79. 8OO

Arg His Pro Val Cys Val Glu Phe Leu Pro Leu. Asn Tyr Lieu. Thir Asn 805 810 815

Val Lieu Ala Glu Ile Glu Ser Glin Gly Val His Lieu. Tyr Glu Lys Glin 82O 825 83 O

Asp His Ile Asin Val Arg Phe Val Glu Glu Ala Ala Lieu Lys His Thr 835 84 O 845

Met Met Lieu. Lieu. Gly Lieu. Arg Tyr Ser 850 855

<210s, SEQ ID NO 7 &211s LENGTH: 13 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: tryptic peptide

<4 OO > SEQUENCE: 7

Lieu. Trp Asp His Pro Met Ser Ser Asn Ile Ile Ser Arg 1. 5 1O

<210s, SEQ ID NO 8 &211s LENGTH: 12 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: tryptic peptide

<4 OOs, SEQUENCE: 8

Asn His Val Thr Arg Lieu. Lieu. Glin Asn Tyr Lys Llys 1. 5 1O US 9,605,041 B2 53 54 The invention claimed is: and wherein the compound to inhibit gSAP activity is 1. A method for inhibiting the accumulation of abnormal selected from imatinib or a labeled derivative protein aggregates in a warm-blooded animal in need of thereof, inhibitory RNA molecules capable of inhib Such inhibition which comprises: 99 iting gSAP expression, vectors and cells producing Measuring gSAP (gamma secretase activating protein') 5 said inhibitory RNA molecules, antibodies to gSAP. expression for identifying whether the animal in need and vaccines for gSAP. thereof has elevated expression levels and/or mutations in gSAP, wherein the animal in need thereof has 2. The method of claim 1, wherein the accumulation of elevated expression levels and/or mutations in gSAP abnormal protein aggregates is related to an AB-mediated relative to normal values as identified using a control 10 disease, wherein the AB-mediated disease is selected from population; and the group consisting of Alzheimer's disease, memory and administering to said animal an effective amount of a cognitive disorders, dementia, amyloid neuropathies, brain compound to inhibit gSAP activity, inflammation, nerve and brain trauma, vascular amyloidosis, wherein the mutations are one or more haplotypes and cerebral hemorrhage with amyloidosis. selected from the following groups of SNPs: or 3.more The haplotypes method of selectedclaim 1, from:wherein the mutations are one 8. 6976567S1468,682rS1819814SIES A. 4729.535. c) rs1819814|rs4729535|rs4729540 and c) rs1819814|rs4729535|rs4729540, and d) rs7781642|rs6955503 rs7776973. d) rs7781642|rs6955503 rs7776973, k . . . .