DOCSLIB.ORG

Molecular Identification and Antimicrobial Resistance of Escherichia Fergusonii and Escherichia Coli from Dairy Cattle with Diarrhoea

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Identification and Antimicrobial Resistance of Escherichia Fergusonii and Escherichia Coli from Dairy Cattle with Diarrhoea Original Paper Veterinarni Medicina, 63, 2018 (03): 110–116 https://doi.org/10.17221/156/2017-VETMED Molecular identification and antimicrobial resistance of Escherichia fergusonii and Escherichia coli from dairy cattle with diarrhoea U. Parin1*, S. Kirkan1, S.S. Arslan2, H.T. Yuksel1 1Faculty of Veterinary Medicine, Adnan Menderes University, Aydin, Turkey 2Institute of Health Sciences, Adnan Menderes University, Aydin, Turkey *Corresponding author: [email protected] ABSTRACT: The aim of this study was to determine the incidence of Escherichia fergusonii in dairy cattle with clinical signs of diarrhoea. The specimens were obtained from three different farms in Denizli province of Turkey, between August 2016 and December 2016. Rectal contents of 57 Holstein-friesian dairy cattle with diarrhoea were collected from farms located in the Aegean Region (Denizli province, Turkey). Rectal swabs were inoculated into enrichment, differential and selective culture media. A total of 49 (86%) Escherichia spp. were isolated by phenotypic identification from 57 rectal swab samples. Presumptive E. fergusonii isolates were tested with the API 20E identi- fication kit and all isolates (100%) were identified as E. coli. Primers targeting specific E. coli and E. fergusonii and genes, including the beta-glucuronidase enzyme, conserved hypothetical cellulose synthase protein and regulator of cellulose synthase and hypothetical protein, putative transcriptional activator for multiple antibiotic resistance were used for detection and differentiation of E. coli and E. fergusonii. Thirteen of the 49 E. coli-verified isolates were identified as E. fergusonii after duplex PCR using EFER 13- and EFER YP-specific primers. Confirmation of strain identity was conducted using Sanger sequencing analysis. The rates of antibiotic resistance of E. fergusonii to penicillin G and erythromycin were 100% and 77%, respectively. In conclusion, field strains of E. fergusonii were detected in cattle with diarrhoea in Turkey, and the strains were found to be resistant to multiple antibiotics. Keywords: bovine; cow; E. fergusonii; E. coli; identification; PCR; antibiotics Escherichia fergusonii bacterium was first pro- available show that E. fergusonii can currently only posed as a new species 65 years after the formal be isolated as a dominant member of the aerobic classification of Escherichia coli. Since 1985, there microbial flora. The bacterium was not identified has been an increasing number of case reports in in birds, fish, frogs or reptiles (Oh et al. 2012). animals. While E. fergusonii has also been asso- With respect to veterinary medicine, Bain and ciated with Ferguson’s disease in humans, only a Green (1999) reported that E. fergusonii causes very few studies have been reported. E. fergusonii various clinical indications in cattle and sheep, is pathogenic in humans and animals, but causes such as abortus, diarrhoea and mastitis symp- diseases only infrequently (Savini et al. 2008). E. toms. Herraez et al. (2005) isolated E. fergusonii fergusonii has been isolated in cases of wound in- from septicaemia cases, fibrino-necrotic typhlitis, fection, urinary tract infection, bacteraemia, diar- fibrinous peritonitis, blood, spleen, liver specimens rhoea, endophthalmitis and pleuritis in humans. and multifocal serosal haemorrhages in ostriches. It has also been isolated from domestic animal These authors reported that stress plays an im- faeces and greens (Hariharan et al. 2007; Weiss et portant role in enteric diseases in ostriches, and al. 2011). Data obtained from the various sources multifactorial factors frequently play a role in the Supported by the Adnan Menderes University Scientific Research Projects Committee (code No. VTF-16043). 110 Veterinarni Medicina, 63, 2018 (03): 110–116 Original Paper https://doi.org/10.17221/156/2017-VETMED aetiology. Subsequently, it was reported that E. fer- different farms in Denizli province of Turkey, a gusonii showed a septicaemic distribution in goats significant area for dairy production, between and caused diarrhoea (Hariharan et al. 2007). August 2016 and December 2016. The farms were Phenotypic characterisation, DNA hybridisa- at least 35 km away from each other. A total of tion and molecular phylogenetic data suggest that 57 Holstein-Friesian dairy cows aged between two E. fergusonii may be classified within the genus and five years were used for sample collection. All Escherichia. E. fergusonii has been proposed as a of the cows were in the lactation period. Rectal new species in the Enterobacteriaceae family and swab samples were collected aseptically from each Escherichia genus. E. fergusonii is closely related to animal showing clinical symptoms of diarrhoea. E. coli based on DNA hybridisation, but there are All of the farms used conventional dairy practic- some phenotypic differences that allow differentia- es approved in Turkey. The specimen collection tion from other species: E. fergusonii does not fer- method was approved by the local Animal Ethics ment lactose, sucrose, raffinose or sorbitol, which Committee of Adnan Menderes University (docu- helps distinguish it from E. coli. Although E. fer- ment No. 64583101/2016/50). The rectal swab gusonii is isolated from specimens such as blood, samples were inoculated into 5 ml of tryptic soy ® urine and faeces, its clinical significance has been broth (Merck Millipore , Germany) and incubated underestimated and has not been taken into account at 37 °C for 24 h. Ten microlitres of each culture in the literature. The food chain and environment in TSB were inoculated onto Simmons citrate ® may be contaminated by colonisation of potential- agar (Oxoid , UK) containing 4% adonitol (SCA) ly pathogenic E. fergusonii (Rayamajhi et al. 2011) as described before (Foster et al. 2010) and eosin in the cattle gut. Current diagnostic methods for methylene blue agar for identification of E. coli. identification ofE. fergusonii consist of inoculation The agar plates were incubated at 37 °C for 24 h. into selective and differential media and biochemi- Adonitol-positive yellow colonies were transferred cal identification methods such as API 20E. The to sorbitol MacConkey agar (SMAC) and incubated conventional identification ofE. fergusonii is time- at 37 °C for 24 h (Wragg et al. 2009; Oh et al. 2012). consuming and commercial biochemical identifica- After Gram staining, Gram-negative small cocco- tion methods cannot discriminate E. fergusonii and bacilli were subjected to further identification. The other Enterobacteriaceae species, since E. fergusonii presumptive Escherichia spp. colonies were applied ® is occasionally regarded as E. coli (Chandra et al. to API 20E test strips (bioMerieux , France) ac- 2013). We hypothesised that the differences between cording to the manufacturer’s recommendations. ® E. fergusonii and E. coli can be diagnosed based Bacterial strains. E. coli ATCC 25922 and ® on the detection of highly conserved E. fergusonii E. fergusoniii ATCC 35469 were obtained from genes in genetic material isolated from dairy cows. the American Type Culture Collection (ATCC). Therefore, the aim of our study was to standardise a The list of bacterial strains used to ensure the method which can be employed in field diagnosis for specificity of the PCR assay is given in Table 1. detection of potentially pathogenic and multidrug- resistant E. fergusonii from dairy cattle in Turkey. Table 1. The list of bacterial strains used in this study Genome sequencing followed by discriminative analysis permits the comprehensive determination Microorganism Origin of relationships among bacterial species and al- Escherichia fergusonii American Type lows the identification of target genes involved in ATCC 35469 Culture Collection antibiotic resistance and virulence. According to Escherichia coli ATCC American Type the best of our knowledge, ours is the first report 25922 Culture Collection to describe the isolation of E. fergusonii from dairy Escherichia coli O157:H7 Refik Saydam Public cattle in Turkey. RHFS 232 Health Institute/Turkey Salmonella enterica serovar American Type Enteritidis ATCC 13076 Culture Collection MATERIAL AND METHODS Salmonella enterica serovar American Type Typhimurium ATCC 14028 Culture Collection Collection of specimens and bacterial isola- Staphylococcus aureus American Type Culture tion. The specimens were obtained from three ATCC 25923 Collection 111 Original Paper Veterinarni Medicina, 63, 2018 (03): 110–116 https://doi.org/10.17221/156/2017-VETMED ® ® Staphylococcus aureus ATCC 25923 was used as (Fermentas , Canada) to determine the size of am- a negative control. plicons. Primers. Primers for a putative toxin gene of Sanger sequencing analysis. Purified PCR E. coli (uidA-F: 5' ATGCCAGTCCAGCGTTTTT products (~50 ng) were prepared for sequencing. GC 3', uidA-R: 5' AAAGTGTGGGTCAATAATC Samples were analysed using the Applied Biosystems ® AGGAAGTG 3') (1487 bp) (Chandra et al. 2013), a PRISM 310 Genetic Analyzer in accordance with gene encoding a conserved hypothetical cellulose the protocol of the BigDye terminator method ® synthase protein (yliE) of E. fergusonii (EFER 13-F: (Applied Biosystems , USA). Nucleotide sequenc- 5' GGGCATAAATCTGGTTGGC 3', EFER 13-R: 5' es of PCR products were analysed using Standard ® CGGGCATACCATAACAATCG 3') (233 bp) and Nucleotide BLAST NCBI Genomic Reference a putative transcriptional activator for a multiple Sequences (available at: https://blast.ncbi.nlm.nih. antibiotic resistance gene (EFER_1569) (EFER YP- gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=
Load more

Recommended publications
  • Distribution of Bacterial 1,3-Galactosyltransferase Genes In
    Distribution of Bacterial α1,3-Galactosyltransferase Genes in the Human Gut Microbiome Emmanuel Montassier, Gabriel Al-Ghalith, Camille Mathé, Quentin Le Bastard, Venceslas Douillard, Abel Garnier, Rémi Guimon, Bastien Raimondeau, Yann Touchefeu, Emilie Duchalais, et al. To cite this version: Emmanuel Montassier, Gabriel Al-Ghalith, Camille Mathé, Quentin Le Bastard, Venceslas Douillard, et al.. Distribution of Bacterial α1,3-Galactosyltransferase Genes in the Human Gut Microbiome. Frontiers in Immunology, Frontiers, 2020, 10, pp.3000. 10.3389/fimmu.2019.03000. inserm-02490517 HAL Id: inserm-02490517 https://www.hal.inserm.fr/inserm-02490517 Submitted on 25 Feb 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ORIGINAL RESEARCH published: 13 January 2020 doi: 10.3389/fimmu.2019.03000 Distribution of Bacterial α1,3-Galactosyltransferase Genes in the Human Gut Microbiome Emmanuel Montassier 1,2,3, Gabriel A. Al-Ghalith 4, Camille Mathé 5,6, Quentin Le Bastard 1,3, Venceslas Douillard 5,6,7, Abel Garnier 5,6,7, Rémi Guimon 5,6,7, Bastien Raimondeau 5,6, Yann Touchefeu 8,9, Emilie Duchalais 8,9, Nicolas Vince 5,6, Sophie Limou 5,6, Pierre-Antoine Gourraud 5,6,7, David A.
    [Show full text]
  • Escherichia Fergusonii: a New Emerging Bacterial Disease of Farmed Nile Tilapia (Oreochromis Niloticus)
    Global Veterinaria 14 (2): 268-273, 2015 ISSN 1992-6197 © IDOSI Publications, 2015 DOI: 10.5829/idosi.gv.2015.14.02.9379 Escherichia fergusonii: A New Emerging Bacterial Disease of Farmed Nile Tilapia (Oreochromis niloticus) A.Y. Gaafar, A.M. Younes, A.M. Kenawy, W.S. Soliman and Laila A. Mohamed Department of Hydrobiology, National Research Centre (NRC), El-Bohooth Street (Formerly El-Tahrir St.) Dokki, Gizza 12622, Egypt Abstract: Tilapia is one of the most important cultured freshwater fish in Egypt. In June (2013) an unidentified bacterial disease outbreak occurred in earthen ponds raised Nile tilapia (Oreochromis niloticus). The API 20E test identified the strain as sorbitol-negative and positive for ADH, ornithine decarboxylase and amygdalin and provided the code 5144113, corresponding to E. fergusonii. The clinical signs of diseased fish showed emaciation, focal reddening of the skin at the base of the fins, exophthalmia with inflammation of periorbital area. Postmortem lesions showed enlargement of gallbladder and spleen with discolored hepatopancreas and congested posterior kidney. Lethal Dose fifty (LD50 ) was performed for experimental infection studies. Histopathological examination of naturally as well as experimentally infected specimens revealed pathological lesions in the hepatopancreas, posterior kidney, spleen, myocardium, skin and gills. The lesions ranged from circulatory, degenerative changes and mononuclear cells infiltrations to necrotic changes in the corresponding organs. As a conclusion, this study was the first evidence that E. fergusonii can infect fish especially farmed tilapia, causing considerable mortality and morbidity, in heavily manured earthen ponds. E. fergusonii causes significant pathological lesions in tilapia that are comparable to other susceptible terrestrial animals.
    [Show full text]
  • Escherichia Coli and Shigella Species M
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Apr. 1988, p. 201-206 Vol. 38. No. 2 0020-7713/88/040201-06$02.OO/O Specificity of a Monoclonal Antibody for Alkaline Phosphatase in Escherichia coli and Shigella Species M. 0. HUSSON,1*2*P. A. TRINELY2C. MIELCAREK,2 F. GAVINI,2 C. CARON,lq2D. IZARD,l AND H. LECLERC' Faculte' de Me'decine, Laboratoire de Bacte'riologie A, 59045 Lille Cedex, France' and Unite' Institut National de la Sante' et de la Recherche Me'dicale 146, Domaine dir CERTIA, 59650 Villeneuve-d'Ascq Cedex, France2 The specificity of monoclonal antibody 2E5 for the alkaline phosphatase of Escherichia coli was studied against the alkaline phosphatases of 251 other bacterial strains. The organisms used included members of the six species of the genus Escherichia (E. coli, E. fergusonii, E. hermannii, E. blattae, E. vulneris, E. adecarboxylata), 41 species representing the family Enterobacteriaceae, and, in addition, Pseudomonas aeruginosa, Aeromonas spp., Plesiomonas shigelloides, Acinetobacter calcoaceticus, and Vibrio cholerae non-01. Three methods were used. An enzyme-linked immunosorbent assay was performed against 21U of alkaline phosphatase per ml; immunofluorescence against bacterial cells and Western blotting against periplasmic proteins were also used. All of our experiments demonstrated the high specificity of monoclonal antibody 2E5. This antibody recognized only E. coli (118 strains tested) and the four species of the genus Shigella (S. sonnei, S. flexneri, S. boydii, S. dysenteriae; 12 strains tested). Since the description of hybridoma production by Kohler mouse immunized with purified Escherichia coli ATCC and Milstein in 1975 (14), many monoclonal antibodies 10536 alkaline phosphatase as described elsewhere (12).
    [Show full text]
  • Higher Prevalence of Extended-Spectrum Cephalosporin
    antibiotics Article Higher Prevalence of Extended-Spectrum Cephalosporin-Resistant Enterobacterales in Dogs Attended for Enteric Viruses in Brazil Before and After Treatment with Cephalosporins Marília Salgado-Caxito 1,2,* , Andrea I. Moreno-Switt 2,3, Antonio Carlos Paes 1, Carlos Shiva 4 , Jose M. Munita 2,5 , Lina Rivas 2,5 and Julio A. Benavides 2,6,7,* 1 Department of Animal Production and Preventive Veterinary Medicine, School of Veterinary Medicine and Animal Science, Sao Paulo State University, Botucatu 18618000, Brazil; [email protected] 2 Millennium Initiative for Collaborative Research on Bacterial Resistance (MICROB-R), Santiago 7550000, Chile; [email protected] (A.I.M.-S.); [email protected] (J.M.M.); [email protected] (L.R.) 3 Escuela de Medicina Veterinaria, Pontificia Universidad Católica de Chile, Santiago 8940000, Chile 4 Faculty of Veterinary Medicine and Zootechnics, Universidad Cayetano Heredia of Peru, Lima 15102, Peru; [email protected] 5 Genomics and Resistant Microbes Group, Facultad de Medicina Clinica Alemana, Universidad del Desarrollo, Santiago 7550000, Chile 6 Departamento de Ecología y Biodiversidad, Facultad de Ciencias de la Vida, Universidad Andrés Bello, Santiago 8320000, Chile 7 Centro de Investigación para la Sustentabilidad, Facultad de Ciencias de la Vida, Universidad Andrés Bello, Santiago 8320000, Chile Citation: Salgado-Caxito, M.l.; * Correspondence: [email protected] (M.S.-C.); [email protected] (J.A.B.) Moreno-Switt, A.I; Paes, A.C.; Shiva, C.; Munita, J.M; Rivas, L.; Abstract: The extensive use of antibiotics is a leading cause for the emergence and spread of antimicro- Benavides, J.A Higher Prevalence of Extended-Spectrum Cephalosporin- bial resistance (AMR) among dogs.
    [Show full text]
  • Studies on the Prevalence of Enterobacteriaceae in Chickens and Chicken Eggs
    BS. VET . MED . J. 7TH SCI . CONF . VOL . 22, NO.1, P.136-144 Beni-Suef Veterinary Medical Journal Studies on the Prevalence of Enterobacteriaceae in Chickens and Chicken eggs 1 2 3 4 M. M. Amer ; A. H. M. Dahshan ; Hala S. Hassan and Asmaa A. Mohamed 1 Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, 2 Department of Poultry Diseases, Faculty of Veterinary Medicine, Beni-Suef University, 3 Department of Bacteriology and Mycology, Faculty of Veterinary Medicine, Beni-Suef University and 4 Veterinary Supervisor, Animal Production, Faculty of Agriculture, Al-Minia University This study was done to investigate the prevalence of the Enterobacteriaceae in chickens and eggs. Isolation of forty four different bacterial isolates belonging to Enterobacteriaceae from chicken egg samples, cloacal swabs and swabs from Hatcheries’s floor, the isolates from commercial flock swabs were biochemically identified as E coli, P. mirabilis E Sakazakii and E .cloacae by incidence 22%, 55 %, 11% and 11 % respectively. The isolates from Layers and broilers breeder cloacal swabs were biochemically identified to be E. coli, P. mirabilis E. fergusonii and E .cloacae by incidence 20 %, 20 %, 20% and 40 % respectively. The isolates from commercial eggs were biochemically identified to be Pantoea Sp. , Kluyvera sp., E Sakazakii , E.aerogenes and E.harmanii by incidence 33.3% , 16.6% , 16.6% , 16.6% and 16.6 % respectively. The isolates from fertilized egg samples were biochemically identified as E Sakazakii , E. fergusonii , E.coli , E. Cloacae , Aeromonas ,S. Anatum and Prov. Alcolifaciens with a number of 1 ,1, 3, 3, 2, 2 and 1 , incidence 8% , 8% , 23% , 23% , 15% , 15% and 8 % respectively.
    [Show full text]
  • Enumeration of Total Airborne Bacteria, Yeast and Mold
    ENUMERATION OF TOTAL AIRBORNE BACTERIA, YEAST AND MOLD CONTAMINANTS AND IDENTIFICATION OF Escherichia coli O157:H7, Listeria Spp., Salmonella Spp., AND Staphylococcus Spp. IN A BEEF AND PORK SLAUGHTER FACILITY By GABRIEL HUMBERTO COSENZA SUTTON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004 ACKNOWLEDGMENTS The author is sincerely grateful to Dr. S. K. Williams, associate professor and supervisory committee chairperson, for her superb guidance and supervision in conducting this study and manuscript preparation. He also extends his gratitude to the other committee members, Dr. Dwain Johnson, Dr. Ronald H. Schmidt, Dr. David P. Chynoweth and Dr. Murat O. Balaban, for their collaboration and useful recommendations during this study. Special thanks are extended to the Institute of Food and Agricultural Sciences of the University of Florida for sponsoring the author throughout the program. Great appreciation and love are expressed to Adrienne and Humberto Cosenza, the author’s parents, and to his girlfriend Candice L. Lloyd for their support throughout the graduate program. The author wishes to thank Larry Eubanks, Byron Davis, Tommy Estevez, Doris Sartain, Frank Robbins, Noufoh Djeri and fellow graduate students for their friendly support and assistance. Overall the author would like to thank God for His inspiration, love and caring. ii TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................
    [Show full text]
  • Emergence and Spread of Cephalosporinases in Wildlife: a Review
    animals Review Emergence and Spread of Cephalosporinases in Wildlife: A Review Josman D. Palmeira 1 ,Mónica V. Cunha 2,3 , João Carvalho 1, Helena Ferreira 4,5, Carlos Fonseca 1,6 and Rita T. Torres 1,* 1 Departamento de Biologia & CESAM, Universidade de Aveiro, Campus de Santiago, 3810-193 Aveiro, Portugal; [email protected] (J.D.P.); [email protected] (J.C.); [email protected] (C.F.) 2 Centre for Ecology, Evolution and Environmental Changes (cE3c), Faculdade de Ciências, Universidade de Lisboa, 1749-016 Lisbon, Portugal; [email protected] 3 Biosystems & Integrative Sciences Institute (BioISI), Faculdade de Ciências, Universidade de Lisboa, 1749-016 Lisbon, Portugal 4 Microbiology, Department of Biological Sciences, Faculty of Pharmacy, University of Porto, 4050-313 Porto, Portugal; [email protected] 5 UCIBIO, REQUIMTE, University of Porto, 4050-313 Porto, Portugal 6 ForestWISE-Collaborative Laboratory for Integrated Forest & Fire Management, Quinta de Prados, 5001-801 Vila Real, Portugal * Correspondence: [email protected] Simple Summary: Antimicrobial resistance (AMR) is one of the global public health challenges nowa- days. AMR threatens the effective prevention and treatment of an ever-increasing range of infections, being present in healthcare settings but also detected across the whole ecosystem, including wildlife. This work compiles the available information about an important resistance mechanism that gives bacteria the ability to inactivate cephalosporin antibiotics, the cephalosporinases (extended-spectrum Citation: Palmeira, J.D.; Cunha, M.V.; beta-lactamase (ESBL) and AmpC beta-lactamase), in wildlife. Through a rigorous systematic litera- Carvalho, J.; Ferreira, H.; Fonseca, C.; ture review in the Web of Science database, the available publications on this topic in the wildlife Torres, R.T.
    [Show full text]
  • Complete Genome Sequence and Characterization of Avian
    Wang et al. Standards in Genomic Sciences (2016) 11:13 DOI 10.1186/s40793-015-0126-6 SHORT GENOME REPORT Open Access Complete genome sequence and characterization of avian pathogenic Escherichia coli field isolate ACN001 Xiangru Wang1,2†, Liuya Wei1,2†, Bin Wang1,2, Ruixuan Zhang1,2, Canying Liu1,2, Dingren Bi1,2, Huanchun Chen1,2 and Chen Tan1,2* Abstract Avian pathogenic Escherichia coli is an important etiological agent of avian colibacillosis, which manifests as respiratory, hematogenous, meningitic, and enteric infections in poultry. It is also a potential zoonotic threat to human health. The diverse genomes of APEC strains largely hinder disease prevention and control measures. In the current study, pyrosequencing was used to analyze and characterize APEC strain ACN001 (= CCTCC 2015182T =DSMZ 29979T), which was isolated from the liver of a diseased chicken in China in 2010. Strain ACN001 belongs to extraintestinal pathogenic E. coli phylogenetic group B1, and was highly virulent in chicken and mouse models. Whole genome analysis showed that it consists of six different plasmids along with a circular chromosome of 4,936,576 bp, comprising 4,794 protein-coding genes, 108 RNA genes, and 51 pseudogenes, with an average G + C content of 50.56 %. As well as 237 coding sequences, we identified 39 insertion sequences, 12 predicated genomic islands, 8 prophage-related sequences, and 2 clustered regularly interspaced short palindromic repeats regions on the chromosome, suggesting the possible occurrence of horizontal gene transfer in this strain. In addition, most of the virulence and antibiotic resistance genes were located on the plasmids, which would assist in the distribution of pathogenicity and multidrug resistance elements among E.
    [Show full text]
  • Identification of Intestinal Microbes in Children With
    IDENTIFICATION OF INTESTINAL MICROBES IN CHILDREN WITH DIARRHEA ANDNON-DIARRHEA USING POLYMERASE CHAIN REACTION / ELECTROSPRAY IONIZATION-MASS SPECTROMETRY (PCR / ESI-MS) Teguh Sarry Hartono1, Dewi Murniati2, Andi Yasmon3, Lucky H Moehario3 1 Infectious Disease HospitalProf Dr Sulianti Saroso, Microbiology Resident–Departement of Microbiology, Faculty of Medicine, University of Indonesia. 2Infectious Disease Hospital Prof Dr Sulianti Saroso, 3Department of Microbiology, Faculty of Medicine, University of Indonesia. Abstract :Microbiota present in human intestinal are diverse, and imbalance in composition of intestinal flora may cause diarrhea.This study aimed to obtain a profile of intestinal bacteria in children with and without diarrhea and assess their presence with incidence of diarrhea. An analitical descriptive with cross sectional design study was carried out. A stool specimen was collected from each children of 2-12 years old with and without diarrhea who lived in North Jakarta. DNA extraction was performed prior to detection of microbes using Polymerase Chain Ceaction/Electrospray Ionization-Mass Spectrometry. Eighty stool specimens consisted of 33 and 47 specimens from children with and without diarrhea were included in the study. Thirty single and 6 multiple matches were detected in 30 specimens of the diarrhea group; 28 single and 8 multiple matches were found in 34 specimens of the non-diarrhea.Escherechiacoli and Klebsiella pneumonia were predominant in both groups. Firmicutes, Proteobacteria and Bacteroidetes were deteced in the diarrhea group, while Actinobacteria, Proteobacteria and Verrucomicrobia were in the non-diarrhea. The relationship of incidence of diarrhea and the present of enteropathogens in the stool was not significant, however, there was a strong correlation of the risk of suffering diarrhea due to the presence of enteropathogens (OR = 0.724 with 95%, CI: 0.237-2.215).
    [Show full text]
  • Hemolytic Uremic Syndrome Caused by Escherichia Fergusonii Infection Seung Don Baek1 , Chinhak Chun2 , Kyoung Sup Hong1
    Correspondence KIDNEY RESEARCH Kidney Res Clin Pract 2019;38(2):253-255 AND pISSN: 2211-9132 • eISSN: 2211-9140 CLINICAL PRACTICE https://doi.org/10.23876/j.krcp.19.012 Hemolytic uremic syndrome caused by Escherichia fergusonii infection Seung Don Baek1 , Chinhak Chun2 , Kyoung Sup Hong1 1Department of Internal Medicine, Mediplex Sejong Hospital, Incheon, Korea 2Center for Infectious Diseases, Mediplex Sejong Hospital, Incheon, Korea Escherichia fergusonii is a rare pathogen that has been blood pressure was 147/80 mmHg. Physical examina- isolated from the intestinal contents of warm-blooded tion showed pretibial pitting edema. Urinary bladder animals [1]. It is closely related to Escherichia coli and catheterization yielded purulent urine. The laboratory causes infection of both wounds and the biliary and uri- findings included the following: white blood cell (WBC) nary tracts in humans [2]. Thrombotic microangiopathy count 14,410/µL, hemoglobin 8.9 g/dL, platelet count includes thrombotic thrombocytopenic purpura (TTP) 14,000/µL, C-reactive protein 22.8 mg/dL, blood urea and hemolytic uremic syndrome (HUS), which share a nitrogen 92 mg/dL, creatinine 5.14 mg/dL, lactate dehy- similar pathogenicity. Neurological and renal complica- drogenase 282 U/L, prothrombin time 1.58 (normal, 0.9- tions significantly affect patient outcomes in these dis- 1.08 international normalised ratio), and activated par- eases. tial thromboplastin time 111 seconds (normal, 81-125 A few case reports regarding infections caused by E. seconds). Urinalysis revealed the urine WBC count as > fergusonii are found in the literature. However, throm- 100/high power field (HPF) and the red blood cell count botic microangiopathy associated with E.
    [Show full text]
  • Escherichia Fergusonii Strains Isolated from Clinical Specimens in Albania
    Journal of Multidisciplinary Engineering Science and Technology (JMEST) ISSN: 2458-9403 Vol. 4 Issue 4, April - 2017 Escherichia fergusonii strains isolated from clinical specimens in Albania Elvira Beli 1* Esat Duraku 2 1 Agricultural University of Tirana, Koder Kamez, Central Military Hospital, Laboratory of Tirane, Albania Microbiology, Tirane, Albania [email protected] Abstract- The material includes four strains of “Pseudoarthrosis cruris”. Six days after surgical E.fergusonii. Two of them were recovered from treatment, signs of an evident wound infection were liver and spleen of diseased animals, a calf and a present, and from two pus specimens, taken with a chicken respectively. The two other strains belong four days interval, E. fergusonii was isolated. The two to a 31-year-old woman, admitted in the Hospital, other strains appertain to non-human sources. They for “Pseudoarthrosis cruris”. Six days after were recovered from liver and spleen of diseased surgical treatment, signs of an evident wound animals, a calf and a chicken respectively. The calf infection were present, and from two pus suffers a diarrheal disease and is suspected to be infected with pathogenic strains of E. coli. The chicken specimens, taken with a four days interval, it is mortem without clinical sing. E.fergusonii was isolated. The specimens were cultured onto sheep blood The four isolated strains were identified by a and Mac-Conkey agar plates. Subcultures on Kligler series of more than forty biochemical Iron Agar were used for biochemical studies and conventional tests, demonstrated the antibiotic susceptibility testing. The biochemical tests morphological, cultural and biochemical were performed as described by Edwards and Ewing characteristics of the family Enterobacteriaceae, [4].
    [Show full text]
  • Genomic Evidence for Revising the Escherichia Genus and Description of Escherichia
    bioRxiv preprint doi: https://doi.org/10.1101/781724; this version posted September 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Title: Genomic evidence for revising the Escherichia genus and description of Escherichia 2 ruysiae sp. nov. 3 4 Running title (51/54 characters incl. spaces): Genomic evidence for revising the Escherichia 5 genus 6 7 Boas C.L. van der Puttena,b,#, Sébastien Matamorosa, COMBAT consortium†, Constance 8 Schultsza,b 9 aAmsterdam UMC, University of Amsterdam, Department of Medical Microbiology, 10 Meibergdreef 9, Amsterdam, Netherlands 11 bAmsterdam UMC, University of Amsterdam, Department of Global Health, Amsterdam 12 Institute for Global Health and Development, Meibergdreef 9, Amsterdam, Netherlands 13 #Corresponding author, email: [email protected] 14 †Members listed in the appendix. 15 16 Abstract (223/250 words) 17 The Escherichia/Shigella genus comprises four Escherichia species, four Shigella species, and 18 five lineages currently not assigned to any species, termed ‘Escherichia cryptic clades’ 19 (numbered I, II, III, IV and VI). Correct identification of Escherichia cryptic clades is strongly bioRxiv preprint doi: https://doi.org/10.1101/781724; this version posted September 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
    [Show full text]