DOCSLIB.ORG

Download Thesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download Thesis This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Investigations into the effects of berry flavonoids on nutrient transport processes in Caco-2 enterocytes Alzaid, Fawaz Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 06. Oct. 2021 This electronic theses or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Title: Investigations into the effects of berry flavonoids on nutrient transport processes in Caco-2 enterocytes Author: Fawaz Alzaid The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENSE AGREEMENT This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. http://creativecommons.org/licenses/by-nc-nd/3.0/ You are free to: Share: to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Investigations into the effects of berry flavonoids on nutrient transport processes in Caco-2 enterocytes Fawaz Alzaid A thesis submitted to the University of London for the degree of Doctor of Philosophy in the Faculty of Science Diabetes and Nutritional Sciences Division King’s College London University of London October 2012 1 2 Dedicated to my family 3 Publications and presentations Abstract publications Alzaid F, Pourvali K, Lin CI, Arno M, Astarloa EA-O, Sharp PA, Hogstrand C, Emery PW, Bagchi D, Preedy VR & Wiseman H. (2010). Flavonoid-rich- berry-extract treatment decreases the expression of DMT1 and functionally- similar metal transporter genes in human intestinal Caco-2 cells. Proceedings of the Nutrition Society. 69. Alzaid F, Pourvali K, Sharp PA, Bagchi D, Preedy VR & Wiseman H. (2010). Anthocyanin-rich berry-extract treatment decreases expression of dietary glucose transporter genes in human intestinal Caco-2 cells. Proceedings of the Nutrition Society. 69. Alzaid F, Pourvali K, Sekhon G, Sharp PA, Preedy VR & Wiseman H. (2010). Flavonoid-rich berry-extract influences expression of genes in the iron-uptake pathway in human intestinal Caco-2 cells. Proceedings of the Nutrition Society. 69. Alzaid F, Robotham A, Pourvali K, Sharp PA, Preedy VR & Wiseman H. (2010). Flavonoid-rich berry-extract treatment influences expression of genes in the copper-uptake pathway in human intestinal Caco-2 cells. Proceedings of the Nutrition Society.69. Alzaid F, Cheung HM, Sharp PA, Preedy VR & Wiseman H. (2011). Flavonoid-rich berry-extract treatment decreases glucose uptake in human intestinal Caco-2 cells. Proceedings of the Nutrition Society. 70. 4 Poster presentations 2009 Poster presentation at Nutrition Society summer meeting, University of Surrey, UK. Title of the poster: Flavonoid-rich-berry-extract treatment decreases the expression of DMT1 and functionally-similar metal transporter genes in human intestinal Caco-2 cells. 2009 Poster presentation at Nutrition Society winter meeting, University of Reading, Surrey, UK. Title of the poster: Anthocyanin-rich berry-extract treatment decreases expression of dietary glucose transporter genes in human intestinal Caco-2 cells. 2010 Poster presentation at Nutrition Society summer meeting, Heriot-Watt University, Edinburgh, Scotland. Title of the poster: Flavonoid-rich berry- extract influences expression of genes in the iron-uptake pathway in human intestinal Caco-2 cells. 2010 Poster presentation at Nutrition Society winter meeting, Royal Institute of British Architects, London, UK. Title of the poster: Flavonoid-rich berry- extract treatment influences expression of genes in the copper-uptake pathway in human intestinal Caco-2 cells. 2011 Poster presentation at Nutrition Society winter meeting, University of Reading, Surrey, UK. Title of the poster: Flavonoid-rich berry-extract treatment decreases glucose uptake in human intestinal Caco-2 cells. 5 Achievements 2008 Postgraduate research scholarship award from the Ministry of Higher Education of the State of Kuwait. 2010 Research support grant from the Arab-British Chamber of Commerce Charitable Foundation. 6 Abstract Flavonoids are known to interact with a number of membrane transporters, influencing the rate of intestinal nutrient absorption. The transcriptional effects and consequences of such interactions remained to be fully elucidated. To address this we carried out gene expression microarray analysis on intestinal Caco-2 cells treated with a flavonoid-rich berry extract (0.125 % w/v for 16 h). This microarray analysis identified alterations in numerous specific nutrient pathways, three of which were selected for further study, namely: 1) glucose, 2) iron and 3) copper. We then determined the effects of berry flavonoids on the expression and function of these transport pathways using qRT-PCR, Western blotting and functional assays. We found: 1) Chronic treatment (16 h) with flavonoids decreased the expression of glucose transporter genes (GLUT2 and SGLT1) and induced an acute (15 min) inhibitory effect on enterocytic glucose uptake. 2) Chronic treatment (16 h) with berry extract modulated the expression of genes that regulate iron uptake (down- regulation of DMT1, DCYTB and HFE; up-regulation of TfR1). Iron transepithelial transport was decreased by both acute (15 min) and chronic (16 h) berry extract treatment. 3) Chronic berry extract treatment (16 h) decreased the expression of genes that coordinate copper uptake (CTR1, HAH1, ATP7A and ATP7B). However, copper uptake was increased by both acute (15 min) and chronic (16 h) berry extract treatment. Thus overall, there is a clear effect of flavonoids on the pathways of glucose, iron and copper and a possible interactive effect between these nutrients themselves. Further research into the functional and physiological relevance of our findings will aid in optimising the dietary management of conditions such as diabetes and disturbances in copper or iron homeostasis. 7 Acknowledgments I would like to thank the following for guidance and support throughout this work: My Supervisors Dr. Helen Wiseman and Prof. Victor R. Preedy. Dr. Paul A. Sharp, his guidance, support, knowledge and limitless patience throughout this work has been invaluable. Dr. Matthew Arno, Dr. Estibalez Aldecoa-Otalora Astarloa, Professor Peter Emery, Ms. Rukshana Hoque, Dr. Katayoun Pourvali and Ms. Abigail Robotham. And my family. 8 Statement of work performed by author I was involved in the planning and performing of all the projects detailed in chapters 3 to 6. This involved planning, sample maintenance, treatments, isolation and purification of sample material, assay design and optimisation, quality controls, statistical analysis and interpretation of data. Assay design and optimisation was carried out in collaboration with Dr. Katayoun Pourvali. In Chapter 3, microarray sample preparation, hybridisation and running was carried out by Dr. Matthew Arno and Dr. Estibalez Aldecoa-Otalora Astarloa. Planning, data interpretation and statistical analysis were carried out under consultation and guidance of Professor Peter Emery, Professor Victor R. Preedy, Dr. Paul A. Sharp, and Dr. Helen Wiseman. I am extremely grateful to all of the above named colleagues for their helpful advice, input and discussions throughout this work. 9 Table of contents Publications and presentations ................................................................................................. 4 Abstract publications ........................................................................................................... 4 Poster presentations ............................................................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Fructose Diet-Induced Hypertension
    Possible Involvement of Up-regulated Salt Dependent Glucose Transporter-5 (SGLT5) in High- fructose Diet-induced Hypertension Hiroaki Hara Saitama Medical Center, Saitama Medical University Kaori Takayanagi Saitama Medical Center, Saitama Medical University Taisuke Shimizu Saitama Medical Center, Saitama Medical University Takatsugu Iwashita Saitama Medical Center, Saitama Medical University Akira Ikari Gifu Pharmaceutical University Hajime Hasegawa ( [email protected] ) Dept. of Nephrology and Hypertension, Saitama Medical Center, Saitama Medical University, Kamoda 1981, Kawagoe, Saitama 350-8550, Japan. Research Article Keywords: salt sensitive hypertension, salt reabsorption, extracellular volume, glucose Posted Date: January 11th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-122315/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Excessive fructose intake causes a variety of adverse conditions (e.g., obesity, hepatic steatosis, insulin resistance and uric acid overproduction). Particularly, high fructose-induced hypertension is the most common and signicant pathological setting, however, its underlying mechanisms are not established. We investigated these mechanisms in 7-week-old male SD rats fed a diet containing 60% glucose (GLU) or 60% fructose (FRU) for 3, 6, or 12 weeks. Daily food consumption was measured to avoid between- group discrepancies in caloric/salt intake, adjusting for feeding amounts. The FRU rats' mean blood pressure was signicantly higher and fractional sodium excretion (FENa) was signicantly lower, indicating that the high-fructose diet caused salt retention. The FRU rats' kidney weight and glomerular surface area were greater, suggesting that the high-fructose diet induced an increase in extracellular uid volume.
    [Show full text]
  • SUPPLEMENTAL DATA Supplemental Materials And
    SUPPLEMENTAL DATA Supplemental Materials and Methods Cells and Cell Culture Human breast carcinoma cell lines, MDA-MB-231 and MCF7, were purchased from American Type Tissue Culture Collection (ATCC). 231BoM-1833, 231BrM-2a, CN34, CN34-BoM2d, CN34-BrM2c and MCF7- BoM2d cell lines were kindly provided by Dr. Joan Massagué (Memorial Sloan-Kettering Cancer Center) (1-3). Luciferase-labeled cells were generated by infecting the lentivirus carrying the firefly luciferase gene. The immortalized mouse bone microvascular endothelial cell (mBMEC) was a generous gift from Dr. Isaiah J. Fidler (M.D. Anderson Cancer Center) (4). MCF10A and MCF10DCIS.com cells were purchased from ATCC and Asterand, respectively. MDA-MB-231, its variant cells, MCF7 and MCF-BoM2d cells were cultured in DMEM medium supplemented with 10% FBS and antibiotics. CN34 and its variant cells were cultured in Medium199 supplemented with 2.5% FBS, 10 µg/ml insulin, 0.5 µg/ml hydrocortisone, 20 ng/ml EGF, 100 ng/ml cholera toxin and antibiotics. MCF10DCIS.com cells were cultured in RPMI-1640 medium supplemented with 10% FBS and antibiotics. MCF10A cells were cultured in MEGM mammary epithelial cell growth medium (Lonza). mBMEC was maintained at 8% CO2 at 33 °C in DMEM with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 1% non-essential amino acids and 1% vitamin mixture. Bone marrow stromal fibroblast cell lines HS5 and HS27A, and osteoblast cell line, hFOB1.19, were purchased from ATCC. Bone marrow derived human mesenchymal stem cells, BM-hMSC, were isolated for enrichment of plastic adherent cells from unprocessed bone marrow (Lonza) which was depleted of red blood cells.
    [Show full text]
  • Chapter 1 - Introduction
    Chapter 1 - Introduction 1 1.1 Epigenetic modifications and gene silencing The fact that a multicellular organism is able to undergo cellular differentiation, even though every cell contains the same genetic material, indicates the existence of an extra layer of phenotype-determining factors. Cellular differentiation is associated with the development of different patterns of gene expression in individual cells or groups of cells, and the way in which these patterns are established involves epigenetics. Epigenetics refers to the process by which transcriptional states are changed in a relatively permanent way in the absence of DNA mutation. Epigenetic gene silencing or activation results from modifications to the gene in question either by changing the methylation state of the DNA or by modifying the proteins that package the DNA. There is increasing evidence that in some cases RNA molecules are also involved. Epigenetic modifications are generally erased and reset between generations in order to provide the necessary pluripotent starting state from which to begin development in the next generation. 1.1.1 DNA methylation DNA methylation is the best studied epigenetic modification. In mammals DNA methylation is always associated with cytosine residues, generally occurring at CpG dinucleotides in a symmetrical fashion, where the cytosines on both strands are methylated. Methylation of cytosine involves the transfer of a methyl group from an S-adenosyl-L-methionine to the 5-position of cytosine, resulting in the modified base 5-methylcytosine (Jeltsch, 2002) (Figure 1.1). Estimates of methylation levels at CpGs in mammals range from 50-90% (Gruenbaum et al., 1981; Jeltsch, 2002). DNA 2 hypermethylation at promoters usually correlates with transcriptional repression and gene silencing.
    [Show full text]
  • Prestinłs Anion Transport and Voltage-Sensing Capabilities Are
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biophysical Journal Volume 96 April 2009 3179–3186 3179 Prestin’s Anion Transport and Voltage-Sensing Capabilities Are Independent Jun-Ping Bai,† Alexei Surguchev,†‡ Simone Montoya,†‡ Peter S. Aronson,§{ Joseph Santos-Sacchi,‡{k and Dhasakumar Navaratnam†k* †Department of Neurology, ‡Division of Otolaryngology, Department of Surgery, §Department of Internal Medicine, {Department of Cellular and Molecular Physiology, and kDepartment of Neurobiology, Yale University School of Medicine, New Haven, Connecticut ABSTRACT The integral membrane protein prestin, a member of the SLC26 anion transporter family, is responsible for the voltage-driven electromotility of mammalian outer hair cells. It was argued that the evolution of prestin’s motor function required a loss of the protein’s transport capabilities. Instead, it was proposed that prestin manages only an abortive hemicycle that results in the trapped anion acting as a voltage sensor, to generate the motor’s signature gating charge movement or nonlinear capaci- tance. We demonstrate, using classical radioactive anion ([14C]formate and [14C]oxalate) uptake studies, that in contrast to previous observations, prestin is able to transport anions. The prestin-dependent uptake of both these anions was twofold that of cells transfected with vector alone, and comparable to SLC26a6, prestin’s closest phylogenetic relative. Furthermore, we identify a potential chloride-binding site in which the mutations of two residues (P328A and L326A) preserve nonlinear capacitance, yet negate anion transport. Finally, we distinguish 12 charged residues out of 22, residing within prestin’s transmembrane regions, that contribute to unitary charge movement, i.e., voltage sensing.
    [Show full text]
  • PAQR6 Antibody (C-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PAQR6 Antibody (C-term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B Specification PAQR6 Antibody (C-term) - Product Information Application WB,E Primary Accession Q6TCH4 Other Accession NP_940798.1, NP_079173.2 Reactivity Human Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 37989 Antigen Region 283-312 PAQR6 Antibody (C-term) - Additional Information PAQR6 Antibody (C-term) (Cat. #AP13667b) Gene ID 79957 western blot analysis in Jurkat cell line lysates (35ug/lane).This demonstrates the PAQR6 Other Names antibody detected the PAQR6 protein (arrow). Progestin and adipoQ receptor family member 6, Progestin and adipoQ receptor family member VI, PAQR6 PAQR6 Antibody (C-term) - Background Target/Specificity The function of this protein remains unknown. This PAQR6 antibody is generated from rabbits immunized with a KLH conjugated PAQR6 Antibody (C-term) - References synthetic peptide between 283-312 amino acids from the C-terminal region of human PAQR6. Kamatani, Y., et al. Nat. Genet. 42(3):210-215(2010) Dilution Smith, J.L., et al. Steroids WB~~1:1000 73(11):1160-1173(2008) Tang, Y.T., et al. J. Mol. Evol. Format 61(3):372-380(2005) Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C in small aliquots to prevent freeze-thaw cycles. Precautions PAQR6 Antibody (C-term) is for research Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 use only and not for use in diagnostic or therapeutic procedures.
    [Show full text]
  • Sexual Dimorphism in Brain Transcriptomes of Amami Spiny Rats (Tokudaia Osimensis): a Rodent Species Where Males Lack the Y Chromosome Madison T
    Ortega et al. BMC Genomics (2019) 20:87 https://doi.org/10.1186/s12864-019-5426-6 RESEARCHARTICLE Open Access Sexual dimorphism in brain transcriptomes of Amami spiny rats (Tokudaia osimensis): a rodent species where males lack the Y chromosome Madison T. Ortega1,2, Nathan J. Bivens3, Takamichi Jogahara4, Asato Kuroiwa5, Scott A. Givan1,6,7,8 and Cheryl S. Rosenfeld1,2,8,9* Abstract Background: Brain sexual differentiation is sculpted by precise coordination of steroid hormones during development. Programming of several brain regions in males depends upon aromatase conversion of testosterone to estrogen. However, it is not clear the direct contribution that Y chromosome associated genes, especially sex- determining region Y (Sry), might exert on brain sexual differentiation in therian mammals. Two species of spiny rats: Amami spiny rat (Tokudaia osimensis) and Tokunoshima spiny rat (T. tokunoshimensis) lack a Y chromosome/Sry, and these individuals possess an XO chromosome system in both sexes. Both Tokudaia species are highly endangered. To assess the neural transcriptome profile in male and female Amami spiny rats, RNA was isolated from brain samples of adult male and female spiny rats that had died accidentally and used for RNAseq analyses. Results: RNAseq analyses confirmed that several genes and individual transcripts were differentially expressed between males and females. In males, seminal vesicle secretory protein 5 (Svs5) and cytochrome P450 1B1 (Cyp1b1) genes were significantly elevated compared to females, whereas serine (or cysteine) peptidase inhibitor, clade A, member 3 N (Serpina3n) was upregulated in females. Many individual transcripts elevated in males included those encoding for zinc finger proteins, e.g.
    [Show full text]
  • Distribution of Glucose Transporters in Renal Diseases Leszek Szablewski
    Szablewski Journal of Biomedical Science (2017) 24:64 DOI 10.1186/s12929-017-0371-7 REVIEW Open Access Distribution of glucose transporters in renal diseases Leszek Szablewski Abstract Kidneys play an important role in glucose homeostasis. Renal gluconeogenesis prevents hypoglycemia by releasing glucose into the blood stream. Glucose homeostasis is also due, in part, to reabsorption and excretion of hexose in the kidney. Lipid bilayer of plasma membrane is impermeable for glucose, which is hydrophilic and soluble in water. Therefore, transport of glucose across the plasma membrane depends on carrier proteins expressed in the plasma membrane. In humans, there are three families of glucose transporters: GLUT proteins, sodium-dependent glucose transporters (SGLTs) and SWEET. In kidney, only GLUTs and SGLTs protein are expressed. Mutations within genes that code these proteins lead to different renal disorders and diseases. However, diseases, not only renal, such as diabetes, may damage expression and function of renal glucose transporters. Keywords: Kidney, GLUT proteins, SGLT proteins, Diabetes, Familial renal glucosuria, Fanconi-Bickel syndrome, Renal cancers Background Because glucose is hydrophilic and soluble in water, lipid Maintenance of glucose homeostasis prevents pathological bilayer of plasma membrane is impermeable for it. There- consequences due to prolonged hyperglycemia or fore, transport of glucose into cells depends on carrier pro- hypoglycemia. Hyperglycemia leads to a high risk of vascu- teins that are present in the plasma membrane. In humans, lar complications, nephropathy, neuropathy and retinop- there are three families of glucose transporters: GLUT pro- athy. Hypoglycemia may damage the central nervous teins, encoded by SLC2 genes; sodium-dependent glucose system and lead to a higher risk of death.
    [Show full text]
  • Knowledge Management Enviroments for High Throughput Biology
    Knowledge Management Enviroments for High Throughput Biology Abhey Shah A Thesis submitted for the degree of MPhil Biology Department University of York September 2007 Abstract With the growing complexity and scale of data sets in computational biology and chemoin- formatics, there is a need for novel knowledge processing tools and platforms. This thesis describes a newly developed knowledge processing platform that is different in its emphasis on architecture, flexibility, builtin facilities for datamining and easy cross platform usage. There exist thousands of bioinformatics and chemoinformatics databases, that are stored in many different forms with different access methods, this is a reflection of the range of data structures that make up complex biological and chemical data. Starting from a theoretical ba- sis, FCA (Formal Concept Analysis) an applied branch of lattice theory, is used in this thesis to develop a file system that automatically structures itself by it’s contents. The procedure of extracting concepts from data sets is examined. The system also finds appropriate labels for the discovered concepts by extracting data from ontological databases. A novel method for scaling non-binary data for use with the system is developed. Finally the future of integrative systems biology is discussed in the context of efficiently closed causal systems. Contents 1 Motivations and goals of the thesis 11 1.1 Conceptual frameworks . 11 1.2 Biological foundations . 12 1.2.1 Gene expression data . 13 1.2.2 Ontology . 14 1.3 Knowledge based computational environments . 15 1.3.1 Interfaces . 16 1.3.2 Databases and the character of biological data .
    [Show full text]
  • Unraveling the Functional Role of the Orphan Solute Carrier, SLC22A24 in the Transport of Steroid Conjugates Through Metabolomic and Genome-Wide Association Studies
    RESEARCH ARTICLE Unraveling the functional role of the orphan solute carrier, SLC22A24 in the transport of steroid conjugates through metabolomic and genome-wide association studies 1☯ 1☯ 1 1 2 Sook Wah Yee , Adrian Stecula , Huan-Chieh Chien , Ling Zou , Elena V. FeofanovaID , 1 1 3,4 5 Marjolein van BorselenID , Kit Wun Kathy Cheung , Noha A. Yousri , Karsten Suhre , Jason M. Kinchen6, Eric Boerwinkle2,7, Roshanak Irannejad8, Bing Yu2, Kathleen 1,9 a1111111111 M. GiacominiID * a1111111111 a1111111111 1 Department of Bioengineering and Therapeutic Sciences, University of California San Francisco, California, United States of America, 2 Human Genetics Center, University of Texas Health Science Center at Houston, a1111111111 Houston, Texas, United States of America, 3 Genetic Medicine, Weill Cornell Medicine-Qatar, Doha, Qatar, a1111111111 4 Computer and Systems Engineering, Alexandria University, Alexandria, Egypt, 5 Physiology and Biophysics, Weill Cornell Medicine-Qatar, Doha, Qatar, 6 Metabolon, Inc, Durham, United States of America, 7 Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, United States of America, 8 The Cardiovascular Research Institute, University of California, San Francisco, California, United States of America, 9 Institute for Human Genetics, University of California San Francisco, California, United States of America OPEN ACCESS Citation: Yee SW, Stecula A, Chien H-C, Zou L, ☯ These authors contributed equally to this work. Feofanova EV, van Borselen M, et al. (2019) * [email protected] Unraveling the functional role of the orphan solute carrier, SLC22A24 in the transport of steroid conjugates through metabolomic and genome- Abstract wide association studies. PLoS Genet 15(9): e1008208. https://doi.org/10.1371/journal.
    [Show full text]
  • PAQR6 (NM 001272108) Human Tagged ORF Clone – RG236776
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG236776 PAQR6 (NM_001272108) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: PAQR6 (NM_001272108) Human Tagged ORF Clone Tag: TurboGFP Symbol: PAQR6 Synonyms: PRdelta Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG236776 representing NM_001272108. Sequence: Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCAGTCTCAAGCTGCCCCAACTTCTTCAAGTCCACCAGGTCCCCCGGGTGTTCTGGGAAGATGGC ATCATGTCTGGCTACCGCCGCCCCACCAGCTCGGCTTTGGACTGTGTCCTCAGCTCCTTCCAGATGACC AACGAGACGGTCAACATCTGGACTCACTTCCTGCCCACCTGTTTCCTGGAGCTGGAAAGCCCTGGGCTC AGTAAGGTCCTCCGCACAGGAGCCTTCGCCTATCCATTCCTGTTCGACAACCTCCCACTCTTTTATCGG CTCGGGCTGTGCTGGGGCAGGGGCCACGGCTGTGGGCAGGAGGCCCTGAGCACCAGCCATGGCTACCAT CTCTTCTGCGCGCTGCTCACTGGCTTCCTCTTCGCCTCCCACCTGCCTGAAAGGCTGGCACCAGGACGC TTTGATTACATCGGCCACAGCCACCAGTTATTCCACATCTGTGCAGTGCTGGGCACCCACTTCCAGCTG GAGGCAGTGCTGGCTGATATGGGATCACGCAGAGCCTGGCTGGCCACACAGGAACCTGCCCTGGGCCTG GCAGGCACAGTGGCCACACTGGTCTTGGCTGCAGCTGGGAACCTACTCATTATTGCTGCTTTCACAGCC ACCCTGCTTCGGGCCCCCAGTACATGCCCTCTGCTGCAGGGTGGCCCACTGGAGGGGGGTACCCAGGCC AAACAACAG ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAAAC This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]