DOCSLIB.ORG

Supplementary Figure 1 the Mutated Amino Acid Residues of SPEF2 and Their Conservativeness Across Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Figure 1 the Mutated Amino Acid Residues of SPEF2 and Their Conservativeness Across Species Supplementary figure 1 The mutated amino acid residues of SPEF2 and their conservativeness across species. The conservativeness analysis was conducted using the ClustalX2 tool. Conserved residues are marked in black (100% conservativeness), dark gray (80% conservativeness), and light gray (60% conservativeness). No shading denotes the residues with less than 60% conservativeness. A B Supplementary figure 2 The SPEF2 transcripts and SPEF2 protein domains affected by the MMAF-associated SPEF2 mutations. (A) According to the Ensembl database (GRCh38), all the six protein-coding transcripts (T201 to T216) of SPEF2 are illustrated here. The SPEF2 variant c.910C>T (p.Arg304*) affects the transcripts T201, T202, T203, T211 and T216, but does not affect T212. The remaining two SPEF2 variants affect the long transcripts T202, T203 and T216. (B) The corresponding positions and affected domains of the previously reported Spef2 mutations in animals. All three human stop-gain variants of SPEF2 (shown in red) are located before the IFT20 binding domain, which has an important role in sperm tail development. This domain was truncated in all three SPEF2-mutated men. The Spef2 mutations associated with PCD-like symptoms in animals are specifically located in the CH domain. A B C D E Supplementary figure 3 Differential interference contrast microscopy (DICM) analysis of the human spermatozoa. DICM images showed normal sperm morphology in a healthy control male (A), while MMAF phenotypes were observed in a SPEF2-mutated male (B to E). The data of the SPEF2-mutated subject A028-II-1 are exemplified here. Scale bars: 5 μm. Supplementary figure 4 CFAP69 immunostaining in the spermatozoa from MMAF subjects with the CFAP251 or DNAH1 mutations. The spermatozoa were stained with anti-CFAP69 (green) and anti-α-tubulin (red) antibodies. DNA was counterstained with DAPI as a nuclei marker. In the spermatozoa from a CFAP251-mutated subject and a DNAH1-mutated subject, CFAP69 staining was still obvious in the abnormal sperm flagella. Scale bars: 5 μm. Supplementary figure 5 Chest X-ray image of the SPEF2-mutated subject A028-II-1. The subject with situs solitus has normal organ placement of left cardiac apex, left gastric vesicle and right liver. And the bilateral pulmonary veins were clear and no significant lesion was observed in the lung. Supplementary figure 6 The expression of six protein-coding transcripts (T201 to T216) of SPEF2 in human control tissues. RNAs prepared from brain, lung, and sperm samples were analyzed using RT-PCR assays. After 35 cycles of amplification using transcript-specific primers (online supplementary table 1), PCR products of four protein-coding transcripts (T201, T202, T203 and T212) were clearly detected in the brain, lung and sperm samples. M: marker. Supplementary figure 7 The IFT20 binding domain of SPEF2 encoded by the long transcripts T202, T203 and T216. The sequence corresponding to the IFT20 binding domain was indicated by a red underline according to a previous report.1 The conservativeness analysis was also conducted using the ClustalX2 tool. Conserved residues are marked in black (100% conservativeness), dark gray (80% conservativeness), and light gray (60% conservativeness). No shading denotes residues with less than 60% conservativeness. Supplementary figure 8 The expressions of SPEF2 transcripts T201/T202/T203 and T212 in spermatozoa of the SPEF2-mutated subject A028-II-1. The primers for transcripts T201/T202/T203 are applicable to both the intact transcripts in controls and the truncated transcripts affected by the SPEF2 variant c.910C>T (p.Arg304*). Compared to the control sample of a healthy man, the expression level of transcripts T201/T202/T203 is strongly reduced in the spermatozoa from subject A028-II-1. SPEF2 transcript T212 was not affected by the variant c.910C>T (p.Arg304*) and was normally expressed in the spermatozoa from subject A028-II-1. M: marker. Supplementary table 1 Primers for the expression analysis of SPEF2 transcripts by RT-PCR. SPEF2 transcript Primer sequences (5' to 3') Product length T201/T202/T203/ Forward: TCTCGCTTGGAGCCAACACT 284 bp T211/T216-Spec * Reverse: CTGTATGTAATCCGCATCAG Forward: AGACACTACCTGCTAACCC T201 341 bp Reverse: TACCCAGACAATTACTATGCT Forward: GAGAAAAGGGAACAGAAGG T202 413 bp Reverse: TGGAAGATTTATTGCAGAA Forward: TCACATAACCACCAAGCAG T203 183 bp Reverse: ACAGGAGTCAAACAGGGAG Forward: AGGCTTCTTGGACAACTGG T211 426 bp Reverse: GTTGCCCAAAGTCTGAATG Forward: TTTTCAAGAGCAATACTTAAAC T212 113 bp Reverse: CGAGTGCTTTCAAAGTACG Forward: CACTCAGCAGGCAGAGGCA T216 402 bp Reverse: ACTTCCAATCACGGTAGCC * Primers used to detect SPEF2 transcripts of T201/T202/T203/T211/T216. Supplementary table 2 Average semen parameters in the patients mutated in SPEF2 and DNAH1 in the study. MMAF with MMAF with Overall Subject SPEF2 mutations DNAH1 mutations M MAF (n=3) (n=16) (n=50) Semen Parameters Semen volume (mL) 3.4±0.6 2.8±1.2 3.2±1.5 Sperm concentration (106/mL) 13.6±6.6* 28.5±30.9 31.9±34.0 Motility (%) 0.2±0.3* 2.4±4.1 2.9±5.6 Progressive motility (%) 0±0* 1.6±3.9 0.8±2.4 Sperm Morphology Absent flagella (%) 19.7±7.6 15.7±12.4 17.7±11.4 Short flagella (%) 36.0±11.5 45.2±10.7 43.6±16.7 Coiled flagella (%) 13.7±9.1* 23.9±11.5 25.3±16.6 Angulation (%) 2.5±2.3 3.9±3.6 3.2±3.0 Irregular caliber (%) 2.0±2.6 2.9±3.9 2.7±3.5 Normal flagella (%) 26.2±11.3* 8.4±9.6 7.5±9.2 Values are mean ± SD; n = total number of patients in each group. *Significant P < 0.05 (Student’s t-test) for the comparisons between the SPEF2 and DNAH1 groups. ONLINE SUPPLEMENTARY METHODS Variant annotation The ANNOVAR software was used for functional annotation with the information of the OMIM, Gene Ontology, KEGG Pathway, SIFT, PolyPhen-2, MutationTaster, 1000 Genomes Project (1KGP), Exome Aggregation Consortium (ExAC), and gnomAD.2,3,4,5,6,7,8 MMAF has been assumed to follow an autosomal recessive inheritance according to previous pedigree analyses.9 10 Therefore, we mainly focused on homozygous or compound heterozygous rare variants identified by WES. Considering the fact that MMAF leads to male infertility, we filtered out DNA polymorphisms with allele frequencies of > 1% in the human populations archived in the databases of 1KGP, ExAC, and gnomAD. Nonsense, frameshift, and essential splice-site variants were preferred. Missense variants predicted to be potentially deleterious simultaneously by the bioinformatic tools of SIFT, PolyPhen-2 and MutationTaster were also kept for further evaluation.5,6,7 References 1 Sironen A, Hansen J, Thomsen B, Andersson M, Vilkki J, Toppari J, Kotaja N. Expression of SPEF2 during mouse spermatogenesis and identification of IFT20 as an interacting protein. Biol Reprod 2010;82:580-90. 2 Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 2010;38:e164. 3 Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000;25:25-9. 4 Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K. KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res 2017;45:D353-D61. 5 Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 2009;4:1073-81. 6 Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. A method and server for predicting damaging missense mutations. Nat Methods 2010;7:248-9. 7 Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods 2014;11:361-2. 8 Lek M, Karczewski KJ, Minikel EV, Samocha KE, Banks E, Fennell T, O'Donnell-Luria AH, Ware JS, Hill AJ, Cummings BB, Tukiainen T, Birnbaum DP, Kosmicki JA, Duncan LE, Estrada K, Zhao F, Zou J, Pierce-Hoffman E, Berghout J, Cooper DN, Deflaux N, DePristo M, Do R, Flannick J, Fromer M, Gauthier L, Goldstein J, Gupta N, Howrigan D, Kiezun A, Kurki MI, Moonshine AL, Natarajan P, Orozco L, Peloso GM, Poplin R, Rivas MA, Ruano-Rubio V, Rose SA, Ruderfer DM, Shakir K, Stenson PD, Stevens C, Thomas BP, Tiao G, Tusie-Luna MT, Weisburd B, Won HH, Yu D, Altshuler DM, Ardissino D, Boehnke M, Danesh J, Donnelly S, Elosua R, Florez JC, Gabriel SB, Getz G, Glatt SJ, Hultman CM, Kathiresan S, Laakso M, McCarroll S, McCarthy MI, McGovern D, McPherson R, Neale BM, Palotie A, Purcell SM, Saleheen D, Scharf JM, Sklar P, Sullivan PF, Tuomilehto J, Tsuang MT, Watkins HC, Wilson JG, Daly MJ, MacArthur DG, Exome Aggregation C. Analysis of protein-coding genetic variation in 60,706 humans. Nature 2016;536:285-91. 9 Yang SM, Li HB, Wang JX, Shi YC, Cheng HB, Wang W, Li H, Hou JQ, Wen DG. Morphological characteristics and initial genetic study of multiple morphological anomalies of the flagella in China. Asian J Androl 2015;17:513-5. 10 Coutton C, Escoffier J, Martinez G, Arnoult C, Ray PF. Teratozoospermia: spotlight on the main genetic actors in the human. Hum Reprod Update 2015;21:455-85. .
Load more

Recommended publications
  • Detection of a 4 Bp Mutation in the 3'UTR Region of Goat Sox9 Gene
    animals Article 0 Detection of a 4 bp Mutation in the 3 UTR Region of Goat Sox9 Gene and Its Effect on the Growth Traits Libang He 1,2, Yi Bi 1,2, Ruolan Wang 1,2, Chuanying Pan 1,2, Hong Chen 1,2, Xianyong Lan 1,2,* and Lei Qu 3,4,* 1 College of Animal Science and Technology, Northwest A&F University, Yangling 712100, Shaanxi, China; [email protected] 2 Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling 712100, Shaanxi, China 3 Shaanxi Provincial Engineering and Technology Research Center of Cashmere Goats, Yulin University, Yulin 719000, Shaanxi, China 4 Life Science Research Center, Yulin University, Yulin 719000, Shaanxi, China * Correspondence: [email protected] (X.L.); [email protected] (L.Q.); Tel.: +86-137-7207-1502 (X.L.); +86-189-9226-2688 (L.Q.) Received: 4 March 2020; Accepted: 8 April 2020; Published: 13 April 2020 Simple Summary: The sex determining region Y (SRY)-type high mobility group (HMG) box 9 (Sox9) gene is critically important in the formation and development of cartilage and is considered the “main regulator” of chondrogenesis. Additionally, a large number of studies have shown that mutations in a single allele of human Sox9 can lead to campomelic dysplasia syndrome. Therefore, the mutations of Sox9 have been the subject of increasing interest among researchers. However, no studies to date have examined the association between Sox9 gene variants and growth traits in goats. Here, we detected a 4 bp indel in the 30Untranslated Regions (30UTR) region of Sox9 in Shaanbei white cashmere (SBWC) goats (n = 1109) and studied the association between this indel and growth traits.
    [Show full text]
  • Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach
    Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds.
    [Show full text]
  • Cilia-Related Protein SPEF2 Regulates Osteoblast Differentiation
    www.nature.com/scientificreports OPEN Cilia-related protein SPEF2 regulates osteoblast diferentiation Mari S. Lehti1,2, Henna Henriksson2, Petri Rummukainen 2, Fan Wang2, Liina Uusitalo- Kylmälä2, Riku Kiviranta2,3, Terhi J. Heino2, Noora Kotaja2 & Anu Sironen1 Received: 5 May 2017 Sperm fagellar protein 2 (SPEF2) is essential for motile cilia, and lack of SPEF2 function causes male Accepted: 22 December 2017 infertility and primary ciliary dyskinesia. Cilia are pointing out from the cell surface and are involved Published: xx xx xxxx in signal transduction from extracellular matrix, fuid fow and motility. It has been shown that cilia and cilia-related genes play essential role in commitment and diferentiation of chondrocytes and osteoblasts during bone formation. Here we show that SPEF2 is expressed in bone and cartilage. The analysis of a Spef2 knockout (KO) mouse model revealed hydrocephalus, growth retardation and death prior to fve weeks of age. To further elucidate the causes of growth retardation we analyzed the bone structure and possible efects of SPEF2 depletion on bone formation. In Spef2 KO mice, long bones (tibia and femur) were shorter compared to wild type, and X-ray analysis revealed reduced bone mineral content. Furthermore, we showed that the in vitro diferentiation of osteoblasts isolated from Spef2 KO animals was compromised. In conclusion, this study reveals a novel function for SPEF2 in bone formation through regulation of osteoblast diferentiation and bone growth. Skeletogenesis occurs through endochondral and intramembranous ossifcation. During intramembranous ossifcation, mesenchymal stem cells (MSC) directly diferentiate into osteoblasts. In endochondral ossifcation, MSCs frst diferentiate to chondrocytes forming the cartilage, which is subsequently replaced by bone.
    [Show full text]
  • Supplementary Information – Postema Et Al., the Genetics of Situs Inversus Totalis Without Primary Ciliary Dyskinesia
    1 Supplementary information – Postema et al., The genetics of situs inversus totalis without primary ciliary dyskinesia Table of Contents: Supplementary Methods 2 Supplementary Results 5 Supplementary References 6 Supplementary Tables and Figures Table S1. Subject characteristics 9 Table S2. Inbreeding coefficients per subject 10 Figure S1. Multidimensional scaling to capture overall genomic diversity 11 among the 30 study samples Table S3. Significantly enriched gene-sets under a recessive mutation model 12 Table S4. Broader list of candidate genes, and the sources that led to their 13 inclusion Table S5. Potential recessive and X-linked mutations in the unsolved cases 15 Table S6. Potential mutations in the unsolved cases, dominant model 22 2 1.0 Supplementary Methods 1.1 Participants Fifteen people with radiologically documented SIT, including nine without PCD and six with Kartagener syndrome, and 15 healthy controls matched for age, sex, education and handedness, were recruited from Ghent University Hospital and Middelheim Hospital Antwerp. Details about the recruitment and selection procedure have been described elsewhere (1). Briefly, among the 15 people with radiologically documented SIT, those who had symptoms reminiscent of PCD, or who were formally diagnosed with PCD according to their medical record, were categorized as having Kartagener syndrome. Those who had no reported symptoms or formal diagnosis of PCD were assigned to the non-PCD SIT group. Handedness was assessed using the Edinburgh Handedness Inventory (EHI) (2). Tables 1 and S1 give overviews of the participants and their characteristics. Note that one non-PCD SIT subject reported being forced to switch from left- to right-handedness in childhood, in which case five out of nine of the non-PCD SIT cases are naturally left-handed (Table 1, Table S1).
    [Show full text]
  • SPEF2 Functions in Microtubule-Mediated Transport in Elongating Spermatids to Ensure Proper Male Germ Cell Differentiation Mari S
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 2683-2693 doi:10.1242/dev.152108 RESEARCH ARTICLE SPEF2 functions in microtubule-mediated transport in elongating spermatids to ensure proper male germ cell differentiation Mari S. Lehti1,2,*, Fu-Ping Zhang2,3,*, Noora Kotaja2,* and Anu Sironen1,‡,§ ABSTRACT 2006, 2002). Mutations in the Spef2 gene (an amino acid substitution Sperm differentiation requires specific protein transport for correct within exon 3 and a nonsense mutation within exon 28) in the big giant sperm tail formation and head shaping. A transient microtubular head (bgh) mouse model caused a primary ciliary dyskinesia (PCD)- structure, the manchette, appears around the differentiating like phenotype, including hydrocephalus, sinusitis and male infertility spermatid head and serves as a platform for protein transport to the (Sironen et al., 2011). Detailed analysis of spermatogenesis in both pig growing tail. Sperm flagellar 2 (SPEF2) is known to be essential for and mouse models revealed axonemal abnormalities, including defects sperm tail development. In this study we investigated the function of in central pair (CP) structure and the complete disorganization of the SPEF2 during spermatogenesis using a male germ cell-specific sperm tail (Sironen et al., 2011). A role of SPEF2 in protein transport Spef2 knockout mouse model. In addition to defects in sperm tail has been postulated owing to its known interaction and colocalization development, we observed a duplication of the basal body and failure with intraflagellar transport 20 (IFT20). During spermatogenesis, in manchette migration resulting in an abnormal head shape. We IFT20 and SPEF2 colocalize in the Golgi complex of late identified cytoplasmic dynein 1 and GOLGA3 as novel interaction spermatocytes and round spermatids and in the manchette and basal partners for SPEF2.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Altered Gene Expression in Circulating Immune Cells Following a 24-Hour Passive Dehydration
    University of Connecticut OpenCommons@UConn Master's Theses University of Connecticut Graduate School 5-10-2020 Altered Gene Expression in Circulating Immune Cells Following a 24-Hour Passive Dehydration Aidan Fiol [email protected] Follow this and additional works at: https://opencommons.uconn.edu/gs_theses Recommended Citation Fiol, Aidan, "Altered Gene Expression in Circulating Immune Cells Following a 24-Hour Passive Dehydration" (2020). Master's Theses. 1480. https://opencommons.uconn.edu/gs_theses/1480 This work is brought to you for free and open access by the University of Connecticut Graduate School at OpenCommons@UConn. It has been accepted for inclusion in Master's Theses by an authorized administrator of OpenCommons@UConn. For more information, please contact [email protected]. Altered Gene Expression in Circulating Immune Cells Following a 24- Hour Passive Dehydration Aidan Fiol B.S., University of Connecticut, 2018 A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science At the University of Connecticut 2020 i copyright by Aidan Fiol 2020 ii APPROVAL PAGE Master of Science Thesis Altered Gene Expression in Circulating Immune Cells Following a 24- Hour Passive Dehydration Presented by Aidan Fiol, B.S. Major Advisor__________________________________________________________________ Elaine Choung-Hee Lee, Ph.D. Associate Advisor_______________________________________________________________ Douglas J. Casa, Ph.D. Associate Advisor_______________________________________________________________ Robert A. Huggins, Ph.D. University of Connecticut 2020 iii ACKNOWLEDGEMENTS I’d like to thank my committee members. Dr. Lee, you have been an amazing advisor, mentor and friend to me these past few years. Your advice, whether it was how to be a better writer or scientist, or just general life advice given on our way to get coffee, has helped me grow as a researcher and as a person.
    [Show full text]
  • Investigating the Effect of Chronic Activation of AMP-Activated Protein
    Investigating the effect of chronic activation of AMP-activated protein kinase in vivo Alice Pollard CASE Studentship Award A thesis submitted to Imperial College London for the degree of Doctor of Philosophy September 2017 Cellular Stress Group Medical Research Council London Institute of Medical Sciences Imperial College London 1 Declaration I declare that the work presented in this thesis is my own, and that where information has been derived from the published or unpublished work of others it has been acknowledged in the text and in the list of references. This work has not been submitted to any other university or institute of tertiary education in any form. Alice Pollard The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives license. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the license terms of this work. 2 Abstract The prevalence of obesity and associated diseases has increased significantly in the last decade, and is now a major public health concern. It is a significant risk factor for many diseases, including cardiovascular disease (CVD) and type 2 diabetes. Characterised by excess lipid accumulation in the white adipose tissue, which drives many associated pathologies, obesity is caused by chronic, whole-organism energy imbalance; when caloric intake exceeds energy expenditure. Whilst lifestyle changes remain the most effective treatment for obesity and the associated metabolic syndrome, incidence continues to rise, particularly amongst children, placing significant strain on healthcare systems, as well as financial burden.
    [Show full text]
  • Reproductionresearch
    REPRODUCTIONRESEARCH Alternative splicing, promoter methylation, and functional SNPs of sperm flagella 2 gene in testis and mature spermatozoa of Holstein bulls F Guo1,2, B Yang1,3,ZHJu1, X G Wang1,CQi1, Y Zhang1,CFWang1, H D Liu1, M Y Feng1, Y Chen3,YXXu2, J F Zhong1 and J M Huang1 1Dairy Cattle Research Center, Shandong Academy of Agricultural Sciences, No. 159 North of Industry Road, Jinan, Shandong 250131, People’s Republic of China, 2College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, People’s Republic of China and 3College of Animal Science, Xinjiang Agricultural University, Urumqi 830052, People’s Republic of China Correspondence should be addressed to J M Huang; Email: [email protected] or Y X Xu; Email: [email protected] or to J F Zhong; Email: [email protected] Abstract The sperm flagella 2 (SPEF2) gene is essential for development of normal sperm tail and male fertility. In this study, we characterized first the splice variants, promoter and its methylation, and functional single-nucleotide polymorphisms (SNPs) of the SPEF2 gene in newborn and adult Holstein bulls. Four splice variants were identified in the testes, epididymis, sperm, heart, spleen, lungs, kidneys, and liver tissues through RT-PCR, clone sequencing, and western blot analysis. Immunohistochemistry revealed that the SPEF2 was specifically expressed in the primary spermatocytes, elongated spermatids, and round spermatids in the testes and epididymis. SPEF2-SV1 was differentially expressed in the sperms of high-performance and low-performance adult bulls; SPEF2-SV2 presents the highest expression in testis and epididymis; SPEF2-SV3 was only detected in testis and epididymis.
    [Show full text]
  • The Role of SPEF2 in Spermatogenesis Suvi Virtanen
    The role of SPEF2 in spermatogenesis Suvi Virtanen Pro gradu –tutkielma Turun yliopisto Biologian laitos 24.9.2016 Linja: fysiologian ja genetiikan linja Erikoistumislinja: fysiologia Laajuus: 40 op Tarkastaja: 1: 2: Hyväksytty (pvm): Arvolause: Turun yliopiston laatujärjestelmän mukaisesti tämän julkaisun alkuperäisyys on tarkastettu Turnitin OriginalityCheck-järjestelmällä University of Turku Department of Biology Faculty of Natural Sciences VIRTANEN, SUVI: The role of SPEF2 in spermatogenesis Master’s thesis 51 p. Physiology May 2016 Correct sperm head shaping and tail assembly are important for male fertility. A deleterious mutation in Sperm flagellar protein 2 (Spef2) gene (also known as Kpl2) has been implicated to disrupt the sperm tail formation in Finnish Yorkshire pigs and big giant head (bgh) mice. SPEF2 has been postulated to have a role in intraflagellar transport (IFT) and has been shown to interact with IFT20, an IFT complex B protein. In this study, a novel conditional male germ cell specific knock-out mouse model (Spef2 cKO) was used to study the role of SPEF2 in spermatogenesis. The aim of the study was to characterize the phenotype of the Spef2 cKO mouse model and test the functionality of novel anti-SPEF2 antibodies. The phenotyping was carried out with histological and immunofluorescent stainings. Novel anti-SPEF2 antibodies were evaluated with immunofluorescence and western blot methods. In addition to defective tail formation, the loss of functional SPEF2 seems to cause defective manchette clearance resulting in club-shaped sperm heads. Therefore, SPEF2 may participate in intramanchette transport (IMT). In addition, Spef2 cKO mice were shown to express multiple gamma-tubulin-positive signals from the basal bodies indicating a possible basal body -defect.
    [Show full text]
  • Strain-Specific Differences in Brain Gene Expression in a Hydrocephalic
    www.nature.com/scientificreports OPEN Strain-specifc diferences in brain gene expression in a hydrocephalic mouse model with motile cilia Received: 18 June 2018 Accepted: 22 August 2018 dysfunction Published: xx xx xxxx Casey W. McKenzie1, Claudia C. Preston2, Rozzy Finn1, Kathleen M. Eyster3, Randolph S. Faustino2,4 & Lance Lee1,4 Congenital hydrocephalus results from cerebrospinal fuid accumulation in the ventricles of the brain and causes severe neurological damage, but the underlying causes are not well understood. It is associated with several syndromes, including primary ciliary dyskinesia (PCD), which is caused by dysfunction of motile cilia. We previously demonstrated that mouse models of PCD lacking ciliary proteins CFAP221, CFAP54 and SPEF2 all have hydrocephalus with a strain-dependent severity. While morphological defects are more severe on the C57BL/6J (B6) background than 129S6/SvEvTac (129), cerebrospinal fuid fow is perturbed on both backgrounds, suggesting that abnormal cilia-driven fow is not the only factor underlying the hydrocephalus phenotype. Here, we performed a microarray analysis on brains from wild type and nm1054 mice lacking CFAP221 on the B6 and 129 backgrounds. Expression diferences were observed for a number of genes that cluster into distinct groups based on expression pattern and biological function, many of them implicated in cellular and biochemical processes essential for proper brain development. These include genes known to be functionally relevant to congenital hydrocephalus, as well as formation and function of both motile and sensory cilia. Identifcation of these genes provides important clues to mechanisms underlying congenital hydrocephalus severity. Hydrocephalus is a complex disorder with both genetic and environmental causes1.
    [Show full text]
  • Supplementary Table 1 Double Treatment Vs Single Treatment
    Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19
    [Show full text]