Supporting Information
Total Page：16
File Type：pdf, Size：1020Kb
Supporting Information SI materials and Methods Generation of Sirpα-/- mice: A neomycin resistant cassette was inserted into the Sirpα gene and replaced exons 2-4 and their flanking regions. The embryonic stem (ES) clones containing the mutated structure were selected and were microinjected into mouse blastocysts. Chimeric mice were produced and were confirmed to contain the mutant allele by genotyping. After extensively backcrossing with WT C57BL/6J mice (> ten generations), heterozygotes containing the mutant allele in C57BL/6J background were obtained and were further bred to obtain homozygous. PCR genotyping was performed using Sirpα gene-specific primers (Forward-1: 5’-ctgaaggtgactcagcctgagaaa and Reverse-1: 5’- actgatacggatggaaaagtccat; and neomycin cassette-specific primers (NeoF 5’-tgtgctcgacgttgtcactg and NeoR 5’-cgataccgtaaagcacgaggaagc). Western Blot (WB) analyses were performed to confirm depletion of Sirpα expression in bone marrow leukocytes, peripheral granulocytes and monocytes, peritoneal and spleen macrophages using mAb P84 and a polyclonal antibody against the Sirpα cytoplasmic tail (1). Antibodies and reagents: Rabbit mAbs against murine phospho-Syk (C87C1), Syk (D3Z1E) calreticulin (D3E6) and myosin IIA (3403) were purchased from Cell Signaling Technology (Danvers, MA). Rabbit anti–murine SHP-1 Ab (C19), goat anti-murine Scavenger receptor-A (SR-A) (E20) were purchased from Santa Cruz Biotechnology (Dallas, TX). Rabbit mAbs against murine calreticulin (EPR2907) and LDL receptor related protein 1 (LRP1) (EPR3724) were purchased from Abcam (Cambridge, MA). Rat mAbs against murine Cd47 (miap301) and Sirpα (P84) were purchased from BD Biosciences (San Jose, CA). LEAF-purified anti-mouse Cd16/32, anti-mouse Cd11b and anti-mouse IL- 17 were purchased from Biolegend (San Diego, CA). The antibody against β-actin was purchased from Sigma (St. Louis, MO). Mouse mAb against phosphotyrosine (4G10) were purchased from EMD Millipore (Billerica, MA). Fluor-conjugated antibodies against murine Cd4, Cd8, Cd11c, Cd11b, F4/80, Ly6G, Ly6C, NK1.1, Cd3, Cd209b, Cd169 and B220, and secondary antibodies were purchased from Biolegend or eBioscience (San Diego, CA). Recombinant murine IL-17, IL-6, TNFα, IL-1β, IL-10 and IFN-γ were purchased from Peprotech (Rocky Hill, NJ). LPS (from E. coli 026:B6), PMA, Scavenger receptor B, type I (SR-BI) inhibitor BLT1 and Dectin inhibitor laminarin were purchased from Sigma. Receptor associated protein (RAP, LRP1 inhibitor) were purchased from Fitzgerald Industries International (Acton, MA). PP1, PP2, SB203580, PD98059, LY294002, LFM-A13, LFM-A11, JAK inhibitor I, JAK3 inhibitor I, Piceatannol, R406, and U73122 were purchased from Millipore. Ex vivo macrophage phagocytosis: For testing phagocytosis towards murine RBC and other types of cells, cells were labeled with CFSE and then incubated with macrophages in 24-well plates for 30 min at 37°C. After washing and labeling macrophages with PE or APC-conjugated anti-F4/80 antibody, phagocytosis of targets by F4/80 positive macrophages was then analyzed by fluorescence microscopy and/or FACS. In other experiments, splenic macrophages were labeled with antibodies against F4/80, Cd11b, Cd169 and Cd209b to determine the subtypes of macrophages. To test phagocytosis of apoptotic cells, CFSE labeled, apoptotic B16 cells (induced by UV irradiation, as described previously (2)) and healthy B16 cells were incubated with macrophages at a ratio of 1:1-2 for 30 min at 37°C, followed by washing and FACS analysis of phagocytosis. To test Fc and complement mediated phagocytosis, freshly isolated human RBC (hRBC) were labeled with mouse anti-human CD47 antibody (clone PF3.1) or 20% mouse serum at room temperature for 30 min followed by incubating with macrophage at a ratio of 1:5-10 for 30 min at 37°C. Cells were then washed and erythrophagocytosis was analyzed by microscopy. To test phagocytosis towards bacteria or zymosan, AlexaFluor-conjugated E.coli (2 µg) or zymosan particles (2 µg) (both from Invitrogen) were incubated with macrophages for 30 min at 37°C, followed by washing and FACS analysis of phagocytosis. Phagocytic indexes are expressed as the numbers of macrophages containing at least one ingested target in a hundred macrophages analyzed. To analyze possible signaling pathways involved in LPS and inflammatory cytokine induced activation of macrophage erythrophagocytosis, macrophages were pretreated with various inhibitors for 15 min and then stimulated with LPS, IL-17A, IL-6 or TNFα for 6-18 h in the presence of inhibitors. Macrophages were then washed with PBS three times and incubate in RPMI1640 with 10% FBS for 2h to minimize the effect of remaining inhibitors in the following erythrophagocytosis assay. The inhibitors used include PP1 and PP2 (20 µM each), SB203580 and PD98059 (20 µM each), LY294002 (20 µM), LFM-A13 and its negative analog LFM-A11 (100 µM each), JAK inhibitor I (1 µM) and JAK3 inhibitor I (5 mM), Piceatannol (50-200 µM), R406 (200 -800 nM) and U73122 (10 μM). To determine potential phagocytic receptor of RBC, LPS or inflammatory cytokines activated macrophages were pretreated with LEAF-purified anti-mouse Cd16/32 (10 µg/ml,), LEAF-purified anti- mouse Cd11b (10 µg/ml), rabbit anti-mouse CRT (10 µg/ml), rabbit anti-mouse LRP1 (20 µg/ml), goat anti-mouse SR-A (10 µg/ml), LRP1 inhibitor RAP (20 µg/ml), SR-BI inhibitor BLT1 (5 µM), Dectin inhibitor laminarin (100 µg/ml) and complement inhibitor heparin (40U/ml), for 15 mins followed by phagocytosis assay in the presence of antibodies or inhibitors. Prior to use in the assay, antibodies and RAP were dialyzed using a membrane with a pore size < 10kD to remove preservative sodium azide. Hemoglobin assay: To assay blood hemoglobin, 10 μl whole blood collected from the tail vein was lysed in 1 ml water followed by reading OD values at 540 nm. To assay spleen hemoglobin, splenocytes were obtained and RBC were lysed in 3 ml RBC lysis buffer. After centrifugation (13,000 rpm, 10 min), the hemoglobin-containing supernatants were collected and measured for OD values at 540 nm. Video microscopy: Isolated PEM or M-CSF-induced BMDM, with or without treatments, were placed in a 35 mm dish on a 37°C temperature control microscope station. Lifetime microscopy videos were captured using a Nikon camera with NIS-Elements software that mages at 1 second intervals over a 45 min period. To video macrophage phagocytosis of RBC, Cd47- or Cd47+ RBC were added into the dish followed by image capturing. Immunoprecipitation and Western blot analysis: Cells were lysed by an ice-cold lysis buffer containing 25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% TritonX-100, 0.5% sodium deoxycholate, a cocktail of protease inhibitors (Sigma) and 1 mM PMSF, followed by centrifugation at 14,000 rpm (15 min). Clear cell lysates were mixed with SDS-PAGE sample buffer followed by heating (5 min) and separation by SDS-PAGE under non-reducing condition. After transfer of proteins onto nitrocellulose, the membrane was blocked with 5% nonfat milk and incubated with different primary antibodies overnight at 4°C. After washing, the proteins were detected by horseradish peroxidase (HRP)-conjugated secondary antibodies and ECL. To detect protein phosphorylation, macrophages were treated with freshly prepared pervanadate (2 mM, 3 min, 37°C) prior to cell lysis. For immunoprecipitation of Sirpα, LRP1 and myosin IIA, murine macrophage lysates were incubated with 1–2 μg primary antibody and protein A–conjugated Sepharose for 4 h (4°C). The beads were washed three times followed by heating in 1× SDS-PAGE sample buffer to release proteins. Cytokine assays: Levels of cytokines in serum or cell culture medium were assayed by standard sandwich ELISA using capturing and biotin-conjugated detecting anti-cytokine antibodies as previously described (3). Purified recombinant murine cytokines (PeproTech) at various concentrations were used as the assay standards. To analyze spleen cytokines level, splenocytes from WT, Sirpα-/- and Cd47-/- mice were cultured in 24 well plate at density of 5x106/ml in RPMI 1640 plus 10% FBS at 37°C. After 24 h, cell culture medium was collected and cytokine level were obtained by ELISA. 1. Zen K, et al. (2013) Inflammation-induced proteolytic processing of the SIRPalpha cytoplasmic ITIM in neutrophils propagates a proinflammatory state. Nat Commun 4:2436. 2. Lv Z, et al. (2015) Loss of Cell Surface CD47 Clustering Formation and Binding Avidity to SIRPα Facilitate Apoptotic Cell Clearance by Macrophages. The Journal of Immunology 195(2):661-671. 3. Bian Z, Guo Y, Ha B, Zen K, & Liu Y (2012) Regulation of the inflammatory response: enhancing neutrophil infiltration under chronic inflammatory conditions. J Immunol 188(2):844- 853. Figure S1. Sirpα-/- mice showed exacerbated colitis under DSS treatment. Female WT and Sirpα-/- mice were given 1-2% dextran sulfate sodium via drinking water for 15d. Compared to WT mice, Sirpα-/- mice displayed significantly lower survival rate (A), higher clinic score (on d10) (B), severe tissue damage and enhanced PMN infiltration into mucosa (on d10) (C). Data (mean ± SEM) represent three independent experiments with 6 mice per group. ***P <0.001. Figure S2. Administration of recombinant IL-17A or IL-6 to mice at different dosages. A) IL-17A or IL-6 dose- dependently induced RBC loss in Sirpα-/- mice and Cd47-/- mice but not WT mice. Mice were i.v. injected with IL-17A or IL-6 (2 x, on day1 and day3, 0.1-10 μg/kg), blood hemoglobin were analyzed on day 5. PBS was used as control. Injection of IL-17A or IL-6 at 5 and 10 μg/kg induced acute anemia in both Sirpα-/- or Cd47-/- mice while no or only mile anemia were detected when injected IL-17A or IL-6 at 0.1 and 1 μg/kg. B) Kinetic study of IL-17A or IL-6 level in WT mouse serum following injection (10μg/kg and 5μg/kg, i.v.).