Evolutionarily Stable Infection by a Male-Killing Endosymbiont in Drosophila Innubila: Molecular Evidence from the Host and Parasite Genomes

Evolutionarily Stable Infection by a Male-Killing Endosymbiont in Drosophila innubila: Molecular Evidence From the Host and Parasite Genomes

Kelly A. Dyer1 and John Jaenike Department of Biology, University of Rochester, Rochester, New York 14627 Manuscript received March 9, 2004 Accepted for publication August 4, 2004

ABSTRACT Maternally inherited microbes that spread via male-killing are common pathogens of insects, yet very little is known about the evolutionary duration of these associations. The few examples to date indicate very recent, and thus potentially transient, infections. A male-killing strain of Wolbachia has recently been discovered in natural populations of Drosophila innubila. The population-level effects of this infection are ,of females are infected, infected females produce very strongly female-biased sex ratios %35ف :significant and the resulting population-level sex ratio is significantly female biased. Using data on infection prevalence selective %5ف and Wolbachia transmission rates, infected cytoplasmic lineages are estimated to experience a advantage relative to uninfected lineages. The evolutionary history of this infection was explored by surveying patterns of polymorphism in both the host and parasite genomes, comparing the Wolbachia wsp gene and the host mtDNA COI gene to five host nuclear genes. Molecular data suggest that this male- killing infection is evolutionarily old, a conclusion supported with a simple model of parasite and mtDNA transmission dynamics. Despite a large effective population size of the host species and strong selection to evolve resistance, the D. innubila-Wolbachia association is likely at a stable equilibrium that is maintained by imperfect maternal transmission of the bacteria rather than partial resistance in the host species.

diverse array of maternally transmitted endosymbi- nally transmitted infection depends on both the fitness A onts kill infected male embryos in a wide variety of infected females and the maternal transmission effi- of insect host species (reviewed in Hurst and Jiggins ciency (Hurst et al. 1997). Empirically, the prevalence 2000). For these symbionts to spread, male death must of male-killing endosymbionts varies tremendously among enhance the fitness of their infected female siblings, for host species, ranging from 1% of Drosophila willistoni in- example, through reduced larval competition or preven- fected with Spiroplasma (Williamson and Poulson tion of inbreeding (reviewed in Hurst et al. 1997). In 1979) to 95% or higher in certain butterflies infected with doing so, however, male-killing endosymbionts impose Wolbachia (Jiggins et al. 1998; Dyson and Hurst 2004). substantial costs on the host populations. For individual If the prevalence of infection reaches substantial fre- females (and the males that mate with them), infection quencies, selection on the host species to evolve resis- can halve the number of viable offspring, due to the tance to male-killing endosymbionts must be strong. Due death of male offspring. At the population level, the non- to their small effective population sizes (Moran 1996), Fisherian sex ratio resulting from male-killing can reduce the endosymbionts may have limited capacity to counter the effective population size of the host species, which in newly evolved host resistance. Thus, one might expect turn causes reductions in genetic variation (Kimura 1983), host species, especially those with large effective popula- the effectiveness of selection against deleterious mutation sizes, to readily evolve resistance to male-killing endo- tions (Ohta 1973), and the rate of adaptive evolution symbionts, thus restricting the evolutionary sojourn times (Peck 1994; Orr and Kim 1998). Finally, if a male-killer of these endosymbionts within host species. reaches a sufficiently high frequency, it may cause host Due to strong selection for host resistance and the extinction due to a paucity of males (Hatcher et al. probable sensitivity of endosymbiont dynamics to envi- 1999). ronmental conditions, male-killing infections may be The population-level cost of harboring a male-killing evolutionarily transient within host species, en route to endosymbiont increases with the prevalence of infec- fixation or elimination. If such infections frequently go tion. In theory, the equilibrium prevalence of a mater- to fixation, thus causing host extinction, higher-level selective processes that act among host populations or species could play an important role in governing the Sequence data from this article have been deposited with the EMBL/ incidence of male-killing endosymbionts within insect GenBank Data Libraries under accession nos. AY541089–AY541237 and AY552552–AY552553. communities. In contrast, an evolutionarily long-lasting 1Corresponding author: Department of Biology, University of Roches- infection polymorphism would indicate that within-pop- ter, Rochester, NY 14627. E-mail: [email protected] ulation processes are important. Thus, the evolutionary

Genetics 168: 1443–1455 (November 2004) 1444 K. A. Dyer and J. Jaenike age distribution of male-killing infections across host or intermediate frequency is expected to reduce the species bears on the question of levels of selection in postrecovery, equilibrium level of mtDNA diversity. these host-parasite associations and is relevant to the In this study, we use molecular variation and popula- question of how rapidly hosts can evolve resistance to tion-level demographic and epidemiological variables these infections. to infer the evolutionary history of a male-killing Wol- The most direct way to infer the history of an endo- bachia that infects D. innubila. D. innubila is a mycopha- symbiont infection within a host species is to examine gous member of the quinaria species group that inhabits patterns of endosymbiont polymorphism. However, when mid- to high-elevation mountain woodlands of Arizona, mtDNA and endosymbionts are maternally co-transmit- New Mexico, and the Mexican Sierra Madre (Patter- ted, mtDNA can also be used to infer the evolutionary son and Wagner 1943; Heed et al. 1962). D. innubila history of the infection within a host species. This is an harbors a strain of Wolbachia that induces embryonic especially useful tool as some intracellular endosymbi- death of sons of infected females (Jaenike et al. 2003). onts have lower rates of molecular evolution than their We show that the population-level effects of this male- host’s mtDNA (e.g., James and Ballard 2000; Shoe- killer are demographically important: the infection is maker et al. 2003). For example, a sweep to fixation of present in about one-third of wild-caught females, which an endosymbiont causing cytoplasmic incompatibility almost always have highly female-biased offspring sex (CI) will purge the host population of mtDNA variation, ratios, and this results in a substantially female-biased but following this sweep mtDNA diversity is expected sex ratio in the population. To infer the evolutionary to recover eventually to preinfection levels. Analysis of history of the infection, we surveyed patterns of poly- mtDNA variation has been used to trace the history of morphism in both the host and the parasite genomes, CI-causing Wolbachia in several species of Diptera (e.g., comparing variation in the Wolbachia and co-transmit- Turelli et al. 1992; Guillemaud et al. 1997; Shoemaker ted host mtDNA to that in host nuclear genes. In striking et al. 1999; Behura et al. 2001), Hymenoptera (e.g., contrast to the recent infections of Adalia and Acraea, Shoemaker et al. 2000; Rokas et al. 2001), and isopods the association between male-killing Wolbachia and D. (Rigaud et al. 1999). innubila is evolutionarily much older. Our findings lead Male-killing endosymbionts will decrease the diversity to a puzzling conclusion: despite the high cost of Wol- of host mtDNA not only during their initial spread, bachia infection, the evolutionary age of the D. innubila- but also at equilibrium (Johnstone and Hurst 1996). Wolbachia association, and the large effective popula- Initially, invasion by a male-killer will increase the fre- tion size of D. innubila, these flies show little, if any, quency of its associated mtDNA haplotype and thus resistance to this male-killing endosymbiont. decrease overall mtDNA diversity. If an invasion is very recent, only a single mtDNA haplotype will occur among infected individuals, but there will be a variety of haplo- MATERIALS AND METHODS types in the uninfected class. Precisely this pattern is Wolbachia infection and male-killing in the wild: D. innubila found in the ladybird beetle Adalia bipunctata and the were collected by sweep-netting over mushrooms in August– butterflies Acraea encendona and A. encendon (von der September of 2001–2003 at 1660 m elevation in the Cave Schulenburg et al. 2002; Jiggins 2003). In the few Creek drainage of the Chiricahua Mountains in southeast studies published to date on species infected with male- Arizona. Wild-caught females were placed individually into culture vials and the number of male and female offspring killing endosymbionts, the infections appear to be very was determined. All fly cultures were maintained at 22Њ on recent on an evolutionary timescale. Instant Drosophila medium (Carolina Biological Supply, Burl- If a male-killing infection persists in a population, imper- ington, NC) supplemented with commercial mushroom (Aga- fect maternal transmission of the endosymbiont will en- ricus bisporus). Females producing at least 10 offspring were able mtDNA haplotypes associated with infected females to used to determine the correlation between Wolbachia infection and offspring sex ratio. emerge into the uninfected class of females. Consequently, DNA was extracted from each wild-caught fly using Gentra’s both the infected and uninfected classes will eventually carry Puregene kit (Gentra Systems, Minneapolis, MN). Our initial haplotypes descended from the initially infected female. assay for Wolbachia infection indicated the presence of a sec- Because uninfected females produce fewer female descen- ond strain of Wolbachia belonging to the B group of Wol- dants than do infected females—the key requirement for bachia (as defined by Werren et al. 1995), whereas the male- killing strain is in the A group. To distinguish the two strains, the spread and persistence of an endosymbiotic male- the wild-caught flies were assayed for Wolbachia infection by killer—new mitochondrial mutations occurring in unin- simultaneously amplifying the wsp gene [using the primers fected females are evolutionary dead ends. Eventually wsp81F and wsp691R (Zhou et al. 1998), which amplify any all mitochondria within a population are expected to strain of Wolbachia] and the ftsZ gene [using ftsZBr and ftsZBf be descended from the infected class of females, making (Werren et al. 1995), which are specific to the B group]. Flies for which both genes amplified were inferred to be infected the effective population size of the mtDNA proportional with the B strain, whereas those that were positive for only to the infection prevalence among females (Johnstone wsp were infected with the A strain. All flies infected with the and Hurst 1996). Thus, a male-killing infection at low B strain were tested for simultaneous infection by the A strain Male-Killing Endosymbionts 1445

TABLE 1 Sequences of the primers used to amplify Drosophila loci

Gene Primera Useb Sourcec Sequence (5Ј to 3Ј) COI TY-J-1460 Both Simon et al. (1994) TACAATCTATCGCCTAAACTTCAGCC TL2-N-3014 Both Simon et al. (1994) TCCATTGCACTAATCTGCCATATTA C1-J-2195 Seq Simon et al. (1994) TTGATTTTTTGGTCACCCTGAAGT C1-N-2332 (Di) Seq This study ATAAACCAATTGCTAGTATTG C1-N-2329 (Df) Seq Simon et al. (1994) ACTGTAAATATATGATGAGCTCA Adhr Adhr-D1 Both Betran and Ashburner (2000) ATGGTNCARATGGAYTAYAT Adhr-D4 Both Betran and Ashburner (2000) RTCNGCCATRTGCCARTA cp36 cp36-F Both This study TGCAACTYGGTCTCTGGTTTG cp36-R Both This study TGAGGCTGGCTGTAGACG per per-F1 (Di) Both This study CCAGGAAGAAGAAGGCCAAATG per-F2 (Df) Both Shoemaker et al. (2004) ACAAGGAGAAGTCCAGGAAGAAG per-R1 (Di) Both Shoemaker et al. (2004) GAACGTCAACCCCAGGCGGAAGG per-R2 (Df) Both This study GCGGAAGGGTTCATAGTTGAC tpi tpi-F Both Shoemaker et al. (2004) CAACTGGAAGATGAAYGGIGACC tpi-R Both Shoemaker et al. (2004) TTCTTGGCATAGGCGCACATYTG v verm-F Amp This study TAYGGMGARTAYCTSATGCTGGAC verm-R Amp This study CGRAAGTCCATRAARTCVARMGG verm-intF Seq This study TTTGAATTCGACTCCATACG verm-intR Seq This study GRTAGAAGACTTTCTRTCTACAAGATC a Primer was used for amplification (Amp), sequencing (Seq), or both. b Primers were used for both D. innubila (Di) and D. falleni (Df) unless otherwise indicated. c Primers we developed for nuclear genes are based on alignments of coding sequence from D. melanogaster, D. pseudoobscura, and D. virilis. by amplifying ftsZ with A group-specific primers (ftsZAf and the entire COI are described in Table 1. As an outgroup and ftsZAr; Werren et al. 1995). for comparative purposes, we sequenced COI from 15 wild- Maternal transmission rate and offspring sex ratio: To mea- caught D. falleni collected near Rochester, NY. D. falleni is the sure the efficiency of maternal transmission of Wolbachia, we closest known relative of D. innubila (Perlman et al. 2003) randomly chose 50 wild-caught females infected with strain A and is not infected with Wolbachia. We consider two data sets Wolbachia and assayed their female offspring individually for (I and II) for the D. innubila COI data. Data set I includes a Wolbachia infection. We simultaneously amplified Wolbachia random sample of 30 individuals from the Chiricahuas and wsp and the host autosomal tpi gene (see Table 1), which is used to infer population genetic parameters. Data set II served as a control for PCR failure and DNA quality. To ex- includes all of the flies in data set I plus additional individuals plore the relationship between Wolbachia transmission rate and comprises 30 females and 32 males that are uninfected, and offspring sex ratio, we assayed infection in the offspring 30 females and 8 males infected with the A group (male- of the few A-strain-infected wild-caught females that produced killing) Wolbachia, and 8 females and 6 males infected with weakly female-biased offspring sex ratios. Because this latter the B group Wolbachia. Data set II was used to infer the set of wild-caught females was not randomly sampled, they association of mtDNA haplotypes and infection status. were not included in the estimate of the overall maternal To visualize relationships and relative abundances of mtDNA transmission rate. haplotypes within D. innubila, a median-joining network was Sequence diversity in Wolbachia and D. innubila: We sequenced created in Arlequin v2.000 (Schneider et al. 2000), with one wsp from 20 randomly chosen females infected with the A D. falleni individual used to root the network. We used several strain, all males infected with the A strain, and all flies infected tests of population structure (described in Wright 1951; Nei with the B strain, using the primers 81F and 691R (Zhou et 1987; Hudson et al. 1992a) to detect differentiation between al. 1998). Because wsp is the most rapidly evolving gene known the mtDNA of infected and uninfected individuals. in Wolbachia (Zhou et al. 1998), it is likely to be the most To distinguish effects specific to mtDNA from demographic sensitive indicator of an infection’s recent evolutionary history. factors affecting the entire host genome, we sequenced five For this and all sequencing we purified amplicons with QIA- nuclear gene regions from a random sample of wild-caught quick columns (QIAGEN, Valencia, CA) or Exosap-IT (United D. innubila individuals (n ϭ 13–23 per locus) and one individ- States Biochemical, Cleveland, OH) and directly sequenced both ual of D. falleni. These regions included Alcohol dehydrogenase- strands using Big Dye Terminator chemistry (Applied Biosystems, related protein (Adhr), triose phosphate isomerase (tpi), chorion pro- Foster City, CA). Base calls were verified using Sequencher tein 36 (cp36), period (per), and vermilion (v); the primers are (Gene Codes, Ann Arbor, MI) and aligned manually. Sites described in Table 1. The per and tpi fragments are all coding with gaps were excluded from the analyses. Sequences from sequence, while the primers of the other three fragments are this study have been deposited in GenBank (accession nos. anchored in exons but amplify across an intron. Because per, AY541089–AY541237 and AY552552–AY552553). cp36, and v are X-linked in D. innubila, we used only males to To investigate mtDNA variation in D. innubila, we used the survey polymorphism for these fragments. For the autosomal Cytochrome Oxidase I gene (COI), as this is one of the most loci Adhr and tpi, we inferred heterozygous sites by manually variable regions of the mitochondria in Drosophila and other examining chromatograms, per the restrictions in Hare and insects (Ballard 2000). Primers for PCR and sequencing of Palumbi (1999), and did not attempt to infer haplotypes. 1446 K. A. Dyer and J. Jaenike

Measures of DNA sequence diversity, including haplotype ␲ ␪ number, nucleotide diversity ( , Tajima 1983), and W (Watt- erson 1975), were obtained using DnaSP version 4.0 (Rozas et al. 2003). The frequency spectrum of polymorphisms was tested for departure from neutrality with DT (Tajima 1989a), DFL (Fu and Li 1993), and H (Fay and Wu 2000; used for COI only) statistics, using only silent site variation. Significance relative to the standard neutral model was determined using 104 coalescent simulations without recombination, as implemented in DnaSP. To test whether the mtDNA of D. innubila has a disproportionate reduction in diversity compared to the nuclear genes, we compared the patterns of polymorphism and divergence to D. falleni at both mitochondrial (COI) and nuclear genes using a multiple-locus HKA test (Hudson et al. 1987) as implemented in the HKA program of J. Hey and the maximum-likelihood-based program MLHKA by S. Wright (Wright and Charlesworth 2004). For the COI statistics, we used the COI data set I (the random sample of flies) and for all loci included variation at silent sites only. When assessing statistical significance, we adjusted for different modes of trans- Figure 1.—Relation between A group Wolbachia infection mission of the mitochondrial, autosomal, and X-linked loci. (as determined by PCR) and offspring sex ratio in wild-caught Wolbachia phylogenetics: To assess the phylogenetic posi- females of D. innubila. Light and dark shading indicates un- tion of the two Wolbachia strains that infect D. innubila,we infected and infected females, respectively. Based on 369 flies analyzed both the wsp (as above) and ftsZ genes (using primers collected from the Chiricahua Mountains of Arizona in August- FtsZf1 and FtsZf2; Werren et al. 1995). The use of two genes September of 2001–2003, each of which produced at least 10 reduces the possibility of phylogenetic misplacement due to offspring. recombination, which has been documented in Wolbachia (Jiggins 2002; Werren and Bartos 2002). We aligned our sequences to previously published sequences from other ar- of the 74 wild-caught females (46 Ϯ 6%) in 2001, 246 thropods and included three sequences from filarial nema- of 683 (36.0 Ϯ 1.8%) in 2002, and 83 of 330 (25.2 Ϯ todes as an outgroup. For wsp, we excluded the unalignable third hypervariable region from the analyses; this region corre- 2.4%) in 2003. Infection rates were much lower among sponds to positions 522–574 of the alignment from Zhou et wild-caught males: 0% in 2001 (n ϭ 39), 2.6% in 2002 al. (1998). (n ϭ 302), and 1.7% in 2003 (n ϭ 176). The prevalence Phylogenetic relationships were constructed separately for of infection with group A Wolbachia decreased signifi- each gene using Bayesian inference. On the basis of the results cantly through time in females (logistic regression with of likelihood-ratio tests, we used the general time reversible ␹2 ϭ Ͻ (GTR) model (Tavare´ 1986) model with gamma-distributed year as a continuous variable, 17.56, P 0.001), rate variation for wsp (Yang 1993) and the GTR model with though not in males (␹2 ϭ 1.393, P Ͼ 0.5). The rare rate classes separated by first, second, or third position within occurrence of infected males in natural populations codons for ftsZ. MrBayes was used to infer tree topology and indicates that the male-killing phenotype of Wolbachia model parameters (version 3.0b; Ronquist and Huelsenbeck is Ͻ100% penetrant in the wild. 2003). Because of the long branches in the wsp phylogeny, we used an exponentially distributed prior on the branch Uninfected females and those infected with group lengths when analyzing this data set. For each analysis we ran A Wolbachia produced very different proportions of the Markov chains for 5 million generations, sampling every female offspring (Figure 1). Whereas all 259 uninfected 100 generations and excluding the first 500,000 generations females produced approximately equal numbers of as burn-in. The final most credible tree was a 50% majority- male and female offspring (mean proportion female ϭ rule tree based on the subsequent 45,000 sampled trees. The Ϯ branch lengths are the average of the posterior estimates for 0.504 0.007), almost all of the 110 infected females each branch. To ensure convergence of the chains, we ran produced very strongly female-biased offspring sex ra- the analysis three additional times for each dataset from a tios (mean proportion female ϭ 0.968 Ϯ 0.009), a highly different initial starting tree. significant difference (F ϭ 1664.89, P Ͻ 0.001). Infection with the group B Wolbachia was found in 4 of 74 females (5%) and 1 of 39 males (3%) in 2001, RESULTS 6 of 683 females (0.9%) and 5 of 302 males (1.7%) in Wolbachia infection and male-killing in wild flies: We 2002, and 0 of 330 females (0%) and 0 of 176 males collected 110 D. innubila from the Chiricahuas in 2001 (0%) in 2003. No flies were coinfected with both A (of which 67% were female), 1107 in 2002 (68.4% fe- group and B group Wolbachia. Excluding the 2003 data male), and 552 in 2003 (64.9% female). The population- because no B-infected individuals were found, there is level sex ratios were similar all 3 years (␹2 ϭ 2.21, P ϭ a significant negative association with infection between 0.33), but for each year they were significantly different the two Wolbachia strains (␹2 ϭ 5.95, P Ͻ 0.015). Two from 1:1 (2001, ␹2 ϭ 11.10, P ϭ 0.010; 2002, ␹2 ϭ 154.51, females infected with B group Wolbachia produced off- P Ͻ 0.001; 2003, ␹2 ϭ 49.82, P Ͻ 0.001). spring; both families had a normal sex ratio (mean Group A (male-killing) Wolbachia was found in 34 fraction female ϭ 0.48 Ϯ 0.02). The normal offspring Male-Killing Endosymbionts 1447

ship of the 17 haplotypes, as well as the association of mtDNA haplotype with infection status. It is evident that there is no association between mtDNA haplotypes and infection status, as each major haplotype includes similar proportions of infected and uninfected individuals. A battery of statistical tests (Nei 1987; Hudson et al. 1992a,b) indicates that there are no differences either in frequency composition or genetic differentiation among haplotypes associated with the three infection categories (uninfected, A group Wolbachia, and B group Wolbachia). The same holds when B group-infected individuals are ϭ excluded. Among the three infection categories, GST 0.00658 (Nm ϭ 75.5), which is only slightly increased Figure 2.—Median-joining network of mtDNA COI haplo- by comparing only A group-infected with uninfected types that occur in the Chiricahua Mountains population of individuals (G ϭ 0.00865, Nm ϭ 57.3; Nei 1987). D. innubila. The area of each circle is proportional to the ST relative frequency of that haplotype in the overall sample. The The level of mtDNA diversity in D. innubila is approxi- shading within each haplotype represents the proportion of mately an order of magnitude lower than that in the individuals of each infection status: dark shading indicates five nuclear genes surveyed (Table 2). When variation infection with male-killing A group Wolbachia, light shading in effective population size among different parts of the indicates infection with the B group Wolbachia, and no shad- genome is accounted for, the neutral theory predicts ing represents uninfected individuals. The arrow indicates where the D. falleni haplotype connects to the network. that among loci the polymorphism within a species should be proportional to the divergence from an outgroup (Hudson et al. 1987). To test whether COI poly- sex ratio and similar frequencies of infection in males morphism in D. innubila is lower than expected under and females indicate that it is not a male-killer. neutrality, we employed an HKA test, using the multilo- Maternal transmission rate and offspring sex ratio: cus form with silent sites only and 104 coalescent simula- From 50 randomly chosen wild-caught females infected tions to determine the significance of the deviation (see with the group A male-killing strain of Wolbachia, we Machado et al. 2002). Four nuclear loci—Adhr, cp36, surveyed an average of 10.86 Ϯ 0.09 daughters per family tpi, and v—show no deviation from the neutral model for Wolbachia infection. Among these families, the (␹2 ϭ 2.40, P ϭ 0.39). We excluded the fifth locus, per, mean fraction of infected daughters was 0.969 Ϯ 0.010, from the HKA analyses because it produced a significant which serves as an estimate of the maternal transmission deviation from neutrality when included with the other rate of Wolbachia. We also assayed the offspring of 9 four nuclear genes (␹2 ϭ 9.01, P ϭ 0.039). This deviation additional wild-caught females infected with A group may be because per is evolving rapidly in D. falleni (K. Wolbachia that had atypical, less female-biased offspring Dyer, unpublished data), thus inflating the divergence sex ratios. Across all 59 families surveyed (i.e., these 9 from D. innubila. Including COI and scaling the Ne of the plus those from the 50 randomly chosen females), the mtDNA (Ne,mtDNA) to be one-fourth that of the autosomes fraction of females among the offspring was positively (due to uniparental inheritance and haploidy) resulted correlated with Wolbachia transmission rate to female in a significant result (␹2 ϭ 11.59, P ϭ 0.025), with most offspring (r 2 ϭ 0.386, F ϭ 35.83, P Ͻ 0.001), a trend of the deviation resulting from the lower-than-expected that holds up when all-female families are excluded (r 2 ϭ polymorphism in COI (7 observed vs. 28 expected poly- 0.286, F ϭ 8.81, P ϭ 0.007). Of the females infected morphic sites). with the group B Wolbachia, only 2 wild-caught females As discussed above, a male-killing endosymbiont will produced offspring, and none of these 52 offspring were decrease the within-population mtDNA diversity not only infected, indicating a 0% transmission rate of these B during the initial sweep, but also at equilibrium (John- group Wolbachia. stone and Hurst 1996). Thus, one may ask whether Sequence diversity in Wolbachia and D. innubila: All the observed level of variation at COI is lower than the wsp sequences obtained from flies infected with A group expected equilibrium level of variation. For species in- Wolbachia were identical (n ϭ 31), as were all wsp se- fected with a male-killing endosymbiont, the effective quences from flies infected with B group Wolbachia population size of the mitochondria (Ne,mtDNA) is approxi- (n ϭ 16). Thus, only one strain from the A group (the mately equal to the effective population size of the in- male-killer) and one from the B group of Wolbachia fected females (Ne,Inf)(Johnstone and Hurst 1996). Thus, (which does not cause male-killing) infect D. innubila we can adjust the inheritance scalar, or relative Ne of the at detectable frequencies. mtDNA to the autosomes, to account for the expected ϭ Among the mtDNA COI samples (data set II, n 115), decrease in Ne,mtDNA. Using an infection rate of 35% among ϭ 18 of 1473 sites were polymorphic within the Chiricahua females, the adjusted Ne,mtDNA becomes (0.25)(0.35) population of D. innubila. Figure 2 shows the relation- 0.0875 relative to the effective population size of the 1448 K. A. Dyer and J. Jaenike

TABLE 2 Summary of D. innubila nucleotide diversity and divergence from D. falleni

Total diversityh Silent diversityh

a b c d e f g ␲␪ ␲␪ i Gene/data set n L h S S1 Mnsyn Msil W W KJC COI Data set I 30 1473 7 8 6 1 7 0.086 0.346 0.137 0.508 20.7 Data set II (all) 115 1473 17 18 13 3 15 0.091 0.230 0.372 0.812 Uninfected 62 1473 12 13 8 1 12 0.098 0.407 0.188 0.734 A strain (mk) 38 1473 7 6 3 1 5 0.077 0.311 0.097 0.342 B strain 14 1473 5 7 5 1 6 0.108 0.417 0.149 0.542 Adhr 26 521 NA 26 7 1 26 1.450 1.355 4.308 3.917 17.3 cp36 20 726 12 16 12 0 17 0.352 0.660 1.016 1.907 4.9 per 22 704 21 37 19 10 29 1.059 1.559 2.609 4.688 51.8 tpi 46 383 NA 27 17 3 26 0.821 1.723 3.149 6.030 8.7 v 21 433 21 128 58 0 145 6.216 9.373 6.994 10.547 16.2 a Number of chromosomes surveyed. b The number of sites used in polymorphism analyses, excluding those with alignment gaps and missing data. c Number of haplotypes. d Total number of segregating sites. e Number of singleton sites. f Number of nonsynonymous segregating mutations. g Number of silent (noncoding ϩ synonymous) segregating mutations. h Estimates of nucleotide diversity at all sites and at silent sites only. All values are multiplied by 10Ϫ2. i Divergence from D. falleni, for silent sites only and with Jukes-Cantor correction. All values are multiplied by 10Ϫ2.

Ϫ1 ϭ autosomes (Ne,Autosomes), resulting in a nonsignificant HKA Ne,mtDNA becomes (0.25)(1.36 )(0.35) 0.129 Ne,Autosomes. test (␹2 ϭ 5.55, P ϭ 0.19). We can further correct this When the inheritance scalar is adjusted for all these fac- inheritance scalar to account for the unequal sex ratio tors, the HKA tests shows that the level of polymorphism found in this population, which reduces the Ne,Autosomes rela- of the mtDNA is not significantly different from that of 2 tive to the Ne,mtDNA. The Chiricahua population of D. innub- the autosomes (␹ ϭ 7.703, P ϭ 0.100). ϭ ف ila is 66% female, which leads to Nm 0.515Nf. Using Using the likelihood-based HKA method of Wright the standard equation for Ne of a population with a biased and Charlesworth (2004), we estimated the maximum- ϭ sex ratio (Hedrick 2000, p. 246) results in Ne 1.36Nf. likelihood estimation (MLE) of the mtDNA inheritance Thus, adjusting for haploidy, uniparental inheritance, un- scalar. This approach allows one to eliminate the effects equal population-level sex ratio, and infection frequency, of heterogeneity among the neutral loci, which can con- tribute to the ␹2-value in the standard HKA. To obtain the MLE of the mtDNA scalar, we fixed the scalars of the autosomal loci to 1.0 and those of the X-linked loci to 0.75 and allowed the mtDNA scalar to vary. Compar- ing the mtDNA to the same four nuclear loci as above resulted in a MLE of the mtDNA scalar of 0.07 relative to the autosomes, with 2-unit bounds (i.e., 95% confidence intervals) from 0.02 to 0.21 (Figure 3). Including per does not significantly alter the results: the MLE of the mtDNA scalar was 0.09 with 2-unit bounds of 0.03–0.25. Thus, while the mtDNA diversity is significantly depressed in D. innubila, the current level of polymorphism is consistent with the equilibrium attained under an evolutionarily long- term male-killing infection. Figure 3.—Maximum-likelihood estimation of the mtDNA We attempted to distinguish demographic effects from scalar relative to four nuclear loci (Adhr, cp36, tpi, and v). a recent mtDNA-specific sweep by examining the fre- The gray line indicates the 2-unit likelihood bounds (95% quency spectrum of mutations, as measured by D-statistics confidence interval). The dotted lines show the scalar expecta- (Tajima 1989a; Fu and Li 1993). All nuclear loci surveyed tions based on (a) 35% infection frequency with a male-killing endosymbiont, (b) 35% infection frequency and a 66% female in D. innubila except for Adhr show an excess of rare population sex ratio, and (c) neutrality. Results were obtained variants, as revealed by negative values of the D-statistics using the MLHKA program of S. Wright. (Table 3). This pattern was statistically significant for Male-Killing Endosymbionts 1449

TABLE 3 Statistics summarizing the frequency spectrum of D. innubila loci

a b c d Gene Data set n L S S D T So DFL COI Data set I (random) 30 347.6 7 Ϫ0.944 7 Ϫ1.680 Data set II 114 347.6 15 Ϫ1.471* 15 Ϫ1.260 All uninfected 62 347.6 12 Ϫ1.272 12 Ϫ0.870 All A strain (mk) 38 347.6 5 Ϫ0.233 5 Ϫ0.182 All B strain 14 347.6 6 Ϫ0.830 6 Ϫ0.807 Adhr 26 173.9 25 0.526 23 0.317 cp36 20 251.3 16 Ϫ1.613* 14 Ϫ2.562* per 22 169.7 27 Ϫ1.532* 26 Ϫ1.557* tpi 46 94.3 26 Ϫ1.631* 26 Ϫ2.649* v 21 382.1 128 Ϫ1.006 93 Ϫ2.274* a Number of surveyed chromosomes. b Number of silent sites in D. innubila, excluding alignment gaps and missing data. c Number of segregating silent sites. d Number of segregating silent sites with deﬁned ancestral site in D. falleni.

DT and/or DFL for these four loci (cp36, per, tpi, and v) by the male-killing Wolbachia strain among female D. an intermediate infection frequency ,%35ف even under the conservative assumption of no recombi- innubila was nation. To test whether DT and DFL averaged over all compared to other insect species infected with male- five nuclear loci depart significantly from neutrality, we killers (reviewed in Hurst and Jiggins 2000). This fre- used the 104 coalescent simulations used in the HKA quency of infection and the almost complete male-kill- test to estimate the expected distribution of D-statistics. ing effect are consistent with our finding that two-thirds ϭϪ For both DT and DFL, the observed means (DT 1.051, of the D. innubila adults collected in the Chiricahuas were ϭϪ DFL 1.745) were significantly less than the simulated female. Such a biased sex ratio may affect the nature ϭϪ ϭ ϭϪ Ͻ means (DT 0.098, P 0.007; DFL 0.108, P 0.001). and intensity of sexual selection in these populations. In The mtDNA COI gene (data set I) harbors a slight some butterflies infected at high levels with male-killing excess of rare mutations. While DT and DFL for COI are Wolbachia, females form lekking swarms that may serve not significantly different from zero, the values are similar to attract males, which are rare in such populations to those for the nuclear genes (Table 3). Furthermore, (Jiggins et al. 2000). It would be interesting to deter- using D. falleni as an outgroup, H (Fay and Wu 2000) mine if the mating system of D. innubila differs from was not significant for the COI gene of D. innubila (H ϭ that of other Drosophila with more normal sex ratios. Ϫ1.94, P ϭ 0.08). Thus, our data do not support the Evolutionary stability of the male-killing infection in occurrence of a recent mtDNA-specific sweep. D. innubila: The wsp gene—the fastest-evolving gene known Wolbachia phylogenetics: All of the MrBayes runs for in Wolbachia (Zhou et al. 1998)—showed no sequence both Wolbachia genes, wsp and ftsZ, converged to the variation among isolates of the A group strain of Wol- same tree; the most credible phylogeny for wsp is shown bachia, indicating that all of the male-killing Wolbachia in Figure 4. The ftsZ-based phylogeny yielded essentially within D. innubila are derived from a single ancestral identical results. Both the wsp and ftsZ phylogenies show infection. Other species whose resident Wolbachia lack that the male-killing strain that infects D. innubila is in within-strain diversity include D. recens (Shoemaker et al. the A group of Wolbachia and that the non-male-killing 2004), D. simulans (James and Ballard 2000), mosquitoes infection belongs to the B group of Wolbachia (ftsZ data (Guillemaud et al. 1997), fire ants (Shoemaker et al. not shown). Among the 180,000 sampled trees (four 2003), and the testacea group of Drosophila (K. Dyer, independent analyses of 45,000 trees each) the A and unpublished data). This pattern may be the result of a B strains never form a bipartition, showing that these are low mutation rate in the endosymbiont. evolutionarily independent infections. The only other The lack of within-strain variation in Wolbachia dem- male-killing Wolbachia known from Drosophila, which onstrates the usefulness of the host mtDNA, which shares is found in D. bifasciata (Hurst et al. 2000), also belongs the same maternal inheritance pattern as the Wolbachia, to the A group. However, among the sampled trees this for inferring the evolutionary history of endosymbiont strain and the D. innubila male-killer never formed a infections. For instance, this approach has been used to bipartition and are thus not monophyletic. show that the butterfly A. encendon experienced a recent infection by two male-killing strains of Wolbachia; specifi- cally, a single mtDNA haplotype is associated with each DISCUSSION strain and a more diverse assemblage of mtDNA types Population-level effects of male-killing Wolbachia: From are found among uninfected individuals (Jiggins 2003). 2001 through 2003, the mean prevalence of infection The patterns found in D. innubila stand in striking con- 1450 K. A. Dyer and J. Jaenike

Figure 4.—Most credible Wolbachia phylogeny based on Bayesian analysis of wsp. Wolbachia strains are shown by host name and host strain, when relevant. Those that are known to induce male-killing are underlined. The tree is rooted with the C group of Wolbachia, which infects ﬁlarial nematodes. Branch lengths are the mean of the posterior estimates for each branch, and the numbers at the nodes represent the proportion of sample trees containing particular bipartitions.

trast to A. encedon and suggest an evolutionarily old infec- ciently old for many mutations to have occurred in the tion. First, there is no association between infection status descendants of the originally infected female. and mtDNA haplotype, indicating that the mtDNA haplo- Fitness and population-level consequences of Wol- type initially associated with the infection has spread to bachia infection: In theory, the equilibrium prevalence the uninfected class, probably via incomplete maternal of a male-killing endosymbiont depends on the advan- transmission. Second, no major mtDNA haplotypes are tage to females gained by the death of their male sib- found only among uninfected individuals, signifying lings, the viability and fertility cost of the infection to that all of the haplotypes that were initially present only females, and the transmission rate of the infection from in uninfected individuals have been lost from the popu- mother to offspring. We use a simplification of earlier lation. Third, despite a reduced level of diversity, there models (e.g., Hurst 1991; Johnstone and Hurst 1996; are a substantial number of polymorphic sites in the Hurst et al. 2000) to estimate the overall net selective mtDNA of D. innubila, indicating the infection is suffi- effect of infection. Let the fitness of a daughter born Male-Killing Endosymbionts 1451 to an infected female be 1 and that of a daughter of population-level proportions of females of 0.65 in 2002 an uninfected female be 1 Ϫ s, where s is the fitness and 0.61 in 2003, values in line with the observed 0.68 difference due to both the direct adverse effect of infec- in 2002 and 0.65 in 2003. tion and the indirect benefit derived from the death Homogenization of haplotype frequencies among in- of one’s male siblings. Infected mothers transmit the fection classes: While the scenario considered above Wolbachia infection to a fraction ␤ of their offspring. pertains to an entire population, it could equally well Thus, infected females will produce a relative number ␤ apply to a subset of the population carrying a single infected and 1 Ϫ␤uninfected female offspring, whereas mtDNA haplotype (call it haplotype i). As a result of the uninfected females will produce 1 Ϫ s uninfected female fitness consequences of infection and the rate of Wol- offspring. If I is the prevalence of infection among fe- bachia transmission, the equilibrium proportion of indi- males of the parental generation, the prevalence of in- viduals carrying this haplotype that are infected will be Îi Ј ϭ Ϫ fection among their daughters (I ) is, for high values and the proportion that are uninfected will be Uˆ i 1 ␤ ϭ Ϫ Ϫ␤ of , approximately Îi, with Îi 1 (1 i)/si. Similarly, for individuals carrying a second haplotype (j), the equilibrium propor- IЈ Ϸ [I␤]/[I(1 Ϫ␤) ϩ I␤ϩ(1 Ϫ I)(1 Ϫ s)]. (1) tion of infected and uninfected females will be Îj and ˆ ˆ ϭ Ϫ Ϫ␤ ␤ The term I(1 Ϫ␤) assumes that the fitness of the unin- Uj, with Ij 1 (1 j)/sj.Ifs and do not depend ϭ ␤ ϭ␤ fected daughters of infected females is equal to the on haplotype (i.e., si sj and i j), then at equilibrium fitness of their infected sisters. The equilibrium preva- the proportion of infected and uninfected females will lence of Wolbachia infection (Î) thus depends only on be the same for each mitochondrial type, or s and ␤: ϭ Îi/Uˆ i Îj/Uˆ j. Î ϭ 1 Ϫ (1 Ϫ␤)/s. (2) Rearranging, ϭ Given our empirical data on the prevalence of Wolbachia Îi/Îj Uˆ i/Uˆ j (4) infection in the Chiricahuas (Î Ϸ 0.35) and the rate of demonstrates that at equilibrium the mtDNA haplotype transmission of Wolbachia from wild-caught females to frequency spectrum should be similar between the in- their offspring (␤ Ϸ 0.97), we infer that s Ϸ 0.046 in the fected and uninfected classes—precisely the pattern ob- Chiricahua population of D. innubila. Assuming that Î lies served in D. innubila. The assumptions of no effect of somewhere within the range of I obtained across the 3 mtDNA haplotype on fitness or transmission rate are years of our study (I ϭ 0.25 Ϫ I ϭ 0.46) yields a 2003 2001 reasonable in the case of D. innubila because all of the corresponding range for s of 0.040–0.056. Clearly, the haplotypes are very closely related. fitness difference between infected and uninfected cyto- Changes in haplotype frequency due to drift are ex- plasmic lineages is large and thus must have a major pected to occur at much slower rates than the approach effect on mtDNA dynamics. to the equilibrium Î/Uˆ ratio within haplotypes. For ex- For realistic values of the parameters s and ␤, the ample, the variance in the frequency of a given haplo- equilibrium prevalence of infection, Î, is approached type (p ) due to one generation of random sampling is very rapidly. To show this numerically, we set the initial i expected to equal p (1 Ϫ p )/N , where N is the effective N (see i i f f/1ف prevalence of infection I ϭ 10Ϫ6, which is 0 f population size of females. On the basis of the value of below), and use the above values of ␤ϭ0.97, Î ϭ 0.35, N for D. innubila presented below, we assume that and s ϭ 0.046, which we assume remain constant through e N Ϸ 106. Thus, for haplotypes that will experience the time. Iteration of Equation 1 yields a relaxation time (␶)of f greatest change in frequency due to drift (p ϭ 0.5), the generations, where ␶ is defined as the number of i 800ف 95% confidence limits for changes in frequency per generations for the departure of I from equilibrium (Î Ϫ Ϯ Ϫ1 generation are 0.001. In contrast, for a newly arisen I␶) to diminish to a fraction e of the initial departure haplotype in which all individuals are infected, the pro- ˆ Ϫ from equilibrium (I I0). Thus, the infection will spread portion of individuals carrying that haplotype that are ,per generation %3ف rapidly on an evolutionary timescale. uninfected will initially increase by The expected proportion of females in a population given our estimates of Wolbachia transmission rates. can be estimated as the fraction of female offspring pro- Thus, when Ii/Ui is far from equilibrium, the rate at duced by infected and uninfected females standardized which this ratio approaches equilibrium will be much by the total offspring production of each genotype, or faster than changes in haplotype frequency due to drift. I(␤/2 ϩ (1 Ϫ␤)/2) ϩ (1 Ϫ s)(1 Ϫ I )/2 F Consequently, changes in haplotype frequencies are ex- ϭ , (3) I(1 Ϫ␤/2) ϩ (1 Ϫ s)(1 Ϫ I ) 2F Ϫ␤I pected to occur effectively in parallel within the infected and uninfected classes of flies. where F ϭ 1 Ϫ s(1 Ϫ I). If D. innubila is univoltine (W. Has mitochondrial diversity reached equilibrium in Heed, personal communication), then the prevalence D. innubila? The HKA test revealed significantly reduced of infection in one year can be used to predict popula- variation in mtDNA. However, when we correct the ef- tion-level sex ratio in the next. This leads to expected fective population size of mtDNA to account for ob- 1452 K. A. Dyer and J. Jaenike

TABLE 4

Estimates of Ne (in millions) for D. innubila and D. falleni based on silent site diversity estimates

D. innubila D. fallenia

Locus N␲ N␪ N␲ N␪ Autosomal Adhr 7.47 9.01 7.64 8.91 tpi 5.25 10.05 6.78 9.58 X-linkedb cp36 1.69 3.18 4.54 5.07 per 4.35 7.81 24.67 28.50 v 11.66 17.58 8.92 11.78 a Data for D. falleni were analyzed from 15 males collected in Rochester, New York (K. Dyer, unpublished data). b Estimates for X-linked genes are not corrected for difference in transmission from the autosomal loci. served population-level sex ratio and prevalence of Wol- bachia infection, the levels of mtDNA polymorphism Figure 5.—Distribution of the pairwise distances among the 17 haplotypes identified from 115 D. innubila and among are not significantly less than expected under neutral the 15 haplotypes identified from 15 D. falleni. D. innubila and expectations. If the prevalence of infection fluctuates D. falleni are shown in dark and light shading, respectively. through time, then the actual effective population size Pairwise distances are in units of base pairs and are Jukes- of the mtDNA is probably smaller than we have assumed, Cantor corrected. and the observed levels of polymorphism are even more consistent with neutral expectations. These results suggest that not only is the Wolbachia infection evolution- ila is dramatically less than that among the 15 haplotypes ␹2 ϭ arily old within D. innubila, but sufficient time has in D. falleni (Figure 5; Komolgorov-Smirnov test, Ͻ elapsed for the species to have attained an equilibrium 187.4, P 0.0001). Thus, our data strongly support the level of mtDNA diversity following a presumed purging conclusion that all extant haplotypes within D. innubila of diversity following the initial Wolbachia invasion. are descended from one female that was initially infected The observations that the extant mtDNA haplotypes with Wolbachia, although we cannot rule out more recent show significantly reduced variation and are all closely horizontal transmission. connected on the haplotype network indicate that the Only one observation suggests the possibility of a re- spread of Wolbachia through D. innubila occurred by cent Wolbachia sweep in D. innubila: the mtDNA shows exclusively vertical transmission. If there had been some a slight excess of rare variants, as indicated by negative, horizontal or paternal transmission during the initial though nonsignificant, D-statistics. However, the rest of spread, one would expect phylogenetically divergent the genome also shows the same pattern, as the mean haplotypes to have simultaneously spread through the D values were significantly more negative than expected species, resulting in the existence of one or more long under neutrality. Because selection acts in a locus-spe- branches in the mtDNA network. Instead, the most di- cific manner, whereas demographic processes affect the vergent D. innubila COI haplotypes differ by only 6 bp whole genome, the generally negative D values suggest (Figure 2), with a mean among-haplotype difference of that demographic processes are responsible for the ob- 3.3 bp. served excess of rare variants (Tajima 1989b; Fay and To test this statistically, we contrast the mtDNA haplo- Wu 1999). type distances within D. innubila to those in D. falleni, No suppressors of male-killing in D. innubila: Given which is the closest known relative of D. innubila. With the high rate of male death and the biased population- the exception of per, the nuclear loci surveyed from level sex ratio due to male-killing Wolbachia, selection these two species have roughly similar polymorphism on the host to resist the infection is strong. Nevertheless, levels, indicating that the two species have similar effec- the almost perfect association between infection with tive population sizes (Table 4). Hence, the mtDNA di- Wolbachia among wild females and their production of versity in D. innubila prior to the Wolbachia invasion strongly female-biased sex ratios indicates that little if is expected to be similar to that seen in present-day any resistance has evolved in the Chiricahua population populations of D. falleni. For D. falleni, COI sequences of D. innubila. In the only other comparable studies to from 15 wild-caught males from Rochester, NY, differ date, no evidence for suppression of male-killing has by as much as 29 bp, with a mean among-haplotype been found in D. bifasciata or the butterflies A. encedon difference of 12.7 bp. The distribution of the pairwise and Hypolimnas bolina (Hurst et al. 2001; Jiggins et al. distances among the 17 COI haplotypes within D. innub- 2002; Dyson and Hurst 2004). In A. encedon, the lack of Male-Killing Endosymbionts 1453 resistance is not surprising, because (1) the Wolbachia been multiple, independent origins of male-killing among infection appears to be very recent and (2) selection several major microbial groups, including the gram-nega- for resistance may be ineffective due to A. encedon’s small tive Flavobacteria, ␣-Proteobacteria (both Wolbachia effective population size, which may be caused by its and Rickettsia), ␥-Proteobacteria, gram-positive Spiro- severely female-biased population sex ratio (Jiggins plasma, and protozoan Microsporidia (reviewed in Hurst 2003). H. bolina has failed to evolve resistance despite and Jiggins 2000; Dunn and Smith 2001). Male-killing harboring the infection for at least 400 generations, has also arisen independently in the A and B groups of although this is a relatively brief period on evolutionary Wolbachia (Hurst et al. 2000). The present study, in timescales (Dyson and Hurst 2004). conjunction with Hurst et al.’s (2000) characterization Neither recent infection nor small effective popula- of male-killers in D. bifasciata, shows that there have tion size applies to the association between D. innubila been multiple origins of male-killing within the A group and the male-killing Wolbachia it harbors. First, all lines of Wolbachia that infect Drosophila. Such recurrent, of evidence indicate that the Wolbachia infection in D. independent origins of this phenotype among endosym- innubila is evolutionarily quite old. Second, levels of biotic bacteria suggest that male-killing symbioses may molecular variation indicate that D. innubila has a very arise at a relatively high evolutionary rate across insect large effective population size. If we assume a mutation lineages. rate ␮ Ϸ 1.5 ϫ 10Ϫ9/silent site/generation for Drosoph- The Wolbachia strain that induces male-killing in D. ila (Andolfatto and Przeworski 2000; McVean and innubila is nested within a cluster of closely related Wol-

Vieira 2001) we can estimate Ne of D. innubila from bachia strains—the Mel group of Zhou et al.(1998)— the polymorphism data because nucleotide diversity (␲) that have a variety of phenotypic effects in other host and the number of segregating sites (␪) are both esti- species. For instance, D. recens, which like D. innubila is a mates of 4N␮ (Tajima 1989a). Without correcting for member of the quinaria group of Drosophila, is infected the difference in Ne between the X and the autosomes, with a closely related strain of Wolbachia that induces ϭ the arithmetic mean Ne for the two autosomal loci is N␲ very strong CI (Werren and Jaenike 1995). Distantly 6.4 ϫ 106 and N␪ ϭ 9.5 ϫ 106, and for the three X-linked related Drosophila hosts, including D. melanogaster and loci is N␲ ϭ 5.9 ϫ 106 and N␪ ϭ 9.5 ϫ 106 (Table 4). D. simulans, also harbor closely related Wolbachia strains

Using the same method for other species, the Ne of D. that cause varying levels of cytoplasmic incompatibility innubila is on par with other mycophagous Drosophila (James and Ballard 2000; Reynolds and Hoffmann such as D. recens and D. falleni (Shoemaker et al. 2004; 2002). Another closely related Wolbachia strain, which K. Dyer, unpublished data) and substantially higher than infects the wasp Amitus fuscipennis, is thought to induce that of D. melanogaster, D. simulans, D. pseudoobscura, and parthenogenesis (Van Meer et al. 1999; R. Stouthamer, D. virilis (data from Hamblin and Aquadro 1999; Vieira personal communication). Among Wolbachia strains in and Charlesworth 1999; Kovacevic and Schaeffer this cluster, wsp is less than 2% divergent at the DNA 2000; Andolfatto 2001; Andolfatto and Wall 2003). sequence level, including the hypervariable region. Typi- Thus, the failure of D. innubila to evolve substantial resis- cally, this hypervariable region is so divergent among tance to male-killing Wolbachia remains an evolutionary Wolbachia strains that it is phylogenetically meaning- conundrum. less. ftsZ also shows next to no variation within this group The low-frequency B infection: The normal offspring (data not shown). This cluster of closely related Wol- sex ratios produced by females infected with B group bachia strains within the Mel group thus provides an Wolbachia and the similar infection prevalence in males excellent opportunity to explore how interactions be- and females show that this strain is not a male-killer. tween endosymbionts and their insect hosts affect the Two lines of evidence suggest that this infection is not manner by which these parasites manipulate host repro- being maintained by vertical transmission within D. in- duction. nubila. First, the B infection was never transmitted from In conclusion, the nature of the processes by which wild-caught infected females to any offspring in labora- male-killing endosymbionts are maintained within spe- tory culture. Second, the mtDNA haplotypes with which cies and insect communities depends on the evolution- the B infection is associated are evenly distributed across ary duration of these associations. At one extreme, male- the mtDNA haplotype network. With exclusive maternal killing infections may be evolutionarily transient, for inheritance, the mtDNA haplotypes associated with the example, by spreading to fixation and thus causing host younger of the A or B group Wolbachia infections should extinction, being lost due to the impermanence of per- be monophyletic, i.e., phylogenetically nested within the missive ecological conditions or the evolution of host overall haplotype network. The B infections may repre- resistance, or evolving into a new non-male-killing pheno- sent horizontal transmission events from mites or encap- type. Such conditions would favor evolutionarily “weedy” sulated parasitoid wasps. endosymbionts, capable of rapid colonization of tempo- Phylogenetic analyses: Male-killing Wolbachia of D. rarily suitable host species. At the other extreme, within- innubila belong to the A group and are not closely re- host species male-killing infections may be evolution- lated to any other known male-killing strain. There have arily stable for long periods within host species, thus 1454 K. A. Dyer and J. Jaenike maintaining strong and persistent selection pressure on and the recombinational landscape in Drosophila pseudoobscura: a study of the second chromosome. Genetics 153: 859–869. the host to evolve some form of resistance to the direct Hare, M. P., and S. R. Palumbi, 1999 The accuracy of heterozygous (male-killing) and indirect (skewed population-level sex base calling from diploid sequence and resolution of haplotypes ratio) effects of these infections. However, our evidence using allele-specific sequencing. Mol. Ecol. 8: 1750–1752. Hatcher, M. J., D. E. Taneyhill, A. M. Dunn and C. Tofts, 1999 indicates that D. innubila exhibits little if any resistance Population dynamics under parasitic sex ratio distortion. Theor. to these parasites, despite having a very large effective Popul. Biol. 56: 11–18. population size and a long evolutionary time during Hedrick, P. W., 2000 Genetics of Populations. Jones & Bartlett, Boston. Heed, W., J. Russell and D. Harrington, 1962 Diversity and den- which to evolve such resistance. sity of Drosophila in the immediate vicinity of Tucson with special As with other maternally inherited endosymbionts, reference to D. pseudoobscura. Dros. Inf. Serv. 36: 73–74. the genetic footprints left by male-killing infections on Hudson, R. R., M. Kreitman and M. Aguade´, 1987 A test of neutral molecular evolution based on nucleotide data. Genetics 116: the host genome, particularly on the mtDNA, can be 153–159. used to infer the evolutionary history of these associa- Hudson, R. R., D. D. Boos and N. L. Kaplan, 1992a A statistical test tions. While others have documented evolutionarily re- for detecting geographic subdivision. Mol. Biol. Evol. 9: 138–151. Hudson, R. R., M. Slatkin and W. P. Maddison, 1992b Estimation cent invasions of male-killing endosymbionts (e.g., Jig- of levels of gene flow from DNA sequence data. Genetics 132: gins 2003), our study provides the first genetic evidence 583–589. of an evolutionarily much older male-killing infection. Hurst, G. D. D., and F. M. Jiggins, 2000 Male-killing bacteria in insects: mechanisms, incidence, and implications. Emerg. Infect. Thus, the stage is set for comparative studies of the Dis. 6: 329–336. evolutionary processes governing the dynamics of short- Hurst, G. D. D., L. D. Hurst and M. E. N. Majerus, 1997 Cyto- and long-term infections. plasmic sex-ratio distorters, pp. 125–154 in Influential Passengers: Inherited Microorganisms and Arthropod Reproduction, edited by S. L. We thank the Southwest Research Station (Portal, AZ) for opportu- O’Neill,A.A.Hoffmann and J. H. Werren. Oxford University nities to conduct fieldwork in the Chiricahuas; M. Minhas for excellent Press, New York. technical assistance; S. Perlman for collecting flies in 2001; S. Wright Hurst, G. D. D., A. P. Johnson, J. H. G. Von Der Schulenburg for assistance with his MLHKA program; and P. Andolfatto, A. Betan- and Y. Fuyama, 2000 Male-killing Wolbachia in Drosophila: court, J. Bollback, E. Braswell, J. Fry, Y. Kim, J. Masly, S. Mullen, A. a temperature-sensitive trait with a threshold bacterial density. Genetics 156: 699–709. Orr, N. Stoletzki, C. Toomajian, and two anonymous reviewers for useful Hurst, G. D. D., F. M. Jiggins and S. J. W. Robinson, 2001 What discussion and/or comments on the manuscript. This work was made causes inefficient transmission of male-killing Wolbachia in Dro- possible by National Science Foundation, Caspari, and American Associa- sophila? Heredity 87: 220–226. tion of University Women fellowships to K.A.D. and National Science Hurst, L. D., 1991 The incidences and evolution of cytoplasmic Foundation grants DEB-0074141 and DEB-0315521 to J.J. male killers. Proc. R. Soc. Lond. Ser. B Biol. Sci. 244: 91–99. Jaenike, J., K. A. Dyer and L. K. Reed, 2003 Within-population structure of competition and the dynamics of male-killing Wol- bachia. Evol. Ecol. Res. 5: 1023–1036. LITERATURE CITED James, A. C., and J. W. O. Ballard, 2000 Expression of cytoplasmic incompatibility in Drosophila simulans and its impact on infection Andolfatto, P., 2001 Contrasting patterns of X-linked and autoso- frequencies and distribution of Wolbachia pipientis. Evolution 54: mal nucleotide variation in Drosophila melanogaster and Drosophila 1661–1672. simulans. Mol. Biol. Evol. 18: 279–290. Jiggins, F. M., 2002 The rate of recombination in Wolbachia bacteria. Andolfatto, P., and M. Przeworski, 2000 A genome-wide depar- Mol. Biol. Evol. 19: 1640–1643. ture from the standard neutral model in natural populations of Jiggins, F. M., 2003 Male-killing Wolbachia and mitochondrial DNA: Drosophila. Genetics 156: 257–268. selective sweeps, hybrid introgression and parasite population Andolfatto, P., and J. D. Wall, 2003 Linkage disequilibrium pat- dynamics. Genetics 164: 5–12. terns across a recombination gradient in African Drosophila mela- Jiggins, F. M., G. D. D. Hurst and M. E. N. Majerus, 1998 Sex nogaster. Genetics 165: 1289–1305. ratio distortion in Acraea encedon (Lepidoptera: Nymphalidae) is Ballard, J. W. O., 2000 Comparative genomics of mitochondrial caused by a male-killing bacterium. Heredity 81: 87–91. DNA in Drosophila simulans. J. Mol. Evol. 51: 64–75. Jiggins, F. M., G. D. D. Hurst and M. E. N. Majerus, 2000 Sex- Behura, S. K., S. C. Sahu, M. Mohan and S. Nair, 2001 Wolbachia ratio-distorting Wolbachia causes sex-role reversal in its butterfly in the Asian rice gall midge, Orseolia oryzae (Wood-Mason): corre- host. Proc. R. Soc. Lond. Ser. B 267: 69–73. lation between host mitotypes and infection status. Insect Mol. Jiggins, F. M., J. P. Randerson, G. D. D. Hurst and M. E. N. Majerus, Biol. 10: 163–171. 2002 How can sex ratio distorters reach extreme prevalences?: Dunn, A. M., and J. E. Smith, 2001 Microsporidian life cycles and a natural population in which male-killing Wolbachia have near- diversity: the relationship between virulence and transmission. perfect vertical transmission efficiency and are not suppressed. Microbes Infect. 3: 381–388. Evolution 56: 2290–2295. Dyson, E. A., and G. D. D. Hurst, 2004 Persistence of an extreme Johnstone, R. A., and G. D. D. Hurst, 1996 Maternally inherited sex-ratio bias in a natural population. Proc. Natl. Acad. Sci. USA male-killing microorganisms may confound interpretation of mi- 101: 6520–6523. tochondrial DNA variability. Biol. J. Linn. Soc. 58: 453–470. Fay, J. C., and C.-I Wu, 1999 A human population bottleneck can Kimura, M., 1983 The Neutral Theory of Molecular Evolution. Cam- account for the discordance between patterns of mitochondrial bridge University Press, Cambridge, UK. versus nuclear DNA variation. Mol. Biol. Evol. 16: 1003–1005. Kovacevic, M., and S. W. Schaeffer, 2000 Molecular population Fay, J. C., and C.-I Wu, 2000 Hitchhiking under positive Darwinian genetics of X-linked genes in Drosophila pseudoobscura. Genetics selection. Genetics 155: 1405–1413. 156: 155–172. Fu, Y. X., and W. H. Li, 1993 Maximum likelihood estimation of Machado, C. S., R. M. Kliman, J. A. Markert and J. Hey, 2002 Infer- population parameters. Genetics 134: 1261–1270. ring the history of speciation from multilocus DNA sequence Guillemaud, T., N. Pasteur and F. Rousset, 1997 Contrasting data: the case of Drosophila pseudoobscura and close relatives. Mol. levels of variability between cytoplasmic genomes and incompati- Biol. Evol 19: 472–488. bility types in the mosquito Culex pipiens. Proc. R. Soc. Lond. Ser. McVean, G. A. T., and J. Vieira, 2001 Inferring parameters of muta- B Biol. Sci. 264: 245–251. tion, selection, and demography from patterns of synonymous Hamblin, M. T., and C. F. Aquadro, 1999 DNA sequence variation site evolution in Drosophila. Genetics 157: 245–257. Male-Killing Endosymbionts 1455

Moran, N. A., 1996 Accelerated evolution and Muller’s rachet in mtDNA as a consequence of endosymbiont infection. Genetics endosymbiotic bacteria. Proc. Natl. Acad. Sci. USA 93: 2873–2878. 168 (in press). Nei, M., 1987 Molecular Evolutionary Genetics. Columbia University Tajima, F., 1983 Evolutionary relationships of DNA sequences in Press, New York. finite populations. Genetics 105: 437–460. Ohta, T., 1973 Slightly deleterious mutant substitutions in evolu- Tajima, F., 1989a Statistical-method for testing the neutral mutation tion. Nature 246: 96–98. hypothesis by DNA polymorphism. Genetics 123: 585–595. Orr, H. A., and Y. Kim, 1998 An adaptive hypothesis for the evolu- Tajima, F., 1989b The effect of change in population-size on DNA tion of the Y chromosome. Genetics 150: 1693–1698. polymorphism. Genetics 123: 597–601. Patterson, J. T., and R. R. Wagner, 1943 Geographical distribution Tavare´,S., 1986 Some probabilistic and statistical problems on the of species of the genus Drosophila in the United States and Mexico. analysis of DNA sequences, pp. 57–86 in Lectures in Mathematics Univ. Texas Publ. 4313: 217–281. in the Life Sciences, Vol. 17. American Mathematical Society, Provi- Peck, J., 1994 A ruby in the rubbish: beneficial mutations, deleteri- dence, RI. ous mutations, and the evolution of sex. Genetics 137: 597–606. Turelli, M., A. A. Hoffmann and S. W. McKenchnie, 1992 Dynam- Perlman, S. J., G. S. Spicer, D. D. Shoemaker and J. Jaenike, 2003 ics of cytoplasmic incompatibility and mtDNA variation in natural Drosophila simulans populations. Genetics 132: 713–723. Associations between mycophagous Drosophila and their How- van Meer, M. M. M., J. Witteveldt and R. Stouthamer, 1999 Phy- ardula nematode parasites: a worldwide phylogenetic shuffle. Mol. logeny of the arthropod endosymbiont Wolbachia based on the Ecol. 12: 237–249. WSP gene. Insect Mol. Biol. 8: 399–408. Reynolds, K. T., and A. A. Hoffmann, 2002 Male age, host effects Vieira, J., and B. Charlesworth, 1999 X chromosome DNA varia- and the weak expression or nonexpression of cytoplasmic incom- tion in Drosophila virilis. Proc. R. Soc. Lond. Ser. B 266: 1905–1912. patibility in Drosophila strains infected by maternally transmitted von der Schulenburg, J. H. G., G. D. D. Hurst,D.Tetzlaff,G. Wolbachia. Genet. Res. 80: 79–87. E. Booth,I.A.Zakharov et al., 2002 History of infection with Rigaud, T., D. Bouchon, C. Souty-Grosset and P. Raimond, 1999 different male-killing bacteria in the two-spot ladybird beetle Mitochondrial DNA polymorphism, sex ratio distorters and popu- Adalia bipunctata revealed through mitochondrial DNA sequence lation genetics in the isopod Armadillidium vulgare. Genetics 152: analysis. Genetics 160: 1075–1086. 1669–1677. Watterson, G. A., 1975 Number of segregating sites in genetic Rokas, A., R. J. Atkinson, G. S. Brown, S. A. West and G. N. Stone, models without recombination. Theor. Popul. Biol. 7: 256–276. 2001 Understanding patterns of genetic diversity in the oak Werren, J. H., and J. D. Bartos, 2002 Recombination in Wolbachia. gallwasp Biorhiza pallida: Demographic history or a Wolbachia se- Curr. Biol. 11: 431–435. lective sweep? Heredity 87: 294–304. Werren, J. H., and J. Jaenike, 1995 Wolbachia and cytoplasmic in- Ronquist, F., and J. P. Huelsenbeck, 2003 MrBayes 3: Bayesian compatibility in mycophagous Drosophila and their relatives. He- phylogenetic inference under mixed models. Bioinformatics 19: redity 75: 320–326. 1572–1574. Werren, J. H., L. Guo and D. W. Windsor, 1995 Distribution of Rozas, J., J. C. Sanchez-DelBarrio, X. Messeguer and R. Rozas, Wolbachia in neotropical arthropods. Proc. R. Soc. Lond. Ser. B 2003 DnaSP, DNA polymorphism analyses by the coalescent 262: 197–204. and other methods. Bioinformatics 19: 2496–2497. Williamson, D. L., and D. F. Poulson, 1979 Sex ratio organisms Schneider, S., D. Roessli and L. Excoffier, 2000 Arlequin Ver 2.000: (Spiroplasmas) of Drosophila, pp. 175–208 in The Mycoplasmas, A Software for Population Genetic Analyses. Genetics and Biometry Vol. III, edited by R. F. Whitcomb and J. G. Tully. Academic Laboratory, University of Geneva, Switzerland. Press, New York. Shoemaker, D. D., V. Katju and J. Jaenike, 1999 Wolbachia and the Wright, S., 1951 The genetical structure of populations. Ann. Eu- evolution of reproductive isolation between Drosophila recens and gen. 15: 323–354. Drosophila subquinaria. Evolution 53: 1157–1164. Wright, S. I., and B. Charlesworth, 2004 The HKA test revisited: Shoemaker, D. D., K. G. Ross, L. Keller, E. L. Vargo and J. H. a maximum-likelihood-ratio test of the standard neutral model. Genetics 168: 1071–1076. Werren, 2000 Wolbachia infections in native and introduced Yang, Z., 1993 Maximum likelihood estimation of phylogeny from populations of fire ants (Solenopsis spp.). Insect Mol. Biol. 9: DNA sequences when substitution rates differ over sites. Mol. 661–673. Biol. Evol. 10: 1396–1401. Shoemaker, D. D., G. Keller and K. G. Ross, 2003 Effects of Wol- Zhou, W., F. Rousset and S. O’Neill, 1998 Phylogeny and PCR- bachia on mtDNA variation in two fire ant species. Mol. Ecol. 12: based classification of Wolbachia strains using wsp gene sequences. 1757–1771. Proc. R. Soc. Lond. Ser. B 265: 509–515. Shoemaker, D. D., K. A. Dyer, M. Ahrens, K. McAbee and J. Jaenike, 2004 Decreased diversity but increased substitution rate in host Communicating editor: D. M. Rand