REGULATION OF SKELETAL MUSCLE DEVELOPMENT
AND DIFFERENTIATION BY SKI
By
HONG ZHANG
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Thesis Advisor: Dr. Ed Stavnezer
Department of Biochemistry
CASE WESTERN RESERVE UNIVERSITY
January, 2009 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______Hong Zhang______candidate for the ______Doctor of Philosophy______degree *.
(signed)______David Samols, Ph.D.______
(chair of the committee)
______Clemencia Colmenares, Ph.D.______
______Nikki Harter, Ph.D.______
______Lynn Landmesser, Ph.D.______
______Ed Stavnezer, Ph.D.______
(date) _____October 27, 2008______
*We also certify that written approval has been obtained for any proprietary material contained therein.
ii TABLE OF CONTENTS
LIST OF TABLES ix
LIST OF FIGURES xii
ACKNOWLEDGEMENTS xiv
LIST OF ABBREVIATIONS xvi
ABSTRACT 1
INTRODUCTION 3
Structure and Protein-protein Interactions of Ski 3
Transcriptional Regulation by Ski 6
Expression Pattern of Ski 7
Biological Activities of Ski 8
Ski Superfamily 9
Overview of Embryonic Muscle Development 10
Genes Involved in Migration of Myogenic Progenitors 14
MRFs Functions in Muscle Development 15
Muscle Satellite Cells and Pax7 16
Transcriptional Regulation of Muscle-specific Genes by Ski 17
Regulation of Myog Transcription 18
Conserved Network of Dach/Six/Eya 20
Our Research Focus 22
MATERIALS AND METHODS 27
Materials 27
Plasmids 27
iii In situ hybridization probes 29
PCR templates and primers 29
Reagents 35
Common reagents for RNA-related experiments 35
Genotyping 35
Immunohistochemistry 36
Whole mount in situ hybridization 37
Primary culture of satellite cell-derived myoblasts 39
DNA Cloning 40
Cell extract and Western blotting 41
Immunofluorescence 45
Chromatin immunoprecipitation (ChIP) 46
Immunoprecipitation 48
Methods 48
Mouse strains and embryos 48
Genomic DNA isolation 49
Genotyping 49
Histological analysis 50
Immunohistochemistry 51
Construction of plasmids for making RNA probes 52
Preparation of digoxigenin (DIG)-labeled RNA probes 53
Preparation of template DNA 54
In vitro transcription 54
iv Purification of labeled probes 55
Probe evaluation 55
Whole mount in situ hybridization 56
Primary culture of satellite cell-derived myoblasts 57
DNA Cloning 58
PCR amplification 58
Restriction enzyme digestion 59
Generation of blunt-end DNA 60
Dephosphorylation 60
Gel separation and DNA purification from gel slice 60
Ligation 61
Transformation 61
Construction of retroviral vectors 62
Tissue culture and transfection 63
Retroviral infection 64
Western blotting 64
Immunofluorescence 66
Quantitative realtime-PCR 67
Chromatin immunoprecipitation (ChIP) 70
Genomic DNA preparation 72
Reporter assays 73
Construction of luciferase reporters 73
Reporter assay 75
v Immunoprecipitation 76
RESULTS AND DISCUSSION 78
CHAPTER I: Ski Is Required For Normal Development of Embryonic
Progenitors of Mouse Hypaxial Muscle but Not For Fetal
Progenitors or Satellite Cells 78
Abstract 78
Introduction 80
Experimental Procedures 82
Mouse strains and embryos 82
Histological analysis 83
Immunohistochemistry 83
Whole mount in situ hybridization 84
Primary culture of satellite cell-derived myoblasts 85
Quantitative realtime-PCR 85
Results 86
Selective muscular hypoplasia of Ski-/- embryos 86
Dynamic expression of Ski 89
Determination and differentiation of myogenic progenitors
in Ski-/- embryos 92
Altered migration of myogenic progenitors in Ski-/- embryos 102
Normal specification of fetal/postnatal myogenic progenitors
in Ski-/- embryos 110
Discussion 115
vi Future Directions 119
Dissecting the roles of Ski during development 119
Mechanism underlying the regulation of Met by Ski 121
CHAPTER II: Ski Regulates Muscle Terminal Differentiation
by Transcriptional Activation of Myog in a Complex
with Six1 and Eya3 125
Abstract 125
Introduction 126
Materials and Methods 129
Construction of retroviral vectors 129
Tissue culture and transfection 130
Retroviral packaging and infection 130
Western blotting 131
Immunofluorescence 133
Realtime-PCR 134
Chromatin immunoprecipitation (ChIP) 134
Reporter assays 136
Co-immunoprecipitation 137
Results 138
Regulated over-expression of Ski stimulates terminal differentiation 138
Generation of C2C12 clones with inducible knock-down of Ski expression 141
Ski knockdown is reversible and Dox-dose dependent 145
Impaired myotube formation in the absence of Ski 146
vii Loss of Ski inhibits commitment to terminal muscle differentiation 149
Ski occupies Myog regulatory region in differentiating myoblasts 153
MEF3 binding site is required for the activation of Myog regulatory
region by Ski 159
Ski associates with Eya3 and Six1 in differentiating muscle cells 162
The DHD of Ski is required for its association with Six1 and
its activation of Myog transcription 163
Discussion 169
Future Directions 173
Mechanism of Myog transcriptional regulation by Ski/Six1/Eya3 complex 173
Regulatory cascades of Ski during myogenic differentiation 174
The regulation of satellite cell behavior by Ski in vivo 174
DISCUSSION 176
The contradictions in this study 176
REFERENCES 179
viii LIST OF TABLES
Table 1. Expression vectors (including empty vectors)
Table 2. Retroviral vectors for knock-down of Ski
Table 3. Luciferase reporters
Table 4. Plasmids for making in situ probes
Table 5. Probes for whole mount in situ hybridization
Table 6. PCR primers for mouse genotyping:
Table 7. Primers for realtime-PCR
Table 8. PCR primers for generating Met fragments
Table 9. PCR primers for generating tTA fragment
Table 10. PCR primers for generating fragment encoding Eya3 ORF (No 3’UTR)
Table 11. PCR primers for generating huSKI fragment without DHD
Table 12. Synthetic DNA oligonucleotides targeting mouse Ski
Table 13. Common primers for generating DNA forms of shRNA inserts targeting
mouse Ski
Table 14. PCR primers for generating Myog regulatory regions for Myog-luciferase
constructs
Table 15. PCR primers for generating Myog-luciferase mutants
Table 16. PCR primers for ChIP assays
Table 17. DEPC-treated reagents
Table 18-1. DNA isolation buffer-1 (For isolation of DNA from yolk sac)
Table 18-2. DNA isolation buffer-2 (For isolation of DNA from tail)
Table 19-1. Fixation solution (Immunohistochemistry)
ix Table 19-2. Permeabilization solution (Immunohistochemistry)
Table 19-3. Blocking solution (Immunohistochemistry)
Table 20-1. STE buffer
Table 20-2. PBST
Table 20-3. Refixation solution (Whole mount in situ hybridization)
Table 20-4. Hybridization mix (Whole mount in situ hybridization)
Table 20-5. Solution I (Whole mount in situ hybridization)
Table 20-6. Solution II (Whole mount in situ hybridization)
Table 20-7. Solution III (Whole mount in situ hybridization)
Table 20-8. MAB stock (Whole mount in situ hybridization)
Table 20-9. MABT (Whole mount in situ hybridization)
Table 20-10. Blocking Solution (Whole mount in situ hybridization)
Table 20-11. NTMT (Whole mount in situ hybridization)
Table 21. Laminin-coating solution (Primary culture of satellite cell-derived
myoblasts)
Table 22-1. Lysis buffer (For isolate genomic DNA)
Table 22-2. DNA loading buffer
Table 22-3. TAE buffer
Table 22-4. SOB medium
Table 22-5. LB medium
Table 22-6. LB-Ampr plate
Table 23-1. RIPA lysis buffer (Cell extract)
Table 23-2. Protein loading buffer
x Table 23-3. 10% APS
Table 23-4. SDS-PAGE separating gel
Table 23-5. SDS-PAGE stacking gel
Table 22-6. TG-SDS (Gel running buffer)
Table 23-7. Transfer buffer
Table 23-8. TBS
Table 23-9. TBST
Table 23-10. Blocking buffer (For Western blot with most of the antibodies)
Table 23-11. Blocking buffer (For Western blot with G8 antibody)
Table 23-12. Assay buffer (Western blot)
Table 23-13. Stripping buffer
Table 24-1. PBS
Table 24-2. Fixation buffer (Immunofluorescence)
Table 24-3. Permeablization buffer (Immunofluorescence)
Table 24-4. Blocking buffer (Immunofluorescence)
Table 25-1. Lysis buffer (ChIP)
Table 25-2. TE buffer
Table 25-3. Blocking buffer (ChIP)
Table 25-4. Pre-blocked protein A beads (ChIP)
Table 25-5. High salt buffer (ChIP)
Table 25-6. Lithium salt buffer (ChIP)
Table 25-7. Elution buffer (ChIP)
Table 26. NETN buffer (Immunoprecipitation)
xi LIST OF FIGURES
Figure 1. Architecture of Ski Protein
Figure 2. Schematic representation of the genetic mechanisms underlying myogenesis
during mouse development
Figure 3. Selective muscular hypoplasia in prenatal Ski-/- mice
Figure 4. Hypoplasia of limb muscle in Ski-/- embryos at mid and late gestation
Figure 5. Dynamic expression pattern of Ski during mouse development
Figure 6. Specification and activation of epaxial and hypaxial myogenesis
Figure 7. Normal commitment to terminal muscle differentiation in the forelimbs of Ski-
/- embryos
Figure 8. Normal levels of proliferation and apoptosis in the myogenic progenitors or
muscle cells in the absence of Ski
Figure 9. Impaired migration of myogenic progenitors in Ski-/- embryos
Figure 10. Loss of Ski affects the expression of Met but not HGF/SF or Msx1
Figure 11. Loss of Ski doesn’t affect in vivo accumulation or in vitro differentiation of
fetal myogenic progenitors
Figure 12. Loss of Ski doesn’t affect in vivo accumulation or in vitro differentiation of
satellite cells
Figure 13. SKI stimulates differentiation of C2C12 myoblasts
Figure 14. Dox-regulated knock-down of Ski in C2C12 cells via shRNAs in the context
of miR30
Figure 15. Loss of Ski prevents terminal differentiation of C2C12 myoblasts
Figure 16. Loss of Ski blocks myogenic differentiation at an early stage
xii Figure 17. Loss of Ski reduces the expression of muscle-specific genes at both mRNA and protein levels.
Figure 18. Ski binds the endogenous Myog regulatory region upon differentiation
Figure 19. The MEF3 binding site is required for maximal activation of Myog promoter by Ski.
Figure 20. Ski interacts with Six1 and Eya3 but not with MyoD or MEF2
Figure 21. The DHD of Ski is required for its association with Six1 and its activation of
Myog transcription
xiii ACKNOWLEDGEMENTS
This work would not have been possible without the support and encouragement
of my advisor, Dr. Ed Stavnezer. His caring supervision, his enthusiastic involvement in
this project and his skilful guidance were of essence to this work. As an excellent mentor,
he always encouraged me to learn as much as possible, support me to be independent, and was always available when I needed his help or advice. He helped me come out of many frustrating moments during my PhD research and his enthusiasm about science always inspires me.
I would also like to thank Dr. Clemencia Colmenares for all her help and support as our collaborator and my committee member. She brought me to the world of
Developmental Biology and shared with me her expertise and research insight. The resources she provided were invaluable and greatly appreciated.
I would like to thank all my committee members, Dr. David Samols, Dr. Nikki
Harter, Dr. Clemencia Colmenares, Dr. Stephen O'Gorman and Dr. Lynn Landmesser, for their caring criticism and support of my research. Without their help and support, my research would not have been as complete as it has become. Special acknowledgement goes to Dr. David Samols for all the corrections and revisions he made on the thesis, which have been significantly useful in shaping it up to completion. I would also like to thank Dr. Lynn Landmesser for taking time out from her busy schedule to serve as my thesis examining member on a short notice.
I want to thank all the fellow students, postdoc and technicians in my lab and Dr.
Colmenares’ lab for their technical support and for sharing their experiences and insights.
xiv I would also like to thank all my friends in this department, for their caring and friendship which help me through tough times and enabled me to have a wonderful time along the way.
I have been accompanied and supported by so many people along the way toward this point of my life and it is my great pleasure to take this opportunity to thank all of them. I hope one day I could provide similar help and support for someone else as they strive to achieve their dreams.
Finally, I am greatly indebted to my family: to my parents who provide constant encouragement and love to me. Their dedication to careers and striving to do their best in both professional and personal life always encouraged me. I also like to thank my husband and my best friend, Yun Ding, for his understanding and unconditional support.
The courage, perseverance and sense of humors with which he responds to life’s challenges have given me strength and courage to face my own. It is to them that I dedicate this work.
This work was supported by grants from the National Institutes of Health (DE15198 to C.C and E.S, CA43600 to E.S, and HD30728 to C.C).
xv LIST OF ABBREVIATIONS
A/B Acrylamide/Bisacrylamide
ALP alkaline phosphatase
APS ammonium persulfate
β-Me beta-Mercaptoethanol bFGF basic fibroblast growth factor
BME basal medium eagle
BMP bone morphogenetic proteins
BSA bovine serum albumin
CHCl3 chloroform
ChIP chromatin immunoprecipitation
CIP calf intestinal alkaline phosphatase
Co-IP co-immunoprecipitation
Ct threshold cycle number
DAPI 4’, 6’-diamidino-2-phenylindole
DEA diethanolamine
DEPC diethyl pyrocarbonate
DIG digoxigenin
DM differentiation medium
DMEM Dulbecco’s Modified Eagle Medium
dNTP deoxyribonucleotide triphosphate
DOC deoxycholate
Dox doxycycline
xvi dsDNA double strand DNA
DTT 1, 4-Dithiothreitol dUTP deoxyUridine triphosphate
E18 embryonic stage 18
EDTA ethylenediaminetetraacetic acid
FBS fetal bovine serum
FITC fluorescein isothiocyanate
FLAG flag epitope
G418 geneticin
GM growth medium
GFP green fluorescent protein
H2O2 hydrogen peroxide
HDAC histone deacetylase hr hour
HRP horseradish peroxidase
HS horse serum
IgG immunoglobulin G
MHC myosin heavy chain min minute
MIR30 microRNA 30
NaF sodium fluoride
NP-40 Nonidet P-40
O.C.T. compound optimal cutting temperature compound
xvii ORF open reading frame
PAGE polyacrylamide gel electrophoresis
PBS phosphate-buffered saline
p.c. post-coitum
PFA paraformaldehyde
Puro puromycin
PVP polyvinylpyrrolidone
RLU relative light units
RNAi RNA interference
RT room temperature
RT-PCR real time RT-PCR
SAP shrimp alkaline phosphatase
SDM site directed mutagenesis
SDS sodium dodecyl sulfate sec second shRNA short hairpin RNA
TBS Tris-buffered saline
TEMED N’,N’,N’,N’-Tetramethylethylenediamine
TGF-β transforming growth factor β
TK promoter thymidine kinase promoter tRNA transfer RNA tTA tetracycline-controlled transactivator
U unit
xviii Regulation of Skeletal Muscle Development and Differentiation by Ski
Abstract By
HONG ZHANG
Ski is the most studied member of a family of proteins all sharing a conserved
Dachshund homology domain. It has been implicated in oncogenic transformation, myogenic conversion of avian embryo fibroblasts and also many aspects of vertebrate development, especially myogenesis. Ski-/- mice exhibit severe defects in skeletal muscle and die at birth, yet little is know about either the underlying mechanisms or the role of
Ski in adult muscle regeneration. In these studies, I used Ski knockout mice and C2C12 myoblast cultures to address these issues, respectively. Detailed analysis of Ski-/-
embryos revealed dramatically reduced hypaxial muscles but less affected epaxial
muscles. The reduced number of myogenic regulatory factor positive cells in Ski-/- mice
suggested an insufficient myogenic cell pool to support muscle formation. However, both
the dermomyotomal hypaxial progenitors and myotomal epaxial progenitors formed and
committed to myogenic fate appropriately. The hypaxial muscle defect in Ski-/- mice was
not caused by abnormal proliferation, terminal differentiation or apoptosis of the
myogenic cells either, but due to impaired migration of embryonic hypaxial progenitors.
Surprisingly, the normal distribution of fetal/postnatal myogenic progenitors in Ski-/-
mice suggested different effects of Ski on the behaviors of embryonic and fetal/postnatal
myogenic progenitors. In addition, although not affecting the terminal differentiation of
embryonic myogenic cells, Ski was necessary for that of adult satellite-cell derived
C2C12 myoblasts as evidenced by impaired myotube formation and reduced induction of
genes essential for myogenic differentiation in the absence of Ski. This function was
1 mainly mediated by Ski’s ability to form a complex with Six1 and Eya3 and activate
Myog transcription through a MEF3 site. It is important in the future to further study mechanisms underlying the contrasting effects of Ski on embryonic, fetal and adult muscle development, to investigate how the association of Ski with Six1/Eya3 is triggered upon differentiation and to identify the transcriptional machinery mediates Ski’s action. The data presented here not only add a new aspect to the understanding of myogenic progenitor migration and hypaxial muscle development but also provide a starting point to achieve the regulation of muscle formation and regeneration through the action of Ski.
2 INTRODUCTION
Structure and Protein-protein Interactions of Ski
The v-ski oncogene originated in the avian Sloan Kettering retroviruses (1-3). Its cellular homologue c-ski was later found to be an evolutionarily conserved gene in species ranging from Xenopus, Zebrafish, chicken to mouse and human (reviewed in (4)).
The c-ski protein is a nuclear protein of 750 residues, while v-ski corresponds to its
residues 21–441(5). The N-terminal region of c-Ski protein, encoded by the first exon of
the gene, is the most highly conserved segment which includes an alanine-rich region
(34-45), a proline-rich region (53-76), several α helices and β turns (91-175), and several
cysteine-histidine rich domains characteristic of zinc-finger like motif (202-295) (Figure
1A) (6-8). Mutational analysis suggests that except for the proline-rich region, these predicted motifs are all important for the biological activities of c-Ski (6). Two distinct domains composed of these motifs have been implicated in mediating important protein- protein interactions of c-Ski. The more conserved one is the Dachshund homology domain (DHD), which defines the Ski gene family including Ski, SnoN, Dach, Fussel-15,
Fussel-18 and Corl (Figure 1B) (7, 9-15).The DHD contains mixed helix turn helix motifs and bears structural features characteristic of the winged-helix/forkhead class of
DNA binding proteins (7). However, in Ski, this domain doesn’t function as a DNA binding domain, but facilitates interactions of Ski with Smad2/3, the nuclear hormone receptor co-repressor N-CoR, Skip and the retinoic acid receptor α (RARα) (16-24). A deletion of this region completely eliminated Ski’s ability to repress transcription and transform chicken embryo fibroblasts (CEFs) (25, 26). The second conserved region is the zinc-finger like motif which is highly homologous to the SAND domain (Sp100,
3
4 Fig. 1. Architecture of Ski protein. (A) A schematic representation of c-Ski and v-Ski
proteins. Regions known to participate in protein-protein interactions are indicated by
colored boxes. Symbols indicate: Ala, alanine-rich region; Pro, proline-rich region;
AH/BT, mixed α helices and β turns; Zn, putative zinc fingers; TR, tandem repeat; LZ,
leucine zipper motif. The locations of these conserved regions within Ski protein are
indicated above the bar in number. Domains required for binding to Ski protein partners
are also indicated in the figure. DHD, Dachshund homology domain; SAND, Sp100,
AIRE-1, NucP41/75 and DEAF-1 domain. Arrowheads indicate protein partners that
interact with Ski. (B) Sequence alignment of SKI-DHD, v-Ski-DHD, Sno-DHD and
DACHbox-N. Identical residues are indicated by a blue background and similar residues
are shown by a yellow background. The secondary structure of Ski-DHD is indicated
above the sequence by blue arrows for β strands and red coils for α helices. T indicates β
turns.
5 AIRE-1, NucP41/75 and DEAF-1 domain)(27). The SAND domain usually mediates
DNA binding, but in Ski, it mediates interaction of Ski with Smad4, Fhl2 and MeCP2 (8,
28, 29).
The C-terminal region of c-ski is missing in v-ski and contains a tandem repeat
and a leucine zipper motif that mediates homo-dimerization and hetero-dimerization with
the closely-related protein, SnoN (6, 30). Although lacking these C-terminal domains, v-
ski can dimerize with c-ski and retain all the biological activity of c-ski.
Transcriptional Regulation by Ski
Although Ski does not bind DNA directly (31), it has been shown to interact with
several transcription factors to modulate transcription as either a co-activator or co-
repressor depending on its DNA-binding partner.
By binding to Smads, Ski negatively regulates transforming growth factor-β
(TGF-β) (21-24) and bone morphogenic protein (BMPs) signaling pathways (28), both of which have been implicated in many aspects of vertebrate development including mesoderm patterning, myogenesis, bone formation, and organogenesis (32) .
Binding of TGF-β or BMPs to their respective receptor serine/threonine kinases
results in phosphorylation of the receptor-regulated Smad proteins (R-Smad). The R-
Smads are Smad2 and Smad3 for TGF-β signaling, and Smad1, Smad5 and Smad8 for
BMP signaling (33). The phosphorylated R-Smads then form complexes with a common
mediator Smad (Co-Smad), Smad4, and translocate into the nucleus. There they bind to
the Smad-binding element (SBE) present in TGF-β/BMP-responsive promoters, interact
with other transcription factors and activate transcription. Through the interaction with
6 Smad2, Smad3 and Smad4, Ski is recruited to DNA in a TGF-β-dependent manner and represses the activation of TGF-β target genes (21-24, 34). Ski also can interact with
Smad4 in a BMP-dependent manner to block BMP signaling (28), thereby influencing
neural specification in the Xenopus and Zebrafish embryos and inhibiting BMP2-induced
osteoblast differentiation in murine bone marrow stromal cells (28, 35, 36).
In addition to the Smad proteins, Ski has also been reported to interact with
several other proteins including N-CoR, mSin3A, RAR, Glioblastoma-3 (Gli3),
retinoblastoma protein (Rb), the methyl-CpG-binding protein MeCP2 and Skip (8, 16-18,
28, 29, 37, 38). These interactions contribute to many aspects of the biological activity of
Ski.
Ski becomes a component of co-repressor complexes by directly binding to N-
coR and mSin3A and these interactions have been implicated in the transcriptional
repression of Mad, Rb and thyroid hormone receptor by Ski (16, 37). When associated
with RAR, Ski recruits N-CoR to repress RAR-induced transcription from retinoic acid
response elements and blocks RAR-induced differentiation of acute promyelocytic
leukemia cells (18). However, N-CoR recruitment is not involved in Smad co-repression
(37). In human melanoma cells, Ski activates Wnt/β -catenin signaling through its
interaction with DRAL/FHL2 (8). Ski has also been reported to bind to full length Gli3
and inhibit sonic hedgehog (Shh)-induced Gli3 target gene transcription (38).
Expression Pattern of Ski
Ski is expressed in virtually all adult and embryonic tissues but at low levels (39,
40) and has also been detected in human tumor cell lines derived from melanoma, breast
7 cancer, prostate cancer and carcinomas of the esophagus, thyroid, vulva, lung, stomach
and epidermoid (10, 41). However, the signaling pathways or molecules that regulate the
transcription, translation and stability of Ski during embryogenesis and in adult tissues are
largely unknown.
Ski is expressed dynamically during embryonic development. It is expressed in
the neural tube, migrating neural crest cells and dermomyotome at embryonic day 9.5
(E9.5)(39, 40). At E12.5, its mRNA expression peaks in skeletal muscle and drops to a
low level by E15.5. At E14-E16, Ski mRNAs are detected at high levels in the brain (39).
In adult mice, Ski is expressed in brain and lung at the highest levels, in stomach, ovaries, heart, diaphragm and spleen at intermediate levels, and in liver, small intestine, uterus, skeletal muscle and skin at relatively low levels (40).
Biological Activities of Ski
v-ski was discovered by virtue of its ability to cause anchorage-independent growth and morphological transformation in avian embryo fibroblasts(2, 3); a property it
shares with c-ski (25, 42) and is correlated with increased SKI levels in tumor cell lines.
Surprisingly, loss of one copy of Ski increased susceptibility to tumorigenesis in mice
(43). In addition, Ski-deficient mouse embryonic fibroblasts (MEFs) exhibited increased cell death, whereas overexpression of Ski protected the cells from apoptosis (44).
Consistent with its expression pattern during embryonic development, Ski has been implicated in biological processes including muscle formation and craniofacial morphogenesis. Both forms of ski have been shown to induce myogenic differentiation in non-muscle avian embryo fibroblasts by activation of the myogenic regulatory factor
8 (MRF) genes, MyoD and myogenin (Myog) (25, 42). In transgenic mice expressing v-ski or c-ski cDNAs, hypertrophy but not hyperplasia of type IIb fast skeletal muscle fibers was observed (45, 46). The involvement of the endogenous gene in muscle development was demonstrated by the observation that Ski-null mice showed a marked decrease in skeletal muscle mass (47). Ski-/- mice also suffered from exencephaly in the 129 background and severe midline facial clefting in the C57BL6/J background (48). In addition, these mice displayed other craniofacial and skeletal abnormalities including facial flattening, a broad forehead, malformation of the eye, a depressed nasal bridge and digit abnormalities. These phenotypes are reminiscent of those found in a human 1p36 deletion syndrome, caused by a hemizygous deletion in the short arm of chromosome
1(48). Interestingly, human SKI gene has been mapped to chromosome 1p36 and is included in the minimally deleted region in this syndrome (48). Thus, it is possible that loss of SKI is responsible for some of the observed craniofacial phenotypes in individuals with 1p36 deletion syndrome.
Ski Superfamily
The Ski gene family also includes another member, SnoN (ski related novel oncogene) which shares a high degree of amino acid sequence identity with the Ski protein in the N-terminal region(10). SnoN forms heterodimers with Ski (49) and interacts with many proteins which have been shown to interact with Ski, such as Smad2 and Smad3, Smad4 and N-CoR (4, 27). Similar to Ski, SnoN also negatively regulates
TGF-β signaling (43) and overexpression of sno in chicken embryo fibroblasts induced oncogenic transformation and myogenic differentiation, although less effectively than c-
9 ski (50). Despite all of the similarities to Ski, SnoN seems to have a very different role in
embryonic development: one SnoN-null line showed embryonic lethality before E3.5,
while the others only showed a defect in T cell activation (9, 43).
Recently, Ski and SnoN have been classified as part of a superfamily with the
retinal determination proteins, Dach1 and Dach2, based on the conserved DHD domain
(7, 51-54). Drosophila dachshund (dac) is involved in the cell-fate determination in the
eyes, and in muscle and leg development(55-61). Vertebrate Dach1 and Dach2 are also
expressed in the limb, brain and eye(11, 13, 62, 63), but targeted disruption of mouse
Dach1 resulted in postnatal lethality without any obvious abnormality in these major
Dach1-expressing organs(64).
The mammalian Dach and Drosophila dac proteins share two evolutionary conserved regions (Dachbox-N and Dachbox-C) which are implicated in protein-protein
interaction (Figure 1A)(7). The N-termini DHD of vertebrate Ski and SnoN proteins
share 28% identity with human DACHbox-N domain, while the C-terminal
oligomerization domain of Ski and SnoN exhibits much weaker homology to the
DACHbox-C domain. The conserved N-terminal DHD domain may mediate common
protein-protein interactions of these Ski superfamily members which are likely to share
not only structural, but also functional properties.
Overview of Embryonic Muscle Development
During post gastrulation vertebrate development, unsegmented paraxial
mesoderm condenses and segments in a rostral to caudal direction to form epithelial
somites on both sides of the neural tube (as reviewed in (65-67)). In response to the
10 extrinsic patterning signals from the adjacent epidermis, neural tube and notochord, the somites differentiate into sclerotome ventrally and dermomyotome dorsally. The sclerotome undergoes an epithelial-mesenchymal transition and differentiates further to give rise to vertebrae and ribs. The dermomyotome maintains its epithelial morphology and subdivides into medial and lateral compartments. Cells from the medial dermomyotome detach and ingress underneath the dermomyotome to form the myotome, which will give rise to epaxial muscles, such as deep back muscle. They are the first cells to differentiate into muscle during embryonic development. The lateral lip of the dermomyotome provides the myogenic progenitors of hypaxial muscles, such as muscles of appendicular, ventrolateral bodywall, tongue, and diaphragm. These progenitors are distinguishable by the expression of the paired box genes, Pax3 and Pax7. At the limb and cervical level, after an epithelial-mesenchymal transition, these myogenic progenitors delaminate from the lip of the dermomyotome and undergo long-range migration to form the tongue, diaphragm and appendicular muscles. At the thoracic and abdominal level, dermomyotome retains its epithelial organization and hypaxial myogenic progenitors don’t migrate but extends ventrally toward the midline to form the ventrolateral bodywall muscle (Figure 2). During muscle development in the limb, two distinct populations of myoblasts, embryonic and fetal myoblasts, temporally contribute to two waves of myogenesis, termed primary and secondary myogenesis, respectively(68, 69). Between
E11.5 and E15.5, the primary (embryonic) myoblasts fuse into primary myotubes as a scaffold for secondary myogenesis, while secondary (fetal) myoblasts remain proliferative. From E15.5, secondary myoblasts progressively enter terminal differentiation and form the final patterning of the limb muscle.
11
12 Fig. 2. Schematic representation of the genetic mechanisms underlying myogenesis in the
different myogenic compartments and at different times (adapted from Birchmeier and
Brohmann, 2000). At E9.5, the epaxial myogenic progenitors are committed to differentiation in the myotome (1), while the hypaxial myogenic progenitors start to
release from the dermomyotome (2). Several genes, such as Pax3 and Met, control this
process. Once these progenitors arrive to their targets sites, they are committed to myogenic lineage, undergo differentiation (3) and finally form hypaxial muscles (4).
Symbols indicate: NT, neural tube; DM, dermomyotome; Myo, myotome; FL, forelimb.
13 A fraction of the myogenic progenitors that migrate into muscle-forming regions
do not commit to terminal differentiation (as reviewed as (70, 71)). In late development these cells are distinguished by expression of Pax7 but not Pax3 and some of them serve
as a reservoir of fetal muscle progenitors. Others become satellite cells, so named
because of their location under the basal lamina of muscle fibers, and comprise the
lineage-restricted progenitor cells of post-natal skeletal muscle.
Genes Involved in Migration of Myogenic Progenitors
The delamination and migration of myogenic progenitors from somites are well- studied processes controlled by several genes including Pax3 (72-77), Met (78, 79), its ligand hepatocyte growth factor/scatter factor (HGF/SF) (78, 79) and Lbx1 (80, 81). Pax3
encodes a paired and homeodomain containing transcription factor that is expressed in
unsegmented paraxial mesoderm first (82) (E8.0) and then throughout the somite (E9.0)
(83). Later on (after E9.0), its expression is restricted to the dermomyotome and then
concentrated in the verntrallateral part of the dermomyotome where the hypaxial
myogenic progenitors arise (84, 85). Pax3 is required for myogenic progenitor’s survival
and the initiation of migration. Pax3 mutant Splotch mice showed a severe defect in all
migratory myogenic progenitor-derived hypaxial muscles, but the epaxial muscles and
the hypaxial muscles derived from the non-migratory myogenic progenitors were less
affected. Further analysis revealed that this defect resulted from a failure of the myogenic
progenitors to delaminate from the dermomyotome and migrate to their target sites (72-
77). Analysis of Splotch mice also revealed markedly reduced Met expression consistent
with an in vitro study that showed transcriptional regulation of Met by Pax3 in cultured
14 cells (73, 76, 86-88). These studies place Pax3 developmentally upstream of Met. Met
encodes a tyrosine kinase receptor and is expressed in the ventral lip of the
dermomyotome. Activation of Met by its ligand HGF/SF mediates epithelial-
mesenchymal transition of dermomyotome cells to generate migratory myogenic progenitors and guides their subsequent migration into limb buds (78, 79). In distal regions, such as limb buds, BMPs function to maintain the viability and proliferative potential of Pax3-positive migratory progenitors (89). In the null mutants of either Met or
HGF/SF, the myogenic progenitors failed to delaminate and migrate out of the dermomyotome and exhibited muscle defects similar to Splotch mice (78, 79). The Lbx1
gene, which encodes a homeodomain transcription factor and is expressed exclusively in
the migratory hypaxial myogenic progenitors, also acts downstream of Pax3 since its
expression is no longer detected in the Splotch mutant (87). In Lbx1-/- mice, myogenic
progenitors failed to migrate laterally into the limb but only some of the limb muscles
were affected, suggesting that Lbx1 is required for the lateral, but not ventral migration of
myogenic progenitors(80, 81).
MRFs Functions in Muscle Development
Although the migratory myogenic progenitors are destined to form skeletal
muscle, they don’t express myogenic regulatory factor genes (Myf5, MyoD, Myog and
MRF4) (67). Targeted inactivation of these genes in mice demonstrated that they are
essential for the skeletal muscle formation in the mouse and play partially overlapping
roles in determination and differentiation of skeletal muscle (as reviewed in(67, 90-92)).
The epaxial progenitors and non-migratory hypaxial progenitors commit to the myogenic
15 program by turning on Myf5 in the dorsal medial dermomyotome and the myotome at
E8.0, followed by the activation of Myog and MyoD expression at E9.0 and E10.0, respectively(93). During their delamination and migration, the migratory hypaxial progenitors do not express the MRFs, but Pax3 and Pax7 (94). Once they reach their destinations, their determination to the muscle lineage is marked by turning off Pax3/7 and expressing the Myf5 and subsequently Myog and MyoD. Previous studies suggested that Myf5 and MyoD are required for myogenic determination while myogenin and
MRF4 act later to control terminal differentiation. Ablation of either Myf5 or MyoD appears to have little or no effect on the muscle formation(95-97), while MyoD-/-/Myf5-/- double knockout mice lack myoblasts and fail to form skeletal muscle (98), suggesting that MyoD and Myf5 play redundant roles in myogenic lineage determination. Disruption of Myog gene in mice blocked myoblast terminal differentiation and fusion, causing a severe deficiency of skeletal muscle formation (99-101). Targeted disruption of MRF4 in mice only causes a mild muscle phenotype compared to myogenin knockout mice (102).
Moreover, genetic studies indicated that the myogenic determination and/or terminal differentiation of satellite cells are also compromised by the absence of the MRF genes,
Myf5, MyoD or Myog (103-107).
Muscle Satellite Cells and Pax7
Muscle satellite cells are responsible for the postnatal growth, repair and maintenance of skeletal muscle (70). Quiescent satellite cells are located underneath the basal lamina of mature skeletal muscle. After being activated by exercise or injury, they undergo multiple rounds of cell division and either undergo differentiation and fuse with
16 new or existing myofibers or return to satellite cell status. Their differentiation is preceded by turning off Pax7 and upregulating MyoD and Myog, while their quiescent status is supported by Pax7 (as reviewed in (70, 71)).
Pax7 is also a paired and homeodomain containing transcription factor and is expressed in somite and adult satellite cells (108-110). It has been shown that the function of Pax7 partially overlaps with the Pax3 gene to keep myogenic progenitors in a proliferative state during embryonic muscle development. Initially, cell culture and electron microscopic analysis suggested that there was a complete lack of muscle satellite cells and severely compromised regeneration in Pax7-/- mice (111, 112). However, recently more sensitive fluorescence-activated cell sorting analysis revealed that the satellite cells can still be detected in these mice, and it is their maintenance or proliferation that appears to be defective (113). These data suggest a role for Pax7 in satellite cell proliferation and survival, but not specification.
Transcriptional Regulation of Muscle-specific Genes by Ski
Previous studies indicated that the regulation of myogenesis by Ski might be mediated by its ability to activate the regulatory elements of muscle-specific genes, such as myosin light chain 1/3 (MLC1/3), muscle creatine kinase (MCK)(114) and most
importantly, Myog (115, 116). The regulatory regions of both MLC1/3 and MCK contain
potent muscle-specific enhancer elements which are active only in differentiated
myotubes. Detailed analysis of the MLC1/3 and MCK enhancers has identified binding
sites for multiple regulatory proteins, including the myogenic regulator factor, MyoD and
myocyte enhancer factor 2 (MEF2) (114). Stimulation of the MLC1/3 enhancer by Ski
17 was mediated by MyoD. However, the transcriptional activity of the MLC1/3 enhancer was reduced when c-ski was cotransfected with MyoD into non-muscle cells (114).
The ability of Ski to activate endogenous Myog expression almost certainly underlies its ability to induce muscle differentiation in vitro and muscle hypertrophy in transgenic mice, in vivo (25, 42, 45). These findings suggest that Ski plays a role in terminal muscle differentiation; consistent with the observation that during mouse development, Ski expression in skeletal muscle is upregulated after the commitment to myogenic differentiation (39).
Regulation of Myog Transcription
The expression of Myog is strictly controlled, both temporally and spatially, during embryonic development. Studies in transgenic mice have shown that a 133-bp regulatory element immediately upstream of the Myog promoter was sufficient for the complete recapitulation of the temporal and spatial expression pattern of Myog during embryogenesis (117-119). Several binding sites for transcription factors are present in this region, including binding sites for MyoD and MEF2 (119-121). Mutation of either site in the myogenin promoter had little effect on LacZ expression, but the mutation of both impaired its expression, suggesting that these two cis-acting elements are important for Myog transcription (117, 122). An in vitro study has shown that the transactivateion of Myog promoter by Ski is mediated through the MyoD/MEF2 complex (115). However, no direct interactions of Ski with these two proteins have been reported.
Recent work has shown that the regulatory elements governing the activation of
Myog are more complex than previously appreciated. Another evolutionarily conserved
18 motif, the MEF3 site (consensus sequence TCAGGTT) is also present in the 133 bp
Myog enhancer and a mutation of this site abolished correct expression of a Myog-LacZ
transgene during embryogenesis (123). The MEF3 site is also found in many other
skeletal muscle-specific regulatory regions and has been shown to mediate the
transcriptional regulation of the muscle-specific cardiac troponin C and aldolase A
promoters both in vitro (124, 125) and in vivo (126, 127). Two skeletal-muscle specific
members of the Six family, Six1 and Six4, bind to the MEF3 element and transactivate
Myog transcription (123).
In vitro studies have revealed that terminal differentiation of myoblasts proceeds
through a highly ordered sequence of events. These cells express MyoD while
proliferating but when growth stimuli are removed, they initiate Myog expression,
followed by the induction of the cyclin-dependent kinase (cdk) inhibitor p21 and
irreversible withdrawal from the cell cycle. Subsequently, these post-mitotic myocytes express muscle-specific contractile proteins such as myosin heavy chain (MHC) and
finally fuse into multinucleated myotubes (128). This process is governed mainly by two families of transcription factors, the MRFs and MEF2, which function in a cooperative manner to activate myogenic-specific gene expression (129-131).
All members in MRF gene family including MyoD, Myf5, myogenin and MRF4, share a highly conserved basic region and adjacent helix-loop-helix motif (bHLH) (as reviewed in (91, 92, 129)). These motifs mediate their heterodimerzation with E2A (E12 and E47) and binding to a conserved consensus DNA sequence CANNTG, known as E box. E boxes are present in the regulatory regions of many muscle specific genes. In myoblast cell culture, MyoD and Myf5 function as markers for the committed myogenic
19 state. They are expressed in both proliferating myoblasts and myotube while Myog
expression strictly coincides with the terminal differentiation. Ectopic overexpression of
any one of the MRF family members is capable of inducing expression of muscle-
specific genes and activation of myogenic differentiation, even in non-muscle cells.
The MEF2 family belongs to the superfamily of MADS (MCM1-agamous
deficient-serum response factor)-box transcription factors and includes MEF2A, MEF2B,
MEF2C and MEF2D (as reviewed in (91, 92, 129)). MEF2A, MEF2B, and MEF2D are
expressed in cardiac muscle, smooth muscle and non-muscle cell types, whereas MEF2C
is restricted to skeletal muscle, brain, and spleen. MEF2 family members share two
highly conserved domains, MADS and MEF2, which mediate DNA binding and
dimerization, respectively. Genetic analysis has demonstrated that members of the MEF2
family are essential for terminal muscle differentiation both in vivo and in vitro (132).
MEF2 proteins can directly bind an A+T-rich element found in the promoters and
enhancers of many muscle specific genes (133). They can also be recruited by bHLH
factors to synergistically regulate the transcription of muscle-specific genes. In addition, the induction of MEF2 by Myog and MyoD during myogenesis suggests that it may function within a regulatory pathway controlled by MRF proteins.
Conserved Network of Dach/Six/Eya
The vertebrate Six family includes sine oculis homeodomain-containing
transcription factors from Six1 to Six6 (134). In vertebrate embryos, Six1 and Six4
expression have been detected in dermomyotome, myotome, limb bud mesenchyme and in migrating myogenic progenitors, suggesting their involvement in muscle development
20 (135, 136). However, Six4-/- mice exhibited no major developmental defects, while Six1-
/- mice had defects in many organs, including craniofacial and muscle deficiencies (135,
136). In addition, Six1-/-Six4-/- mice show an aggravation of phenotype previously
observed in the Six1-/- mice (135). All Six family proteins have two domains in common:
a homeodomain that mediates DNA binding and a SIX-domain that mediates their
interactions with other proteins, such as eyes absent, Eya (134, 137). Six and Eya
function as a complex in a cooperative manner, in which Six mediates DNA binding and
Eya mediates transcriptional activation (138).
There are three members in the mammalian Eya family (Eya1-3) (139-142). The
N-terminal domains of Eya proteins are variable in sequence and mediate transcriptional
activation (139). However, all the Eya proteins share a highly conserved C-terminal domain, known as the EYA domain (55, 61, 137). The EYA domain carries phosphatase activity and also mediates interactions of Eya proteins with the SIX domain of Six proteins (137) and with the Dachbox-C domain of Dach proteins (55, 61). Although Eya has no apparent DNA-binding activity, it can be translocated from the cytoplasm to the nucleus by Six proteins and serves as a co-activator of Six in transcriptional regulation
(138). Eya also can reverse Dach co-repressor function and activate transcription by recruiting other co-activators (58).
Drosophila sine oculis (so), eyes absent (eya) and dac are co-expressed in multiple organs, including eye, somite and muscle (11, 13, 51, 53, 54, 60, 139). Their highly conserved vertebrate homologues Six, Eya and Dach/Ski/SnoN (7, 11, 13) are also co-expressed in these organs (142). Drosophila sine oculis (so) has been shown to act synergistically with eyes absent (eya) and dachshund (dac) by direct protein-protein
21 interactions. Similar interactions underlie the synergism of their mammalian homologues,
Six, Eya and Dach (11, 55-58, 134, 137, 139, 143). This evolutionarily conserved
regulatory network of Eya/Six/Dach has been shown to drive Drosophila eye morphogenesis(55, 57, 60, 137, 144-147) (51) }(11, 13, 54), regulate myogenesis in
chicken somite culture and in the chick limb and activate transcription of reporters
containing the Myog MEF3 site (56, 58).
Our Research Focus
The previous studies of the molecular mechanisms underlying the biological activities of Ski focused on its involvement in tumorigenesis. However, although both in
vivo and in vitro studies clearly implicated Ski in the regulation of myogenesis, our
knowledge is still fragmentary and the underlying mechanisms have not yet been fully
characterized. This study will focus on investigating the molecular mechanisms by which
Ski regulates myogenesis in greater detail.
The major aim of the first part of my study is to identify the cellular and
molecular mechanisms by which the Ski-null mutation leads to the skeletal muscle defects observed in Ski -/- mice.
The previous work in Dr. Colmenares’ lab suggested that Ski-/- mouse embryos exhibited a dramatic reduction of skeletal muscle mass and this defect was not caused by impaired terminal differentiation (47). However, this conclusion was only based on
Northern analyses of RNA prepared from embryos at E13.5~E16.5. Here we will expand our horizon and apply more developmental analyses to investigate the possible mechanisms underlying the regulation of embryonic muscle development by Ski. In
22 general, lineage determination, cell proliferation, cell death and terminal differentiation
all play important roles in organogenesis, including muscle development (89, 148).
Interestingly, Ski has been previously implicated in these biological processes in certain non-muscle cells (25, 42, 44). This led us to hypothesize that Ski might also regulate lineage determination, cell proliferation, cell death or terminal differentiation in muscle cells and that the muscle defect in Ski-null mice might be caused by interference with these processes during muscle development.
A deficiency in myogenic determination at early stages could lead to an insufficient myogenic progenitor pool to undergo differentiation therefore resulting in reduced muscle mass. In the same way, increased apoptosis or defective proliferation of
Ski-/- muscle cells could also cause a dramatic reduction in the number of myogenic progenitors at early stages or myoblasts at later stages. In addition, previous published study only examined terminal differentiation of myoblasts in Ski-/- embryos at
E13.5~E16.5 (47). However, differentiation deficiencies, as either premature or blocked
differentiation, could occur to not only myoblasts at late stages (E11.5~E18.5) but also to
myogenic progenitors at early stages (E9.0~E11.5). Premature differentiation of
myogenic cells occurs at the expense of cell expansion and depletes muscle cell pool,
whereas blocked differentiation results in a lack of myotube formation even with a
sufficient number of myogenic cells. Finally, numerous studies have indicated that
impaired migration of myogenic progenitors to their target sites selectively affects
hypaxial muscle formation (72-81, 87), which led us to consider the possible involvement
of Ski in cell migration.
23 In the present study, muscle formation in Ski-/- embryos was reexamined in greater detail with additional developmental and molecular analyses and molecular markers in order to identify the underlying cause of the muscle defect observed in Ski-/-
embryos. We considered the possibilities that the defect was caused by abnormal fate
determination, cell proliferation, cell survival, terminal muscle differentiation, or
impaired migration of embryonic myogenic progenitors.
The major aim of the second part of my study was to understand not only the role
of Ski in the terminal differentiation of satellite cells-derived C2C12 myoblasts but to
determine how Ski regulates this process.
Although Ski has been implicated in myogenesis by both in vivo and in vitro
studies (25, 42, 45, 47, 48, 149), there are many aspects that have not been investigated or
fully characterized yet. Previous studies only investigated the involvement of endogenous
Ski in differentiation of embryonic myogenic cells, but not that of adult satellite cells
since Ski-/- mice die at birth. However, considering that these satellite cells are the source
for adult muscle regeneration, it is of great interest to determine whether Ski regulates their differentiation. In addition, although overexpression of Ski has been reported to stimulate myogenesis in quail fibroblasts by inducing MyoD and Myog expression (25), the molecular mechanisms underlying the transactivation of these genes by Ski haven’t been fully understood yet. Also very little is known about whether Ski could also control terminal differentiation of determined muscle cells by a similar mechanism. These unresolved questions are all critical if we are to understand the role of Ski in myogenesis.
We hypothesize that Ski regulates the terminal differentiation of satellite cells by regulating the transcription of critical muscle-specific genes. As a transcriptional co-
24 regulator, this activity of Ski is mediated by its interaction with certain DNA-binding partners on the regulatory regions of these target genes. The published study which suggested a cooperation between Ski and MyoD:MEF2 complex only relied on reporter assays and did not demonstrate an interaction between Ski and either of these two proteins (115). Because of that, the possible involvement of MyoD and MEF2 in the transcriptional regulation of Myog by Ski will be re-examined. In addition, recent studies have implicated other cis-elements in the transcriptional regulation of Myog promoter including a MEF3 binding site (117, 119-121, 123, 150). The observation that a Ski family member, Dach, synergized with Six1 and Eya3 to regulate the transcription driven by this cis-element led us to investigate whether Ski also influences this element through a similar cooperation with Six1 and Eya3. Furthermore, since the interaction of mammalian Dach with Six protein is mediated by the evolutionarily conserved DHD motif (55, 151), we tested the possibility that through this conserved domain (7, 11, 13),
Ski interacts with Six and Eya proteins to regulate Myog expression and thereby control commitment of myogenic cells to terminal differentiation (56).
Since Ski-/- mice die prior to birth and techniques to manipulate embryonic myogenic cells are not yet available (47), we were not able to address these issues using the Ski knockout mouse model. Therefore, C2C12 myoblasts were used. C2C12 myoblast is widely-used as an in vitro model to study the behavior of adult satellite cells. These cells were originally obtained through serial passage of myoblasts isolated from the muscles of adult mice shortly after injury and are capable of proliferation and differentiation (152). Inducible gain-of-function and loss-of-function of Ski in C2C12 myoblasts were generated to examine the affect of Ski on terminal differentiation and to
25 identify the downstream direct target genes of Ski. Additionally, the occupancy of Ski on the regulatory region of these genes in the chromatin context was examined and the cis- element(s) and DNA-binding partner(s) which mediate the transcriptional regulation of these genes by Ski were investigated.
26 MATERIALS AND METHODS
1 Materials
1.1 Plasmids
Table 1 Expression vectors (including empty vectors)
Plasmid name Vector (cut) Insert (cut)
LNIT-huSKI LNITX (PmeI) pSHHSKIN1D (BamHIB-ClaIB) Encodes full-length huSKI pCSA pCSA-MyoD (EcoRI) self ligation pCSA-huSKI pCSA (EcoRV) pCDNA3-huSKI (BamHIB-EcoRV) Encodes full-length huSKI
RSV-huSKIEE Encodes full-length c-ski
RSV-delta7EE Deletion of bases 1745~2012 of huSKI
RSV-huSKIDHDEE RSV-SKIEE (AfeI-AscI) PCR product (StuI-AscI) (see Table 11) pCMX-flag-Six1 pCMX-flag (PstIB) pCDNA-Six1 (BamHIB-XhoIB) Encodes full-length mSix1 pCMX-flag-Eya3 pCMX-flag (EcoRI-NheI) PCR product (EcoRI-NheI) (see Table 10) (No 3’UTR) Encodes full-length mEya3 without 3’ UTR pCMX-flag-Mef2c From H-Y. Kao’s lab Encodes full-length Mef2c pCSA-MyoD From M.L. Harter’s lab Encodes full-length MyoD
Table 2 Retroviral vectors for knock-down of Ski
Plasmid name Vector (cut) Insert (cut)
TMP-tTA TMP (EcoRV-BstXI) PCR product (EcoRV-BstXI) (see Table 9)
27 TMP-tTA-mSki1145 TMP-tTA (EcoRI/XhoI) PCR product (EcoRI-XhoI) (see Table 12, 13)
TMP-tTA-mSki1819 TMP-tTA (EcoRI/XhoI) PCR product (EcoRI-XhoI) (see Table 12, 13)
TMP-tTA-mSki1311 TMP-tTA (EcoRI/XhoI) PCR product (EcoRI-XhoI) (see Table 12, 13)
TMP-tTA-mSki977 TMP-tTA (EcoRI/XhoI) PCR product (EcoRI-XhoI) (see Table 12, 13)
Table 3 Luciferase reporters
Myog184 pGL3-Basic (HindIII-SmaI) PCR product (HindIII-StuI) (see Table 14)
Myog1102 pGL3-Basic (HindIII-SacI) PCR product (HindIII-SacI) (see Table 14)
Myog184-MEF2m Myog184 MEF2 site mutant (see Table 15)
Myog184-MEF3m Myog184 MEF3 site mutant (see Table 15)
Myog184E1m Myog184 E1 box mutant (see Table 15)
Myog184E1E2m Myog184E1m E1 and E2 boxes mutant (see Table 15)
Table 4 Plasmids for making in situ hybridization probes
Plasmid name Vector (cut) Insert (cut)
Bluescribe-mMet1837 Bluescribe-Myf5 (HindIII-EcoRI) PCR product (HindIII-EcoRI)
Bluescribe-mMet459 Bluescribe-Myf5 (HindIII-EcoRI) PCR product (HindIII-EcoRI) pVZIIα-mMet167 pVZIIα-MyoD (EcoRI) PCR product(EcoRI)
BluescriptSK-mSkiSE0.35 pBluescript II SK (EcoRV) pmSkiCDS1 (SmaI)
BluescriptSK-mSkiSE0.7 pBluescript II SK (EcoRV) pmSkiCDS1 (SmaI) pVZIIα-mSkiPE0.35 pVZIIα-mMet167 (EcoRI-SmaI) pmSkiCDS1(EcoRI-PvuII) pVZIIα-mSkiSE0.45 pVZIIα-mMet167 (EcoRI-SmaI) pmSkiCDS1 (EcoRI-SmaI)
28 Bluescribe-mHGF07HE Bluescribe-Myf5 (HindIII-EcoRI) pBS-mHGF07 (HindIII-EcoRI) pVZIIα-mHGF07PE PVZIIα-MyoD (PstI-EcoRI) pBS-mHGF07 (PstI-EcoRI)
Bluescribe-mHGF14HE Bluescribe- Myf5(EcoRI-HindIII) pBS-mHGF14 (EcoRI-HindIII)
1. 2 In situ hybridization probes
Table 5 Probes for whole mount in situ hybridization
Probe Plasmid antisense T3/T7 sense T3/T7
MyoD (1342-1785) pVZIIα-MyoD MluI T3 HindIII T7
Myf5 (15-326) Bluescribe-Myf5 HindIII T7 EcoRI T3
Myogenin (250bp) mMYBS1A HindIII T7 EcoRI T3
Pax3 (1156-1675) BluescriptKS-Pax3 HindIII T7 BamHI T3
Ski (969-1320) BluescriptSK-mSkiSE0.35 HindIII T3 EcoRI T7
Ski (263-969) BluescriptSK-mSkiSE0.7 HindIII T3 EcoRI T7
Ski (1773-2123) pVZIIα-mSkiPE0.35 EcoRI T3 HindIII T7
Ski (1320-1773) pVZIIα-mSkiSE0.45 HindIII T7 EcoRI T3
Met (1837-2347) Bluescribe-mMet1837 HindIII T7 EcoRI T3
Met (459-757) Bluescribe-mMet459 HindIII T7 EcoRI T3
Met (167-757) pVZIIα-mMet167 NotI T3 HindIII T7
HGF (871-1098) Bluescribe-mHGF07HE HindIII T7 EcoRI T3
HGF (397-652) pVZIIα-mHGF07PE HindIII T7 EcoRI T3
HGF (40-588) Bluescribe-mHGF14HE EcoRI T3 HindIII T7
Msx1 (300bp) BluescriptSKII-Msx1 EcoRI T7 Asp718 T3
1. 3 PCR templates and primers
Table 6 PCR primers for mouse genotyping
29 PCR primers Sequence
Primer 1 Ski 2980 (forward) 5’-GGGGAGACCATCTCTTGTTTCG-3’
Primer 4 Ski 4258 (reverse) 5’-GACTTTGAGGATCTCCAGCTGG-3’
Old primers (which generate an extra “neo alone” band)
Neo Primer 2 (forward) 5’-GGAGAGGCTATTCGGCTATGAC-3’
Neo Primer 3 (reverse) 5’-CGCATTGCATCAGCCATGATGG-3’
New neo primers
Neo Primer 2 Complement 5’-GTCATAGCCGAATAGCCTCTCC-3’
Neo Primer 3 Complement 5’-CCATCATGGCTGATGCAATGCG-3’
Table 7 Primers for realtime-PCR
Genes Sequence
GAPDH (GenBank NM_008656) Forward: 5'-CATGGCCTTCCGTGTTCCTACC-3'
Reverse: 5'-GATGCCTGCTTCACCACCTTCTT-3'
Myf5 (GenBank NM_008656) Forward: 5'-TATTACAGCCTGCCGGGACA-3'
Reverse: 5'-CTGCTGTTCTTTCGGGACCA-3'
Pax7 (GenBank AF254422) Forward: 5'-CCACCCACCTACAGCACCAC-3'
Reverse: 5'-GCTGTGTGGACAGGCTCACG-3'
Ski (GenBank NM_011385) Forward: 5'-TGCAGTGTCTGCGAGTGAGAAAG-3'
Reverse: 5'-GCAGGGTGGACTGTTCACAACCT-3'
Myog (GenBank NM_031189) Forward: 5'-CCAGTGAATGCAACTCCCACAG-3'
Reverse: 5'-TGGACGTAAGGGAGTGCAGATTG-3' p21 (GenBank NM_007669) Forward: 5'-AGTCAGGCGCAGATCCACAG-3'
Reverse: 5'-ACGGGACCGAAGAGACAACG-3'
MyoD (GenBank M84918) Forward: 5'-CTCTGATGGCATGATGGATTACA-3'
30 Reverse: 5'-CTCGACACAGCCGCACTCTT-3'
Table 8 PCR primers for generating Met in situ hybridization probes
Template cDNA synthesized from total RNA extracted from mouse liver
PCR primers Sequence
167-757 forward 5’-CCCAAGCTTCCTACACGGCCATCATATTT-3’
167-757 reverse 5’-CGAAGGCATGTATGTACTTTATGG-3’
459-757 forward 5’-CCCAAGCTTCATCCAGTCTGAGGTCCACT-3’
459-757 reverse 5’-CGAAGGCATGTATGTACTTTATGG-3’
1837-2347 forward 5’-CCCAAGCTTAAGCGAGAGCACGACAAA-3’
1837-2347 reverse 5’-CACCCACTTCATGCACATCT-3’
Table 9 PCR primers for generating tTA fragment
Template LNITX
Primers Sequence tTA-L 5'-TATATAATATCTTCCTTTGAAAAACACGATGA-3' tTA-R 5'-TATATAGATATCTACCCACCGTACTCGTCAA-3'
Table 10 PCR primers for generating fragment encoding Eya3 ORF for pCMX-flag-Eya3 (No 3’UTR)
Sequence for Mus musculus Eya3 mRNA refer to GenBank NM_010166
Template pCDNA-Eya3
Primers Sequence
Eya3PCR-L 5'-CATGAATTCCAGGAACCAAGAGAACAGACT-3'
31 Eya3PCR-R 5'-CATGCTAGCTCAGAGGAAGTCAAGCTCTAA-3'
Table 11 PCR primers for generating huSKI DHD deletion
Sequence for human SKI mRNA refer to GenBank NM_003036
Template RSV-huSKIEE
Primers Sequence
hkDHD-L 5'- AAAAGGCCTGCAAGAAGGAGCTGG-3'
hkDHD-R 5'- TGCCATAGTCGAATTTCTCC-3'
Table 12 Synthetic DNA oligonucleotides for shRNA targeting mouse Ski
Sequence for Mus musculus Ski mRNA refer to GenBank AF435852
Underlines indicate the sequences of the target sites: sense strands are shown in
lowercase and anti-sense strands are shown in uppercase.
TMP-tTA-mSki1145 oligo 1145 (1145-1163)
TGCTGTTGACAGTGAGCGCGcagtgtctgcgagtgagaaATAGTGAAGCCACAGATG TATTTCTCACTCGCAGACACTGCATGCCTACTGCCTCGGA
TMP-tTA-mSki1819 oligo 1819 (1819-1837)
TGCTGTTGACAGTGAGCGCGcgcaatttgaggaaagagaTTAGTGAAGCCACAGATG TAATCTCTTTCCTCAAATTGCGCTTGCCTACTGCCTCGGA
TMP-tTA-mSki977 oligo 977 (977-995)
TGCTGTTGACAGTGAGCGACcagcttccataagacccaaATAGTGAAGCCACAGATG TATTTGGGTCTTATGGAAGCTGGGTGCCTACTGCCTCGGA
TMP-tTA-mSki1311 oligo 1311 (1311-1329)
TGCTGTTGACAGTGAGCGacgggcaccagagcctcttactTAGTGAAGCCACAGATGT
32 AAGTAAGAGGCTCTGGTGCCCGGTGCCTACTGCCTCGGA
Table 13 Common Primers for generating DNA forms of shRNA inserts
targeting mouse Ski
Primers Sequence
5’ primer for MIR30 5'-CAGAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3'
3’ primer for MIR30 5'-CGCGGCGAATTCCGAGGCAGTAGGCA-3'
Table 14 PCR primers for generating Myog regulatory regions for Myog-
luciferase constructs (Myog184 and Myog1102)
Template: genomic DNA from C57BL/6 mouse tail
Sequence for Mus musculus Myog gene refer to GenBank M95800
DNA fragments containing Myog regulatory region (-1102~+18)
Primers Sequence
Myog1102CR-L 5'-CAAGGAACTGAAGGGGTCTG-3'
Myog1102CR-R 5'-GCTTGTTCCTGCCACTGG-3'
DNA fragments containing Myog regulatory region (-184~+18)
Primers Sequence
Myog184CR-L 5'-AGAAATGAAAACTAATCAAATTACAG-3'
Myog184CR-R 5'-GCTTGTTCCTGCCACTGG-3'
Table 15 PCR primers for generating Myog-luciferase mutants
Note: mutated bases are shown in lowercases.
33 Myog184-MEF2m
Template Myog184
Primers Sequence
MEF2(SDM)F 5'-TCAGGTTTCTGTGGCGTTGGCgggATTTATCTCTGGGTTCATGCC-3'
MEF2(SDM)R 5'-GGCATGAACCCAGAGATAAATcccGCCAACGCCACAGAAACCTGA-3'
Myog184-MEF3m
Template Myog184
Primers Sequence
MEF3(SDM)F1 5'-CAACAGCTTAGAGGGGGGCTCgaGggTCTGTGGCGTTGGCTATATTT-3'
MEF3(SDM)R1 5'-AAATATAGCCAACGCCACAGAccCtcGAGCCCCCCTCTAAGCTGTTG-3'
Myog184-E1m
Template Myog184
Primers Sequence
MyoG-E1-F2 5'-GTTTAAATGGCACCCAGtgGTaGGTGTGAGGGGCTGCGG-3'
MyoG-E1-R2 5'-CCGCAGCCCCTCACACCtACcaCTGGGTGCCATTTAAAC-3'
Myog184-E1E2m
Template Myog184-E1m
Primers Sequence
E2(SDM)F 5'-AAAGGAGAGGGAAGGGGAATtgCAaGTAATCCACTGGAAACGTCT-3'
E2(SDM)R 5'-AGACGTTTCCAGTGGATTACtTGcaATTCCCCTTCCCTCTCCTTT-3'
Table 16 PCR primers for ChIP assays
34 Sequence
Mouse Myog regulatory region (-69~+39) Forward: 5′-GGGCAAAAGGAGAGGGAAG-3′ (GenBank M95800)
Reverse: 5′-AGTGGCAGGAACAAGCCTT-3′
Non-promoter region (+1943~+2185 Forward: 5′-GTCAAGAACTGACTTAAGGCC-3′ downstream of the mouse Myog gene) (GenBank NW_001030662.1) Reverse: 5′-GACACTAGGAGAAGGGTGGAG-3′
Mouse Smad7 regulatory (-274~-142) Forward: 5’-TAGAAACCCGATCTGTTGTTTGCG-3’ (GenBank NW_001030635.1)
Reverse: 5’-CCTCTGCTCGGCTGGTTCCACTGC-3’
1. 4 Reagents
1.4.1 Common reagents for RNA-related experiments
Table 17 DEPC-treated reagents
DEPC-treated H2O Add 1ml DEPC to 1000ml of Milli-Q H2O, mix well and let it set
at room temperature overnight. The next day, autoclave for 30min
and store at room temperature.
DEPC-treated PBS Add 1ml DEPC to 1000ml of 1×PBS, mix well and let it set at
room temperature overnight. The next day, autoclave for 30min
and store at room temperature.
1.4.2 Genotyping
Table 18-1 DNA isolation buffer-1 (For isolation of DNA from yolk sac)
KCl 50mM
35 Tris-Cl (pH8.3) 10mM
MgCl2 2.0mM
Gelatin 0.1mg/ml
NP-40 0.45%
Tween-20 0.45%
Proteinase K 500µg/ml
Table 18-2 DNA isolation buffer-2 (For isolation of DNA from tail)
Tris-Cl (pH 7.5) 100mM
EDTA (pH 8.0) 5mM
SDS 0.2%
NaCl 200mM
Proteinase K 0.2μg/ml
1.4.3 Immunohistochemistry
Table 19-1 Fixation solution
PBS 1×
PFA 4%
Table 19-2 Permeabilization solution
PBS 1×
Triton X-100 0.1%
Table 19-3 Blocking solution
36 PBS 1×
BSA 1%
Heat inactivated goat serum 3%
Tween 20 0.01%
1.4.4 Whole mount in situ hybridization
Table 20-1 STE buffer
Tris-Cl (pH8.0) 10mM
NaCl 10mM
EDTA (pH 8.0) 1mM
Add DEPC-treated H2O
Table 20-2 PBST
PBS 1×
Tween 20 0.1%
Table 20-3 Refixation solution
PBST 1×
PFA 4%
Glutaraldehyde 0.2%
Table 20-4 Hybridization mix
Formamide 50%
37 20×SSC (pH4.5 with citric acid) 5×
SDS 1%
Yeast tRNA (20mg/ml) 50µg/ml
Heparin (50mg/ml) 50µg/ml
Table 20-5 Solution I
Formamide 50%
20×SSC (pH4.5 with citric acid) 4×
SDS 1%
Table 20-6 Solution II
Tris-Cl (pH7.5) 0.01M
NaCl 0.5M
Tween 20 0.01%
Table 20-7 Solution III
Formamide 50%
20×SSC (pH4.5 with citric acid) 2×
Table 20-8 MAB stock (2×)
Maleic Acid 200mM
NaCl 300mM
Ajust pH to 7.5 using NaOH
38 Table 20-9 MABT
MAB stock (2×) 1×
Tween 0.1%
Levamisole 2mM
Table 20-10 Blocking solution
MAB stock (2×) 1×
Tween 0.1%
Levamisole 2mM
BMB blocking reagent (Roche) 2%
Incubate at 65°C for 30min to let the blocking reagent dissolve completely and adjust to pH7.5 with NaOH. Cool to room temperature and add heat-inactivated goat serum to
20% final concentration.
Table 20-11 NTMT
Tris-Cl (pH9.5) 100mM
MgCl2 50mM
NaCl 100mM
Tween 20 0.1%
Levamisole 2mM
1.4.5 Primary culture of satellite cell-derived myoblasts
Table 21 Laminin-coating solution
Tris-Cl (pH7.2) 50mM
39 NaCl 0.15M
Laminin 1µg/cm2
1.4.6 DNA Cloning
Table 22-1 Lysis buffer (For isolation of genomic DNA)
Tris-Cl (pH8.0) 100mM
NaCl 200mM
EDTA (pH8.0) 10mM
SDS 0.5%
Proteinase K 0.1mg/ml
Table 22-2 DNA loading buffer (10×) (For agarose gels)
Glycerol 50%
EDTA (pH8.0) 100mM
SDS 1%
Bromphenol Blue 0.4%
Xylene cyanol 0.4%
Table 22-3 TAE buffer (10×)
Tris 400mM
Acetate 400mM
EDTA (pH8.0) 10mM
Table 22-4 SOB medium
40 BACTO-Tryptone 20g
BACTO-Yeast Extract 5.5g
1M NaCl 10ml
1M KCl 10ml
Add H2O to 1L, autoclave
2+ Add 10ml of 2M Mg (1M MgCl2 and 1M
MgSO4) and 10 ml 2M Glucose before use
Table 22-5 LB medium
BACTO-Tryptone 10g
BACTO-Yeast Extract 5g
NaCl 10g
Add H2O to 1L, autoclave
Table 22-6 LB-Ampr plate
BACTO-Tryptone 10g
BACTO-Yeast Extract 5g
NaCl 10g
Add H2O to 1L, adjust pH to 7.0 with 2N NaOH and add 20g Agar
After autoclave, cool to 55°C and add Ampicillin to 100μg/ml
1.4.7 Cell extracts and Western blotting
Table 23-1 RIPA lysis buffer
41 Tris-Cl (pH 8.0) 50mM
NaCl 100mM
EDTA (pH8.0) 1mM
Glycerol 10%
NP-40 0.2%
Sodium orthovanadate 0.1mM
Sodium pyrophosphate 5mM
NaF 1mM
Complete protease inhibitor cocktails (Roche)
Table 23-2 Protein loading buffer (2×)
1M Tris-Cl (pH6.8) 1ml
Glycerol 2ml
10% SDS 4ml
1% Bromophenol blue 2ml
Add H2O to 10ml
Add 2% β-Me before use
Table 23-3 10% APS
0.1g ammonium persulfate (APS)
Add H2O to 1.0 ml
Ideally use fresh. Can store at -20°C
42 Table 23-4 SDS-PAGE separating gel (6%, 20ml)
H2O 8.2ml
1M Tris-Cl (pH8.9) 7.6ml
10% SDS 0.2ml
29:1 A/B 4ml
10% APS 0.2ml
TEMED 20µl
Table 23-5 SDS-PAGE stacking gel (4%, 5ml)
H2O 7.4ml
1M Tris-Cl (pH6.8) 1.3ml
10% SDS 0.1ml
29:1 A/B 1.3ml
10% APS 0.1ml
TEMED 10µl
Table 23-6 TG-SDS (Gel running buffer, 10×)
Tris 30g
Glycine 144g
SDS 10g
Add H2O to 1L
Table 23-7 Transfer buffer (10×)
43 Tris 60.6g (25mM)
Glycine 242.4g (192mM)
Add H2O to 4L
Before use, dilute 10× Transfer buffer to 1× and add Methanol to 12.5% final concentration
Table 23-8 TBS (10×)
Tris 24.2g
NaCl 80g
Add H2O to 1L and adjust pH to 7.6
Table 23-9 TBST
TBS 1×
Tween 20 0.1%
Table 23-10 Blocking buffer (For Western blot with most of the antibodies)
TBS 1×
Tween 20 0.1%
Nonfat dry milk 5%
Table 23-11 Blocking buffer (For Western blot with anti-Ski G8 antibody)
PBS 1×
Casein (technical grade) 0.4%
44 PVP (MW 40,000) 1%
EDTA (pH8.0) 10mM
Tween 0.2%
Dissolve at 65°C for 2hr and cool to about 37°C
Add Sodium azide to 0.0.2% and adjust pH to 7.4
Table 23-12 Assay buffer
DEA 100mM
MgCl2 1mM
Sodium azide 0.02%
Adjust pH to 10.0
Table 23-13 Stripping buffer
Tris-Cl (pH 6.8) 62.5mM
SDS 2%
β-Me 100mM
1.4.8 Immunofluorescence
Table 24-1 PBS (10×)
Na2HPO4 (anhydrous) 10.9g
NaH2PO4 (anhydrous) 3.2g
NaCl 90g
Add H2O to 1L and adjust pH to 7.2
45 Table 24-2 Fixation buffer
PFA 3.7%
PBS 1×
Table 24-3 Permeablization buffer
PBS 1×
Goat serum 10%
Triton-X 100 1%
Table 24-4 Blocking buffer
PBS 1×
Goat serum 10%
Tween 20 0.1%
1.4.9 Chromatin immunoprecipitation (ChIP)
Table 25-1 Lysis buffer
Tris-Cl (pH8.0) 50mM
EDTA 2mM
NaCl 150mM
Triton X-100 1%
DOC 0.1%
SDS 0.1%
Table 25-2 TE buffer
46 Tris-Cl (pH8.0) 10mM
EDTA 1mM
Table 25-3 Blocking buffer
Salmon testes DNA 1mg/ml
BSA 10mg/ml sodium azide 0.05%
TE 1×
Table 25-4 Pre-blocked protein A beads
Wash 50% Slurry protein A beads (Repligen) twice with cold PBS and TE buffer.
Resuspend beads in blocking buffer to 33% slurry and incubate for at least one day at 4°C
Table 25-5 High salt buffer
Tris-Cl (pH8.0) 50mM
EDTA (pH8.0) 2mM
NaCl 500mM
Triton X-100 1%
DOC 0.1%
SDS 0.1%
Table 25-6 Lithium salt buffer
47 Tris-Cl (pH8.0) 20mM
EDTA 1mM
LiCl 250mM
NP-40 0.5%
DOC 0.5%
Table 25-7 Elution buffer
Tris-Cl (pH8.0) 10mM
EDTA (pH8.0) 5mM
SDS 1%
1.4.10 Immunoprecipitation
Table 26 NETN buffer
Tris-Cl (pH8.0) 20mM
NaCl 100mM
EDTA (pH8.0) 1mM
NP-40 0.1%
Glycerol 10%
DTT 1mM complete protease inhibitors cocktails (Roche)
2 Methods
2. 1 Mouse strains and embryos
48 Generation of C57BL/6 mice with a null mutation of Ski has been described (47,
48). Embryos obtained by heterozygous mating were staged by counting the appearance
of the vaginal plug as day 0.5p.c. and in some cases by determining the number of
somites. Yolk sac or tail DNA was isolated and genotyped by PCR.
2. 2 Genomic DNA isolation
For embryos at E9.0~E12.5, yolk sac were dissected and rinsed thoroughly in
PBS, placed in appropriate amount of DNA isolation buffer-1 (E10.0~E10.5=50µl;
E11.0~E11.5=100µl; E12.0~E12.5=150µl) and incubated overnight at 55°C. The lysate was cleaned by centrifuge at 6,000rpm for 30sec and the supernatant was used for genotyping.
For embryos older than E12.5, mouse tail were dissected and rinsed thoroughly in
PBS, placed into appropriate amount of DNA isolation buffer-2 (E12.5~E15.5=300µl;
E15.5~E18.5=500µl) and incubated overnight at 55°C. The lysate was cleaned by centrifuge at 6,000rpm for 30sec and the supernatant was used for genotyping.
2. 3 Genotyping
PCR reactions using Platinum Taq DNA polymerase (Invitrogen) was set up as follows:
PCR Buffer 1×
MgCl2 1.5mM
dNTPs 200µM each
PCR enhancer 1×
49 Platinum Taq 2.5U
Primers 1~4 200nM each
Genomic DNA 1.5µl
Add sterile Milli-Q H2O to 50µl
The PCR program was:
Step 1 (initial melting) 94°C =4min
Step 2 (amplification) 94°C =30sec
60°C =1min
72°C =1min 30sec
Repeated for 32 cycles
Step 3 (final extension) 72°C =9min
PCR reactions with DNA isolated from Ski+/+, Ski+/- and Ski-/- embryos were used as positive controls and that with H2O only was used as negative control. PCR products were resolved in a 1.0% agrose gel and visualized by ethidium bromide- staining.
2. 4 Histological analysis
Dissected embryos were fixed overnight at 4°C with 3.7% formaldehyde in PBS, embedded in paraffin and sectioned at 12µm. Sections were stained with hematoxylin/eosin and photographed under bright-field illumination with an Olympus
BX50 microscope equipped with a Polaroid PDMC2 digital camera and software. Figures were assembled using Photoshop CS (Adobe).
50 2. 5 Immunohistochemistry
Embryos were dissected in PBS and fixed with 4% paraformaldehyde (PFA) in
PBS at 4°C for varying times depending on the stage. The times were E9.5=1hr;
E10.5=2hr; E11.5=3hr; E12.5=4hr; E13.5~E15.5=overnight and E16.5~E18.5=overnight
(cut into three pieces). The fixed embryos were equilibrated in PBS with increasing concentrations of sucrose (10%, 20% and 30%) at 4°C, then 1:1 30%sucrose/OCT mixture for 1hr at room temperature with gentle rocking and finally embedded in OCT compound (Tissue-Tek, Miles Inc., Elkhart, Illinois, USA). The embryos were positioned as desired at the bottom center of embedding molds (Polysciences) and the molds were quickly placed in pulverized dry ice until the OCT compound was completely frozen.
Embedded samples were stored at -80°C until ready for sectioning. Cryostat sections were cut at 10μm, mounted on Superfrost plus slides (Fisher) and air dried overnight.
Immunofluorescence on equivalent sections from sibling Ski-/- and control embryos was performed as described previously (153). Sections were washed three times in PBS, permeabilized in 0.1%Triton X-100/PBS for 20min and washed again in PBS.
Afterwards, sections were incubated in blocking solution for 10min and with primary antibodies in blocking solution overnight at 4°C. After another three washes in PBS, sections were incubated with secondary antibodies in blocking solution for 45min at RT, washed again in PBS and mounted in aqueous Vectashield (with DAPI).
For immunofluorescence, the following primary antibodies at the indicated dilutions were used: Pax3 (monoclonal, 1/200; Developmental Studies Hybridoma Bank),
Pax3 (rabbit polyclonal, 1/200; kindly provided by Martyn D. Goulding, The Salk
Institute) (80), Lbx1 (polyclonal, 1/200; kindly provided by Martyn D. Goulding, The
51 Salk Institute, CA) (80), Myogenin (F5D, monoclonal, 1/200; Santa Cruz), Myosin heavy
chain (MF20,monoclonal, 1/400; Developmental Studies Hybridoma Bank), Desmin
(D33, monoclonal, 1/400; Dako), phospho-Histone H3(Ser 10) (rabbit polyclonal, 1/200;
Cell Signaling), activated Caspase-3 (Asp 175) (rabbit polyclonal, 1/200; Cell Signaling)
and Pax7 (monoclonal, 1/200; Developmental Studies Hybridoma Bank). Secondary
antibodies were AlexaFluor 488 and 594 (1/300, Molecular Probes). Fluorescent images
were obtained with Olympus BX50 microscope equipped with a PDMC2 Polaroid digital
camera and software. Figures were assembled using Photoshop CS (Adobe).
Experiments were performed on at least 6 sections from 4 or more normal and
mutant siblings with each antibody. Statistical significance (set at P<0.05) of differences
between mutants and controls was assessed using Student’s test.
2. 6 Construction of plasmids for making RNA probes
To generate plasmids for making Met probes, total RNA was extracted from mouse liver using an RNAeasy kit (Qiagen) and cDNA was generated using reverse
transcriptase SuperScript™ III (Invitrogen) with random hexamer primers according to the manufacturer’s instructions. PCR reactions using Pfx DNA polymerase to amplify
Met fragments were set up as following:
Pfx PCR Buffer 1×
dNTPs 300µM each
MgSO4 1mM
Primers 300nM each
cDNA 4µl
52 Pfx (5U/µl) 1.25U
PCR enhancer 0.5×
Add sterile Milli-Q H2O to 50µl
The PCR program was set up as following:
Step 1 (initial melting) 94°C =5min
Step 2 (amplification) 94°C =15sec
55°C =30 sec
68°C =1min 15sec
Repeated for 30 cycles
Step 3 (final extension) 68°C =7min
PCR products were digested with restriction enzymes and cloned into vectors as described in section 2.
To generate plasmids for making Ski probes, fragments containing different regions of the Ski gene were generated by digestion of pmSkiCDS1 with restriction enzymes and inserted into appropriate vectors (see Table 4).
To generate plasmids for making HGF/SF probes, fragments containing different regions of the HGF/SF gene were generated by digestion of pBS-mHGF07 and pBS- mHGF14 with restriction enzymes and inserted into appropriate vectors (see Table 4 and
8).
2. 7 Preparation of digoxigenin (DIG)-labeled RNA probes
53 DIG-labeled RNA probes were prepared from linearized plasmids with DIG RNA
Labeling Mixture (Roche) and T3 (Ambion) or T7 RNA polymerase (Roche) according
to the instructions provided by the manufacturers.
2.7.1 Preparation of template DNA
~20µg DNA plasmid was linearized by digestion overnight at 37°C with a
restriction enzyme that leaves a 5’ overhang. Afterwards, the digestion products were resolved in a 0.8% agrose gel to make sure the digestion was complete. Digested DNA was purified by phenol chloroform extraction and ethanol precipitation. Digested DNA was diluted in RNase-free H2O (Qiagen) to a final volume of 200µl and mixed with 1
volume (200µl) of Phenol/CHCl3/soamyl alcohol (USB). After centrifugation at
12,500rpm, 4°C for 10min, the top aqueous phase was mixed with 1/10 volume of
RNase-free 3M sodium acetate and 2 volume of cold 100% ethanol and kept at -80°C for
15min. DNA was pelleted by spinning at the 12,500rpm, 4°C for 15min and was washed with cold 70% ethanol. Finally, the DNA pellet was air dried and dissovled in ~25µl
RNase-free H2O.
2.7.2 In vitro transcription
In vitro transcription was set up as following:
Linearized plasmid 1µg
Transcription Buffer (with DTT) (Ambion) 1×
DIG RNA Labeling Mix 1×
RNase OUT inhibitor (40U/µl)(invitrogen) 1µl
T7/T3 RNA Polymerase (20U/µl) 2µl
DEPC-treated H2O to 20µl
54 The reaction mixture was incubated for 2hr at 37°C and treated with 1µl of DNase
I (Ambion, 2U/µl) for 30min at 37°C.
Probes used in this study are for Pax3 (75); Msx1 (154); Myog (155), MyoD (155) and Myf5 (156). Met probes were subcloned fragments of bases 167-757 and 1837-2347 of murine Met cDNA (88). Mouse Ski probes were four subclones of bases 263-969, 969-
1320, 1320-1773 and 1773-2123 of Ski cDNA (NM_011385). HGF/SF (NM_010427) probes were three separate clones of bases 322-578, 871-1068 and 1837-2347. All antisense riboprobes revealed reproducible hybridization patterns whereas their corresponding sense probes showed no significant signals.
2.7.3 Purification of labeled RNA probes
Free nucleotide in the DIG-labled probes was romoved using a Spin Column
(Amasham ProbeQuant G-50 column). A ProbeQuant G50 column was vortexed and the bottom closure was snapped off. The cap was loosen ¼ turn and the column was centrifuged into an empty RNase-free Eppendorf tube at 3000 rpm for 1min. The in vitro transcription products were diluted to 50µl by adding DEPC-treated STE buffer, added to the center of the rinse bed and collected in a new RNase-free Eppendorf tube by centrifugation at 3000 rpm for 2 min. Probes were stored at -80 °C.
2.7.4 RNA Probe evaluation
2µl of 1/10 and 1/100 dilutions of the newly synthesized probe and of a set of serial diluted DIG-labeled control RNA (Roche, 100ng/µl) (1/10~1/105) were spotted on a nylon hybridization membrane (Hybond). After the spot dried completely, probes were cross-linked twice onto the membrane at UV 245nm. The membrane was incubated with blocking solution for 15min and then with alkaline phosphatase-conjugated anti-
55 digoxigenin antibody (ALP-conjugated anti-DIG antibody, 1/5000 dilution in blocking
solution) for 30min with gentle rocking. After washes in MABT, the membrane was
equilibrated in NTMT for 2min and incubated with BM purple (Roche) for 10min in the
dark to develop the signal. The signals from the prepared probes were compared to those
of standards to estimate the concentration.
2. 8 Whole mount in situ hybridization
Sibling embryos of different genotypes, but similar size, were analyzed in
parallel. Whole mount in situ hybridization was performed according to a protocol
described by Joyner (157). Embryos were dissected in DEPC-treated PBS, fixed in 4%
PFA overnight at 4°C, washed twice in PBS, dehydrated through 25%, 50%, 75%, and
100% methanol series in PBST (5min each) and stored at -20°C in 100% methanol.
Prior to use, embryos were rehydrated through the reversed methanol series back
to PBST. Embryos were bleached in 6% H2O2/PBST for 30 min at room temperature,
washed three times in PBST, treated with 1µg/ml or 10µg/ml proteinase K in PBST at room temperature for varying time, depending on the stage. The times and proteinase K concentrations used here were E7.5=1µg/ml for 1min; E8.5=1µg/ml for 2min;
E9.5=10µg/ml for 2~3min; E10.5=10µg/ml for 5min; E11.5=10µg/ml for 8min and for each additional day of development, incubation with 10µg/ml proteinase K for 1min was added. The proteinase K treatment was stopped by incubation with 2mg/ml glycine in
PBST for 10min. Embryos were washed three times in PBST and refixed in 4%
PFA/0.2% glutaraldehyde/PBST for 20min at room temperature. After another two washes in PBST, embryos were equilibrated in 1:1 PBST/hybridization mix and then
56 hybridization mix. Afterwards, embryos were incubated with hybridization mix for
20min at room temperature and then for at least 1hr at 70°C. Hybridized was carried out
with 1µg/ml DIG-labeled RNA probe overnight at 70°C. The next day, embryos were
washed through Solution I (70°C, 2×30min), 1:1 SolutionI/Solution II (70°C, 10min),
Solution II (room temperature, 3×5min), 100µg/ml RNase A in solution II (37°C, 30min),
Solution II (room temperature, 5min) and finally Solution III (65°C, 2×30min).
Afterwards, embryos were washed twice in MABT buffer at room temperature, incubated
with blocking solution for at least 3hr at RT and with ALP-conjugated anti-DIG antibody
(1/2000 dilution in blocking solution) overnight at 4°C. Embryos were then washed five
times in MABT 1hr each at room temperature and overnight at 4°C. The next day,
embryos were incubated in NTMT for 30min and stained with BM purple plus 2mM
Levamisole in the dark. After the signals were fully developed, stained embryos were
refixed in 4% PFA/PBST overnight. Stained embryos were dehydrated through PBST,
25%, 50%, 75% and 100% ethanol series and photographed under Zeiss KL1500 LCD
illumination, using a Zeiss stemi SV11 stereomicroscope equipped with a Zeiss AxioCam
color digital camera and Zeiss Axiovision software version 2.0. Afterwards, embryos were rehydrated back to PBST and stored in 70% glycerol/PBST at 4°C. Figures were assembled using Photoshop CS (Adobe). Experiments were performed on 3 or more normal and mutant siblings with each probe.
2. 9 Primary culture of satellite cell-derived myoblasts
Satellite cell-derived myoblasts were isolated from pooled limb muscles of E15.5 or E18.5 embryos by enzymatic dissociation (152) with minor modifications. Limb
57 muscles were dissected and the skin and bone were removed. Muscle tissues were
digested in 2:1 0.05% trypsin-EDTA (GIBCO-BRL) and 100U/ml collagenase III
(GIBCO-BRL) in Hank’s BSS for 4hr (E15.5) or overnight (E18.5) at 4°C. The next day,
most of the enzyme solution was removed, leaving the tissue in ~300µl enzyme solution
at 37°C for 10min (E15.5) or 20min (E18.5). The tissues were further suspended in
serum-free medium and separated into uniform cell suspension by vigorous pipetting.
After the tissue debris was removed by filtration through a cell filter (GIBCO-BRL), the
cell suspension was preplated on standard culture dishes for 1hr to get rid of the fibroblasts. The unattached myoblasts were counted and plated on culture dishes coated
with 1µg/cm2 laminin (GIBCO-BRL) at room temperature for at least 1hr.
Growth medium (GM) was Dulbecco's modified Eagle's medium (DMEM) plus
20% fetal bovine serum (FBS), 0.1mM BME, 10ng/ml human recombinant basic fibroblast growth factor (GIBCO BRL), and 2µg/ml gentamycin (GIBCO BRL).
Differentiation medium (DM) was DMEM plus 2% heat-inactivated horse serum and
2µg/ml gentamycin. GM was changed every 12hr and DM every second day.
Cells were cultured to 60% confluence in GM and switched into DM for the indicated time periods. Cells were fixed in 4% PFA and differentiated myoblasts were detected with anti-MHC (MF20, 1/100) and FITC-conjugated secondary antibodies.
Nuclei were stained with DAPI. Images were taken from representative areas and about
200 total cells/area were counted.
2. 10 DNA Cloning
2.10.1 PCR amplification
58 To generate DNA fragments for subcloning, PCR reactions using Platinum Pfx DNA polymerase (Invitrogen) were set up as follows:
Pfx PCR Buffer 1×
dNTPs 300µM each
MgSO4 1mM
Primers 300nM each
Plasmid DNA 300ng
Pfx DNA polymerase 1.25U
PCR enhancer 0.5×
Add sterile Milli-Q H2O to 50µl
PCR program was:
Step 1 (initial melting) 94°C =2min
Step 2 (amplification) 94°C =15sec
55°C =30sec
68°C=2min
Repeated for 30 cycles
Step 3 (final extension) 68°C =7min
2.10.2 Restriction enzyme digestion
To generate the vectors and inserts for cloning, DNA was digested as follows:
Plasmid DNA/PCR product 1~5µg
NEB buffer 1×
BSA (if needed) 1×
Restriction enzyme (NEB) 30 U
59 Add sterile Milli-Q H2O to 30µl
The reaction was incubated at the appropriate temperature for 2hr.
2.10.3 Generation of blunt-end DNA
To generate blunt ends, the enzyme-digested DNA was subjected to the following reaction:
Enzyme-digested DNA 1µg
T4 DNA polymerase buffer 1×
BSA 50µg/ml
dNTP 200µM each
T4 DNA polymerase (NEB) 1U
The reaction was incubated at 12°C for 15min, resolved in 0.8% agarose gel and the product was purified by a gel purification kit (Qiagen).
2.10.4 Dephosphorylation
To avoid self-ligation, enzyme-digested vector with two compatible ends was subjected to shrimp alkaline phosphatase (SAP, Roche) treatment as follows:
Enzyme-digested DNA (3~5kb) 1µg
SAP buffer 1×
SAP enzyme 1U
The reaction was incubated at 37°C for 10min (sticky end) or 60min (blunt end).
Afterward, the enzyme was heat-inactivated at 65°C for 20min and the dephosphorylated product was used directly for ligation.
2.10.5 Agarose gel separation and DNA purification from gel slices
60 DNA fragments were mixed with DNA loading buffer and separated on 0.8%
agarose gels (for fragments larger than 500bps) or 1.5% agarose gel (for fragments
smaller than 500bps). DNA fragments were visualized by ethidium bromide-staining.
DNA in the gel slices were recovered using a gel purification kit (Qiagen) following the
manufacture’s instructions. The concentration of recovered DNA fragments was
estimated by running an aliquot on a gel in comparison with a 1kb DNA ladder (NEB).
2.10.6 Ligation
In ligation reactions, 200~500ng vector DNA was used and the molar ratio of
insert to vector was around 3:1. The ligation reaction was carried out with T4 DNA ligase
(Roche) as follows:
Insert and Vector 8µl
T4 DNA ligation buffer 1µl
T4 DNA ligase 1µl
The reaction was incubated overnight at 4°C.
2.10.7 Bacterial Transformation
40µl competent cells were transformed with 5µl of the ligation products by
incubation on ice for 30min, heat-shock at 42°C for 1min (XL1-blue supercompetent
cells) or 2min (home made DH5α competent cells) followed by incubation on ice for
another 2min. The transformed cells were then cultured in 1ml SOC medium for 60min at
37°C with shaking (180rpm). Afterwards, cells were pelleted with a brief spin in a
microfuge and resuspended in 100µl LB medium. 50µl of cells were plated on LB-Ampr plates and kept at 37°C for 16~18hr. Clones were picked and cultured in LB medium at
61 37°C. The following day, DNA was extracted using a DNA Miniprep kit (Eppendorf) and
analyzed by enzymatic diagnosis or further verified by DNA sequencing.
2.11 Construction of retroviral vectors LNIT-huSKI and TMP-tTA-mSki
The replication-defective retroviral vector LNITX was kindly provided by Dr. F.
Gage and was described earlier (158). A DNA fragment containing the entire coding
region of the human SKI cDNA was excised from the plasmid pSHHSKIN1D using
BamHI and ClaI, blunt-ended with T4 DNA polymerase, and inserted into the LINTX
vector at the PmeI site to produce LNIT-huSKI.
The replication-defective self-inactivating retroviral vector TMP-tTA was
modified from the TMP vector (kindly provided by Dr. Scott Lowe) (159-161) by
replacing its GFP gene with the tetracycline transactivator gene tTA from the LNITX
vector (158). The sequences of shRNAs targeting mouse Ski were chosen using RNAi
Codex (http://codex.cshl.edu/scripts/newmain.pl) and are designated by their positions in
the mouse Ski cDNA sequence (GenBank AF435852): mSki1145 (bases 1145-1163),
mSki1819 (bases 1819-1837) and mSki977 (bases 977-995), respectively. DNA forms of
these shRNA inserts were generated by PCR amplification of 97 base synthetic
oligonucleotides (Fisher Operon) using Pfu DNA polymerase (Invitrogen) and a common
set of primers (5'-cagaggctcgagaaggtatattgctgttgacagtgagcg-3' and 5'-
cgcggcgaattccgaggcagtaggca-3'). The PCR products were subsequently digested with
XhoI and EcoRI and inserted between these sites within TMP-tTA vector to generate
TMP-tTA-mSki1145, TMP-tTA-mSki1819 and TMP-tTA-mSki977. Clones containing these shRNA-encoding inserts were sequence-verified.
62 The PCR reaction was as follows:
Pfx PCR buffer 2×
dNTP 300µM
MgSO4 1mM
Primer 300nM each
PCR enhancer 0.5×
Pfx DNA polymerase 0.5 U
DNA template 60ng
Add sterile Milli-Q H2O to 50µl
The PCR program was:
Step 1 (initial melting) 94°C =5min
Step 2 (amplification) 94°C =45sec
68°C =1min15sec
Repeated for 25 cycles
Step 3 (final extension) 68°C =7min
2.12 Tissue culture and transfection
Proliferating mouse C2C12 myoblasts were maintained in growth medium (GM) consisting of Dulbecco's modified Eagle's medium (DMEM) (Gibco-BRL) supplemented with 20% fetal bovine serum (FBS, Atalantic Biosolution), 100μg/ml penicillin,
100units/ml streptomycin and 0.002% Fungizone (Gibco-BRL). To avoid spontaneous differentiation, cells were always kept in subconfluent (60-70%) conditions. Terminal differentiation was induced by switching subconfluent cell (80%) to differentiation
63 medium (DM) consisting of DMEM, 2% heat-inactivated horse serum plus antibiotics as in GM.
2.13 Retroviral infection
The retrovirus packaging cell line, PA317 (ATCC No. SD3443) was cultured in
DMEM containing 10% FBS, 100μg/ml penicillin and 100units/ml streptomycin. They
were transfected with retroviral constructs by using Fugene 6 (Roche) according to the
manufacturer's protocol. 24 hr after transfection, the medium was harvested and live cells
were removed by centrifugation at 1000×g for 10min. The retroviral-containing
supernatant was used to infect exponentially growing C2C12 cells at 25% confluence in
the presence of 10ng/ml polybrene (Sigma) to enhance infectivity. The infection was
repeated with freshly-harvested virus 12hr later. After an additional 12hr of culture,
C2C12 cells were switched to GM plus 2μg/ml doxycycline (Dox, an analog of
tetracycline) and antibiotics (G418 at 750μg/ml for LNITX-based constructs and
puromycin at 2ng/ml for TMP-tTA-based constructs). Two weeks later the resulting
individual colonies were isolated using cloning discs according to manufacturer’s protocol (PGC Scientifics, 62-6151-14) and expanded in GM with Dox and G418 or puromycin. After culture in GM minus Dox, clones were screened by western blot analysis for tet-regulated Ski overexpression or knockdown.
2.14 Western blotting
Whole-cell extracts were prepared from confluent C2C12 cells on 100 mm culture dishes (~3 × 106 cells) as follows: cells were washed twice with PBS, scrapped into
64 400µl of RIPA lysis buffer (supplemented with phosphatase and protease inhibitors
complete protease inhibitor cocktail (Roche)). After 10min incubation on ice, the
suspension was subjected to three freeze-thaw cycles and cell debris was removed by
centrifugation at 12,500 rpm for 15min at 4°C. Protein concentrations were determined
by Bradford assay (Bio-Rad) and equal amounts of proteins (20μg ~ 40μg) were boiled in protein loading buffer, separated by 6% SDS–PAGE and liquid transfered to Immobilon-
P membranes (0.45um, Millipore) at 100V for 3hr (small-size gel) or 4 hr (medium-size gel).
For most antibodies, the blots were washed for 10min in TBST, pre-blocked for
1hr at room temperature in blocking buffer and incubated with primary antibodies diluted in the blocking buffer overnight at 4°C. The membranes were then washed three times
with TBST, further incubated for 1hr at room temperature with secondary antibodies
conjugated to horseradish peroxidase (HRP) or alkaline phosphatase (ALP) followed by
thress washes with TBST. Signals were detected using either enhanced chemiluminescent
HRP substrate (Pierce) or CDP-Star® alkaline phosphatase chemiluminescent substrate
(1/50 dilution in assay buffer, Tropix) and exposure to HyBlot CL autoradiography film
(Denville Scientific).
When using anti-Ski G8 monoclonal antibody, the blots were pre-blocked
overnight at 4°C in blocking buffer and then incubated with primary antibody in the same
solution for 30min at room temperature. The membranes were washed twice with
blocking buffer and further incubated with ALP-conjugated secondary antibodies
(Sigma) for 30min at room temperature. Subsequently, the blots were washed with
65 blocking buffer then with assay buffer and the signal was detetected with CDP-Star® alkaline phosphatase chemiluminescent substrate as above.
The following primary antibodies were used for immunoblotting: Ski
(monoclonal antibody, 1/2000, G8, Learner Research Institute Hybridoma Core Facility or rabbit polyclonal antibody, 1/1000, H329, Santa Cruz); Myog (1/1000, F5D, Santa
Cruz), TFIIE-α (1/3000, C-17, Santa Cruz), MHC (1/1000, MF-20, Developmental
Studies Hybridoma Bank), MyoD (1/1000, 5.8A, Santa Cruz) and anti-Flag (1/5000, M2,
Sigma). The secondary antibodies used were: ALP-conjugated anti-mouse IgG (Fc
specific) and anti-rabbit IgG (whole molecule) (1/30000; Sigma); HRP-conjugated
Mouse IgG TrueBlotTM and Rabbit IgG TrueBlot™ (1/1000, eBioscience)
For reblotting the membrane with other antibodies, the membrane was stored in
plastic wrap at 4°C after immunodetection until stripping was performed. The membrane
was submerged in stripping buffer and incubated in a 70°C water bath for 30min with
occasional agitation. The membrane was then washed twice with TBST and Western blotting was performed as described above.
2.15 Immunofluorescence
LAB-TEK® eight-well chamber slides (Nunc) were coated with 1µg/cm2 laminin
(Invitrogen) at room temperature for at least 1hr. To assay the differentiation potential of cultures, C2C12 myoblasts (2×104) were seeded into each well in GM and switched to
DM at 80% confluence for 3 days. Cells were washed three times with PBS and fixed in
3.7% PFA/PBS for 30min at room temperature. After three washes with PBS, fixed cells were permeabilized with 10% goat serum/1% Triton-X 100/PBS for 10min at room
66 temperature, incubated with blocking buffer for 1hr at room temperature and then
incubated with primary antibodies diluted in blocking buffer overnight at 4°C.
Afterwards, cells were washed three times with PBST, incubated with secondary
antibodies for 1hr at room temperature, washed three with PBS again and mounted in
Vectashield aqueous mounting medium with DAPI (Vector Laboratories). Images were
obtained using Olympus BX50 upright fluorescence microscope equipped with a Polaroid
digital camera PDMC2, Polaroid PDMC2 software and fluorescent illumination. Images
were assembled into figures using Photoshop CS (Adobe).
The following primary antibodies were used for immunofluorescence: MyoD
(1/100; 5.8A, Santa Cruz); Myog (1/100; F5D, Santa Cruz), MHC (1/200; MF20;
Developmental Studies Hybridoma Bank) and p21 (1/100; SX118, BD Pharmingen).
Secondary antibodies were Alexa 488 or Alexa594-conjugated goat anti-mouse IgG
antibody (1/300, Molecular Probes). Control experiments performed with normal IgG as the primary antibody yielded no signal above the background.
Quantification was performed by counting at least 1000 DAPI-stained nuclei in
more than 10 random fields per culture plate. For MHC, the differentiation index =
Number of nuclei within MHC-stained multinucleate myotubes/total number of DAPI-
stained nuclei and the fusion index = the average number of nuclei per MHC-stained myotube. For nuclear proteins, the differentiation index=number of antibody-stained nuclei/total number of DAPI-stained nuclei. All experiments were performed in triplicate on three independent cultures and the standard deviation was calculated.
2.16 Quantitative realtime-PCR
67 RNA was isolated using a RNeasy kit (Qiagen) according to manufacture’s
instructions. Briefly, cells from a 100mm dish (~90% confluence) were washed with
DEPC-treated PBS and scrapped into 600µl RLT buffer. The lysate was homogenized by
vortexing, mixed with 1 volume 70% ethanol and RNA was collected by RNeasy spin column. After genomic DNA was removed by on-column DNase I digestion, RNA was eluted from the column in RNase-free water. cDNA was generated using reverse transcriptase SuperScript™ III (Invitrogen) with random hexamer primers according to the manufacturer’s instructions. RNA was incubated with hexamer and dNTPs as
follows:
Total RNA 5µg
Hexamer 200ng
dNTP 1mM
Incubate at 65 °C for 5min and placed on ice for another 2min
Afterwards, this mixture was incubate with
RT buffer 1×
MgCl2 2mM
DTT 10mM
RNase Inhibitor 40U
SuperScriptTM III RT 200U
The reverse transcription program was as follows:
25 °C =10min
50 °C =50min
85 °C =5min
68 Finally, the reaction was incubated with 1µl RNase H (2U/µl) at 37°C for 20min to degrade the RNA template.
Quantitative realtime-PCR (iCycler iQTM, Bio-Rad) was performed with 5-fold diluted RT reaction using SYBR® Green PCR Core Reagents (Applied Bioscience)
according to the manufacturers’ protocols.
The reaction was as follows:
SYBR Green Buffer 1×
MgCl2 3.5mM
dNTPs (with dUTP) 200µM each
Gold Taq DNA polymerase 0.625U
Primers 100nM each
Diluted cDNA 1µl
Add sterile Milli-Q H2O to 25µl
The PCR program was as follows:
Step 1 (initial melting) 94°C =10min
Step 2 (amplification) 94°C =15sec
60°C =20sec
72 °C=20sec
Repeated for 40 cycles
Step 3 (final extension) 72°C =5min
Step 4 (melting curve) starting from 72°C, the temperature was increased
by 0.5°C each cycle until 94°C (totally 44 cycles)
69 Analyses were performed in triplicate on RNA samples from three independent
experiments. Threshold cycles (Ct) of target genes were normalized against the
housekeeping gene Gapdh, and relative transcript levels were calculated from the Ct
values as Y=2-ΔCt, where Y is fold difference in amount of target gene versus Gapdh and
ΔCt=Ctx-CtGapdh.
2.17 Chromatin immunoprecipitation (ChIP)
C2C12 cells cultured in GM or DM for 36hr (~2×107 cells, 150mm plate) were
washed with cold PBS and cross-linked with 1% formaldehyde/PBS for 10min at room
temperature. Fixation was stopped by with the addition of 2.5ml 1.25M Glycine for 5min
at room temperature. Fixed cells were further washed with PBS, scrapped from the plates
and resuspended at 2×107 cells/ml in lysis buffer. Suspensions was sonicated for 8 cycles
of 0.5sec on/0.5sec off for a total of 1min to yield chromatin with an average DNA length of 200~500bp. The size of sonicated chromatin was analyzed as following: 20μl sonicated cells were mixed with 30μl H2O and 5μl 5M NaCl and kept in a thermal cycler at 65°C overnight to reverse the cross-link. Afterwards, samples were treated with 10µg
RNase A at 37°C for 30min and 50µg proteinase K at 45°C for 1.5 hr. After being mixed with 50μl Phenol/CHCl3/isoamyl alcohol and centrifuge at 12,500rpm for 5min, the
aqueous phase was resolved in a 1.5% agarose gel (30V for 45min to diffuse out the salt followed by 100V for 60min) and visualized by ethidium bromide staining.
Equal amounts of sheared chromatin from each sample (2×106 cells per assay)
were preabsorbed at 4°C for 1hr with 40μl 33% slurry of pre-blocked protein A beads
(Repligen). After pelleting the beads by centrifugation, the supernatant was incubated
70 overnight at 4°C with either 2µg rabbit polyclonal Ski antibody (H329, Santa Cruz) or
normal rabbit IgG (Santa Cruz). Antibody-chromatin complexes were captured by
incubation with 40µl 33% slurry pre-blocked Protein A beads for 1hr at 4°C. The beads
were washed sequentially in lysis buffer, high salt buffer, lithium salt buffer and TE
buffer. Complexes were eluted from the beads in 300μl of elution buffer.
The immunoprecipitated DNA and input DNA were mixed with 5M NaCl to final concentration of 0.2M and formaldehyde cross-linking was reversed by overnight incubation at 65°C. Afterwards, a 40µl sample was treated with 10µg RNase A and 50µg proteinase K and DNA was isolated by Phenol/CHCl3/isoamyl alcohol and ethanol
precipitation as described above. The aqueous phase was then incubated with 10µg
glycogen and 2.5 volume of cold 100% ethanol for 1hr at -80°C and DNA was pelleted
by centrifugation for 30min at 12,500rpm. DNA pellets were washed with room
temperature 70% ethanol; air dried and resuspended in 40µl of 10mM Tris-HCl pH8.5.
The optimal PCR cycle numbers were determined by realtime-PCR and 5% of purified
DNA was analyzed by regular PCR using HotStart-IT Taq Master mix (USB). For input
control, 10% of cross-linked chromatin was precleaned and purified as described above
and then assessed for PCR by using the same sets of primers.
The regular PCR reaction was set up as follows:
DNA from ChIP assay 2µl
Primers 100nM each
HotStart-ITTM Taq Master mix 1×
H2O to 25µl
The real-time PCR reaction was set up as follows:
71 DNA from ChIP assay 2µl
Primers 100nM each
HotStart-ITTM Taq Master mix 1×
Fluoresence Dye (Bio-rad) 10nM
SYBR Green (Bio-rad) 0.2×
H2O to 25µl
The PCR program was:
Step 1 (initial melting) 95°C =2min
Step 2 (amplification) 95°C =30sec
60°C =30sec
72 °C=60sec
Repeated for 35 cycles
Step 3 (final extension) 72°C =5min
25% of each reaction mixture was resolved on a 1.5% agarose gel (30V for 45min to diffuse out the salt followed by 100V for 60min) and visualized by ethidium bromide staining.
2.18 Genomic DNA preparation
Cells on 100mm plates were washed twice with PBS, scrapped into three
Eppendorf tubes and pelleted by centrifuge at 5,000rpm for 4min. Each tube of cells was incubated with 1ml of lysis buffer at 55°C with occasional agitation for 3hr and then kept at 55°C without agitation overnight. After being mixed with an equal volume of
Phenol/CHCl3/isoamyl alcohol and centrifuging at 12,500rpm for 10min, the aqueous
72 phase was mixed with 2.5 volume of cold 100% ethanol and DNA was pelleted at
12500rpm for 10min. After washing with 70% ethanol, the DNA pellet was air dry and
dissolved in 250µl TE at 37°C overnight.
2.19 Reporter assays
2.19.1 Construction of luciferase reporters
DNA fragments containing the full-length (-1102~+18, Genbank M95800) or
proximal (-184~+18, Genbank M95800) Myog regulatory region were amplified by PCR
using C57BL/6 genomic DNA as template.
The real-time PCR reaction was set up as follows:
Pfx Buffer 1×
dNTP mix 300µM
MgSO4 1mM
Primers 300nM each
Genomic DNA 360ng
Pfx DNA polymerase 1U
Enhancer 0.5×
Add H2O to 50µl
The PCR program was:
Step 1 (initial melting) 94°C =2min
Step 2 (amplification) 94°C =15sec
55°C =30sec
68 °C=2min
73 Repeated for 30 cycles
Step 3 (final extension) 68°C =7min
Myog184 luciferase reporter carrying the luciferase gene downstream of this
Myog regulatory region was generated by inserting HindIII-StuI digested PCR product
into the HindIII-SmaI site of the pGL3-Basic vector (Promega). Myog-luciferase
constructs with E box, MEF2 and MEF3 mutations (Myog184-E1E2m, Myog184-
MEF2m and Myog184-MEF3m) were generated from Myog184 luciferase reporter using
the QuikChange® Site-Directed Mutagenesis Kit (Stratagene). Mutagenic primers were
designed using Stratagene’s QuikChange® Primer Design Program at
http://www.stratagene.com/qcprimerdesign. Ski expression vector pCDNA-huSki was
previously described (24).
The Site-Directed Mutagenesis PCR reaction was set up as follows:
DNA template (Myog184) 100ng
SDM PCR buffer 1×
Primer 125ng each
dNTP mix 125µM
Pfu DNA polymerase 2.5U
Add H2O to 50µl
The PCR program was:
Step 1 (initial melting) 95°C =30sec
Step 2 (amplification) 95°C =30sec
55°C =1min
68 °C=17min
74 Repeated for 18 cycles
After amplification, 1µl DpnI (10U/µl) was added to the PCR reaction and
incubated for 6hr at 37°C to digest the parental supercoiled dsDNA. 1µl of the DpnI-
treated DNA was transformed into XL1-Blue supercompetent cells and individual clones
were picked and expanded. DNA was extracted from these cells using a Miniprep Kit
(Eppendorf) and sequence-verified.
2.19.2 Reporter assays
Cells (1×105 per well) were seeded in 12-well plates and transfected at 80% confluence using Lipofectamine 2000 (Invitrogen) with a combined total of 4µg expression vector and reporter plasmids DNAs. 18 h after transfection, cells were switched to DM and incubated for another 48hr prior to cell harvest. Transfected cells were washed twice with PBS and then lysis in 70μl of 1× Reporter Lysis Buffer
(Promega) with one round of freeze-thaw followed by incubation at room temperature for
20min with shaking. Cell debris was removed by centrifugation and the luciferase activity in the supernatant was determined by the dual luciferase reporter assay system
(Promega), according to the manufacturer’s instructions. A Renillar luciferase vector pGL3-TK-Renillar was used as an internal control. Briefly, in a 96-well white plate, 70μl cell lysate was incubated with equal volume of Dual-GloTM Luciferase Reagent for 10min
and the Firefly luciferase activity was measured. Afterwards, this mixture was incubated
with 1 volume of diluted Stop&Glo substrate (1/100 in Dual-GloTM Stop&Glo Reagent)
for another 10min and the Renilla luciferase activity was measured. Luciferase units were
determined using a MAXline microplate luminometer (Molecular Devices). The relative
light units (RLUs) were generated by normalizing firefly luciferase units to Renilla
75 luciferase units of the co-transfected pTK-Renilla-luc vector. Relative Response Ratio
was calculated by comparing RLUs of different samples. The experiments were done in
duplicate and the reported results represent at least three independent experiments.
2.20 Immunoprecipitation
C2C12 cells (~ 50% confluent, 100mm dishes) were transfected with expression
plasmids for pCMX-flag-Six1, pCMX-flag-Eya3 (No 3’ UTR), pCMX-flag-Mef2c,
pCSA-MyoD and full-length Ski or its mutants with Lipofectamine 2000. 18 h after
transfection, cells were switched into DM and cultured for 2 days. Cells were scrapped
from the plates, resuspended in 1ml of NETN buffer and sonicated 0.5sec on/0.5 sec off
for a total of 1 min. Cell debris were removed by centrifugation for 15 min at 10, 000rpm
at 4°C and lysate was preabsorbed with 30μl 50% slurry protein A beads for 1hr at 4 °C
followed by centrifugation. After the protein concentration was determined with a
Bradford protein assay (Bio-Rad), a fraction of the cell lysates were subjected to immunoblotting to detect the expression of the proteins of interest and, if needed, the amounts of lysates used for immunoprecipitation were adjusted accordingly.
Immunoprecipitation was carried out as following: ~200µg precleaned lysate was
incubated in parallel with either 4µg rabbit polyclonal anti-Ski (H329, Santa Cruz) or
normal rabbit IgG for 3 h at 4°C. The immunocomplexes were then incubated with 40μl
33% slurry protein A beads (Repligen) overnight at 4°C. Precipitates were washed 5
times in ice-cold NETN buffer, resuspended and released from the beads by boiling in
protein loading buffer for 10 min. The precipitated proteins were separated by 6% SDS–
PAGE and analyzed by Western blotting. If precipitating and primary Western blotting
76 antibodies were from the same species, either HRP-conjugated Mouse IgG TrueBlotTM or
Rabbit IgG TrueBlot™ was used as the secondary antibody accordingly.
77 CHAPTER I: Ski Is Required For Normal Development of Embryonic Progenitors
of Mouse Hypaxial Muscle but Not For Fetal Progenitors or Satellite Cells
This chapter has been submitted to Molecular and Cellular Biology
Abstract
The Ski proto-oncogene encodes a transcriptional co-regulator that stimulates
muscle differentiation in vitro and promotes muscle hypertrophy in vivo. Ski-/- fetal mice
exhibit dramatically reduced skeletal muscle mass. Here we show that the defect is most severe in hypaxial muscles which are derived from progenitor cells that originate in the somite-derived dermomyotome and migrate to distal sites of muscle development. In Ski-
/- embryos the dermomyotome develops normally as does the myotomal epaxial muscle that develops from non-migratory progenitors. Using the myogenic regulatory factors
(MRF) as markers, we found that myogenic determination (Myf5 and MyoD) and
commitment to differentiation (Myog) were initiated appropriately in the absence of Ski.
However, cells expressing MRF genes were reduced in number and restricted to more proximal locations in the limbs. This defect apparently resulted from impaired distal migration of embryonic myogenic progenitors (Pax3 positive) that accumulated at the body/limb bud junction and dorsoproximal region of the limb; not from a failure of myogenic cells to proliferate and differentiate or to excessive apoptosis. Defective migration was not due to reduced BMP signaling or altered expression of HGF/SF but was likely caused by reduced expression of Met, a downstream target of Pax3 and known
effecter of progenitor migration. Although they derive from the same pool of migratory
progenitors as their embryonic counterparts, we found that the number and distribution of
78 fetal myogenic progenitors and satellite cells were not affected by the lack of Ski. When cultured in vitro these Pax7-positive satellite cells gave rise to myoblasts that were fully capable of terminal muscle differentiation.
79 Introduction
The Ski proto-oncogene encodes a bifunctional transcriptional co-regulator that is ubiquitously expressed and participates in several key regulatory pathways. Ski does not bind DNA but associates with DNA binding transcription factors and mediates either transcriptional repression or activation. The best characterized role of Ski is as a co- repressor of the Smad proteins activated by transforming growth factor beta (TGFβ) or bone morphogenetic proteins (BMPs) (21-24). Ski is also a co-repressor of hormone receptors (16, 18, 37), Gli3 (38), MeCP2 (29), and GATA-1 (162). On the other hand, Ski acts as a transcriptional co-activator with NF-I (163), β-catenin (8) and the myogenic regulatory factor (MRF), MyoD (114).
Ski was shown to activate the muscle-specific enhancers of myosin light polypeptide 1 (Myl1), muscle creatine kinase (Ckm) and myogenin (Myog) in cooperation with MyoD (114-116). Co-activation of muscle-specific gene transcription by Ski has been shown to be related to its normal biological function by analyses of transgenic and knock-out mice (45, 47). The ability of Ski to activate endogenous Myog expression
(149) almost certainly underlies its ability to induce muscle differentiation in vitro (42) and muscle hypertrophy in transgenic mice, in vivo (45). These findings suggest that Ski plays a role in terminal muscle differentiation; consistent with the observation that during mouse development Ski expression in skeletal muscle is upregulated after the commitment to myogenic differentiation (39).
Ski has also been implicated in myogenic lineage determination by virtue of its ability to induce the transdifferentiation of fibroblasts into fully functional myoblasts
(42). This role for Ski was also suggested by its expression within the lateral regions of
80 the somites (dermomyotome) that contain the progenitors of skeletal muscle (39). These progenitors do not express muscle-specific genes, including the MRFs, but they are distinguishable by the expression of the paired box genes, Pax3 and Pax7 (70). Some of
the progenitors in the dermomyotome delaminate to form the myotome, which gives rise
to locally differentiating epaxial muscles of the trunk and back (65). Their determination
to the muscle lineage is marked by turning off Pax3/7 and expressing the MRF gene,
Myf5 (92). Hypaxial muscle on the other hand, is derived from progenitors within the
dermomyotome that delaminate and migrate to distal regions, such as the limb buds and
ventral trunk (65). They also commit to the myogenic program by turning off Pax3/7 and
turning on Myf5, MyoD and eventually, Myog expression (92). In Pax3 mutant mice,
delamination and migration of these progenitors are defective, leading to a loss of hypaxial muscle (72-77). Defects in hypaxial muscle formation arising from abnormal migration are also observed in mice lacking either receptor tyrosine kinase Met (78, 79), which acts downstream of Pax3 (73, 76, 86-88) or its ligand hepatocyte growth factor/scatter factor (HGF/SF) (78, 79). Activation of Met by HGF/SF mediates epithelial-mesenchymal transition of dermomyotome cells to generate migratory myogenic progenitors and guides their subsequent migration into limb buds. In distal regions, such as limb buds, BMPs function to maintain the viability and proliferative potential of Pax3-positive migratory progenitors (89).
A fraction of the progenitors that migrate into muscle-forming regions do not commit to terminal differentiation. In late development these cells are distinguished by expression of Pax7 but not Pax3. Some of them serve as a reservoir of fetal muscle progenitors while others become satellite cells, which are located under the basal lamina
81 of muscle fibers and comprise the lineage-restricted progenitor cells of post-natal skeletal
muscle (70). Studies of knockout mice indicate that the specification and function of these cells are defective in the absence of Pax3 or Pax7 and that their myogenic
determination and/or terminal differentiation are compromised by the absence of the
MRF genes, Myf5, MyoD or Myog (70).
Defective skeletal muscle development is also a feature of Ski-null mice (47).
These mice have several additional defects, some of which are highly dependent upon the
genetic background; exencephaly is a prominent feature in 129/S6 Ski-/- mice whereas
midline facial clefting occurs in a C57BL/6J background (48). However, both Ski-/-
congenic strains show hypoplasia and disorganization of several types of skeletal muscle including limb, diaphragm and tongue muscles (47, 48). The muscle phenotype of Ski-/-
mice is reminiscent of that in mice lacking Myog in that most muscles are present but
smaller than normal and with somewhat disorganized myofibers (99, 100). This
similarity, and the fact that Ski was shown to activate Myog transcription, led us to re-
assess Ski expression during early mouse development, to examine MRF gene expression
in Ski knockout mice, and subsequently to investigate BMP signaling and the expression
of Pax3, Pax7, Met, HGF/SF. Our findings reveal a role for Ski in the regulation of
embryonic but not fetal myogenic progenitor migration.
Experimental Procedures
Mouse strains and embryos
Generation of C57BL/6 mice with a null mutation of Ski has been described (47,
48). Embryos obtained by heterozygous mating were staged by counting the appearance
82 of the vaginal plug as embryonic day 0.5 (E0.5). Greater than 90% of C57BL/6 Ski-/-
embryos exhibit midline facial clefting by E12.5. In all comparative studies, sibling
embryos of similar somite number and/or crown-rump size were chosen and genotyped
by PCR using yolk sac or tail DNA.
Histological analysis
Dissected embryos were fixed overnight at 4°C with 3.7% formaldehyde in
phosphate buffered saline (PBS), embedded in paraffin and sectioned at 12 µm. Sections
were stained with hematoxylin/eosin and photographed under bright-field illumination
with an Olympus BX50 microscope equipped with a Polaroid PDMC2 digital camera and
software. Figures were assembled using Photoshop CS (Adobe).
Immunohistochemistry
Embryos were fixed for 1-4 hours at 4°C with 4% paraformaldehyde (PFA) in
PBS, equilibrated in sucrose/PBS at 4°C and embedded in OCT (Tissue-Tek, Miles Inc.,
Elkhart, Illinois, USA). 10μm cryostat sections were mounted on glass slides and immunofluorescence on equivalent sections from sibling Ski-/- and control embryos was performed as described (153). Stained sections were mounted in aqueous Vectashield
(with DAPI) and fluorescent images were obtained with an Olympus BX50 microscope equipped with a PDMC2 Polaroid digital camera. Figures were assembled using
Photoshop CS. Experiments involving cell counts were performed on 4 or more mutant and wild-type pairs with each antibody. Statistical significance (set at P<0.05) of differences between mutants and controls was assessed using Student’s t-test.
The following antibodies at the indicated dilutions were used: Pax3 monoclonal,
1/200, Myosin heavy chain (MHC) monoclonal (MF20), 1/400, and Pax7 monoclonal,
83 1/200 (Developmental Studies Hybridoma Bank); Pax3 rabbit polyclonal, 1/200, kindly
provided by M. Goulding of The Salk Institute (80); Myogenin monoclonal (F5D), 1/200
(Santa Cruz), Desmin monoclonal (D33), 1/400 (Dako); phospho-Histone H3 (Ser 10) rabbit polyclonal, 1/200, and activated Caspase-3 (Asp 175) rabbit polyclonal, 1/200
(Cell Signaling); AlexaFluor 488 and AlexaFluor 594 secondary antibodies, 1/300
(Molecular Probes).
Whole mount in situ hybridization
Embryos were dissected in diethyl pyrocarbonate treated PBS, fixed in 4% PFA at
4°C for 1- 4 hours, washed in PBS, dehydrated stepwise in 25%, 50%, and 75%
methanol in PBT (PBS plus 0.1% Tween 20) and stored at –20°C in 100% methanol.
Fixed embryos were rehydrated through the reversed methanol series back to PBT and
whole mount in situ hybridization was performed as described by Matise and Joyner
(157).
Stained embryos were refixed in 4% PFA/PBT, dehydrated through 25%, 50%,
75%, and 100% ethanol series in PBT and photographed under Zeiss KL1500 LCD
illumination, using a Zeiss stemi SV11 stereomicroscope equipped with a Zeiss AxioCam
color digital camera and Zeiss Axiovision software version 2.0. Figures were assembled
using Photoshop CS. At least three mutant and wild-type pairs were analyzed with each
probe. Control sense strand probes showed no significant signals.
Digoxigenin (DIG)-labeled RNA probes were transcribed from linearized
plasmids with DIG RNA Labeling Mixture (Roche) and T3 (Ambion) or T7 (Roche)
RNA polymerase. Probes for Pax3 (75); Msx1 (154); Myog, MyoD (155) and Myf5 (156)
have been described. Met probes were subcloned fragments of bases 167-757 and 1837-
84 2347 of murine Met cDNA (88). Mouse Ski probes were four subclones of bases 263-969,
969-1320, 1320-1773 and 1773-2123 of Ski cDNA (GenBank accession no.
NM_011385). HGF/SF (GenBank accession no.NM_010427) probes were four subclones of bases 322-578, 871-1068 and 1837-2347.
Primary culture of satellite cell-derived myoblasts and immunodetection of MHC
Satellite cell-derived myoblasts were isolated from pooled limb muscles of E15.5 and E18.5 embryos by enzymatic dissociation (152) with minor modifications. Limb muscles were digested in 0.0375% trypsin-EDTA (GIBCO-BRL), 33 unit/ml collagenase
III (GIBCO-BRL) in Hank’s BSS at 4°C overnight. After preplating the cell suspension on standard culture dishes, unattached myoblasts were counted and plated on culture dishes coated with laminin (1 µg/cm2) (GIBCO-BRL).
Growth medium (GM) was Dulbecco's modified Eagle medium (DMEM)
(GIBCO BRL) plus 20% fetal bovine serum (GIBCO BRL), 0.1 mM BME, 10 ng/ml human recombinant basic fibroblast growth factor (GIBCO BRL), and 2 µg/ml gentamycin (GIBCO BRL). Differentiation medium (DM) was DMEM plus 2% horse serum (GIBCO BRL) and 2 µg/ml gentamycin. GM was changed every 12 hour and DM every second day.
Cells were cultured to 60% confluence in GM then cultured in DM for the indicated time periods. Cells were fixed in 4% PFA and differentiated myoblasts were detected with anti-MHC (MF20, 1: 100) and FITC-conjugated secondary antibodies.
Nuclei were stained with DAPI. Images were taken from representative areas and about
200 total cells/area were counted.
Quantitative realtime-PCR
85 Isolation of RNA using RNeasy (Qiagen), reverse transcription using
SuperScript™ III (Invitrogen) and quantitative realtime-PCR (iCycler iQTM, Bio-Rad)
using SYBR® Green PCR Core Reagents (Applied Bioscience) were performed
according to the manufacturers’ protocols. The PCR primers were: Myf5 (GenBank accession no. NM_008656) forward: 5'-TATTACAGCCTGCCGGGACA-3'; reverse: 5'-
CTGCTGTTCTTTCGGGACCA-3' and Pax7 (GenBank accession no. AF254422)
forward: 5'- CCACCCACCTACAGCACCAC-3'; reverse: 5'-
GCTGTGTGGACAGGCTCACG-3'. Triplicate analyses were performed on samples from three independent cultures. Relative transcript levels were calculated from the threshold cycle numbers (Ct) as Y=2-ΔCt, where Y is fold difference in amount of Myf5 or
Pax7 versus Gapdh and ΔCt=CtMyf5-CtGapdh or CtPax7-CtGapdh.
Results
Selective muscular hypoplasia of Ski-/- embryos
Previous studies (47) revealed a dramatic reduction in skeletal muscle mass in Ski-
deficient mice but the underlying mechanism was not determined. As a first step in
analyzing the defect, we performed an extensive histological examination of the muscle
of perinatal mice at E18.5. Examples of this analysis in Fig. 3 show that the loss of Ski
affects development of hypaxial muscle to a much greater extent than epaxial muscle.
Distal hypaxial muscles of the limb, such as flexors and extensors along the ulna and
radius, show significant reductions in size and some muscles are completely absent (Figs.
3A-B2). Other limb muscles such as the triceps brachii are markedly reduced in size and
disorganized (Figs. 3C-D2). However, shoulder muscles (around the scapula) are present
86
87 Fig. 3. Selective muscular hypoplasia in prenatal Ski-/- mice. Hematoxylin/Eosin-staining
of transverse sections of E18.5 Ski+/- (A, C, E, G) and Ski-/- (B, D, F H) embryos. (A, B)
Distal forelimb muscles are absent (arrowheads) or severely reduced (arrows) in the Ski-/-
embryo. (A1, B1, A2, B2) Higher magnification of A and B showing areas with muscle
defect; r, radius; u, ulna. (C, D) Proximal forelimb showing reduction of triceps brachii
(arrows and arrowheads) in Ski-/- embryo compared to normal littermates. (C1, D1, C2,
D2) Higher magnification of areas indicated by arrows and arrowheads in C and D; h,
humerus. (E-H) Shoulder (arrowheads) and back (arrows) muscles are normal in size
although distorted in shape and position due to severely reduced brown fat formation in
the absence of Ski; s, scapula; bf, brown fat. Scale bar (A-D, E-H) 125μm, (A1-D2)
50 μm.
88 and only slightly affected in Ski-/- embryos (arrowheads, Figs. 3E and F). Back muscles
are even less affected and some are comparable to the control (arrows, Figs. 3E-H).
Although Ski-/- mutants are leaner than controls, bones of both the shoulder (scapula) and the limb (humerus, ulna and radius) appear normal in diameter and length. This
observation and the relatively normal epaxial muscle suggest that the Ski null mutation
results in a specific reduction of hypaxial myogenesis rather than a general growth defect
or developmental delay.
To determine whether the defect in hypaxial muscle development was apparent at
earlier stages, we assessed the presence and size of muscle groups at E12.5 and E15.5.
Myosin Heavy Chain (MHC) staining revealed development of appropriate muscle
groups in the trunk and proximal limbs of Ski-/- embryos, but the sizes of these muscles
appeared markedly reduced compared to the wild types (Fig. 4). This phenotype was
more severe in the distal forelimbs where some muscle groups were completely missing
(arrowheads, Figs. 4E and F). Results obtained by staining adjacent sections with anti-
desmin antibody were virtually identical to the observations of MHC staining (data not
shown). Thus the defect in hypaxial muscle development was already apparent at the
onset of secondary myogenesis at E12.5.
Dynamic expression of Ski in the developing neural tube, somites and limb buds of mouse
embryos
The hypaxial muscle defects observed in the Ski-null mice could be due either to
early effects on migration and/or commitment of progenitors, or to later effects on
terminal differentiation. To determine whether the pattern of Ski expression during
development can distinguish among these possibilities, Ski mRNA expression in mouse
89
90 Fig. 4. Hypoplasia of limb muscle in Ski-/- embryos at mid and late gestation.
Immunofluorescence with anti-MHC on transverse thoracic sections of E12.5 and E15.5 wild-type (A, C, E) and Ski-/- embryos (B, D, F). Forelimb muscles were either severely reduced in size (compare the boxed areas in A, B magnified in A1, B1 and panels C-F, arrows) or virtually absent (E, F, arrowheads) in the Ski-/- mutant. Scale bar (A, B, C-F)
125μm, (A1, B1) 50 μm.
91 embryos from E9.5 to E12.5 was examined by whole mount in situ hybridization. At E9.5
Ski mRNA expression was highest in the neural tube but was also detected laterally in the somites (Figs. 5A and A1). At E10.5 (Fig. 5B), Ski expression in the spinal cord had decreased rostrally and exhibited a gradual increase toward the tail region where it was also observed in the most recently formed somites and in presomitic mesoderm. Ski was also highly expressed throughout the apical ectodermal ridge (AER) of the limb buds and in the underlying limb mesenchyme in a distal to proximal decreasing gradient. At E12.5,
Ski expression in the distal limbs was highest in the interdigital mesenchyme (Fig. 5C).
The results revealed that Ski expression during early mouse embryogenesis is highly dynamic in the neural tube, somites and limb buds. Combined with previously published data which also revealed stage-dependent expression of Ski in body wall muscles (39, 40), these results are consistent with a role of Ski in hypaxial muscle development, but they do not discriminate between an early role in determination or migration and a later role in differentiation.
Determination and differentiation of myogenic progenitors in Ski-/- embryos
To investigate the origins of the selective muscle defects in Ski knockouts, the initiation and progression of epaxial and hypaxial myogenesis were examined at earlier stages. Although these two types of muscles arise from distinct developmental pathways, the MRF genes are required for the determination and differentiation of both. Epaxial muscle originating in the myotome is the first skeletal muscle to be generated (65). The emergence of determined myogenic cells in the myotome is marked by activation of Myf5
(156, 164), which is followed by Myog expression as these cells commit to terminal differentiation (155). To establish whether loss of Ski affects the determination or
92
93 Fig. 5. Dynamic expression pattern of Ski during mouse development. Whole mount in situ hybridization with Ski probes was performed on E9.5 (22 somites) (A, A1), E10.5
(30 somites) (B) and E12.5 (48 somites) (C) embryos. Expression in the neural tube
(white arrow), somites (arrowhead) and limb buds (black arrows) is indicated. nt, neural tube; so, somite; fl, forelimb; hl, hindlimb. Scale bar (A) 100μm, (A1) 50μm, (B)
125 μm, (C) 250 μm.
94 differentiation of myogenic progenitors, the distribution of Myf5-positive (Myf5+) or
Myog+ cells was examined in E9.5 embryos, while undetermined progenitors in the
dermomyotome were identified by Pax3 expression (Figs. 6A and B). In the Ski-/-
embryos, the distribution of Myf5+ and Myog+ cells in the myotome was very similar to that of the wild type embryos. This observation suggests that development of epaxial muscle in the myotome is Ski-independent, in agreement with the finding that at later stages these muscles are relatively normal in the Ski-/- embryos. Furthermore, the
absence of Myf5+ and Myog+ cells in the Pax3+ dermomyotome of mutant embryos
indicates that hypaxial myogenic progenitors do not prematurely commit to
differentiation in the absence of Ski.
At E10.0, hypaxial myogenic progenitors that have migrated to their distal locations also initiate myogenesis by activating expression of MRFs (92). To investigate whether the myogenic program is activated normally in the absence of Ski, we examined the expression of Myf5, MyoD and Myog by whole mount in situ hybridization. In wild type embryos at E10.0, Myf5 transcripts were present in the myotome of all somites as well as in the distal locations populated by migratory myogenic progenitors (Figs. 6C and
E). In contrast to the normal expression of Myf5 in the myotome its expression in the forelimb buds of Ski-/- embryos was impaired compared to that of controls (Figs. 6D and
F). At E10.5 MyoD expression reflected this pattern with normal levels in the myotome but greatly reduced levels in the limb buds (Figs. 6G-J). By this stage of development, expression of Myog initiates terminal muscle differentiation in the myotome and in the limb buds (155). Consistent with the observed patterns of Myf5 and MyoD expression, expression of Myog in Ski-/- embryos was similar to that of control embryos in the
95
96 Fig. 6. Specification and activation of epaxial and hypaxial myogenesis. (A, B) Thoracic transverse sections of wild-type and Ski-/- E9.5 embryos were examined by double immunofluorescence for expression of Pax3 and Myf5 (A) or Pax3 and Myog (B). (C-N)
Whole mount in situ hybridization for Myf5 (C-F) of E10 (30 somites) embryos or for either MyoD (G-J) or Myog (K-N) of E10.5 (34, 38 somites) embryos. Note normal expression of MRF genes in the myotome (arrowheads) but decreased extent and distribution of expression in the limb buds (arrows) of Ski-/- embryos. Scale bar (C, D, K-
N) 150μm, (E, F, I, J) 100 μm, (G, H) 200 μm.
97 myotome but not in the limb buds (Figs. 6K and L). The dense groups of Myog+ cells that
extended ventrally and distally in the forelimb buds of wild-type embryos (Fig. 6K) were
dramatically depleted proximally and almost undetectable distally in Ski-/- embryos (Fig.
6L). A similar deficiency was observed in the hind limbs (Figs. 6M and N).
The analysis of MRF gene expression indicated that, in the absence of Ski,
differentiation of myotomal epaxial muscle was normal, but the determination and
commitment of hypaxial myogenic precursors, although initiated appropriately, was
defective in extent and pattern. To determine whether this problem persisted during the
transition from primary to secondary myogenesis, we analyzed hypaxial muscle formation
at successive stages, using desmin as a marker for all myoblasts and Myog to identify
myoblasts committed to terminal differentiation. At E11.5, the first appearance of hypaxial musculature was observed at the body-limb junction and in the proximal forelimb (Fig. 7). Although masses of desmin+ myoblasts had formed at the body-limb
junction of both Ski-/- and wild type embryos (red arrows, Figs. 7A and B), the spread of
these myoblasts into the forelimbs was markedly compromised in Ski-/- embryos, with
few desmin+ cells detected proximally and none detected distally (white arrows and
arrowheads, Figs. 7A and B). Myog+ cells were found in the proximal limb (arrow, Fig.
7C) and extending in two streams ventrally and dorsally toward the distal end of the limb
in wild-type embryos (arrowheads, Fig. 7C). By contrast, Myog expression in Ski-/-
embryos was markedly reduced in both intensity and extension into the distal and ventral
forelimb (arrow and arrowheads, Fig. 7D), confirming the observation of desmin staining.
In summary, these results indicate that in Ski-/- embryos determination and commitment
98
99 Fig. 7. Normal commitment to terminal muscle differentiation in the forelimbs of Ski-/-
embryos. Transverse sections of Ski+/+ and Ski-/- embryos were examined by
immunofluorescence with antibodies to desmin (A, B) or Myog (C, D); nuclei were
stained with DAPI. (A, B) Note the accumulation of desmin+ cells at the limb/body
junction (red arrows) and the very low numbers of these cells in the limb (white arrows and arrowheads) of the E11.5 Ski-/- embryo. (C, D) The number of Myog+ cells was
reduced in Ski-/- embryos, particularly in the distal and ventral regions of the limb
(arrows and arrowheads). (E-H) At both E12.5 and E15.5, reduced numbers of Myog+ cells in the Ski-/- embryos (F, H) compared to the Ski+/+ littermates (E, G). (I) the percentage of Myog+ nuclei (values above bars) was not significantly reduced in Ski-/-
embryos (P>0.3). Error bars = standard deviation, n= number of samples. Scale bar (A-D)
75μm, (E-H) 50 μm.
100 to differentiation are initiated correctly in both epaxial and hypaxial muscle, but the latter
exhibit defects in both the distribution and the abundance of committed myogenic cells.
Analysis of Myog expression at later stages revealed that the reduction of
committed myoblasts persisted in the Ski-/- embryos. At E12.5 and E15.5, the total
number of Myog+ cells in individual muscles of the mutants was consistently reduced compared to their counterparts in the wild-type (Figs. 7E-H). This reduction could have
resulted either from a decrease in the number of myogenic progenitors or from a block in
their commitment to differentiation. These alternatives were distinguished by comparing
the percentage of Myog+ cells in corresponding muscles of wild type and Ski-/- embryos.
In the case of reduced numbers of myogenic progenitors but normal commitment, this
percentage should be similar in both genotypes. If, on the other hand, there were normal
numbers of progenitors in Ski-/- embryos but impaired differentiation, the percentage of
Myog+ cells would be reduced. We found that the percentage of Myog+ cells was not
significantly different between Ski-/- and Ski+/+ littermates (Fig. 7I). Thus, the reduction in the total numbers of Myog+ cells and the subsequent large reduction in the size of
hypaxial muscle in the mutant (Figs. 3 and 4) did not appear to be due to a block in
commitment to terminal differentiation.
Taken together, our data indicate that the reduced size of hypaxial muscle groups
in the Ski-/- embryos appears to result from neither premature nor defective differentiation, but from an insufficient pool of myogenic progenitors that give rise to the committed myogenic cells. This deficiency could be the consequence of reduced proliferation, abnormal apoptosis or defective migration. We examined the numbers of mitotic and apoptotic myogenic cells in E10.5, E12.5 and E15.5 embryos by
101 immunofluorescence with antibodies for phosphorylated histone H3 and activated caspase-3, respectively. No significant differences in the levels of proliferation and apoptosis in either the Pax3+ progenitors or the desmin+ muscle cells were observed in mutant compared with wild-type embryos (Fig. 8), ruling out these processes in the defective accumulation of distal myogenic cells.
Altered migration of myogenic progenitors in Ski-/- embryos
In light of the above results we hypothesized that defective migration of progenitors was responsible for the selective defect in the hypaxial muscle of Ski-/- embryos. This possibility was attractive because the phenotype of Ski-/- embryos is reminiscent of Pax3-deficent Splotch mice and of Met-/- or HGF-/- mice which also show severe deficits in hypaxial limb muscle and less affected epaxial muscle. The selective muscle defects in these mutants result from impaired delamination and migration of myogenic progenitors (72, 73, 75, 77-79, 86, 88). Thus the hypaxial muscle defect in the
Ski-/- embryos might result from decreased expression of Pax3, Met and/or HGF.
To test this hypothesis, we examined Pax3 expression as an indicator of the formation, distribution, and migration of myogenic progenitors. Results of whole mount in situ hybridization of E9.5 and E10 embryos showed that the expected expression of
Pax3 in the dorsal neural tube was comparable in wild-type and Ski-/- embryos, as was the morphology of the Pax3+ dermomyotome (Figs. 9A-F, also Fig. 6). At both stages,
Pax3 was also expressed in myogenic progenitors that had delaminated and migrated into the forelimb bud of wild-type embryos. However, in the Ski-/- mutants Pax3+ cells had migrated to the proximal forelimb bud but did not extend as far into the limb bud as in the
102
103 Fig. 8. Normal level of proliferation and apoptosis in the myogenic progenitors or muscle cells in the absence of Ski. Transverse sections of Ski-/- embryos and normal littermates at E10.5 (A, B, H, I), E12.5 (C, D, J, K) and E15.5 (E, F, L, M) were analyzed for the numbers of mitotic cells (anti-p-H3, A-F) or apoptotic cells (anti-caspase 3, H-M) by immunofluorescence. Myogenic progenitors and myoblasts were labeled with anti-
Pax3 and anti-desmin antibodies, respectively. (G) Quantitative data are presented as the number of mitotic cells per unit muscle area (values above bar) and the values for mutant and wild type embryos were not significantly different (P>0.3). n is the number of samples. The numbers of apoptotic cells were too small to calculate significance.
104
105 Fig. 9. Impaired migration of myogenic progenitors in Ski-/- embryos. Expression of
Pax3 in wild-type and Ski-/- E9.5 (25 somites) and E10.0 (28 somites) embryos was analyzed by whole mount in situ hybridization. (A, B) At E9.5, Pax3+ cells invaded the
forelimb buds in the wild-type, but accumulated at the body/limb junctions in the mutant
(arrows). Note similar expression of Pax3 in the neural tube and dermomyotome of wild-
type and Ski-/- mutant (arrowheads). Lateral views of Ski-/- E10.0 embryos (D) show comparable expression of Pax3 in dermomyotome (black arrowheads) and neural tube
(white arrowheads) to that of the wild type (C). Whereas dorsal views of hindlimbs (E, F)
reveal reduced numbers and less distal extension of Pax3+ cells in the Ski-/- embryos than in the wild-type (arrows). (G, H) Immunofluorescence with anti-Pax3 of thoracic transverse sections of E10.5 embryos. In the wild-type, larger numbers of Pax3+ cells progressed dorsally and ventrally toward the distal forelimb than in the Ski-/- embryo
(arrows) where they accumulated at the dorsal limb/body junction (arrowheads). (I-K)
Quantification of Pax3+ cells in G and H shows their number in the forelimb (I); their
maximum extension as a percentage of the full length of the forelimb (J); and their
distribution in proximal, middle and distal regions. Values above the bars represent the
number or percentage of Pax3+ cells and the error bar represents the standard deviation, *
denotes P<0.05 and n is the number of samples. Scale bar (A-H) 50 μm.
106 wild-type (Figs. 9A and B). The difference in migration was also evident in the hindlimb
(Figs. 9E and F).
The distribution of myogenic precursors in E10.5 forelimbs of embryos was further analyzed by immunofluorescence with Pax3 antibody. Consistent with the mRNA expression data, we detected extensive invasion of the limb by Pax3+ myogenic progenitors in wild-type embryos, but in the Ski-/- embryos these cells appeared to accumulate at the body-limb junction (arrowheads, Figs. 9G and H also Fig. 6) and migrated into the distal limb in significantly reduced numbers (p<0.05) (Figs. 9G-K).
The difference was even more pronounced in the ventral half of the limb (arrows, Figs.
9G and H). By E11.0, migration of myogenic progenitors to the forelimb was completed and expression of Pax3 decreased thereafter (data not shown).
The apparent migration defect led us to examine the expression of Met and its ligand HGF/SF, which mediate delamination and migration of myogenic progenitors. At
E10.5, Met expression was detected in migratory progenitors in the lateral dermomyotome and forelimb buds of the wild-type (Figs. 10A and C), but was barely detectable in the lateral lip of the dermomyotome and notably reduced in limb buds of the
Ski-/- embryos (Figs. 10B and D). Unlike Met, HGF/SF expression in the limb bud mesenchyme, which provides a signal for migration into the limb, was indistinguishable between the Ski-/- mutant and the normal control (Figs. 10E-H).
Altered BMP signaling has also been implicated in defective Pax3+ progenitor accumulation (89). Moreover, Ski has been shown to regulate BMP signaling in cultured cells (28) and Ski expression in the AER (Fig. 5B) overlaps that of BMP (165). To assess a possible role of BMP in the hypaxial muscle defect of Ski-/- embryos, we examined the
107
108 Fig. 10. Loss of Ski affects the expression of Met but not HGF/SF or Msx1. Expression of
Met, HGF/SF and Msx1 in wild-type and Ski-/- E10.5 (33, 28, 29 somites) embryos was analyzed by whole mount in situ hybridization. Lateral (A, B) and dorsal (C, D) views show expression of Met at the lateral lips of dermomyotome (arrowheads) and in the limb buds (arrows) of the wild-type (A, C), but at appreciably lower levels in the Ski-/- mutant
(B, D). Lateral (E, F) and dorsal (G, H) views show HGF/SF is expressed at comparable
level along the migration route and at the target sites in the limb bud mesenchyme
(arrows) of wild-type (E, G) and Ski-/- mutant (F, H). (I, J) Lateral view of Msx1
expression reveals an indistinguishable pattern of BMP signaling in the wild-type and
Ski-/- mutant (arrows). Scale bar (A-J) 100 μm.
109 expression of Msx1, a direct transcriptional target of BMP signaling in the limb bud
(166). We found that the pattern and level of Msx1 expression was indistinguishable in
the limb buds of wild-type and Ski-/- embryos (Figs. 10I and J), suggesting that BMP
signaling in the limb bud is not affected by the loss of Ski. Taken together, our results
strongly suggest that in the absence of Ski, migration of hypaxial myogenic progenitors
into the limb is impaired due to the down-regulation of Met expression. This results in an
insufficient number of myogenic cells to support normal hypaxial muscle formation.
Normal specification of fetal/postnatal myogenic progenitors in Ski-/- embryos
Recent data support a model in which a pool of Pax3+/Pax7+ cells in the
dermomyotome is the source of both embryonic and fetal/postnatal myogenic progenitors
(70). We have shown that defective migration of the Pax3+ embryonic component of that
pool early in development is responsible for the underdevelopment of distal hypaxial
muscle in Ski-/- mice. At later developmental stages, the cells that comprise fetal
myogenic progenitors and satellite cells are marked by the expression of Pax7 (70). To determine whether the establishment of these cells at their target sites was also affected by the lack of Ski, we scored the number of Pax7+ cells in fetal muscles at E15.5 (Fig. 11)
and E18.5 (Fig. 12). We found that, despite their reduced size, individual muscles of Ski-
/- fetuses contained about the same total numbers of Pax7+ cells as the wild type, and at
E18.5 a large fraction of these cells assumed the satellite position under the basal lamina
(Figs. 11A and B and Figs. 12A-D). In fact, because the muscles in the mutant contained
fewer myotubes, the number of Pax7+ nuclei per myotube was higher in the Ski-/- fetuses than in the controls (Fig. 11C and Fig. 12E).
110
111 Fig. 11. Loss of Ski doesn’t affect in vivo accumulation or in vitro differentiation of fetal
myogenic progenitors. (A-D) Immunofluorescence of thoracic transverse sections of
E15.5 Ski-/- embryos and normal littermates with anti-laminin and anti-Pax7. In both
Ski+/+ and Ski-/- embryos a large fraction of Pax7+ cells are positioned under the basal
lamina of myotubes. Similar total numbers (A, B) of Pax7+ cells but increased density per
myotube (C numbers above bars) in individual muscles of Ski-/- embryos compared to controls. Error bars = standard deviation of multiple muscles in three independent experiments. (D-G) Myoblasts isolated from limb muscle of E15.5 embryos were plated in GM (D, E). When they reached ~60% confluence cells were switched to DM and photographed at 48 hours (F, G). Myotube formation by Ski-/- cells was comparable to that of the controls.
112
113 Fig. 12. Loss of Ski doesn’t affect in vivo accumulation or in vitro differentiation of satellite cells. (A-D) Immunofluorescence of thoracic transverse sections of E18.5 Ski-/- embryos and normal littermates with anti-laminin and anti-Pax7. In both Ski+/+ and Ski-
/- embryos a large fraction of Pax7+ cells are positioned under the basal lamina of
myotubes. Similar total numbers (A, B) of Pax7+ cells but increased density per myotube
(C, D, E numbers above bars) in individual muscles of Ski-/- embryos compared to controls. Error bars = standard deviation of multiple muscles in three independent experiments. (F-I) Myoblasts isolated from limb muscle of E15.5 embryos were plated in
GM (F, G). When they reached ~60% confluence cells were switched to DM and photographed at 48 hours (H, I). Myotube formation by Ski-/- cells was comparable to that of the controls. (J) Quantitative RT-PCR of Myf5 and Pax7 mRNAs from myoblasts
at ~60% confluence in GM revealed similar expression in Ski-/- and control myoblasts.
Relative mRNA levels (values above bars) were calculated as described in Materials and
Methods. Error bars = standard deviation in three independent experiments. (K) Myotube
formation was examined by immunostaining with anti-MHC at the indicated time after
switching from GM into DM. Values above bars = percentage of nuclei in MHC-positive
muscle cells; error bars = standard deviation, n= number of samples. Scale bar (A, B)
40 μm, (C, D) 5 μm.
114 Pax7+ progenitors are the source of myoblasts that can proliferate and differentiate
in culture (70). We therefore asked whether cells isolated from the muscle of Ski-/-
fetuses retained these abilities. We found that mutant and wild-type E15.5 and E18.5 limb
muscles gave rise to proliferating myoblasts that expressed Myf5 and Pax7 at comparable
levels (Figs. 11D, E and Figs. 12F, G, J) and differentiated into MHC+ myotubes
indistinguishably after two days of culture in DM (Figs. 11F, G and Figs. 12H, I, K).
Thus the Pax7+ cells of Ski-/- fetuses, like their Pax3+ embryonic counterparts, are fully
competent for terminal differentiation. However, migration of the fetal progenitors
appears to be independent of Ski function while that of the embryonic progenitors is
regulated by Ski.
Discussion
Previous publications that implicated Ski in the development and differentiation of skeletal muscle have provided evidence supporting seemingly disparate roles for Ski in
these processes (25, 42, 45, 114-116). Several studies suggested that Ski promotes post-
commitment muscle differentiation and growth. Ski expression increases during
differentiation of myoblasts in vitro and Ski transgenic mice develop an over-muscled phenotype that results from selective postnatal hypertrophic growth of fast muscle fibers
(45). Those results are consistent with the ability of Ski to co-operate with MyoD and activate the expression of genes involved in terminal muscle differentiation, such as
Myog, Myl1 and Ckm (114-116). However, our findings demonstrate that the terminal differentiation of both epaxial and hypaxial myogenic cells is unaffected by the loss of
115 Ski. We therefore conclude that Ski is not required for terminal differentiation in either of these myogenic lineages.
The earliest demonstration of Ski’s influence on muscle differentiation suggested
its role in myogenic determination by showing that overexpression of Ski in non-
myogenic fibroblasts promotes their trans-determination to the muscle lineage (25, 42).
This activity of Ski is analogous to that of the MRFs. Indeed Ski has been shown to be
capable of inducing the expression of MyoD and Myog, suggesting it acts upstream of
these genes in the myogenic pathway (25). Consistent with that model, the present work
demonstrates that Ski is expressed in the myogenic regions of somites, prior to the
determination of myogenic progenitors. However, neither the generation of Pax3+ progenitors in the dermomyotome nor their subsequent myogenic determination in the myotome and limb buds, marked by MRF expression, was affected by the loss of Ski.
Despite that conclusion, we observed a large reduction in the numbers of hypaxial progenitors in the distal limbs of Ski-/- embryos. This could have resulted from any combination of premature differentiation, reduced expansion, or impaired migration of these cells due to abnormal BMP signaling. Previous studies have demonstrated the potentially deleterious effect of premature differentiation by showing that in the absence of BMP signaling, myogenic progenitors switch off Pax3 expression, turn on MyoD and lose their ability to migrate and proliferate (148). This does not seem to be the case in Ski mutants because activation of MRF expression was only observed in the myotome but not in the dermomyotome and we did not detect an excess of MRF positive cells along the migration route. Although abnormal BMP signaling could also affect the level of proliferation or apoptosis (89), neither of these processes was altered in the progenitors in
116 the dermomyotome or limb buds of Ski-/- embryos. Furthermore, unchanged Msx1
expression in the Ski-/- embryos indicates that the progenitor cell defect is not due to deregulated BMP signaling.
Having ruled out the other likely possibilities, our results suggested that defective migration was the underlying cause of reduced hypaxial muscle in Ski mutant mice. In support of this model, we found that dense clusters of Pax3-expressing cells accumulated
in close proximity to the lateral dermomyotomal lip and at the body wall/limb junction of
the mutant embryos. This phenotype is similar to that of Met-/- and HGF/SF-/-embryos,
which subsequently also exhibit selective defects in hypaxial muscle development due to
impaired migration of progenitor cells (78, 79). Therefore, defective migration in the Ski-
/- mutant could be caused by decreased Met activity or expression in myogenic
progenitors or by reduced expression of its ligand, HGF/SF. Our results favor the former possibility by showing normal HGF/SF expression but dramatically reduced Met
expression. Thus it appears that Ski regulates migration of myogenic progenitors by
direct or indirect control of Met expression.
Ski does not bind DNA but acts as a transcriptional co-regulator of DNA-binding
transcription factors (26, 31, 163). It therefore might be expected that the absence of Ski
would only cause a partial loss of function of these factors or the genes they regulate.
Thus our observation that the Ski null mutation produces a partial phenocopy of Pax3 and
Met mutants which produce more severe deficiencies in hypaxial myogenesis is in
keeping with Ski’s transcriptional function (77, 78). Early in development Ski expression
in the dermomyotome coincides with the expression domain of Pax3 (72, 73, 75). Thus
an attractive possibility would be that Ski regulates Pax3 expression in myogenic
117 progenitors. However, we found that Pax3 expression in this domain is not affected by
the loss of Ski. Thus it is more likely that Ski acts to regulate genes downstream of Pax3.
Since expression of Met is barely detectable in the lateral dermomyotome of the Splotch
mutant, Pax3 has been suggested to directly control the migration of myogenic
progenitors by transactivation of Met expression (73, 76, 86, 88). The down regulation of
Met expression in Ski-/- embryos described here supports the possibility that Ski normally
functions as a co-factor with Pax3 to activate Met expression. This model is appealing in
light of recent findings that implicate the Ski family member, Dachshund (11), as a co-
regulator with the Drosophila homolog of Pax3 (56, 58).
Although the possible cooperation between Pax3 and Ski to activate genes required for migration remains to be clarified, other similarities in their mutants are consistent with this model. Mice lacking Ski displayed not only defective myogenesis, but also severe defects in patterning of craniofacial and cardiac structures derived from the cranial neural crest, such as midline facial clefting, a depressed nasal bridge (47) and defective development of the cardiac outflow tract (C. Colmenares, unpublished observations). Interestingly, Pax3 mutant Splotch mice, display defects in the same neural crest derivatives, and these have been linked to defective migration of the neural crest precursors (167-169). Thus, despite their distinct embryological origins, aberrant neural crest development and impaired myogenic progenitor development may reveal a common mechanism that is subject to regulation by both Ski and Pax3.
A surprising finding in this study is the contrast between the effect of Ski loss on embryonic myogenic progenitors and its lack of effect on fetal and adult progenitors. A large body of data indicate that these progenitor populations originate from a common
118 pool of Pax3+Pax7+ cells in the dermomyotome (70), but as development proceeds they
become distinct (108, 170). During early development Pax3+Pax7- embryonic progenitors
give rise to MRF+ myoblasts at distal locations which differentiate into primary and
secondary muscle fibers. These progenitors are depleted in the absence of Ski. Later in development, progenitors expressing mainly or exclusively Pax7 are found within these muscles. Some of these cells commit to terminal differentiation but many retain their progenitor status and become satellite cells. Their Ski-independent development provides additional support for their divergence from the Pax3+Pax7- embryonic progenitors of earlier development. Future studies of Ski mutant mice may help to identify the factors responsible for the generation of these two populations from a common precursor.
Future Directions
Dissecting the roles of Ski during development
Our work demonstrates that Ski regulates the migration of embryonic myogenic progenitors, but not those of the fetal or adult myogenic progenitors. The most important questions remaining are what is/are the difference(s) between migratory embryonic progenitors and migratory fetal/adult progenitors and how Ski specifically regulates
migration of embryonic myogenic progenitors? Various cell-surface adhesion molecules which regulate cell-cell adhesion or cell-matrix adhesion mediate the ability of cells to
detach from a cohesive structure, undergo long-range migration and contribute to the
formation of tissues during development (171). Identification of the cell-surface adhesion molecules that are differentially expressed in embryonic, fetal and adult myogenic progenitors will enable further determination of how Ski is involved in progenitor
119 migration at different development stages. Several recent studies have indicated that the
HGF/SF receptor, Met, can interact with the hyaluronon receptor CD44, α2β1 integrin,
β4 integrin, ezrin, the Fas receptor, semaphoring receptors, β-catenins or E-cadherin at
the cell membrane to mediate cell-cell and cell-matrix adhesion (172-178). These
interactions are potentially important for the specificity or robustness of Met signaling. It
is possible that the different effects of absence of Ski on migration are mediated through
these adhesion molecules.
To study the affect of Ski on migration, we will analyze adhesion molecule
expression in specific subsets of myogenic cells. embryonic and fetal myogenic
progenitors differ in their expression of Pax proteins: embryonic and fetal myogenic
progenitors are either Pax3+ or Pax3+Pax7+ whereas adult myogenic progenitors are
Pax7+ only (108-110, 179, 180). Based on this, myogenic progenitors will be harvested at
different developmental stages and sorted by flow cytometry with anti-Pax3, and anti-
Pax7 antibodies. The expression profile of adhesion molecules in these cells will be generated by microarray. Genes which are differentially expressed in these cells will be confirmed by realtime-PCR and further by double immunofluorescence in vivo at different developmental stages. This comparison will hopefully give some insight into genes regulated by Ski that control progenitor migration.
The mouse model used in this study has Ski knocked out in all tissues constitutively and exhibits the overall consequences of the loss of Ski throughout development. Taking advantage of the cell type-specific and stage-dependent activation of Pax3, Pax7, Myog promoters (85, 117), mice with Ski ablated in certain myogenic cells at certain stages will be generated by crossing mice with a floxed Ski allele to
120 animals that transgenically express Cre recombinase under the control of the Myog
promoter (Myog-Cre)(181), Pax3 promoter (Pax3-Cre) (182) or Pax7 promoter (Pax7-
Cre) (183). These mouse models will be used to investigate the role of Ski in the
regulation of myogenic progenitor behavior during early development and myogenic cell
behavior during mid and late development. They also can be used to study whether the
effect of Ski on myogenic cell behavior is cell-autonomous or cell-nonautonomous.
Mechanism underlying the regulation of Met by Ski
My study indicated that defective progenitor migration observed in Ski-/- mice
was not due to decreased HGF signaling to activate Met tyrosine receptor, but likely
caused by a reduced transcript level of Met as evidenced by in situ hybridization analysis.
The key experiment to confirm this statement would be to reintroduce a transgene
carrying Met into Ski null mice to restore the migratory ability of Pax3+ myogenic
progenitors.
Previous studies have implicated several transcription factors in the regulation of
Met in fibroblasts and epithelial cell lines (86, 184-187). However, the Met promoter is
regulated in a cell-type specific manner (188) and little is known about how Met is
controlled in myogenic cells except that its expression is modulated by Pax3 in C2C12
myoblasts (86). In a future study, it will be important to determine the molecular
mechanism underlying the regulation of Met by Ski in myogenic progenitors, including
the regulatory region of Met promoter that mediates Ski’s activity and the DNA-binding
partner for Ski at these sites. Since techniques to isolate and culture myogenic progenitors in vitro are not available, we will try to address this issue in the cultures of C2C12 myoblasts which were isolated from adult mouse muscle (152). The disadvantage of this
121 model system is that since loss of Ski only compromised the migration of embryonic
myogenic cells and not their fetal and adult counterparts, the data collected from cultures
of C2C12 cells may not faithfully recapitulate the role of Ski in embryonic myogenic
cells. However, since these cells are of myogenic origin (152) and have been shown to
migrate in response to HGF (189-192). Additionally, overexpression of Pax3 was correlated with enhanced Met expression (86) in these cells. Therefore, they are the best in vitro model to address this issue so far.
The regulation of Met transcription by Ski could be direct or through Ski’s ability to regulate the expression of Pax3. To date, Pax3 is the only transcriptional factor known to bind the Met promoter, activate Met transcription and is co-expressed with Met in myogenic progenitors (73, 76, 83-86, 88). C2C12 cells in which Ski is overexpressed or knocked down will be used to evaluate the effect of Ski on the expression of Pax3 and
Met. These cells will also be tested in cell migration assays in response to HGF. In addition, the direct association of Ski with the endogenous Pax3 or Met promoters will be assessed by ChIP assays. Reporter assays will be used to further identify the minimal regulatory regions that mediate the regulation of Pax3 or Met promoters by Ski.
Since Ski can not bind to DNA directly (31), to further understand the transcriptional regulation of Pax3 or Met by Ski, it is important to identify the DNA- binding partners which recruit Ski to these promoters. If Ski directly regulates the transcription of Pax3, Hox, Pbx and Meis protein families will be examined because they have been shown to regulate Pax3 expression and interact with Pax3 promoter through
their consensus binding elements (193). They are all candidate DNA-binding partners
that might recruit Ski to the Pax3 promoter. The interaction of Ski with these proteins and
122 their association on the endogenous Pax3 promoter will be examined by
immunoprecipitation and sequential ChIP assay, respectively. The key experiment to
demonstrate that Pax3 is a mediator of transcriptional regulation of Met by Ski will be to
reintroduce Pax3 into C2C12 cells in which Ski is knocked down and eventually into Ski
null mice to rescue Met expression and myogenic progenitor migration.
Pax3 bind the Met promoter directly and it also cooperates with Six, Eya and a
Ski family member, Dach to regulate myogenesis during early development (56, 58). We know from our own study that Ski substitutes for Dach to cooperate with Six1/Eya3 on transactivation of Myog during C2C12 differentiation. If Ski directly regulates Met
transcription, it will be of great interest to investigate whether Ski also substitutes for
Dach in the conserved network of Pax3/Six/Eya/Dach and it is Pax3 that recruits Ski to
the Met promoter and regulates Met expression. Synergetic regulation of transcription
from Met promoter by these proteins will be examined by reporter assay and their
association with the endogenous Met promoter will be assessed by sequential ChIP assay.
Immunoprecipitation assays will also be used to determine the ability of these proteins to
physically interact with each other. The key experiments to establish Pax3 as a DNA-
binding partner of Ski on the Met promoter will be to examine whether Ski is still able to
bind and transactivate the Met promoter in C2C12 cells lacking Pax3 expression.
Because of the disadvantages of using the adult satellite-cell derived C2C12 cells,
the data collected from cultures of C2C12 cells will be confirmed in mouse models.
Transgenic mice carrying a LacZ gene under the control of Pax3 or Met promoters will
be introduced into wild-type and Ski-/- mice and a comparison of LacZ expression in
123 Pax3+ myogenic progenitors in these transgenic lines will demonstrate whether Ski also transactivates the Pax3 or Met promoters in myogenic progenitors.
124 CHAPTER II: Ski Regulates Muscle Terminal Differentiation by Transcriptional
Activation of Myog in a Complex with Six1 and Eya3
This chapter has been submitted to Journal of Biological Chemistry
Abstract
Overexpression of the Ski pro-oncogene has been shown to induce myogenesis in
non-muscle cells, to promote muscle hypertrophy in postnatal mice and to activate
transcription of muscle-specific genes. However, the precise role of Ski in muscle cell
differentiation and its underlying molecular mechanism are not fully understood. To
elucidate Ski’s involvement in muscle terminal differentiation, two retroviral systems
were used to achieve conditional overexpression or knockdown of Ski in satellite cell-
derived C2C12 myoblasts. We found that enforced expression of Ski promoted differentiation while loss of Ski severely impaired it. Compromised terminal differentiation in the absence of Ski was likely due to the failure to induce Myog and p21, despite normal expression of MyoD. Chromatin immunoprecipitation and transcriptional reporter experiments showed that Ski occupied the endogenous Myog regulatory region and activated transcription from the Myog regulatory region upon differentiation.
Transactivation of Myog was largely dependent on a MEF3 site bound by Six1; not on the binding site of MyoD or MEF2. Activation of the MEF3 site required direct interaction of Ski with Six1 and Eya3 mediated by the evolutionarily conserved DHD domain of Ski. Our results indicate that Ski is necessary for muscle terminal differentiation and that it exerts this role, at least in part, through its association with Six1 and Eya3 to regulate the Myog transcription.
125 Introduction
Originally identified as a transduced avian retroviral oncogene (1-3), Ski is an evolutionarily conserved gene in species ranging from flies to humans (4). The retroviral v-ski protein corresponds to residues 21–441 of chicken c-Ski which is a nuclear protein of 750 residues (5). The amino terminal half of c-Ski is the most highly conserved segment, containing two distinct domains that mediate protein-protein interactions (6).
The more conserved of these, the Dachshund homology domain (DHD), defines the Ski
gene family which includes: Ski, SnoN, Dach, Fussel-15, Fussel-18 and Corl (7, 9-15).
The DHD has been implicated in the interactions of Ski with Smad2/3, N-CoR, Skip and
RARα (16-24). The second conserved region comprises the SAND domain (Sp100,
AIRE-1, NucP41/75 and DEAF-1 domain) which mediates the interactions of Ski with
Smad4, FHL2 and MeCP2 (8, 28, 29). The C-terminal region of c-ski is missing in v-ski
and contains a tandem repeat/leucine zipper motif which mediates both homo- dimerization and hetero-dimerization with SnoN (6, 30).
Ski does not bind DNA directly (31), but interacts with several different transcription factors to modulate transcription as either a co-activator or a co-repressor
depending on its DNA-binding partner. Both v-ski and c-ski cause oncogenic transformation and induce myogenic differentiation in non-muscle avian embryo fibroblasts (2, 3, 149). The latter activity involves activation of muscle-specific genes, including the myogenic regulatory factor (MRF) genes, MyoD and myogenin (Myog) (25,
42, 149). Transgenic mice expressing v-ski or c-ski cDNAs develop selective hypertrophy of type IIb fast skeletal muscle fibers (45). Moreover, expression of Ski increases in skeletal muscle at mid-gestation of mouse development (39). The requirement of the
126 endogenous gene for normal muscle development was demonstrated by the observation that Ski-null mice show a marked decrease in skeletal muscle mass (47).
Further studies indicated that regulation of myogenesis by Ski might be mediated by its ability to activate transcription driven by the regulatory elements of muscle-specific genes, such as myosin light chain 1/3 (MLC 1/3), the muscle creatine kinase (MCK) and most importantly, Myog (114-116). The Ski-responsive cis element of Myog resides in an
184bp regulatory region immediately upstream of the Myog promoter. This region has been shown to be sufficient for the complete recapitulation of the temporal and spatial expression pattern of Myog during embryogenesis (115, 117-119). DNA binding sites for
MyoD and myocyte enhancer binding factor 2 (MEF2) in this regulatory region were found to be necessary for Myog transcription (119-121). Transient reporter assays have shown that Ski co-operates with MyoD and MEF2 to activate transcription from the
184bp Myog regulatory region (115). However, no direct interactions between Ski and these muscle-specific transcription factors have been reported.
In vitro studies have revealed that terminal differentiation of myoblasts proceeds through a highly ordered sequence of events. These cells express MyoD while proliferating but when growth stimuli are removed, they initiate expression of Myog, followed by the induction of the cyclin-dependent kinase (cdk) inhibitor p21 and irreversible withdrawal from the cell cycle. Subsequently, these post-mitotic myocytes express muscle-specific contractile proteins such as myosin heavy chain (MHC) and finally fuse into multinucleated myotubes (128). This process is governed mainly by two families of transcription factors, the MRFs and MEF2 (129-131). The MRF gene family includes MyoD, Myf5, Myog and MRF4 (91, 92, 129). All MRF family members share a
127 highly conserved basic region and adjacent helix-loop-helix motif (bHLH) which mediates binding to a consensus DNA sequence CANNTG, known as the E box, which is
present in the regulatory regions of many muscle specific genes. Forced expression of
any MRF gene is capable of inducing expression of muscle-specific genes and activation
of myogenic differentiation, even in non-muscle cells. The MEF2 proteins belong to the
superfamily of MADS (MCM1-agamous deficient-serum response factor)-box
transcription factors, and directly bind an A+T-rich element found in the promoters and enhancers of many muscle specific genes (133). Genetic analysis reveals that members of the MEF2 family are also essential for terminal muscle differentiation (132).
Another cis-element, the MEF3 site (consensus sequence TCAGGTT), is also
present in the 133 bp Myog regulatory region. Studies of transgenic mice demonstrated
that mutation of this MEF3 site abolishes correct expression of a Myog-LacZ transgene
during embryogenesis (123). Two skeletal-muscle specific members of the Six family
(sine oculis homeodomain-containing transcription factors), Six1 and Six4, bind to the
MEF3 element and transactivate Myog transcription (123). Drosophila sine oculis (so) has been shown to act synergistically with eyes absent (eya) and dachshund (dac) by direct protein-protein interactions. Similar interactions underlie the synergism of their mammalian homologues, Six, Eya and Dach (11, 55-58, 134, 137, 139, 143). This evolutionarily conserved regulatory network of Eya/Six/Dach has been shown to regulate
myogenesis in chicken somite culture and in the chick limb and to activate transcription
of reporters containing the Myog MEF3 site (56, 58). Interaction of mammalian Dach
with Six protein is mediated by the evolutionarily conserved DHD motif (55, 151). This
has led to the suggestion that by virtue of its possession of these conserved domains (7,
128 11, 13), Ski might also interact with Six and Eya proteins to regulate Myog expression
and thereby control commitment of myogenic cells to terminal differentiation (56).
In this study, we have addressed this possibility by exploiting the well-
characterized mouse muscle satellite cell line, C2C12, as a model system. Using
retroviral vectors to achieve tetracycline (tet)-regulated overexpression or knockdown of
Ski, we asked whether Ski might not only stimulate but also be required for terminal differentiation of C2C12 cells. To probe the mechanism underlying the transcriptional regulation of Myog by Ski, the E-box, MEF2 and MEF3 sites in the Myog regulatory region were investigated as the possible cis-response elements. Using co- immunoprecipitation, we asked whether direct binding of Ski to MyoD, MEF2c, Six1 and/or Eya3 mediate its transcriptional activity. Finally, ChIP assays were performed to determine whether Ski resides at the endogenous Myog regulatory region prior to or concomitant with the initiation of terminal differentiation.
Materials and Methods
Construction of retroviral vectors
The replication-defective retroviral vector LNITX was kindly provided by Dr.
Fage and was described earlier (158). A DNA fragment containing the entire coding region of the human SKI cDNA was excised from the plasmid pSHHSKIN1D using
BamHI and ClaI, blunt-ended with T4 DNA polymerase, and inserted into the LINTX vector at the PmeI site to produce LNIT-huSKI.
The replication-defective retroviral vector TMP-tTA was modified from the TMP vector (kindly provided by Dr. Scott Lowe) (159-161) by replacing its GFP gene with the
129 tetracycline transactivator (tTA, ) gene (194). The sequences of shRNAs targeting mouse
Ski were chosen using RNAi Codex (http://codex.cshl.edu/scripts/newmain.pl) and are designated by their positions in the mouse Ski cDNA sequence (GenBank AF435852): mSki1145 (bases 1145-1163), mSki1819 (bases 1819-1837) and mSki977 (bases 977-
995). DNA forms of these shRNA inserts were generated by PCR amplification of 97
base synthetic oligonucleotides using Pfu DNA polymerase (Invitrogen) and a common
set of primers (5'-cagaggctcgagaaggtatattgctgttgacagtgagcg-3' and 5'-
cgcggcgaattccgaggcagtaggca-3'). The PCR products were subsequently digested with
XhoI and EcoRI and inserted between these sites within TMP-tTA vector to generate
TMP-tTA-mSki1145, TMP-tTA-mSki1819 and TMP-tTA-mSki977. Clones containing these shRNA-encoding inserts were sequence-verified.
Tissue culture and transfection
Proliferating mouse C2C12 myoblasts were maintained in growth medium (GM) consisting of Dulbecco's modified Eagle's medium (DMEM) (Gibco-BRL) supplemented with 20% fetal bovine serum (FBS, Atalantic Biosolution), 100μg/ml penicillin,
100units/ml streptomycin and 0.002% Fungizone (Gibco-BRL). To avoid spontaneous differentiation, cells were always kept in subconfluent (60-70%) conditions. Terminal
differentiation was induced by switching subconfluent cell (80%) to differentiation
medium (DM) consisting of DMEM, 2% heat-inactivated horse serum plus antibiotics as in GM. Morphological differentiation, judged by myotube formation, was documented by digital photography of phase-contrast microscopic images.
Retroviral packaging and infection
130 The retrovirus packaging cell line, PA317 (ATCC No. SD3443) was cultured in
DMEM containing 10% FBS, 100μg/ml penicillin and 100units/ml streptomycin. They were transfected with retroviral constructs by using Fugene 6 (Roche) according to the manufacturer's protocol. 24 hr after transfection, the medium was harvested and live cells were removed by centrifugation at 1000×g for 10min. The retrovirus-containing supernatant was used to infect exponentially growing C2C12 cells at 40% confluence in the presence of 10ng/ml polybrene (Sigma). The infection was repeated with freshly- harvested virus 12hr later. After an additional 12hr of culture, C2C12 cells were switched to GM plus 2μg/ml doxycycline (Dox, an analog of tetracycline) and antibiotics (G418 at
750μg/ml for LNITX-based constructs and puromycin at 2ng/ml for TMP-tTA-based constructs). Two weeks later the resulting individual colonies were isolated using cloning discs according to manufacturer’s protocol (PGC Scientifics, 62-6151-14) and expanded in GM with Dox and G418 or puromycin. After culture in GM minus Dox, clones were screened by western blot analysis for tet-regulated Ski overexpression or knockdown.
Western blotting
Whole-cell extracts were prepared from confluent C2C12 cells on 100 mm culture dishes as follows: cells were scraped into 400µl of lysis buffer (50mM Tris pH 8.0,
100mM NaCl, 1mM EDTA, 10% glycerol, 0.2% Nonidet P-40, 0.1mM sodium orthovanadate, 5mM sodium pyrophosphate, 1mM NaF and complete protease inhibitor cocktail (Roche)). After 10min incubation on ice, the suspension was subjected to three freeze-thaw cycles and cell debris was removed by centrifugation at 12,500 rpm for
15min at 4°C. Protein concentrations were determined by Bradford assay (Bio-Rad) and equal amounts of proteins were boiled in protein loading buffer (100mM Tris pH6.8,
131 20% glycerol, 4% SDS, 0.2% Bromophenol blue and 2%β-Me), separated by 6% SDS–
PAGE and transfered to Immobilon-P membranes (0.45um, Millipore).
For most antibodies, blots were pre-blocked for 1hr at room temperature in
blocking buffer (20mM Tris pH 7.6, 125mM NaCl, 0.1% Tween-20 and 5% w/v nonfat
dry milk) and incubated with primary antibodies in the same solution overnight at 4°C.
The membranes were then washed with TBST (20mM Tris pH 7.6, 125mM NaCl and
0.1% Tween 20), and incubated for 1hr at room temperature with secondary antibodies
conjugated to horseradish peroxidase (HRP) or alkaline phosphatase (ALP) followed by
washes with TBST. Signals were detected using either enhanced chemiluminescent HRP
substrate (Pierce) or CDP-Star® alkaline phosphatase chemiluminescent substrate (1/50,
Tropix) and exposure to HyBlot CL autoradiography film (Denville Scientific).
When using anti-Ski G8 monoclonal antibody, the blots were pre-blocked overnight at 4°C in blocking buffer (PBS (7.7mM Na2HPO4, 2.7mM NaH2PO4, 150mM
NaCl, pH7.2), 0.4% Casein, 1% PVP (40,000), 10mM EDTA and 0.2% Tween, pH7.2) and then incubated with primary antibody in the same solution for 30min at room
temperature. The membranes were washed with blocking buffer and further incubated
with ALP-conjugated secondary antibodies (Sigma) for 30min at room temperature.
Subsequently, the blots were washed with blocking buffer then with assay buffer (0.1M
EDTA, 1mM MgCl2 and 0.02% Azide, pH10.0) and the signal was detetected with CDP-
Star® alkaline phosphatase chemiluminescent substrate as above.
The following primary antibodies were used for immunoblotting: Ski
(monoclonal antibody, 1/2000, G8, Learner Research Institute Hybridoma Core Facility
or rabbit polyclonal antibody, 1/1000, H329, Santa Cruz); Myog (1/1000, F5D, Santa
132 Cruz), TFIIE-α (1/3000, C-17, Santa Cruz), MHC (1/1000, MF-20, Developmental
Studies Hybridoma Bank), MyoD (1/1000, 5.8A, Santa Cruz) and anti-Flag (1/5000, M2,
Sigma). The secondary antibodies used were: ALP-conjugated anti-mouse IgG (Fc
specific) and anti-rabbit IgG (whole molecule) (1/30000; Sigma); HRP-conjugated
Mouse IgG TrueBlotTM and Rabbit IgG TrueBlot™ (1/1000, eBioscience)
Immunofluorescence
C2C12 myoblasts (2×104) were seeded into each well of LAB-TEK® eight-well
chamber slides (Nunc) coated with 1µg/cm2 laminin (Invitrogen) in GM and switched to
DM for 3 days. Cells were fixed in 3.7% paraformaldehyde/PBS for 30min at room
temperature, permeabilized with 10% goat serum/1% Triton-X 100/PBS for 10min,
incubated with blocking buffer (PBS, 10% goat serum and 0.1% Tween 20) for 1hr at
room temperature and then with primary antibodies overnight at 4°C. Chambers were washed with PBST (PBS and 0.1% Tween-20), incubated with secondary antibodies for
1hr at room temperature, washed with PBS and mounted in Vectashield aqueous mounting medium with DAPI (Vector Laboratories). Images were obtained using
Olympus BX50 upright fluorescence microscope equipped with a Polaroid digital camera
PDMC2, Polaroid PDMC2 software and fluorescent illumination. Images were
assembled using Photoshop CS (Adobe).
The following primary antibodies were used for immunofluorescence: MyoD
(1/100; 5.8A, Santa Cruz); Myog (1/100; F5D, Santa Cruz), MHC (1/200; MF20;
Developmental Studies Hybridoma Bank) and p21 (1/100; SX118, BD Pharmingen).
Secondary antibodies were Alexa 488 or Alexa594-conjugated goat anti-mouse IgG
133 antibody (1/300, Molecular Probes). Control experiments performed with normal IgG as the primary antibody yielded no signal above the background.
Quantification was performed by counting at least 1000 DAPI-stained nuclei in
more than 10 random fields per culture plate. For MHC, the differentiation index = nuclei
within MHC-stained multinucleate myotubes/total number of DAPI-stained nuclei and
the fusion index = the average number of nuclei per MHC-stained myotube. For nuclear
proteins, the differentiation index=number of antibody-stained nuclei/total number of
DAPI-stained nuclei. All experiments were performed in triplicate on three independent
cultures and the standard deviation was calculated.
Realtime-PCR
RNA was isolated using the RNeasy kit (Qiagen) with DNase I treatment
according to manufacturer’s protocol, and cDNA was generated using reverse
transcriptase SuperScript™ III (Invitrogen) with random hexamer primers according to the manufacturer’s instructions. Quantitative realtime-PCR (iCycler iQTM, Bio-Rad) was
performed using SYBR® Green PCR Core Reagents (Applied Bioscience) according to
the manufacturers’ protocols. PCR was performed for 40 cycles of 94 °C for 15s, 60°C
for 20s, and 72°C for 20s, followed by a single 72°C extension step for 5 min. Primer
sequences used for realtime PCR will be provided upon request. Analyses were
performed in triplicate on RNA samples from three independent experiments. Threshold
cycles (Ct) of target genes were normalized against the housekeeping gene Gapdh, and
relative transcript levels were calculated from the Ct values as Y=2-ΔCt, where Y is fold
difference in amount of target gene versus Gapdh and ΔCt=Ctx-CtGapdh.
Chromatin immunoprecipitation (ChIP)
134 Chromatin immunoprecipitation experiments were performed essentially as
described (195). Briefly, C2C12 cells cultured in GM or DM for 2 days were cross-linked with 1% formaldehyde/PBS for 10min at room temperature. Fixed cells were scraped and resuspended at 2×107 cells/ml in lysis buffer (50mM Tris pH8.0, 2mM EDTA, 150mM
NaCl, 1% Triton-100, 0.1% DOC, 0.1% SDS). Suspensions were sonicated to yield
chromatin with an average DNA length of 200~500bp. Equal amounts of chromatin from
each sample (2×106 cells per assay) were preabsorbed at 4°C for 1hr with 40μl 50%
slurry of pre-blocked protein A beads (Repligen, previously incubated with 1mg/ml
salmon testes DNA, 10mg/ml BSA and 0.05% sodium azide in TE buffer (10mM Tris
pH8.0 and 1mM EDTA)). After pelleting the beads, supernates were incubated overnight at 4°C with either 2μg rabbit polyclonal Ski antibody (H329, Santa Cruz) or normal
rabbit IgG. Antibody-chromatin complexes were then captured by incubation with 40μl
50% slurry pre-blocked Protein A beads at 4°C for 1hr. The beads were washed
sequentially in lysis buffer, high salt buffer (50mM Tris pH8.0, 2mM EDTA, 500mM
NaCl, 1% Triton-100, 0.1% DOC and 0.1% SDS), lithium salt buffer (20mM Tris pH8.0,
1mM EDTA, 250mM LiCl, 0.5% NP-40, 0.5% DOC) and TE buffer. Complexes were
eluted from the beads in 150μl of elution buffer (10mM Tris pH 8.0, 5mM EDTA and
1% SDS) and formaldehyde cross-linking was reversed by overnight incubation at 65°C.
After treatment with RNase A and proteinase K, DNA was isolated by phenol extraction
and ethanol precipitation. The optimal PCR cycle numbers were determined by realtime-
PCR and 5% of purified DNA was analyzed by regular PCR using HotStart-IT Taq
Master mix (USB). 25% of each reaction mixture was resolved on a 1.5% agarose gel and
visualized by ethidium bromide staining. The following PCR primer sets were used: the
135 mouse Myog regulatory region (-169~+39, Genbank M95800): 5′-gggcaaaaggagagggaag-
3′ and 5′-agtggcaggaacaagcctt-3′; the non-promoter region downstream of Myog gene
(+1943~+2185 downstream of the Myog gene, GenBank NW_001030662.1) served as a
negative control: 5′-gtcaagaactgacttaaggcc-3′ and 5′-gacactaggagaagggtggag-3′; the
mouse Smad7 regulatory region (-274~-142, GenBank NW_001030635.1): 5-
tagaaacccgatctgttgtttgcg-3 and 5-cctctgctcggctggttccactgc-3. For input control, 10% of
cross-linked chromatin was purified as described above and assessed for PCR by using
the same sets of primers.
Reporter assays
A 202bp DNA fragment (-184~+18, Genbank M95800) containing the Myog
regulatory region was amplified by PCR using C57BL/6 genomic DNA as template.
Myog184 luciferase reporter carrying the luciferase gene downstream of this Myog regulatory region was generated by inserting HindIII-StuI digested PCR product into the
HindIII-SmaI site of the pGL3-Basic vector (Promega). Myog-luciferase constructs with
E box, MEF2 and MEF3 mutations (Myog184-E1E2m, Myog184-MEF2m and Myog184-
MEF3m) were generated from Myog184 luciferase reporter using the QuikChange® Site-
Directed Mutagenesis Kit (Stratagene). Ski expression vector pCDNA-huSki was
previously described (24).
Cells (1×105) were seeded in 12-well plates and transfected at 80% confluence
using Lipofectamine 2000 (Roche) with a combined total of 4µg of expression vector and
reporter plasmid DNAs. 18hr after transfection, cells were switched to DM for 48hr prior
to harvest and lysis in 1×Reporter lysis buffer (Promega) with one round of freeze-thaw
followed by incubation at room temperature for 20min. Cell debris was removed by
136 centrifugation and luciferase activity in the supernatant was determined by a dual
luciferase reporter assay system (Promega), according to the manufacturer’s protocol
using a MAXline microplate luminometer (Molecular Devices). The relative light units
(RLUs) were generated by normalizing firefly luciferase units to Renilla luciferase units
of the co-transfected pTK-Renilla-luc vector. The experiments were done in duplicate
and the reported results represent at least three independent experiments.
Co-immunoprecipitation
C2C12 cells (~ 50% confluent, 100mm dishes) were transfected with expression
plasmids for flag-tagged Six1, flag-tagged Eya3, flag-tagged Mef2c, MyoD and full-
length Ski or its mutants using Lipofectamine 2000. 18hr after transfection, cells were
refed GM or switched to DM and harvested 2 days later in 1ml of NETN buffer (20mM
Tris pH 8.0, 100mM NaCl, 1mM EDTA, 0.1% NP-40, 10% glycerol, 1mM dithiothreitol
and complete protease inhibitors cocktails). After brief sonication, cell debris was
removed by centrifuge at 10,000 rpm for 15min at 4°C. The lysates were preabsorbed
with protein A beads and protein concentrations were determined by the Bradford protein
assay. Immunoprecipitations using equal amounts of proteins with either rabbit
polyclonal anti-Ski or normal rabbit IgG were collected by overnight incubation with
protein A beads (Repligen) at 4°C. Precipitates were washed 5 times in NETN,
resuspended and boiled in protein loading buffer, separated by 6% SDS-PAGE and
analyzed by Western blotting. If precipitating and primary Western blotting antibodies
were from the same species, either HRP-conjugated Mouse IgG TrueBlotTM or Rabbit
IgG TrueBlot™ was used as the secondary antibody accordingly.
137 Results
Regulated over-expression of Ski stimulates terminal differentiation of C2C12 cells
Overexpression of Ski has been reported to induce non-muscle fibroblasts to
differentiate into myotubes (25, 42), suggesting a role of Ski in myogenic lineage
determination and terminal differentiation. To assess the role of Ski in terminal
differentiation independent of its possible role in myogenic lineage determination, C2C12
cells which have already committed to myogenic fate and require only serum deprivation
to undergo terminal differentiation were used in this study. In order to regulate Ski
expression, C2C12 cells were infected with LNIT-huSKI; a retroviral vector that allowed
both G418 selection and doxycycline (Dox) regulation of SKI expression, (Fig. 13A).
Several G418-resistant clones were isolated and propagated in growth medium (GM) containing Dox to suppress SKI overexpression. They were then subdivided and tested for SKI expression after three-day cultures in either the presence or absence of Dox.
Western blot analysis of cell extracts revealed obvious induction of SKI expression in several LNIT-huSKI clones after Dox withdrawal (Fig. 13B), whereas a clone infected with the LNITX empty vector did not overexpress SKI, regardless of Dox treatment (Fig.
13D, right panel).
Using these clones, we examined the effect of SKI expression on myotube formation. LNIT-huSKI cells were cultured in GM with or without Dox for 4 days. Upon reaching 80% confluence, the cells were induced to differentiate by switching to differentiation medium (DM) while maintaining the presence or absence of Dox. One day after initiating differentiation, LNIT-huSKI cells that expressed exogenous SKI had prematurely formed myotubes, but no myotubes were observed in the same clone
138
139 Fig. 13. SKI stimulates differentiation of C2C12 myoblasts
(A) Schematic representation of retroviral vector LNIT-huSKI showing the 5′- and 3′-
long terminal repeats (LTR), neomycin resistance gene (neor), internal ribosomal entry
site (IRES), tetracycline-controlled transactivator gene (tTA) (tTA, ); the minimal CMV
promoter regulated by tetracycline response elements (TRE-CMV) and human SKI
coding region (SKI).
(B) Dox-regulated SKI expression in LNIT-huSKI clones. Western analysis of SKI
expression in representative C2C12 LNIT-huSKI clones cultured under induced condition
(-Dox) or suppressed condition (+Dox) for three days. A vector-only clone (LNITX) was used as a negative control (Ctrl). TFIIE-α was a loading control.
(C) A representative C2C12 LNIT-huSKI clone (F8) was cultured in GM or DM for 1 day with or without Dox and phase contrast microscopy shows myotube formation only
in the absence of Dox.
(D) Enhanced Myog expression by overexpression of SKI. LNIT-huSKI F8 clone or a vector-only clone (LNITX) was cultured in GM or DM for 1 day with or without Dox and Western blot analysis revealed the expression of Myog and SKI. TFIIE-α was a loading control. Note that endogenous Ski expression in the right panel was revealed only after much longer exposure than the left panel where overexpression of SKI was detected.
140 cultured in the presence of Dox to suppress SKI overexpression (Fig. 13C). Western
analysis of these cells revealed expression of Myog only in cells that expressed
exogenous SKI (Fig. 13D, left panel). These results were not due to Dox treatment since
the vector-only controls showed no obvious difference in Myog or endogenous Ski
expression in the presence or absence of Dox (Fig. 13D, right panel). These data indicate
the increased SKI expression stimulates the commitment of C2C12 myoblasts to terminal
muscle differentiation.
Generation of C2C12 clones with inducible knock-down of Ski expression
The gain-of-function study above indicated that, as in avian cells, overexpression of Ski induces muscle terminal differentiation of C2C12 cells. However, those results do not necessarily implicate endogenous Ski in this process. To address this issue we asked whether knocking down endogenous mouse Ski expression would affect the differentiation of C2C12 cells. To accomplish this and avoid potential deleterious effects on the long-term cell viability due to the loss of endogenous Ski, we used tet-regulated expression of shRNAs to knockdown Ski in C2C12 cells. The TMP-tTA vector used for this purpose was modified from the TMP retroviral vector (159-161) by substituting the tTA gene for the GFP gene, so that this single retrovirus carries both tTA and its response element (TRE) (Fig. 14A). DNA sequences which encoded shRNAs targeting mouse Ski were inserted within the framework of micoRNA-30 (miR30), downstream of the TRE-
CMV promoter (Fig. 14A). Transcripts of this cassette resembling natural microRNA-30 could be generated upon removal of Dox, resulting in the knockdown of Ski. Three different shRNA inserts targeting mouse Ski gene were designed and retroviral constructs, designated as TMP-tTA-mSki977, 1145 and 1819 were generated.
141
142 Fig. 14. Dox-regulated knock-down of Ski in C2C12 cells via shRNAs in the context of
miR30
(A) Schematic representation of TMP-tTA-mSki retroviral vector showing the 5’ LTR
and 3’ self inactivating LTR (SIN-LTR), puromycin resistance gene (Puror) driven by the
PGK promoter, IRES, tTA and a microRNA cassette downstream of TRE-CMV
promoter. The shRNAs targeting mouse Ski were inserted into the microRNA cassette
between the 5’ and 3’ flanking sequences derived from the miR30 primary transcript
(5’miR30 and 3’miR30).
(B) Dox-regulated knockdown of Ski in TMP-tTA-mSki1819 clones. Western analysis of
Ski expression was performed on representative C2C12 TMP-tTA-mSki1819 clones or
the vector-only clone (Ctrl) cultured with (+Dox) or without Dox (-Dox) for one week.
(C) Western blot analysis revealed decreased Ski expression in C2C12 TMP-tTA- mSki1145 clone in response to removal of Dox. Cells were cultured in the presence of
200ng/ml Dox for eight days, switched into Dox-free medium and analyzed after culture for indicated number of days.
(D) Western blot analysis revealed restoration of Ski expression in C2C12 TMP-tTA- mSki1145 clone in response to addition of Dox. Cells were cultured in the absence of
Dox for eight days to achieve the maximal knockdown of Ski and then switched into medium containing 200ng/ml Dox for indicated number of days.
(E) Western blot analysis revealed dose response of Ski knockdown to Dox in a C2C12
TMP-tTA-mSki1145 clone. Cells were cultured in the absence of Dox for 6 days and switched into medium containing the indicated concentration of Dox for another 6 days.
143 TFIIE-α was used as a loading control and a vector-only clone (Ctrl) shows the endogenous Ski level.
144 PA317 packaging cells were transfected with each of the three TMP-tTA-mSki
vectors (or the empty vector) and viruses were harvested to infect C2C12 myoblasts.
Puromycin-resistant clones were isolated and propagated in GM plus Dox to prevent shRNA expression. These clones were then subdivided and cultured with or without Dox for 6 days prior to testing for conditional knockdown of Ski. Western analysis of several
TMP-tTA-mSki1819 clones revealed a highly efficient Dox-dependent knockdown of Ski without significant leakiness (Fig. 14B). TMP-tTA-mSki cells grown in the absence of
Dox produced nearly undetectable Ski level while the same clones grown in the presence of Dox expressed Ski at similar levels to that of the vector-only control. Out of approximately 40 clones tested with each of the three TMP-tTA-mSki shRNAs, 70~80%
exhibited Dox-dependent knockdown of Ski, indicating the high efficiency of this system
(data not shown).
Ski knockdown is reversible and Dox-dose dependent
To determine the kinetics of Ski knockdown, a C2C12 TMP-tTA-mSki1145 clone
was propagated in Dox-containing medium, transferred to Dox-free medium and
monitored for Ski expression over an 8-day period. Western analysis showed that
knockdown of Ski was apparent within 4 days after Dox removal and was virtually
complete after 6 days (Fig. 14C). This knockdown was completely reversible; re-addition
of Dox to these cells restored normal Ski expression within 4 days (Fig. 14D). The extent
of Ski knockdown was also doxycycline dose-dependent; expression of Ski was barely
detectable at 2ng/ml of Dox or less and was comparable to the vector-only control at
20ng/ml of Dox or more (Fig. 14E). Taken together, these data demonstrated that this
145 single-vector system allows tightly regulated and reversible knockdown of endogenous
Ski.
Impaired myotube formation in the absence of Ski
Using this Dox-regulated knockdown system, we next evaluated the consequences of the loss of Ski on terminal differentiation. A C2C12 TMP-tTA-mSki1145 clone was either kept in GM plus Dox to maintain Ski expression or switched into GM minus Dox for 7 days to achieve the maximal knock-down of Ski. Subsequently, upon reaching 80% confluence, these cells were switched from GM to DM while continuing the maintenance or suppression of Ski expression. Phase microscopy of the cultures prior to switching to
DM revealed that the morphology of TMP-tTA-mSki and TMP-tTA cells in GM was similar and not affected by the loss of Ski expression (Figs. 15A-D). This was not true for cells that were switched into DM to induce differentiation. The TMP-tTA-mSki cells in which Ski expression was maintained exhibited extensive myotube formation (Figs. 15E and I). However, when Ski expression was knocked down in the TMP-tTA-mSki clone, no obvious myotube formation was visible within 2 days (Fig. 15F) and only a few small myotubes had formed after 4 days (Fig. 15J). The lack of myotube formation was not due to delayed differentiation kinetics, since in the absence of Dox, TMP-tTA-mSki cells did not show significant myotube formation even after 6 days in DM (data not shown).
Furthermore, the differentiation defect of TMP-tTA-mSki cells in the absence of Dox was not due to the withdrawal of Dox, because myotube formation of the TMP-tTA control was independent of Dox (Figs. 15G and H). Thus the results indicate that Ski expression is required for terminal muscle differentiation of C2C12 cells.
146
147 Fig. 15. Loss of Ski prevents terminal differentiation of C2C12 myoblasts.
Prior to the following assays, cells were cultured for 7 days in GM either with Dox as a control or without Dox to achieve maximal knock-down of Ski.
(A-J) A C2C12 TMP-tTA-mSki1145 clone was analyzed for the effect of Ski knockdown on myotube formation by phase contrast microscopy (left panel). Cells were cultured to
80% confluence in GM with (+Dox) or without Dox (-Dox), switched to DM with
continued presence or absence of Dox and cultured for 2 days and 4 days. A vector-only
clone (TMP-tTA) was cultured the same way and used as a control. Representative fields
are shown at 25× magnification.
(G, H) TMP-tTA-mSki1145 cells were cultured as described above and kept in DM for 3
days. Myotubes were labeled by indirect immunofluorescence with antibody against
MHC (green) and nuclei were counterstained with DAPI (blue). Representative fields are
shown at 100× magnification.
(I, J) Quantitative analysis of the immunofluorescence assays in G and H. Red bars
represent culture in the presence of Dox (+Dox) and blue bars represent culture in the
absence of Dox (-Dox). The percentage of DAPI-stained nuclei in MHC-positive cells (I)
and the average number of nuclei per MHC-positive myotube (J) were calculated as
described in Materials and Methods. Data above the bar represent means of three
independent experiments. Error bars show standard deviations of means.
148 Decreased myotube formation in the absence of Ski could be due to a block at any
stage in the differentiation pathway or a failure of fully differentiated myocytes to fuse.
To distinguish between these possibilities, we performed immunofluorescence for MHC which is a terminal differentiation marker expressed in both unfused myocytes and multinucleated myotubes. Consistent with the morphological observations above, TMP- tTA-mSki cells exhibited extensive formation of MHC-positive multinucleated myotubes when expressing Ski, while the vast majority of cells from the same clonal line were
MHC-negative when Ski expression was knocked down (Figs. 15K and L). The effects of loss of Ski on terminal differentiation and fusion were further quantified by measuring both the percentage of nuclei in MHC-positive cells (differentiation index) and the average number of nuclei per MHC-positive myotube (fusion index). We found that the loss of Ski caused significant (P<0.05) drops in both the differentiation index (from
46.4±6.2% to 14.6±9.8%) and fusion index (20.7±7.7 to 3.4±1.7 nuclei per myotube)
(Figs. 15M and N), respectively. The results indicate that in the absence of Ski, both differentiation (~3 fold fewer MHC-positive cells) and myotube formation (~ 6 fold fewer nuclei/myotube) were severely impaired (Figs. 15M and N). Thus the loss of Ski resulted in a differentiation block upstream of myocyte fusion.
Loss of Ski inhibits commitment to terminal muscle differentiation
To determine the stage at which terminal differentiation was blocked by the absence of Ski, we further examined the expression of an early differentiation marker,
Myog, and a late differentiation marker, MHC. As shown in Figure 16A, when maintained in GM, neither the C2C12 TMP-tTA-mSki1145 cells nor the TMP-tTA cells express Myog or MHC at detectable levels regardless of Dox treatment. However, after 3
149
150 Fig. 16. Loss of Ski blocks myogenic differentiation at early stage.
(A, B) A representative C2C12 TMP-tTA-mSki1145 clone (A), TMP-tTA-mSki1819 clone (B) or TMP-tTA-mSki977 clone (B) was cultured as described in the legend to Fig.
15 and kept in DM for 3 days prior to Western analysis for Ski, MHC and Myog expression. TFIIE-α was used as a loading control.
(C) Western blotting revealed expression of Ski, MHC and Myog in a C2C12 TMP-tTA- mSki1819 clone cultured in DM for 3 days with the indicated concentrations of Dox
(0~200ng/ml).
151 days of culture in DM, TMP-tTA-mSki cells in which Ski expression was maintained by
Dox treatment expressed both Myog and MHC at high levels. This was also the case when TMP-tTA cells were cultured in DM regardless of Dox treatment. In contrast, when the same TMP-tTA-mSki clone with Ski expression knocked down were cultured in DM,
Myog and MHC were expressed at very low levels (Fig. 16A). Similar results were
obtained using TMP-tTA-mSki clones expressing the other two shRNAs, indicating that
the differentiation block was not due to an off-target effect of the shRNA (Fig. 16B). In
addition, a Dox dose-response experiment with a C2C12 TMP-tTA-mSki clone
expressing a different shRNA (mSki1189) revealed that the expression of Myog and
MHC dropped in parallel with the decrease in endogenous Ski expression (Fig. 16C). The
loss of Myog expression indicated that differentiation was blocked at a very early stage in
the absence of Ski expression.
The early stages of muscle differentiation are marked by a well-characterized
progression of protein expression including the myogenic regulatory factors (MyoD and
Myog) and the cell cycle regulator (p21) (91, 92, 128, 129). To obtain a quantitative
assessment of the early disruption of the myogenic differentiation program due to the loss of Ski expression, we investigated the percentage of cells expressing these proteins during the differentiation of C2C12 TMP-tTA-mSki clones in the absence or presence of
Dox. Myog and p21 are markers of commitment to terminal differentiation and
withdrawal from the cell cycle, respectively. Their increased expression can be detected
in both differentiating myocytes and fully differentiated multinucleated myotubes and is
widely used to assess the early stage of differentiation. Within 3 days of switching to
DM, 35.5% of TMP-tTA-mSki cells were Myog-positive when cultured in the presence
152 of Dox (Figs. 17A and G) and 27.9% were p21-positive (Figs. 17C and H). In sharp
contrast, in the same TMP-tTA-mSki clone with Ski expression knocked down, the percentages of Myog and p21-positive cells decreased to 8.8% (Figs. 17B and G) and
14.9% (Figs. 17D and H), respectively. On the other hand, the expression of MyoD, a constitutive myogenic lineage marker of C2C12 cells, was comparable in the presence and absence of Ski expression (Figs. 17E, F and I). These results indicate that the loss of
Ski blocked a step in the differentiation pathway downstream of MyoD. Results obtained with a representative TMP-tTA-mSki1145 clone were shown in Figure 17 and similar results were obtained with two other clonal lines (data not shown).
To determine whether the observed Ski-dependent changes in protein expression were due to reductions in the expression of their mRNAs, we performed quantitative realtime-RT-PCR on RNA isolated from TMP-tTA-mSki cells cultured for three days in
DM plus or minus Dox. Concomitant with the 5.4-fold lower expression of Ski mRNA in
TMP-tTA-mSki cells in the absence of Dox, Myog and p21 mRNA levels were reduced by 12 fold and 5.5 fold, respectively. On the other hand, the level of MyoD mRNA was not significantly affected by the loss of Ski (Fig. 17J). These results mirror those obtained in the analyses of protein expression and indicate that Ski is necessary for the transcription or accumulation of mRNAs which are important for initiating muscle terminal differentiation.
Ski occupies Myog regulatory region in differentiating myoblasts
Because Ski is known to be a co-regulator of transcription it seemed likely that the changes we detected in the expression of muscle-specific mRNA might be due to direct effects of Ski on transcription. This possibility was especially appealing for Myog
153
154 Fig. 17. Loss of Ski reduces the expression of muscle-specific genes at both mRNA and
protein levels.
(A-F) Indirect immunofluorescence was performed on a C2C12 TMP-tTA-mSki1145
clone cultured in DM with or without Dox for 3 days. Differentiating cells were detected
with antibodies against Myog, p21 or MyoD (green) and total nuclei were counterstained
with DAPI (blue). Representative fields are shown at 400× magnification.
(G-I) Quantitative analysis of the immunofluorescence assays in C-H. Red bars represent
culture in the presence of Dox (+Dox) and blue bars represent culture in the absence of
Dox (-Dox). The fraction of nuclei positively-stained for Myog (G), p21 (H) and MyoD
(I) were calculated as described in Materials and Methods. Data above the bar represent
means of three independent experiments. Error bars show standard deviations of means.
(J) Quantitative realtime-PCR analysis of Ski, Myog, p21 and MyoD mRNA level in a
C2C12 TMP-tTA-mSki1145 clone cultured in DM with or without Dox for 3 days. Fold
change of the transcript level in culture in the presence of Dox over that in the absence of
Dox was calculated as described in Materials and Methods. Data above the bars represent
means from three independent experiments performed in triplicate. Error bars show
standard deviations of means.
155 not only because its expression is required for the initiation of terminal differentiation
(91, 92, 128, 129) but also because published reporter gene assays have demonstrated that transient overexpression of Ski can transcriptionally activate the Myog regulatory region
(115, 116).
To investigate whether endogenous Ski might directly regulate Myog
transcription, we performed ChIP assays on C2C12 cells cultured in either GM or DM.
DNA was isolated from the chromatin immunoprecipitated with anti-Ski antibodies and
was analyzed by PCR using primers that amplify the Myog regulatory region including
the E1 box, a MEF2 site and a MEF3 element (119-121, 123, 150) (Fig. 18A). The ChIP
assays revealed that Ski was not bound to this endogenous Myog regulatory region in
proliferating C2C12 cells cultured in GM. However, Ski became associated with this
region when the cells were stimulated to differentiate by switching them into DM (Fig.
18B, top panel). The specificity of this interaction was verified by negative results in
control ChIP assays using either a non-specific antibody (normal IgG) and the same
primers amplifying the Myog regulatory region or the Ski antibody and primers
amplifying a non-promoter region downstream of Myog gene (Fig. 18B, top and middle
panels). Furthermore, the observation that Ski was expressed at similar levels in cells
cultured in GM and DM indicated that the increased interaction between Ski and the
endogenous Myog regulatory region upon differentiation was not due to a parallel
increase in Ski expression (Fig. 18C). Likewise, the fact that the Smad7 regulatory
region, which is known to be bound by Ski (196), was occupied by Ski in both
proliferating and differentiating cells (Fig. 18B, bottom panel) indicated that Ski’s
chromatin binding ability didn’t depend merely on the change from GM to DM. Thus Ski
156
157 Fig. 18. Ski binds the endogenous Myog regulatory region upon differentiation.
(A) Schematic representation of the Myog regulatory region. E-boxes (E1 and E2), the
MEF2 binding site and MEF3 binding site are indicated as open boxes relative to the transcriptional start site (+1). Primer sets used to amplify sequences spanning the Myog regulatory region or a non-promoter region downstream of the Myog gene is represented as arrows.
(B) ChIP analysis of Ski’s occupancy of the endogenous Myog regulatory region in proliferating and differentiating cells. Equivalent amounts of cross-linked chromatin from
C2C12 cells cultured in GM or in DM for 2 days were precipitated with an antibody against Ski (α-Ski) or a normal rabbit IgG. The DNA isolated from precipitated chromatin was analyzed by PCR using primers spanning Myog regulatory region (upper), non-promoter region (middle) or Smad7 regulatory region (lower) and following electrophoresis, PCR products were visualized by ethidium bromide staining.
(C) Western analysis of Ski, MHC and Myog expression in C2C12 cells cultured in GM or in DM for the indicated periods of time. TFIIE-α was used as a loading control.
158 selectively binds the Myog regulatory region in concert with a signal that initiates
differentiation. These results suggest that the requirement for endogenous Ski in the
initiation of terminal muscle differentiation might be due to its direct role in activating of
Myog transcription.
MEF3 binding site is required for the activation of Myog regulatory region by Ski
In light of the above results we sought to define the Ski-response cis element in
the Myog regulatory region. A 184 bp Myog regulatory region sequence has been defined
as a muscle-specific regulatory region and contains a number of transcriptional factor
binding sites which are critical for activation of Myog transcription during differentiation
(117, 119-121, 123, 150). Among others, they include two consensus MyoD binding E-
boxes (proximal E1 box and distal E2 box), a MEF2 binding site and a MEF3 site (Fig.
19A, upper panel). Ski does not bind DNA directly, but it has previously been shown to
synergize with MyoD and MEF2 in activating transcription of Myog reporters containing
this 184 bp sequence (115). This synergy requires the binding of these transcription
factors to their response elements in the Myog regulatory region. To address whether Ski
activation of Myog regulatory region was mediated only through these binding sites, we
mutated the MEF2 binding site or both E boxes (E1 and E2) to eliminate binding by their
corresponding transcriptional factors (Fig. 19A). In addition, we mutated the MEF3 site
although it had not previously been implicated in activation by Ski. C2C12 myoblasts were transfected with the wild-type Myog reporter (Myog184) or its mutated derivatives
(Myog184-MEF3m, Myog184-MEF2m, Myog184-E1E2m, see Fig. 19A) along with a Ski
expression vector or an empty vector and luciferase activity was measured 2 days after switching the cells to DM. Ski expression potentiated the activity of the wild-type Myog
159
160 Fig. 19. The MEF3 binding site is required for maximal activation of Myog promoter by
Ski.
(A) Schematic representation of the 184bp proximal Myog regulatory region and its
mutants. The intact E1 and E2 boxes, MEF2 site and MEF3 site are indicated as open
boxes, whereas the mutated elements are marked by “X”. The sequences of wild type
binding sites are indicated in uppercase and the mutated bases in these binding sites are
indicated in lowercase.
(B, C) C2C12 cells were co-transfected with wild-type or mutated reporters described
above along with a Ski expression vector or an empty vector (mock) and cultured in DM
for 2 days. Luciferase activity (RLU) of each sample was calculated as described in
Materials and Methods.
(B) Activation of wild-type Myog regulatory region (Myog184) by Ski was calculated as
the fold change of RLU in Ski-transfected cells over that in the empty vector-transfected
cells which was set to an arbitrary unit of 1. Data are expressed as the mean values from
three independent experiments performed in triplicate. Error bars represent the standard
deviations of the means.
(C) The activation of wild-type and mutated Myog regulatory region by Ski were
calculated as described in B. The activation of the mutated Myog regulatory regions
(Myog184-E1E2m, Myog184-MEF2m, Myog184-MEF3m) by Ski is expressed as the
percentage of that with the wild-type which was set at 100%. Data are expressed as the
mean data of each reporter from three independent experiments performed in triplicates.
Error bars represent the standard deviations of the means.
161 reporter (Fig. 19B) and surprisingly activated the transcription of the reporters carrying
mutations of either the MEF2 site or both E boxes to approximately 80% of the level
observed with the wild-type reporter (Fig. 19C). These results suggested that activation of
Myog regulatory region by Ski was not mediated exclusively by these two regulatory elements. However, activation of the reporter bearing a mutated MEF3 site by Ski was only 50% of that of the wild type (Fig. 19C), indicating that this site may be the major
Ski-responsive cis element within the Myog regulatory region.
Ski associates with Eya3 and Six1 in differentiating muscle cells
We have shown that activation of Myog transcription by Ski is mediated mainly
through the MEF3 site in the regulatory region. Since Ski does not bind DNA directly, it
seemed likely that its association with the endogenous Myog regulatory region and its
activation of Myog transcription are mediated by its association with transcription factors
that bind to MEF3 element. Six1 has been shown to bind to the MEF3 site of the Myog
regulatory region (123) and to synergize with Eya to positively regulate the transcription
driven by this cis element (58). In addition, because Dach, a Ski family member, forms a
trimeric complex with Six1/Eya3 to regulate muscle-specific gene expression (58), it
seemed possible that Ski may be tethered to Myog regulatory region via an association with Six1/Eya3 in a similar manner. We therefore investigated whether Ski interacts with
Six1/Eya3 in muscle cells undergoing terminal differentiation. C2C12 cells were co- transfected with Ski and Flag-tagged Six1 and Eya3 expression vectors and cells were
cultured either in GM or induced to differentiate in DM for 48hr. Extracts of these cells
were immunoprecipitated with either rabbit anti-Ski or normal rabbit IgG and analyzed
for co-precipitation of Six1/Eya3 by Western blotting with anti-Flag. As seen in Figure
162 20A, neither Six1 nor Eya3 was precipitated by normal rabbit IgG whereas Six1 was co-
precipitated with Ski at comparable levels in proliferating (GM) and differentiating (DM)
cells. In contrast, co-precipitation of Eya3 with Ski was barely above background in
proliferating cells, but clearly detectable in differentiating cells. Thus in muscle cells Ski is constitutively associated with Six1 but interacts with Eya3 only upon differentiation.
Because a previous study suggested Ski activated transcription of Myog regulatory region in co-operation with MyoD and MEF2 (115), we performed similar co- precipitation assays to examine the possible interactions of Ski with these proteins.
Surprisingly, neither MyoD nor MEF2C co-precipitated with Ski in either proliferative or differentiating C2C12 cells (Figs. 20B and C). Considering that MyoD and MEF2 activate the transcription of some muscle-specific genes in a cooperative manner (129), it seemed possible that their interactions with Ski might require the presence of both proteins. To test this possibility, similar co-immunoprecipitation experiments were performed with extracts of C2C12 cells that were co-transfected with Ski and both MyoD and MEF2 expression vectors. Once again both proteins were expressed at high levels but neither of them co-precipitated with Ski in C2C12 cells cultured in GM or DM (Fig.
20D). Although negative results are inconclusive, these observations and the results of the reporter assays suggest that previously described transcriptional co-operation of Ski with MyoD and MEF2 may be actually mediated by an indirect interaction of
MyoD/MEF2 complex with a DNA-bound Ski/Six1/Eya3 trimeric.
The DHD of Ski is required for its association with Six1 and its activation of Myog transcription
163
164 Fig. 20. Ski interacts with Six1 and Eya3 but not with MyoD or MEF2.
(A-D) C2C12 cells were co-transfected with expression plasmids for Ski and Flag-tagged
Six1 and Eya3 (A), MEF2-Flag (B), MyoD (C) or MEF2-Flag and MyoD (D) and cultured in GM or DM for 2 days. Lysates were immunoprecipitated with an rabbit antibody against Ski (α-Ski lanes) and precipitates were analyzed by Western blotting using anti-Ski, anti-Flag or anti-MyoD antibodies. 10% of the input for immunoprecipitation (Input lanes) confirms that comparable amounts of these proteins were used in the immunoprecipitation assays. Immunoprecipitation with a normal rabbit
IgG (IgG lanes) was used as a negative control.
165 It has been shown that Dach interacts with Six1 through its DHD domain (55, 56,
58). It was therefore of interest to determine whether this conserved domain in Ski also mediates its interaction with Six1. The ability of a Ski mutant lacking the DHD to interact with Six1 was examined by coimmunoprecipitation (Figs. 21A and B). Deletion of the
DHD from Ski (SkiΔDHD) greatly reduced its ability to interact with Six1 although it did
not affect interaction with Eya3.
Having identified the DHD as the Six1 binding domain in Ski, we sought to
determine the effect of its deletion on transcriptional activation of Myog. Cotransfection
experiments showed that SkiΔDHD failed to activate transcription of the wild-type Myog
reporter (Myog184) significantly compared to the wild-type Ski (Fig. 21C). Western blots
of the transfected cells demonstrated that the lack of reporter activation by Ski∆DHD was
not due to a failure to express this protein at similar level to the wild-type Ski (Fig. 21D).
To confirm these results, we next asked whether the DHD of Ski was also required for
activation of endogenous Myog expression upon differentiation. To answer this question
we assessed whether re-introducing Ski or SkiΔDHD into C2C12 TMP-tTA-mSki cells
could overcome the loss of Myog and MHC expression due to the knock-down of Ski in
these cells. C2C12 TMP-tTA-mSki cells were grown in GM minus Dox to achieve the
maximal knock-down of Ski, transfected with Ski expression vectors and analyzed for
Myog and MHC expression after 2 days of culture in DM minus Dox. We found that
wild-type Ski restored Myog and MHC expression. However, SkiΔDHD failed to do so
and this inability was not attributable to poor expression of this mutant (Fig. 21E),
indicating that the DHD is needed for the activation of Myog transcription.
166
167 Fig. 21. The DHD of Ski is required for its association with Six1 and its activation of
Myog transcription.
(A) Schematic diagrams represent Ski and the DHD deletion mutant (Ski∆DHD).
(B) Interaction of Ski with Six1 was mediated by its DHD. C2C12 cells were co- transfected with expression plasmids for Flag-tagged Six1 and Eya3 and full-length Ski or Ski∆DHD (described in A) and cultured in DM for 2 days. Immunoprecipitation assays were performed as described in the legend to Fig. 20.
(C) C2C12 cells were co-transfected with the wild-type Myog reporter (Myog184) and expression vectors for wild-type Ski or Ski∆DHD and cultured in DM for 2 days.
Luciferase activity of each sample was calculated as described in Materials and Methods and the fold activation of Myog reporter by wild-type Ski and Ski∆DHD were calculated as described in the legend to Fig. 19B. Data are expressed as the mean values from three independent experiments performed in triplicate. Error bars represent the standard deviations of the means.
(D) Western blotting of the same lysates used for the luciferase assays in C revealed similar expression of wild-type Ski and Ski∆DHD. TFIIE-α was used as a loading control.
(E) Cells were cultured in GM in the absence of Dox for six days to achieve maximal knock-down of Ski and then transfected with expression vectors for wild-type Ski or
Ski∆DHD. Cells were then switched to DM and cultured for 2 day prior to harvest.
Western blotting revealed expression of Ski, MHC and Myog. TFIIE-α was used as a loading control.
168 Discussion
The role of Ski in terminal differentiation has been evidenced by its ability to induce myogenesis in non-muscle cells in vitro and hypertrophy of type II fast muscle of adult mice when it was overexpressed (25, 42, 45, 149). It remained of great interest to
determine whether Ski also regulates terminal differentiation of muscle satellite cells
which are the committed myogenic cells and responsible for the skeletal muscle
regeneration (197, 198). However, since Ski-/- mice die at birth, we were not able to address this issue using this mouse genetic model (47). We have therefore used a well- established in vitro model, satellite cell-derived C2C12 myoblasts, to investigate the role of Ski in terminal differentiation and its underlying molecular mechanism. Our findings that differentiation was enhanced by overexpression of Ski and severely impaired in the absence of endogenous Ski indicate that Ski not only induces but also is necessary for differentiation of determined myoblasts. We further established a tight linkage between the myogenic activity of Ski and the expression of Myog at both mRNA and protein levels. Additional results suggest that direct regulation of Myog underlies Ski’s myogenic activity by demonstrating transcriptional activation of Myog by Ski in reporter assays and the association of Ski with the endogenous Myog regulatory region upon differentiation.
Surprisingly, transcriptional activation of Myog by Ski was largely mediated by its cooperation with Six1/Eya3 through a MEF3 binding site, not with MyoD or MEF2 through the E boxes or the MEF2 binding site. The necessity of an evolutionary conserved DHD for the interaction of Ski with Six1 is consistent with published data on the interaction between Dach and Six proteins (56). Our findings support a model in
169 which Ski substitutes for Dach in the standard Dach/Six1/Eya3 complex to regulate
myogenesis.
Our earlier attempts to perform these studies using C2C12 myoblasts were
frustrated by our inability to maintain cells in which Ski is constitutively overexpressed
or knocked down. Here we surmounted this problem using inducible vectors, which
allowed cloning and propagation of transduced cells expressing endogenous Ski at
normal levels prior to acute induction or knockdown of Ski expression. The retroviral
vector we constructed for regulated knockdown (TMP-tTA) was modified from the TMP
retroviral vector of Lowe and coworkers (159-161). Since the TMP vector only carries
the TRE-driven microRNA cassette while a second vector provides the tTA gene, two rounds of infection and antibiotic selection are required. This approach works well for
cells whose activity is not compromised by prolonged passage, but it is not optimal for
C2C12 myoblasts which gradually lose their differentiation potential. Our new vector,
TMP-tTA, carries the TRE-driven microRNA cassette and the tTA gene in a single
retroviral vector, so only one round of infection/antibiotic selection is needed. This vector
has been proven as effective as the original TMP vector with regard to the efficiency,
reversibility, dose dependence and insignificant leakiness of knockdown. Given its
simplicity and effectiveness, this knockdown vector is suitable to study any gene required
for cell survival and is especially useful in cells whose activities of interest are sensitive
to prolonged cell culture passage.
Earlier work showed that Ski stimulated myogenesis in non-muscle primary avian
cells by inducing both MyoD and Myog, two genes controlling myogenic lineage
determination and terminal differentiation, respectively (25). We therefore assumed that
170 loss of Ski would lead to downregulation of both of these genes and result not only in
impaired differentiation but also in loss of myogenic identity. However, in the present
report, we observed that loss of Ski only affected the expression level of Myog but not
MyoD in determined C2C12 myoblasts, indicating that Ski is not necessary for
maintaining myogenic identity. Given the pivotal role of Myog in the initiation of
differentiation (91, 92, 128, 129), it is likely that regulation of Myog expression is the key
mediator of Ski’s effect on terminal differentiation. Furthermore, our data revealed that
the regulation of Myog expression by Ski was not only at protein level, but also at
transcript level. This result along with the observed transactivation of Myog reporter by
Ski and the occupancy of Ski on the endogenous Myog regulatory region places Myog as
a direct transcriptional target of Ski.
As a non-DNA binding transcription factor, Ski has to be brought into contact
with promoters/enhancers by interaction with transcription factors that bind to specific
DNA cis-regulatory elements (31). Cis-elements essential for transcriptional regulation of
Myog include two E boxes and a MEF2 site which are bound by MyoD and MEF2, respectively (119-121, 123, 150). Previous studies have shown that MyoD and MEF2 cooperatively activate the Myog transcription through binding to these elements at the onset of myogenesis (129). This cooperative interaction has also been seen in the upstream regulatory sequences of other muscle-specific genes, including MLC1/3 and
MCK (114, 199-201). Interestingly, Ski has been implicated in activation of these promoters in co-operation with MyoD and a previous report based solely on reporter assays suggested the same mechanism for the transactivation of Myog regulatory region by Ski (115). However, our results, using the same Myog regulatory region, appear to
171 conflict with this report by showing that the destruction of E boxes or the MEF2 site had
only a marginal effect on the ability of Ski to activate the transcription of Myog reporters.
We cannot explain this discrepancy but we believe that although reporter assays can be
useful for defining cis-response elements, their biological significance requires
confirmation by additional experiments. Our inability to detect direct interactions of Ski
with MyoD or MEF2 and the absence of any previous data showing these interactions suggests an indirect mechanism for the co-operation between Ski and MyoD on Myog
activation.
Recent studies demonstrating the presence of functional Pbx1 and MEF3 binding
sites have revealed that the Myog regulatory region is more complex than previously believed (58, 123, 150, 202, 203). Our data underscore this complexity by showing that
the MEF3 site instead of the previously implicated E boxes and MEF2 site mediated
transactivation of Myog by Ski. These sites reside in close proximity within the Myog
regulatory region suggesting that their combined occupancy by Six1, MyoD and MEF2
may be the basis for the cooperation between Ski and these proteins. Our finding that
activation of Myog transcription by Ski requires interaction with the MEF3-binding Six1
protein provides the mechanism for recruitment of Ski to the Myog regulatory region.
This interaction and the observation that Ski-/- mice exhibited a similar muscle defect as
the Six1-/- mice, suggests a common mechanism by which both Ski and Six1 regulate
myogenesis (47, 48, 123, 134, 136, 204).
The differentiation-dependent interaction between Ski, Six1 and Eya3 correlates
well with the observation that the association of Ski with the endogenous Myog
regulatory region occurs only in differentiating cells. Since growth factor signaling can
172 block the ability of Eya to interact with Six proteins (59, 138), it is possible that the
withdrawal of serum growth factors initiates terminal differentiation by freeing Eya to
form the Ski/Six/Eya trimeric complex on the Myog regulatory region to activate its
transcription. Dachshund, has also been reported to transactivate the Myog reporter
through the interaction with Six and Eya (55, 58). However, since activation of Myog
expression and subsequent differentiation was almost abolished in the absence of Ski, we
believe that in C2C12 myoblasts it is Ski, not Dach, that is the essential member of this
trimeric complex. Our findings shed new light on the mechanism of Ski’s myogenic
activity and the importance of the Ski/Six/Eya trimeric complex in muscle terminal
differentiation.
Future Directions
Mechanism of Myog transcriptional regulation by Ski/Six1/Eya3 complex
We have shown that Ski regulates the Myog promoter through a MEF3 site and is
also associated with Six1/Eya3. However, in order to prove that the regulation of Myog
by Ski is due to its ability to interact with Six1 and Eya3 proteins, we will use the same
shRNA-based strategy we employed with Ski to knockdown Six1 or Eya3 in C2C12
cells. We will examine the effect of knockdown of Six1 and Eya3 expression on the transactivation of Myog promoter, induction of Myog expression and occupancy of
endogenous Myog promoter by Ski in these cells by reporter assays, western blotting and
ChIP assays, respectively.
Our data also indicate that although Ski interacts with Six1 in both proliferative
and differentiating cells, the interaction between Ski and Eya is differentiation-dependent.
173 These results correlated with the differentiation-induced association of Ski with
endogenous Myog promoter. The remaining question here is how serum removal triggers
these protein-protein and protein-DNA associations. Because little is known about how
Eya3 is involved in myogenic differentiation, as a starting point, we will investigate the
intracellular location of Eya3 and posttranslational modifications of Eya3, especially its
phosphorylation under proliferation and differentiation conditions. Based on the
knowledge gained from the above experiments, we will further investigate whether the
translocation or change of phosphorylation status of Eya3 causes the change in its ability
to interact with Ski and Six1 and to associate with Myog promoter, therefore altering the
formation of Ski/Six1/Eya3 complex on the endogenous Myog promoter.
Regulatory cascades of Ski during myogenic differentiation
Our results indicate that Myog is a target gene of Ski and plays a major role in the
regulation of myogenic differentiation by Ski. However, our understanding of how Ski
regulates this process is still fragmentary. To unravel the transcriptional activation
cascade of Ski, microarray-based gene expression profiles of C2C12 cells in which Ski is
overexpressed or knocked down under proliferation or differentiation conditions will be generated and computationally analyzed. ChIP-on-chip assays will also be used to identify transcriptional factor-binding sites for Ski in proliferating and differentiating
C2C12 cells in a genome-wide manner. Combining these studies will allow us to uncover unexplored aspects of the myogenic regulation by Ski, reveal the transcriptional regulation cascades downstream of Ski and suggest some new directions for future studies.
The regulation of satellite cell behavior by Ski in vivo
174 Our studies suggest that Ski is required for the differentiation of satellite cell- derived C2C12 cells in vitro, but since constitutive Ski knockout mice die at birth, we could not use these animals to study the effect of Ski on the behavior of adult satellite cells. In the future, taking advantage of the Pax7 promoter which is active early in myogenic progenitors and later in satellite cells (108-110, 179), mice with Ski ablated in satellite cells will be generated by crossing mice with a floxed Ski allele to animals that transgenically express Cre recombinase under the control of the Pax7 promoter (Pax7-
Cre). These animals will enable us to investigate the role of Ski in satellite cells in vivo.
175 DISCUSSION
The Contradictions in This Study
In this study, the apparent requirement of Ski in myogenic differentiation of
C2C12 myoblasts appears to contradict our finding that both myogenic cells in Ski knockout mouse embryos and primary culture of satellite cells isolated from Ski knockout mice didn’t exhibit differentiation defect. However, this is not the first time people see such a striking contrast between in vitro myoblast culture and in vivo mice studies. For example, the distinct effects of Ski on differentiation in cell culture systems and in mice are reminiscent of p53. A number of studies have demonstrated that in C2C12 myoblasts, exogenous wild-type p53 stimulates myogenic differentiation, whereas interference with the function of endogenous p53 by a dominant negative p53 mutant inhibited this process
(205-208). However, skeletal muscles of p53-/- mice develop normally (208, 209). In addition, after whole muscle transplantation or crush injury, the regeneration ability of muscles was comparable between p53-/- mice and wild-type control, suggesting unaffected differentiation of satellite cells in the absence of p53 (210).
Unlike the intact animal model, C2C12 cell culture is a relatively isolated experimental system. Because of this, one of the possibilities to reconcile the apparent conflict between the in vivo myogenic cells and in vitro C2C12 culture is the flexibility or redundancy built into myogenic processes that are controlled by the microenviroment in vivo. For example, the normal muscle development and regeneration in p53-/- mice could be due to the compensatory effects of p63 and/or p73. Another well-known example is the compensatory mechanism between MyoD and Myf5. MyoD and Myf5 are functionally redundant for skeletal myogenesis. Both MyoD-/- and Myf5-/- mutant mice
176 have apparently normal skeletal muscle (96, 97). Only in the absence of both MyoD and
Myf5, mice exhibit a complete absence of skeletal muscle (98). Similar to these major
myogenic determination factors, although Ski probably participates in the major pathway
that regulates myogenic differentiation, other pathways may exist to substitute for Ski in
this complicated process during embryogenesis, although we don’t know what they are
yet. In the absence of Ski, these alternative pathways are activated in myogenic cells to
compensate for Ski’s function, probably by signals from the surrounding tissues. In
C2C12 myoblasts, because of the lack of these external signals, the loss of Ski is
catastrophic.
Different effects of Ski on differentiation were also observed between primary
satellite cells culture and C2C12 myoblasts. This reminds us of Myog-/- mice(99).
Although Myog is well known to be necessary for myogenic differentiation, satellite cells
isolated from Myog-/- mice differentiate normally in culture. This contradiction also
could be explained by the compensatory mechanism. In vivo, constitutive loss of Ski or
Myog may initiate certain compensatory mechanisms to maintain the differentiation potential of these satellite cells, therefore even after being isolated and cultured in vitro, they still be able to undergo differentiation. However, acute knockdown of Ski in C2C12 cells after Dox removal may not be able to give cells enough time or may require certain extrinsic signals to activate these compensatory mechanisms.
In spite of the conflict between them, both the in vitro and in vivo studies provide insights into myogenesis. The study with the in vivo mice model is at the whole animal level and includes microenvironmental influences, whereas cultured C2C12 cells provide a more controlled cellular environment and are available to measure cell autonomous
177 effects. In such an in vitro system, the effect of selectively altered gene expression on differentiation can be isolated from the potential compensatory effects often seen in animal models and can be evaluated with much less concern about possible indirect effects. We believe that by combining the advantages of both experimental systems, we can gain greater understanding of the overall biological significance of Ski and how it is involved in the complicated process of myogenesis.
178 REFERENCES
1. E. Stavnezer, D. S. Gerhard, R. C. Binari, I. Balazs, J Virol 39, 920 (Sep, 1981).
2. E. Stavnezer, A. E. Barkas, L. A. Brennan, D. Brodeur, Y. Li, J Virol 57, 1073
(Mar, 1986).
3. Y. Li, C. M. Turck, J. K. Teumer, E. Stavnezer, J Virol 57, 1065 (Mar, 1986).
4. X. Liu, Y. Sun, R. A. Weinberg, H. F. Lodish, Cytokine Growth Factor Rev 12, 1
(Mar, 2001).
5. C. Colmenares, E. Stavnezer, Semin Cancer Biol 1, 383 (Dec, 1990).
6. G. Zheng, J. Teumer, C. Colmenares, C. Richmond, E. Stavnezer, Oncogene 15,
459 (Jul 24, 1997).
7. J. J. Wilson, M. Malakhova, R. Zhang, A. Joachimiak, R. S. Hegde, Structure 12,
785 (May, 2004).
8. D. Chen et al., Cancer Res 63, 6626 (Oct 15, 2003).
9. S. Pearson-White, Nucleic Acids Res 21, 4632 (Sep 25, 1993).
10. N. Nomura et al., Nucleic Acids Res 17, 5489 (Jul 25, 1989).
11. K. L. Hammond, I. M. Hanson, A. G. Brown, L. A. Lettice, R. E. Hill, Mech Dev
74, 121 (Jun, 1998).
12. E. Mizuhara, T. Nakatani, Y. Minaki, Y. Sakamoto, Y. Ono, J Biol Chem 280,
3645 (Feb 4, 2005).
13. R. J. Davis, W. Shen, T. A. Heanue, G. Mardon, Dev Genes Evol 209, 526 (Sep,
1999).
14. S. Arndt, I. Poser, T. Schubert, M. Moser, A. K. Bosserhoff, Lab Invest 85, 1330
(Nov, 2005).
179 15. S. Arndt, I. Poser, M. Moser, A. K. Bosserhoff, Mol Cell Neurosci 34, 603 (Apr,
2007).
16. T. Nomura et al., Genes Dev 13, 412 (Feb 15, 1999).
17. F. Tokitou et al., J Biol Chem 274, 4485 (Feb 19, 1999).
18. R. Dahl, M. Kieslinger, H. Beug, M. J. Hayman, Proc Natl Acad Sci U S A 95,
11187 (Sep 15, 1998).
19. R. Dahl, B. Wani, M. J. Hayman, Oncogene 16, 1579 (Mar 26, 1998).
20. T. Prathapam, C. Kuhne, M. Hayman, L. Banks, Nucleic Acids Res 29, 3469 (Sep
1, 2001).
21. S. Akiyoshi et al., J Biol Chem 274, 35269 (Dec 3, 1999).
22. K. Luo et al., Genes Dev 13, 2196 (Sep 1, 1999).
23. Y. Sun et al., Mol Cell 4, 499 (Oct, 1999).
24. W. Xu et al., Proc Natl Acad Sci U S A 97, 5924 (May 23, 2000).
25. C. Colmenares, J. K. Teumer, E. Stavnezer, Mol Cell Biol 11, 1167 (Feb, 1991).
26. R. Nicol, G. Zheng, P. Sutrave, D. N. Foster, E. Stavnezer, Cell Growth Differ 10,
243 (1999).
27. K. Luo, Curr Opin Genet Dev 14, 65 (Feb, 2004).
28. M. Takeda et al., Mol Biol Cell 15, 963 (Mar, 2004).
29. K. Kokura et al., J Biol Chem 276, 34115 (Sep 7, 2001).
30. H. C. Heyman, E. Stavnezer, J Biol Chem 269, 26996 (Oct 28, 1994).
31. T. Nagase et al., Nucleic Acids Res 18, 337 (Jan 25, 1990).
32. K. A. Waite, C. Eng, Nat Rev Genet 4, 763 (Oct, 2003).
33. J. Massague, Annu Rev Biochem 67, 753 (1998).
180 34. S. Atanasoski et al., Neuron 43, 499 (Aug 19, 2004).
35. W. Wang, F. V. Mariani, R. M. Harland, K. Luo, Proc Natl Acad Sci U S A 97,
14394 (Dec 19, 2000).
36. C. D. Kaufman, G. Martinez-Rodriguez, P. B. Hackett, Jr., Mech Dev 95, 147
(Jul, 2000).
37. N. Ueki, M. J. Hayman, J Biol Chem 278, 24858 (Jul 4, 2003).
38. P. Dai et al., Genes Dev 16, 2843 (Nov 15, 2002).
39. S. Namciu et al., Dev Dyn 204, 291 (Nov, 1995).
40. G. E. Lyons et al., Dev Dyn 201, 354 (Dec, 1994).
41. S. Fumagalli, L. Doneda, N. Nomura, L. Larizza, Melanoma Res 3, 23 (Feb,
1993).
42. C. Colmenares, E. Stavnezer, Cell 59, 293 (Oct 20, 1989).
43. T. Shinagawa et al., Oncogene 20, 8100 (Dec 6, 2001).
44. L. Li, Ph.D. thesis, Case Western Reserve University (2004).
45. P. Sutrave, A. M. Kelly, S. H. Hughes, Genes Dev 4, 1462 (Sep, 1990).
46. S. B. Charge, A. S. Brack, S. M. Hughes, Am J Physiol Cell Physiol 283, C1228
(Oct, 2002).
47. M. Berk, S. Y. Desai, H. C. Heyman, C. Colmenares, Genes Dev 11, 2029 (Aug
15, 1997).
48. C. Colmenares et al., Nat Genet 30, 106 (Jan, 2002).
49. S. B. Cohen, G. Zheng, H. C. Heyman, E. Stavnezer, Nucleic Acids Res 27, 1006
(Feb 15, 1999).
181 50. P. L. Boyer, C. Colmenares, E. Stavnezer, S. H. Hughes, Oncogene 8, 457 (Feb,
1993).
51. X. Caubit et al., Dev Dyn 214, 66 (Jan, 1999).
52. T. A. Heanue et al., Mech Dev 111, 75 (Feb, 2002).
53. R. J. Davis et al., Mol Cell Biol 21, 1484 (Mar, 2001).
54. Z. Kozmik et al., Dev Genes Evol 209, 537 (Sep, 1999).
55. R. Chen, M. Amoui, Z. Zhang, G. Mardon, Cell 91, 893 (Dec 26, 1997).
56. T. A. Heanue et al., Genes Dev 13, 3231 (Dec 15, 1999).
57. K. Ikeda, Y. Watanabe, H. Ohto, K. Kawakami, Mol Cell Biol 22, 6759 (Oct,
2002).
58. X. Li et al., Nature 426, 247 (Nov 20, 2003).
59. H. Ozaki, Y. Watanabe, K. Ikeda, K. Kawakami, J Hum Genet 47, 107 (2002).
60. G. Mardon, N. M. Solomon, G. M. Rubin, Development 120, 3473 (Dec, 1994).
61. W. Shen, G. Mardon, Development 124, 45 (Jan, 1997).
62. R. J. Davis, W. Shen, Y. I. Sandler, T. A. Heanue, G. Mardon, Mech Dev 102,
169 (Apr, 2001).
63. R. J. Davis, Y. I. Pesah, M. Harding, R. Paylor, G. Mardon, Genesis 44, 84 (Feb,
2006).
64. M. Backman, O. Machon, C. J. Van Den Bout, S. Krauss, Dev Dyn 226, 139 (Jan,
2003).
65. B. Christ, C. P. Ordahl, Anat Embryol (Berl) 191, 381 (May, 1995).
66. T. P. Yamaguchi, Curr Opin Genet Dev 7, 513 (Aug, 1997).
67. M. Buckingham, Curr Opin Genet Dev 11, 440 (Aug, 2001).
182 68. F. E. Stockdale, Dev Biol 154, 284 (Dec, 1992).
69. P. M. Wigmore, G. F. Dunglison, Int J Dev Biol 42, 117 (Mar, 1998).
70. M. Buckingham, Curr Opin Genet Dev 16, 525 (Oct, 2006).
71. M. Buckingham, F. Relaix, Annu Rev Cell Dev Biol 23, 645 (2007).
72. E. Bober, T. Franz, H. H. Arnold, P. Gruss, P. Tremblay, Development 120, 603
(Mar, 1994).
73. G. Daston, E. Lamar, M. Olivier, M. Goulding, Development 122, 1017 (Mar,
1996).
74. T. Franz, R. Kothary, M. A. Surani, Z. Halata, M. Grim, Anat Embryol (Berl) 187,
153 (Feb, 1993).
75. M. Goulding, A. Lumsden, A. J. Paquette, Development 120, 957 (Apr, 1994).
76. F. Relaix et al., Genes Dev 17, 2950 (Dec 1, 2003).
77. P. Tremblay et al., Dev Biol 203, 49 (Nov 1, 1998).
78. F. Bladt, D. Riethmacher, S. Isenmann, A. Aguzzi, C. Birchmeier, Nature 376,
768 (Aug 31, 1995).
79. S. Dietrich et al., Development 126, 1621 (Apr, 1999).
80. M. K. Gross et al., Development 127, 413 (Jan, 2000).
81. K. Schafer, T. Braun, Nat Genet 23, 213 (Oct, 1999).
82. F. R. Schubert et al., Dev Dyn 222, 506 (Nov, 2001).
83. M. D. Goulding, G. Chalepakis, U. Deutsch, J. R. Erselius, P. Gruss, EMBO J 10,
1135 (May, 1991).
84. S. Tajbakhsh, M. Buckingham, Curr Top Dev Biol 48, 225 (2000).
183 85. F. Relaix, D. Rocancourt, A. Mansouri, M. Buckingham, Genes Dev 18, 1088
(May 1, 2004).
86. J. A. Epstein, D. N. Shapiro, J. Cheng, P. Y. Lam, R. L. Maas, Proc Natl Acad Sci
U S A 93, 4213 (Apr 30, 1996).
87. D. Mennerich, K. Schafer, T. Braun, Mech Dev 73, 147 (May, 1998).
88. X. M. Yang, K. Vogan, P. Gros, M. Park, Development 122, 2163 (Jul, 1996).
89. H. Amthor, B. Christ, M. Weil, K. Patel, Curr Biol 8, 642 (May 21, 1998).
90. M. H. Parker, P. Seale, M. A. Rudnicki, Nat Rev Genet 4, 497 (Jul, 2003).
91. R. L. Perry, M. A. Rudnick, Front Biosci 5, D750 (Sep 1, 2000).
92. M. E. Pownall, M. K. Gustafsson, C. P. Emerson, Jr., Annu Rev Cell Dev Biol 18,
747 (2002).
93. M. Buckingham et al., Symp Soc Exp Biol 46, 203 (1992).
94. C. Birchmeier, H. Brohmann, Curr Opin Cell Biol 12, 725 (Dec, 2000).
95. T. Braun, M. A. Rudnicki, H. H. Arnold, R. Jaenisch, Cell 71, 369 (Oct 30, 1992).
96. A. Kaul, M. Koster, H. Neuhaus, T. Braun, Cell 102, 17 (Jul 7, 2000).
97. M. A. Rudnicki, T. Braun, S. Hinuma, R. Jaenisch, Cell 71, 383 (Oct 30, 1992).
98. M. A. Rudnicki et al., Cell 75, 1351 (Dec 31, 1993).
99. Y. Nabeshima et al., Nature 364, 532 (Aug 5, 1993).
100. P. Hasty et al., Nature 364, 501 (Aug 5, 1993).
101. J. M. Venuti, J. H. Morris, J. L. Vivian, E. N. Olson, W. H. Klein, J Cell Biol 128,
563 (Feb, 1995).
102. E. N. Olson, H. H. Arnold, P. W. Rigby, B. J. Wold, Cell 85, 1 (Apr 5, 1996).
103. J. R. Beauchamp et al., J Cell Biol 151, 1221 (Dec 11, 2000).
184 104. D. D. Cornelison, B. J. Wold, Dev Biol 191, 270 (Nov 15, 1997).
105. D. D. Cornelison, B. B. Olwin, M. A. Rudnicki, B. J. Wold, Dev Biol 224, 122
(Aug 15, 2000).
106. L. A. Megeney, B. Kablar, K. Garrett, J. E. Anderson, M. A. Rudnicki, Genes
Dev 10, 1173 (May 15, 1996).
107. D. Montarras, C. Lindon, C. Pinset, P. Domeyne, Biol Cell 92, 565 (Dec, 2000).
108. L. Kassar-Duchossoy et al., Genes Dev 19, 1426 (Jun 15, 2005).
109. F. Relaix, D. Rocancourt, A. Mansouri, M. Buckingham, Nature 435, 948 (Jun
16, 2005).
110. J. Gros, M. Manceau, V. Thome, C. Marcelle, Nature 435, 954 (Jun 16, 2005).
111. P. Seale et al., Cell 102, 777 (Sep 15, 2000).
112. F. Relaix et al., J Cell Biol 172, 91 (Jan 2, 2006).
113. S. Oustanina, G. Hause, T. Braun, EMBO J 23, 3430 (Aug 18, 2004).
114. J. C. Engert, S. Servaes, P. Sutrave, S. H. Hughes, N. Rosenthal, Nucleic Acids
Res 23, 2988 (Aug 11, 1995).
115. N. Kobayashi et al., Genes Cells 12, 375 (Mar, 2007).
116. K. Ichikawa, T. Nagase, S. Ishii, A. Asano, N. Mimura, Biochem J 328 ( Pt 2),
607 (Dec 1, 1997).
117. S. P. Yee, P. W. Rigby, Genes Dev 7, 1277 (Jul, 1993).
118. T. C. Cheng, B. S. Tseng, J. P. Merlie, W. H. Klein, E. N. Olson, Proc Natl Acad
Sci U S A 92, 561 (Jan 17, 1995).
119. D. G. Edmondson, T. C. Cheng, P. Cserjesi, T. Chakraborty, E. N. Olson, Mol
Cell Biol 12, 3665 (Sep, 1992).
185 120. T. K. Blackwell, H. Weintraub, Science 250, 1104 (Nov 23, 1990).
121. T. J. Brennan, E. N. Olson, Genes Dev 4, 582 (Apr, 1990).
122. T. C. Cheng, M. C. Wallace, J. P. Merlie, E. N. Olson, Science 261, 215 (Jul 9,
1993).
123. F. Spitz et al., Proc Natl Acad Sci U S A 95, 14220 (Nov 24, 1998).
124. M. S. Parmacek et al., Mol Cell Biol 14, 1870 (Mar, 1994).
125. K. Hidaka, I. Yamamoto, Y. Arai, T. Mukai, Mol Cell Biol 13, 6469 (Oct, 1993).
126. M. Salminen, S. Lopez, P. Maire, A. Kahn, D. Daegelen, Mol Cell Biol 16, 76
(Jan, 1996).
127. F. Spitz et al., Mol Cell Biol 17, 656 (Feb, 1997).
128. V. Andres, K. Walsh, J Cell Biol 132, 657 (Feb, 1996).
129. J. D. Molkentin, E. N. Olson, Proc Natl Acad Sci U S A 93, 9366 (Sep 3, 1996).
130. V. Sartorelli, G. Caretti, Curr Opin Genet Dev 15, 528 (Oct, 2005).
131. C. A. Berkes, S. J. Tapscott, Semin Cell Dev Biol 16, 585 (Aug-Oct, 2005).
132. E. N. Olson, M. Perry, R. A. Schulz, Dev Biol 172, 2 (Nov, 1995).
133. R. Pollock, R. Treisman, Genes Dev 5, 2327 (Dec, 1991).
134. K. Kawakami, S. Sato, H. Ozaki, K. Ikeda, Bioessays 22, 616 (Jul, 2000).
135. R. Grifone et al., Development 132, 2235 (May, 2005).
136. C. Laclef et al., Development 130, 2239 (May, 2003).
137. F. Pignoni et al., Cell 91, 881 (Dec 26, 1997).
138. H. Ohto et al., Mol Cell Biol 19, 6815 (Oct, 1999).
139. P. X. Xu, I. Woo, H. Her, D. R. Beier, R. L. Maas, Development 124, 219 (Jan,
1997).
186 140. N. Mishima, S. Tomarev, Int J Dev Biol 42, 1109 (Nov, 1998).
141. G. Borsani et al., Hum Mol Genet 8, 11 (Jan, 1999).
142. R. Quiring, U. Walldorf, U. Kloter, W. J. Gehring, Science 265, 785 (Aug 5,
1994).
143. G. Oliver et al., Development 121, 4045 (Dec, 1995).
144. G. Halder et al., Development 125, 2181 (Jun, 1998).
145. N. M. Bonini, W. M. Leiserson, S. Benzer, Cell 72, 379 (Feb 12, 1993).
146. B. N. Cheyette et al., Neuron 12, 977 (May, 1994).
147. N. M. Bonini, Q. T. Bui, G. L. Gray-Board, J. M. Warrick, Development 124,
4819 (Dec, 1997).
148. H. Amthor, B. Christ, K. Patel, Development 126, 1041 (Feb, 1999).
149. C. Colmenares, P. Sutrave, S. H. Hughes, E. Stavnezer, J Virol 65, 4929 (Sep,
1991).
150. A. B. Heidt, A. Rojas, I. S. Harris, B. L. Black, Mol Cell Biol 27, 5910 (Aug,
2007).
151. X. Li, V. Perissi, F. Liu, D. W. Rose, M. G. Rosenfeld, Science 297, 1180 (Aug
16, 2002).
152. T. A. Rando, H. M. Blau, J Cell Biol 125, 1275 (Jun, 1994).
153. L. Kassar-Duchossoy et al., Nature 431, 466 (Sep 23, 2004).
154. A. P. Monaghan et al., Development 112, 1053 (Aug, 1991).
155. D. Sassoon et al., Nature 341, 303 (Sep 28, 1989).
156. M. O. Ott, E. Bober, G. Lyons, H. Arnold, M. Buckingham, Development 111,
1097 (Apr, 1991).
187 157. M. P. Matise, A. L. Joyner, J Neurosci 17, 7805 (Oct 15, 1997).
158. S. J. Odelberg, A. Kollhoff, M. T. Keating, Cell 103, 1099 (Dec 22, 2000).
159. R. A. Dickins et al., Nat Genet 37, 1289 (Nov, 2005).
160. J. M. Silva et al., Nat Genet 37, 1281 (Nov, 2005).
161. F. Stegmeier, G. Hu, R. J. Rickles, G. J. Hannon, S. J. Elledge, Proc Natl Acad
Sci U S A 102, 13212 (Sep 13, 2005).
162. N. Ueki, L. Zhang, M. J. Hayman, Mol Cell Biol 24, 10118 (Dec, 2004).
163. P. Tarapore et al., Nucleic Acids Res. 25, 3895 (1997).
164. T. H. Smith, A. M. Kachinsky, J. B. Miller, J Cell Biol 127, 95 (Oct, 1994).
165. S. Pizette, L. Niswander, Development 126, 883 (Feb, 1999).
166. Y. Wang, D. Sassoon, Dev Biol 168, 374 (Apr, 1995).
167. S. J. Conway, D. J. Henderson, A. J. Copp, Development 124, 505 (Jan, 1997).
168. S. J. Conway, D. J. Henderson, M. L. Kirby, R. H. Anderson, A. J. Copp,
Cardiovasc Res 36, 163 (Nov, 1997).
169. J. A. Epstein et al., Development 127, 1869 (May, 2000).
170. D. Horst et al., Int J Dev Biol 50, 47 (2006).
171. J. J. Kerrigan, J. T. McGill, J. A. Davies, L. Andrews, J. R. Sandy, J R Coll Surg
Edinb 43, 223 (Aug, 1998).
172. T. Crepaldi, A. Gautreau, P. M. Comoglio, D. Louvard, M. Arpin, J Cell Biol 138,
423 (Jul 28, 1997).
173. S. Giordano et al., Nat Cell Biol 4, 720 (Sep, 2002).
174. V. Orian-Rousseau, L. Chen, J. P. Sleeman, P. Herrlich, H. Ponta, Genes Dev 16,
3074 (Dec 1, 2002).
188 175. L. Trusolino, A. Bertotti, P. M. Comoglio, Cell 107, 643 (Nov 30, 2001).
176. X. Wang et al., Mol Cell 9, 411 (Feb, 2002).
177. S. Hiscox, W. G. Jiang, Biochem Biophys Res Commun 261, 406 (Aug 2, 1999).
178. K. D. McCall-Culbreath, Z. Li, M. M. Zutter, Blood 111, 3562 (Apr 1, 2008).
179. R. Ben-Yair, C. Kalcheim, Development 132, 689 (Feb, 2005).
180. S. Biressi et al., Dev Biol 304, 633 (Apr 15, 2007).
181. S. Li et al., Proc Natl Acad Sci U S A 102, 1082 (Jan 25, 2005).
182. J. Li, F. Chen, J. A. Epstein, Genesis 26, 162 (Feb, 2000).
183. C. Keller, M. S. Hansen, C. M. Coffin, M. R. Capecchi, Genes Dev 18, 2608 (Nov
1, 2004).
184. D. W. Seol, Q. Chen, M. L. Smith, R. Zarnegar, J Biol Chem 274, 3565 (Feb 5,
1999).
185. D. W. Seol, Q. Chen, R. Zarnegar, Oncogene 19, 1132 (Feb 24, 2000).
186. G. G. McGill, R. Haq, E. K. Nishimura, D. E. Fisher, J Biol Chem 281, 10365
(Apr 14, 2006).
187. D. Rusciano, P. Lorenzoni, M. M. Burger, J Cell Sci 112 ( Pt 5), 623 (Mar, 1999).
188. D. W. Seol, R. Zarnegar, Biochim Biophys Acta 1395, 252 (Feb 11, 1998).
189. A. Germani et al., Am J Pathol 163, 1417 (Oct, 2003).
190. K. Kawamura et al., J Biol Chem 279, 54862 (Dec 24, 2004).
191. J. Suzuki, Y. Yamazaki, G. Li, Y. Kaziro, H. Koide, Mol Cell Biol 20, 4658 (Jul,
2000).
192. K. Bandow, T. Ohnishi, M. Tamura, I. Semba, Y. Daikuhara, J Cell Physiol 201,
236 (Nov, 2004).
189 193. S. C. Pruitt, A. Bussman, A. Y. Maslov, T. A. Natoli, R. Heinaman, Gene Expr
Patterns 4, 671 (Oct, 2004).
194. M. Gossen, H. Bujard, Proc Natl Acad Sci U S A 89, 5547 (1992).
195. D. P. Young, I. Kushner, D. Samols, J Immunol 181, 2420 (Aug 15, 2008).
196. N. G. Denissova, F. Liu, J Biol Chem 279, 28143 (Jul 2, 2004).
197. S. Kuang, M. A. Rudnicki, Trends Mol Med 14, 82 (Feb, 2008).
198. F. Le Grand, M. A. Rudnicki, Curr Opin Cell Biol 19, 628 (Dec, 2007).
199. L. A. Gossett, D. J. Kelvin, E. A. Sternberg, E. N. Olson, Mol Cell Biol 9, 5022
(Nov, 1989).
200. N. Rosenthal et al., Nucleic Acids Res 18, 6239 (Nov 11, 1990).
201. B. M. Wentworth, M. Donoghue, J. C. Engert, E. B. Berglund, N. Rosenthal, Proc
Natl Acad Sci U S A 88, 1242 (Feb 15, 1991).
202. L. Zhang, C. Wang, Oncogene 26, 1595 (Mar 8, 2007).
203. C. A. Berkes et al., Mol Cell 14, 465 (May 21, 2004).
204. C. Laclef, E. Souil, J. Demignon, P. Maire, Mech Dev 120, 669 (Jun, 2003).
205. A. Porrello et al., J Cell Biol 151, 1295 (Dec 11, 2000).
206. Y. Tamir, E. Bengal, Oncogene 17, 347 (Jul 23, 1998).
207. S. Soddu et al., J Cell Biol 134, 193 (Jul, 1996).
208. N. Almog, V. Rotter, Biochim Biophys Acta 1333, F1 (Aug 8, 1997).
209. L. A. Donehower et al., Nature 356, 215 (Mar 19, 1992).
210. J. D. White, C. Rachel, R. Vermeulen, M. Davies, M. D. Grounds, Int J Dev Biol
46, 577 (2002).
190