Lanthanide-Dependent Methylotrophic Pathway in Methylobacterium Aquaticum Strain 22A

Lanthanide-dependent methylotrophic pathway in Methylobacterium aquaticum strain 22A

2020, September

Patcha Yanpirat

Graduate School of Environmental and Life Science (Doctor’s Course) OKAYAMA UNIVERSITY

Table of Contents

Abstract ...... i

Abbreviations ...... iii

1. Introduction ...... 1

1.1. Methanol and methylotrophs ...... 1

1.2. Methylotrophy in Methylobacterium species...... 2

1.3. Role of lanthanides in methylotrophy ...... 3

1.4. Methylobacterium aquaticum strain 22A...... 6

1.5. Formaldehyde oxidation in Ln-dependent methylotrophy in Methylobacterium aquaticum strain 22A ...... 7

2. Materials and Methods ...... 9

2.1. Strain and culture conditions ...... 9

2.2. Construction of formaldehyde oxidation gene deletion mutants ...... 9

2.3. Growth experiment of the mutants ...... 10

2.4. Formaldehyde accumulation and degradation assay in a resting cell reaction ... 10

2.5. S-hydroxymethyl glutathione dehydrogenase (Hgd) assay ...... 11

2.6. ATP assay ...... 11

2.7. Expression vector construction ...... 12

2.8. Purification of recombinant XoxF1 and MxaF ...... 12

2.9. MDH activity and enzyme kinetics...... 13

3. Results and Discussion ...... 14

3.1. Phylogenetic analysis of GSH-dependent formaldehyde dehydrogenase in Methylobacterium species ...... 14

3.2. Characterization of the mutants in formaldehyde oxidation pathways ...... 14

3.2.1. Growth of formaldehyde oxidation mutants in liquid medium ...... 15

3.2.2. Growth of the mutants on solid medium ...... 16

3.3. Formaldehyde accumulation and degradation analysis in a resting cell reaction 17

3.4. hgd encodes S-hydroxymethylglutathione dehydrogenase...... 19

3.5. ATP assay ...... 20

3.6. The recombinant XoxF1-His oxidizes methanol and formaldehyde...... 21

Conclusion ...... 22

References ...... 23

Acknowledgements ...... 34

List of Figures

Figure 1. A schematic of methylotrophy in strain AM1...... 36

Figure 2. A comparison of enzymes and pathways used in the methylotrophy of (A) M. extorquens AM1 and (B) M. aquaticum 22A...... 37

Figure 3. Molecular phylogenetic analysis of MDH-like proteins found in strain 22A and other related sequences. The evolutionary history was inferred by using the maximum likelihood method based on the JTT matrix-based model (Jones et al., 1992). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Evolutionary analyses were conducted in MEGA7 (Kumar et al., 2016)...... 38

Figure 4. Pathways involved in the methylotrophy of M. aquaticum 22A, showing the target enzymes in this work...... 39

Figure 5. Molecular phylogenetic analysis of GSH-dependent pathway genes in Methylobacterium type strains using 16S. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The phylogenetic tree was constructed using neighbor joining clustering method (Saitou and Nei, 1987) in MEGA7 (Kumar et al., 2016). Asterisks (*) indicate species containing Hgd and Fgh genes. Dots, M. aquaticum and M. extorquens...... 40

Figure 6. Growth of various formaldehyde oxidation-pathway mutants constructed in the (A.) wild type, (B.) ΔxoxF1Sup, and (C.) ΔmxaF backgrounds, in methanol succinate liquid medium in the presence and absence of La3+. The results are presented as average ± SD (technical triplicates)...... 41

Figure 7. Growth of various formaldehyde oxidation-pathway mutants constructed in the (A) wild type, (B.) ΔxoxF1Sup, and (C.) ΔmxaF backgrounds, in methanol plus succinate liquid medium in the presence and absence of La3+. The results are presented as average ± SD (technical triplicates)...... 42

Figure 8. Growth of various formaldehyde pathway mutants generated in wild type, ΔxoxF1Sup, and ΔmxaF backgrounds on methanol solid medium in the presence and absence of La3+. The partitioning of wild type and ΔxoxF1Sup in each plate corresponds to scheme (X) while ΔmxaF corresponds to scheme (Y)...... 43

and ΔxoxF1Sup in each plate corresponds to scheme (X) while ΔmxaF corresponds to scheme (Y)...... 44

Figure 10. Formaldehyde accumulation and degradation in the resting cell reaction of various MDH and formaldehyde oxidation pathway mutants. All mutants were grown on methanol plus succinate in the presence of La3+ (except those marked with asterisks (*) which were grown on succinate) and subjected to resting cell reaction with methanol (2% v/v, 60 min) or formaldehyde (500 µM, 30 min). The quantities of accumulated (open bar) and degraded (filled bar) formaldehyde were quantified and shown as concentrations in the cell reaction mixture. The results are presented as average ± SD (n=3). -, not tested; n.d., not detected. Statistical analysis was conducted by employing ANOVA and Tukey’s multiple comparison test, and the groups with p<0.05 were denoted with different letters for each group of background genotypes, and formaldehyde production and degradation...... 45

Figure 11. Hgd activity in the cell-free extracts of the wild type, Δfae1Δfae2, ΔxoxF1SupΔfae1Δfae2, ΔmxaFΔfae1Δfae2, and Δhgd, grown on methanol plus succinate in the (A) presence and (B) absence of La3+. Filled bar, +La; open bar, -La; n.d., not detected. The results are presented as average ± SD (n=3, biological replicates). Statistical analysis was conducted by employing ANOVA and Tukey’s multiple comparison test independently for each dataset (presence/absence of La3+), and p values for the comparisons with the wild type data are shown...... 46

Figure 12. Measurement of intracellular ATP levels in the mutants generated from (A) wild type, (B) ΔxoxF1Sup, and (C) ΔmxaF. The mutants were grown on succinate and methanol in the presence (filled bars) and absence (open 3+ bars) of La . The concentration levels are normalized to OD600. The results are presented as average ± SD (technical triplicates). Compact letter displays are a-f for +La; s-v for -La...... 47

Figure 13. Purification of (A) XoxF1-His and (B) MxaF-His expressed in strain 22A. SDS-PAGE of crude cell extract, flow-through fraction through Ni-NTA column, and purified MDH in eluate fractions. Arrows indicate the purified protein bands. MxaF-His was additionally stained using Silver Stain Plus (Bio-Rad)...... 48

Figure 14. Gel filtration of MxaF-His (dashed) and XoxF-His (solid) over 20 minutes...... 48

Figure 15. The activity of XoxF1-His against methanol and formaldehyde of varying concentrations. The data was used to calculate kinetic parameters. The results are presented as average ± SD (technical triplicates)...... 49

List of Tables

Table 1. Primer sets for generation of formaldehyde oxidation gene mutants used in this study...... 50

Table 2. Formaldehyde-oxidation deficient mutants list ...... 51

Table 3. Mineral medium (MM) used in this study...... 52

Table 4. Primer sets used to generate His-tag protein...... 53

Table 5. Specific growth rates (SGRs) and cell yield of various formaldehyde oxidation mutants grown on methanol in the presence and absence of La3+. The growth rates are calculated for the growth during 0 - 44 h. The results are presented as average ± SD (technical triplicates). NG, no growth. Groups indicate compact letter display for one-way ANOVA and Tukey’s multiple comparison test (p < 0.05), only for specific growth rates...... 54

Table 6. Specific growth rates (SGRs) and cell yield of various formaldehyde oxidation mutants grown on methanol plus succinate in the presence and absence of La3+. The growth rates are calculated for the growth during 0 - 24 hours. The results are presented as average ± SD (technical triplicates). NG, no growth. Groups indicate compact letter display for one-way ANOVA and Tukey’s multiple comparison test (p < 0.05), only for specific growth rates...... 56

Table 7. Growth phenotypes of formaldehyde pathway-mutants in the wild type, ΔxoxF1Sup, and ΔmxaF backgrounds on solid MM. Phenotypes are indicated by their growth on solid medium relative to their respective genetic backgrounds. “++” indicates growth comparable to the backgrounds; “+” indicates visibly less growth than the backgrounds; “tr” indicates trace growth; “-” indicates no observable growth; “n.d” means “not determined”. Upper row, methanol; Lower row, methanol plus succinate...... 58

Table 8. LC-MS analysis of purified His-tagged MxaF and XoxF ...... 59

Table 9. Comparison of XoxF and ExaF enzyme kinetics (Km and Vmax) from various methylotrophic and methanotrophic strains on methanol and formaldehyde. Vmax unit “U” are referenced as defined by each source...... 60

Abstract

Methanol is the most abundant single-carbon compound that is produced by plants, primarily through pectin metabolism during leaf expansion, and emitted through the stomata. It is metabolized by methylotrophic bacteria residing in the phyllosphere (plant surface), as a carbon and energy source. Methylobacterium species are one of the most predominant methylotrophic bacteria in the phyllosphere. It is known that the species can be found in any kind of terrestrial plants, and they have plant-growth promoting abilities via auxin and cytokinin synthesis. Therefore, it is important to elucidate their physiology in harsh environments like the phyllosphere, where environments change rapidly and drastically in terms of nutrition, humidity, temperature, sunlight, and wind. On the other hand, methylotrophs are important biocatalysts to convert cheap feedstock, methanol, into valuable compounds, like carotenoids, amino acids, vitamins, and cofactors. Associated bacterial methylotrophic pathways have been studied for a half century.

Most of the genes and proteins involved in the methylotrophic pathway have been investigated using Methylorubrum (formerly Methylobacterium) extorquens strain AM1 as a model organism of Gram-negative methylotrophs in detail. Generally, Methylobacterium species utilize methanol in a methylotrophic process initiated by methanol dehydrogenases (MDHs). MDHs are encoded by mxaF and xoxF, which are calcium (Ca2+)- and lanthanide (Ln3+)-dependent, respectively. Lanthanides (Ln), commonly known as being included in the rare-earth elements (REEs), serve as an essential cofactor for XoxF-type MDH. The recent unexpected finding on the Ln3+-dependency of XoxF has increased our knowledge and also raised new questions on bacterial methylotrophy.

Methylobacterium aquaticum strain 22A was isolated from a moss and shown to be a potent plant-growth promoter. The strain 22A genome encodes common genes involved in methylotrophy, however, the presence of different types of MDH-like genes and formaldehyde oxidation genes is unique to the strain. Mr. extorquens and Me. aquaticum, belonging to different genera, are phylogenetically and physiologically different. In this study, therefore, I focused on the functions of the genes and pathways specifically found in strain 22A, and tried to reveal their functionality, and explore the evolutionary advantages over strain AM1 achieved by the availability of multiple redundant formaldehyde oxidation pathways.

Strain 22A contains six MDH-like genes encoded in the genome: mxaF and xoxF1 as major MDHs for methylotrophy, ExaF-type Ln3+-dependent alcohol dehydrogenase (ADH) and other genes that may be involved in the utilization of longer secondary alcohols. XoxF was reported to oxidize formaldehyde as well as methanol, while MxaF oxidizes only methanol. ExaF was also shown, in related work, to support Ln-dependent methanol growth and capable of oxidizing formaldehyde. Strain 22A possesses two known formaldehyde oxidation pathways, tetrahydromethanopterin (H4MPT)-dependent pathway, and the glutathione- dependent pathway (GSH pathway). Strain AM1 does not have the latter. In strain 22A, it was found that formaldehyde oxidation pathways were downregulated in the presence of Ln3+ but the net formaldehyde degradation activity in the cells is still high, suggesting the involvement ii of xoxF in formaldehyde oxidation. Interestingly, this is not observed in strain AM1. The detailed objectives of this study are to determine the roles of multiple formaldehyde oxidation pathways, functions of the GSH pathway, and roles of XoxF or ExaF in formaldehyde oxidation in strain 22A. To this end, a series of formaldehyde oxidation pathway mutants (fae1, fae2, and mch in the H4MPT pathway and hgd in the GSH pathway) was generated in the wild type (WT), ΔmxaF, and ΔxoxF1Sup genetic backgrounds. ΔxoxF1Sup is a suppression mutant of ΔxoxF1 that recovered its growth on methanol due to the mutation of mxbD (sensor kinase), whereas ΔxoxF1 cannot grow in the absence of La3+, as the expression of mxaF depends on 3+ xoxF1. The mutants were grown in the absence and presence of La on mineral medium (MM) with supplemented methanol to determine the metabolic capacity for methanol, and methanol plus succinate to determine toxicity of accumulated formaldehyde.

After all examinations on the complex growth data, I concluded that: (1) Based on the growth differences in H4MPT pathway deficient mutants (Δfae1Δfae2Δmch), it was shown that the ΔmxaF background mutant could grow on methanol slowly but wild type and ΔxoxF1Sup could not. This means that MxaF produces formaldehyde to a toxic level in the absence of the formaldehyde oxidation pathways. (2) Formaldehyde oxidation deficient mutants with only either xoxF1 and exaF could grow on methanol plus succinate, which means that the enzymes can oxidize formaldehyde to alleviate formaldehyde toxicity in vivo. (3) The high Hgd activity in ΔxoxF1SupΔfae1Δfae2, deficient in both XoxF and formaldehyde oxidation, showed that the GSH pathway is functional in strain 22A and has a contribution to the net formaldehyde oxidation. (4) Since H4MPT pathway mutants have significant growth deficiencies compared to the GSH pathway mutant, H4MPT pathway has the primary role in formaldehyde oxidation, but in ΔxoxF1Sup, the pathway is indispensable and GSH pathway can replace it in a rather inefficient way. (5) The lack of growth in mch mutants and the high formaldehyde accumulation, as well as low formaldehyde degradation compared to the wild type, suggested that Mch is involved in the regulation of MDH, especially MxaF. (6) Since fae2 mutant showed slower growth on methanol compared to the wild type, Fae2 is partly involved in methylotrophy and is not essential for growth.

This study revealed most of the coordinated roles of multiple and complex pathways for methanol and formaldehyde oxidation. Such different but redundant pathways may enable the cells to change metabolic flux in the pathways, in response to the metal and growth substrate availability.

iii

Abbreviations

ADH alcohol dehydrogenase

DCPIP dichlorophenol indophenol

Fae formaldehyde activating enzyme

Fdh formate dehydrogenases

Fgh S-formylglutathione hydrolase

Fhc formyltransferase/hydrolase

Gfa glutathione-dependent formaldehyde activating enzyme

GSH glutathione

H4F tetrahydrofolate

Hgd S-hydroxymethyl glutathione dehydrogenase

H4MPT tetrahydromethanopterin

ICP-MS inductively-coupled plasma mass spectrometry

Km kanamycin

KPB potassium phosphate buffer

LB Luria-Bertani lut lanthanide utilization and transport gene

Mch methenyl-H4MPT cyclohydrolase

MeOH-La MM with 0.5% (v/v) methanol

MeOH+La MM with 0.5% (v/v) methanol and 30 μM La3+ iv

MDH methanol dehydrogenase

MM mineral medium

MtdA, MtdB methylene-H4MPT dehydrogenases

PMS phenazine methosulfate

PQQ pyrroloquinoline quinone

PtG power-to-gas

PtL power-to-liquid

REE rare earth element

SGR specific growth rate

TCA tricarboxylic acid cycle

TCRS two-component regulation system

WT wild type 1

Introduction

1.1. Methanol and methylotrophs Methanol is the most abundant single-carbon (C1) compound produced by plants as a by-product of pectin metabolism in the plant cell wall, primarily during leaf expansion, and is emitted through the stomata (Fall and Benson, 1996; Martinez-Gomez et al., 2015). Methanol is accumulated at night in leaves and released in a transient burst as the stomata open in the morning of the diurnal cycle (Nemecek-Marshall et al., 1995; Hüve et al., 2007; Dorokhov et al., 2015; Martinez-Gomez et al., 2015). Annual emission of methanol from plants is estimated to be 100 Tg (Galbally and Kirstine, 2002), which is greater than the manufactured amount of 32 Tg in 2004 (Olah et al., 2009). In comparison, the emission of methane is estimated to be 580 Tg per year (IPCC, 2007). Including other gaseous C1 compounds, these make up one of the major carbon cycle components on our planet.

In addition to natural emission, methanol can be produced by oxidizing methane or reducing CO2. The utilization of methanol has a long history: beginning as a by-product from charcoal manufacturing (giving it an alternate name wood alcohol). Its role in the chemical industry has expanded over the last century and created the “methanol economy” as a field of its own (Olah et al., 2009). Apart from the commonly known uses as fuel and in the chemical industry, methanol can also be used as an energy storage medium by reducing CO2, in a process commonly known as power-to-liquid (PtL). Methanol is more energy-efficient compared to methane stored in a power-to-gas (PtG) process (Räuchle et al., 2016).

Methanol is consumed and metabolized by microorganisms known as methylotrophs. Methylotrophs are microorganisms that can utilize single-carbon (C1) compounds, or multiple- carbon compounds without a carbon-carbon bond (such as dimethyl ether), as a carbon and energy source (Anthony, 1982; Schmidt et al., 2010). Growth of methylotrophs is generated by oxidizing C1 compounds with specific dehydrogenases, as opposed to relying on TCA cycle (Anthony, 1982; Anthony, 2011). C1 compounds include methane, methanol, halogenated methane, methylamine, methanethiol, dimethyl sulfide, formaldehyde, and formate. Methylotrophs are divided into obligate methylotrophs that grow only on C1 compounds, and facultative methylotrophs that can use larger compounds with carbon-carbon bonds, such as succinate and pyruvate (Anthony, 1982). Methylotrophy can be found in some Gram-positive and Gram-negative bacteria. Some yeasts are also methylotrophs but have different methanol oxidation mechanisms compared to bacteria (Popov and Lamzin, 1994).

Methylotrophic bacteria inhabit and play an important role as methanol consumers in the phyllosphere, the aerial parts of plants, especially on leaf surfaces. With a combined 1,017,260,200 km2 of upper and lower leaf surface, an area twice as large as Earth’s land surface, the leaf is a major part of the phyllosphere. With an estimated population density of 106–107 bacteria per cm2, there could be up to 1026 bacterial cells on leaf surfaces (Vorholt, 2012; Iguchi et al., 2015). The vast surface of the phyllosphere directly influences the amount of methanol released, which further magnifies the importance of these bacteria. Additionally, 2 the phyllosphere is an environment with various biotic and abiotic stresses, including changing light levels, rapidly fluctuating temperature, limited nutrients, and presence of antimicrobial compounds produced by plants and competing microbes. This contrasts with the more stable rhizosphere with more abundant nutrients. Bacteria on leaf surface, therefore, must adapt to these stresses and evolve their metabolism to be successful in this challenging environment (Lindow and Brandl, 2003; Vorholt, 2012). Many culture-dependent and -independent studies revealed that alphaproteobacteria in the genus Methylobacterium are predominant in the phyllosphere. The ability to utilize methanol gives them an advantage in phyllosphere colonization (Sy et al., 2005; Delmotte et al., 2009; Vorholt, 2012).

With the ability to utilize single-carbon compounds, methylotrophic bacteria are used for various purposes in agricultural, environmental, and value-added chemical production fields. These uses include promotion of plant growth (Fall and Benson, 1996; Vorholt, 2012; D’Aquino and Tommasi., 2016; Jorge et al., 2019), nutrient uptake (Nemecek-Marshall, 1995; Sy et al., 2005; Tani et al., 2012), and use as biofertilizers (Tani et al., 2012). For environmental concerns, an example is in wastewater treatment (Weissermel and Arpe, 2008; Tsagkari and Sloan, 2019). It is possible to use methylotrophs to upcycle methanol into more useful compounds which would otherwise be waste or contaminants. Various methylotrophs have been engineered to produce valuable chemical compounds such as L-glutamate, gamma- aminobutyric acid, L-lysine, along with various proteins involved in the metabolic process (Sonntag et al., 2015; Pfeifenschneider et al., 2017; Chistoserdova, 2018).

1.2. Methylotrophy in Methylobacterium species As a long-standing model organism for methylotrophy, Methylobacterium extorquens strain AM1 (hereafter referred to as strain AM1) is a Gram-negative methylotroph commonly used for biochemical and physiological studies of methanol metabolism (Chistoserdova et al., 2003; Anthony, 2011). A schematic of methylotrophy in strain AM1 is shown in Fig. 1.

Methanol is first oxidized into formaldehyde in the periplasm using pyrroloquinoline quinone (PQQ)-dependent methanol dehydrogenases (MDHs) (Anthony, 1982; Anthony and Williams, 2003). MDH consisting of MxaF and MxaI subunits (MxaFI) is a heterotetrameric 2+ (α2β2), calcium (Ca )-dependent MDH (Ghosh et al., 1995), which is indispensable for growth on methanol under laboratory conditions. The strain AM1 genome encodes other MDH-like genes named xoxF1 and xoxF2 (Schmidt et al., 2010; Vu et al., 2016). It was discovered that XoxF-type MDH is highly induced and activated in the presence of lanthanides (Hibi et al., 2011). Ln-dependent MDHs have been suggested to precede and be more prevalent than the Ca-dependent homologs (Keltjens et al., 2014; Wehrmann et al., 2017). This means the Ca- dependent MDHs were evolved to adapt to low-lanthanide environments. In particular, the phyllosphere has a lower La availability compared to the rhizosphere. Therefore, it is possible that Ca-dependent MDHs (like MxaF) are evolved for life above the soil (Wehrmann et al., 2017). This finding extends knowledge and answers questions in methylotrophy; which is discussed in detail below. 3

Formaldehyde is transported into the cytoplasm and oxidized to formate (Marx et al., 2003). In strain AM1, this is done using the tetrahydromethanopterin (H4MPT) pathway (Chistoserdova et al., 1998). After formaldehyde is transported into the cytoplasm, the compound is condensed with H4MPT into methylene-H4MPT. This may occur spontaneously or catalyzed by formadehyde activating enzyme (Fae) (Vorholt et al., 2000). Methylene- H4MPT is then oxidized into methenyl-H4MPT using one of its dehydrogenases: MtdA which is strictly NADP dependent (Vorholt et al., 1998), or MtdB which can use either NAD+ or + NADP (Hagemeier et al., 2000). In addition to the roles in the H4MPT pathway, MtdA is also known to reduce methenyl-H4MPT to methylene-H4MPT, leading to the serine cycle which generates biomass (Marx and Lidstrom, 2004). MtdB has another role as energy generation in the form of NADH (Chistoserdova et al., 1998; Goenrich et al., 2002b; Hagemeier et al., 2000;

Marx et al., 2003; Marx and Lidstrom, 2004; Vorholt, 2002). Methenyl-H4MPT is converted to formyl-H4MPT by methynyl-H4MPT cyclohydrolase (Mch) (Pomper et al., 1999). Finally, formate is released from formyl-H4MPT through the action of the formyltransferase/hydrolase complex (Fhc) (Pomper and Vorholt, 2001; Pomper et al., 2002).

Formate can be oxidized into CO2 by formate dehydrogenase (FDH) (Popov and Lamzin, 1994; Chistoserdova, 2011). There are at least four fdh genes involved in the growth on formate in Strain 22A, all of which contributing to formate oxidation, but fdh4a and fdh4b require each other to function (Chistoserdova et al., 2004; Chistoserdova et al., 2007), or converted into methylene-tetrahydrofolate via the tetrahydrofolate (H4F) pathway for its assimilation into the serine cycle and eventual use in the synthesis of cell constituents (Crowther et al., 2008; Peyraud et al., 2011). Strain AM1 adjusts the metabolic flux of these dissimilations and assimilations depending on the metabolic demands (Marx et al., 2005; Šmejkalová et al., 2010). H4MPT pathway is known to be the primary formaldehyde oxidation pathway in some strains, such as strain AM1 (Vorholt et al., 2000), which has only this pathway for formaldehyde oxidation.

1.3. Role of lanthanides in methylotrophy The 15 lanthanide (Ln) elements from lanthanum (La) to lutetium (Lu), along with the two chemically similar elements scandium (Sc) and yttrium (Y) are called ‘rare-earth elements’ or REEs, and are also called ‘rare earth metals’ by the IUPAC (Connelly et al., 2005). Although they are called “rare earth”, these elements are relatively common in the Earth’s crust, with a combined rare earth abundance (220 ppm) greater than carbon (200 ppm). However, these elements are highly insoluble, and their historical difficulty to separate and obtain gave them the collective name “rare earth elements” (Gupta and Krishnamurthy, 2004; Hu et al., 2006). REEs are naturally present both in the soil and aquatic environments in varying concentrations (D’Aquino and Tommasi, 2016). Additionally, REEs were also detected in the phyllosphere at a lower level. For example, elemental analysis of Arabidopsis thaliana revealed REEs at concentrations up to 10 µg/g dry weight. Among these, Ce was the most abundant (10±2 µg/g dry weight) followed by La (7±1 µg/g) (Ochsner et al., 2019). These levels are lower than the rhizosphere, where some Ln are found at levels similar to base metals like copper and zinc (Ce, 4

66 ppm; La, 39 ppm; Cu, 60 ppm; Zn, 70 ppm) (Gupta and Krishnamurthy, 2004; Tyler, 2004; Vu et al., 2016).

Lanthanides are commonly distinguished by mass (Gupta and Krishnamurthy, 2004) and may exhibit different properties. They are used for various industrial processes (Binnemans et al., 2013), with an exponential increase in use in recent years (D’Aquino and Tommasi, 2016). Lanthanides are also known as the vitamins of modern industry because they are indispensable for manufacturing high-tech products including UV-absorbing glasses, strong magnets, lasers, and fluorescent agents (Martinez-Gomez et al., 2016). Lanthanide is also in agriculture to increase crop yield (Hu et al., 2006). In addition, amidst the expansion of REE economy, many considerations are made regarding economic cost/benefit and environmental impact. Recycling is considered as a secondary supply of REEs. Recycling is driven by many reasons including reduced risks from market fluctuation and the ability to specifically recycle high-value elements from discarded electronics instead of mining every element together (Golev et al., 2014). This makes recycling an attractive option for a sustainable development of rare earth economy.

In addition to the industrial methods, methylotrophs are also being considered as a platform for recovering of these elements as they are known to sense these elements. Additionally, these microorganisms can also be used for chemical productions. They can also recycle methane and use common feedstock like methanol (Hu et al., 2006; Roszczenko- Jasińska et al., 2019). This makes them attractive as a key component in the future economy, of which both Ln and methanol have gradually increasing roles. However, despite a trend of industrial application and previous research on Ln, as well as a previous discovery of XoxF, there had been no reports on their importance for biological systems, until the more recent finding on the Ln3+-dependency of XoxF.

The purified MDH from Methylobacterium radiotolerans grown in the presence of La3+ was first shown to be XoxF, whereas the one grown in the absence of La3+ was MxaFI (Hibi et al., 2011). XoxF1 purified from strain AM1 was also shown to contain La3+, and a mutant deficient for mxaF, which was believed to be indispensable for methanol growth, did grow in 3+ the presence of La (Nakagawa et al., 2012). Therefore, XoxF is functional for methylotrophy and can substitute for MxaF, only in the presence of Ln3+. A crystalized XoxF purified from a methanotroph, Methylacidiphilum fumariolicum SolV, which can grow only in the presence of an acidic mudpot water of the isolation source, was shown to contain Ln3+ in the catalytic site, proving that the enzyme is metalated with Ln3+ (Pol et al., 2014). XoxF transcription is activated by light Ln3+ (La3+, Ce3+, Pr3+, and Nd3+) preferentially, and the protein is activated by these metals (Vu el al., 2016; Masuda et al., 2018; Featherston et al., 2019; Ochsner et al., 2019; Picone and Op den Camp, 2019). These four metals are more abundant in the natural environments. XoxFs from different microorganisms show similar preference for Ln3+, especially light Ln3+, which causes a comparatively higher MDH activity (Lumpe et al., 2018). Furthermore, MDH in the presence of gadolinium (Gd) and all heavier lanthanides produce a consistently lower specific activity compared to La, a phenomenon called the “gadolinium break” (Lumpe et al., 2018). 5

XoxF1 expression is induced in the presence of Ln3+ whereas MxaFI is expressed when Ln3+ is absent (Skovran et al., 2011; Farhan Ul Haque et al., 2015; Chu and Lidstrom, 2016; Vu et al., 2016). Under low La3+ conditions (between 0.25 and 1 µM), both mxaF and xoxF are simultaneously expressed in M. extorquens PA1, a strain closely related to AM1, before mxaF is fully repressed at higher La3+ concentrations (Ochsner et al., 2019). This phenomenon is called the “lanthanide switch”. In strain AM1, the lanthanide switch is controlled by a two- component regulation system (TCRS) consisting of MxbD (sensor) and MxbM (regulator), which is responsible for the expression of mxaF and the repression of xoxF in the absence of Ln3+ (Skovran et al., 2011; Chu and Lidstrom, 2016; Vu et al., 2016; Zheng et al., 2018). The ligand of MxbD is currently unknown but is suggested to be XoxF (Vu et al., 2016; Ochsner et al., 2019), because mxaF expression is dependent on the presence of xoxF, in addition to mxbDM and mxcQE (encoding another set of TCRS) (Skovran et al., 2011). However, suppressor mutations in the mxbD sensor kinase can arise which bypass the need for XoxF, presumably by constitutively activating the MxbM response regulator (Skovran et al., 2011; Ochsner et al., 2019; Skovran et al., 2019)

Further current studies revealed that a set of genes encoding the TonB-dependent receptor and the ABC transporter, which are now named as the lanthanide utilization and transport (lut) genes, is reported to be essential for Ln3+-dependent methylotrophy in strain AM1 and also in M. extorquens strain PA1 (Roszczenko-Jasińska et al., 2019; Ochsner et al., 2019). These findings suggest that Ln3+ is incorporated into the cytosol; the observation of the phosphate-salt of Ln3+ in the cytosol supports this possibility (Roszczenko-Jasińska et al., 2019).

Besides XoxF, another Ln3+-dependent MDH homolog called ExaF, a PQQ-dependent ethanol dehydrogenase, participates in methylotrophy in strain AM1. The purified ExaF oxidizes ethanol and acetaldehyde as well as methanol and formaldehyde (Good et al., 2016). A mutant that lacked mxaF and xoxF1 still exhibited very slow growth on methanol in the presence of Ln3+, suggesting the small contribution of ExaF in methylotrophy (Good et al., 2016; Vu et al., 2016). In addition, deletion of exaF alone did not affect growth on methanol, showing that ExaF is not a primary methanol oxidation system (Good et al., 2019).

The XoxF proteins encoded in many bacterial genomes can be categorized into five major groups (groups XoxF1-XoxF5, Keltjens et al., 2014). XoxF-type MDHs have been characterized from various species including Methylacidiphilum infernorum, Paracoccus denitrificans, Methylotenera mobilis (Chistoserdova, 2011), Methylacidiphilum fumariolicum SolV (Pol et al., 2014), and Methylomirabilis oxyfera (Wu et al., 2015). The wide distribution of xoxF in many bacterial genomes led to the discovery of new Ln3+-dependent methylotrophs of novel genera, such as Oharaeibacter diazotrophicus and Novimethylophilus kurashikiensis (Lv et al., 2017; Lv et al., 2018; Lv and Tani, 2018). Certain known microorganisms have also been revealed to be methylotrophs. Bradyrhizobium species generally contain XoxF-type MDHs (but not the MxaFI-type MDH) and exhibit methanol growth only in the presence of Ln3+ (Fitriyanto et al., 2011; L. Wang et al., 2019). These diverse groups of XoxF enzymes may prefer different lanthanides and substrates (Skovran and Martinez-Gomez, 2015). 6

1.4. Methylobacterium aquaticum strain 22A M. aquaticum strain 22A (hereafter referred to as strain 22A) was isolated from the moss Racomitrium japonicum (Tani et al., 2011), with which it engages in symbiosis (Tani et al., 2012). It can promote plant growth in some mosses and seed plants (Tani et al., 2012). This ability is also seen in some M. extorquens strains (Abanda-Nkpwatt et al., 2006; Ryu et al., 2006; Subhaswaraj et al., 2017). Its complete genome data consist of one chromosome and five plasmids (Tani et al., 2015). The genome encodes almost the same gene set for methylotrophy found in strain AM1. However, due to the recent reclassification of the Methylobacterium species, M. extorquens has been reclassified as Methylorubrum extorquens (Green and Ardley, 2018). This means that strain AM1 and strain 22A differ at the genus level, prompting us to study the methylotrophy in strain 22A in greater depth as another model for methylotrophy. The transcriptome (RNA-seq) analysis of strain 22A grown on methanol showed distinct gene regulations affected by Ln3+ (Masuda et al., 2018). There are some critical differences between them in the methylotrophic pathways, which led to major questions regarding the general nature of methylotrophy, forming the basis for this study.

While strain AM1 has two functional XoxF genes (XoxF1 and XoxF2) (Vu et al., 2016), the second XoxF gene in strain 22A seems to be a pseudogene with low transcription (Masuda et al., 2018). Among the six MDH-like genes encoded in the genome, the expression of the mxa cluster was downregulated and that of the xox cluster was upregulated in the presence of La3+; a gene putatively encoding ExaF-type MDH was also upregulated. Although ExaF can oxidize methanol, its contribution to the methylotrophic system is still only partly understood.

In addition to the H4MPT pathway, strain 22A contains genes for the glutathione (GSH)-dependent pathway, which is absent in strain AM1 (Fig. 2). In the GSH pathway, formaldehyde is conjugated with glutathione to generate S-hydroxymethyl glutathione by glutathione-dependent formaldehyde activating enzyme (Gfa). It is then converted into S- formylglutathione by S-hydroxymethyl glutathione dehydrogenase (Hgd) with NAD+ as the electron acceptor, thereby generating NADH. Finally, S-formylglutathione hydrolase (Fgh) converts S-formylglutathione into formate (Yurimoto et al 2005; Keltjens et al., 2014; Masuda et al., 2018). However, the actual functionality of the GSH pathway in strain 22A has never been verified.

The genes for formaldehyde oxidation (the H4MPT pathway and the GSH pathway) were downregulated in the presence of La3+ (Masuda et al., 2018). Nevertheless, strain 22A cells grown in the presence of La3+ showed lower production of formaldehyde through methanol oxidation compared to those grown in the absence of La3+, whereas the cellular formaldehyde degradation activity was not changed (Masuda et al., 2018). Does xoxF1 also participate in formaldehyde oxidation, in addition to two formaldehyde oxidation pathways?

It has been suggested that a direct oxidation of methanol to formate by XoxF takes place in Methylacidiphilum fumariolicum strain SolV (Pol et al., 2014; Bogart et al., 2015), albeit in an XoxF-type-specific way (Keltjens et al., 2014). Another study has suggested that in strain 3+ AM1 the H4MPT pathway is not downregulated with La , and that in vivo formaldehyde 7 oxidation by XoxF does not occur. However, it was also shown that ExaF can alleviate formaldehyde toxicity in an fae mutant strain, indicating in vivo formaldehyde oxidation (Good et al., 2019). Many reports on the enzymatic characterization of XoxF proteins showed that XoxF is also active on formaldehyde in vitro (Good et al., 2018; Good et al., 2019). However, its contribution to the net formaldehyde oxidation in vivo remains unclear.

1.5. Formaldehyde oxidation in Ln-dependent methylotrophy in Methylobacterium aquaticum strain 22A The M. aquaticum strain 22A genome encodes 6 MDH-like proteins. Their phylogenetic tree is constructed and shown in Fig. 3. Based on the homology, it can be predicted that 1p33165 is mxaF, c05215 is xoxF1, c27990 is named as xoxF2 but its ORF is truncated, and 1p32165, c07235, and 1p30675 are designated as adh4, adh5 (exaF), and adh6, respectively. Gene deletion mutants for each of them had been previously constructed (Nakatsuji, master thesis 2015). In addition, the mutants with a single gene remaining (such as, mxaF is intact but the other five genes have been deleted) had also been constructed and referred to with “re-” (for example, re-mxaF). The growth experiments of these mutants confirmed that XoxF1 supports methanol growth in the presence of La3+ while MxaF supports growth better in the absence of La3+. re-xoxF2 showed no growth on methanol which means it is inactive. Also, while ExaF does contribute to methanol growth in the presence of La3+, the growth depending on ExaF is very weak compared to growth in ethanol (Yanpirat et al., 2020). Therefore, only MDHs of MxaF and XoxF1 should be considered as active MDHs that contribute to methanol growth in strain 22A.

As seen in strain AM1, strain 22A also shows lanthanide-switch, as evidenced by a transcriptome analysis (Masuda et al., 2018). ΔmxaF could not grow on methanol in the absence of La3+, whereas it could grow in the presence of La3+, due to the intact xoxF1. ΔxoxF1 does not grow on methanol irrespective of La3+, because the mxaF expression is dependent on the presence of xoxF1. The suppression mutants of xoxF1 (xoxF1Sup) and re-mxaF (re- mxaFSup) were isolated (Nakatsuji, master thesis 2015). The genome re-sequencing analysis revealed that the mutants contain mutations in mxbD, encoding a sensor kinase that had been known to be indispensable for methanol growth and mxaF expression (Springer et al., 1997; Vu et al., 2016). The deletion mutant of mxbD showed no growth in the absence of La3+ whereas it could grow in the presence of La3+ (Hiraga, master thesis 2018). Therefore, mxbD is indispensable for mxaF expression but not for xoxF expression. The mutated mxbD from ΔxoxF1Sup and re-mxaFSup were introduced into ΔmxbD, and the transformants restored the growth on methanol in the absence of La3+, suggesting that the mutations in the mxbD, but not the other mutations in the genome found by the re-sequencing, were the cause of the suppression phenotypes. The mutations in mxbD were located in the HAMP domain of the protein, suggesting that MxbD is activated without its unknown ligand in the suppression mutants.

Thus, MDH mutants for strain 22A, ΔmxaF, ΔxoxF1, ΔxoxF1Sup are available and are used in this study for the generation of formaldehyde oxidation pathway mutants. ΔxoxF1Sup 8 is particularly important as the mutant that constitutively expresses mxaF that is under regulation of mxbD in the wild type.

The formaldehyde oxidation pathways, i.e. the H4MPT pathway and the GSH pathway, consist of several steps utilizing H4MPT and glutathione as a formaldehyde carrier, respectively. The elimination of key enzymes from these pathways would alter the cell’s methylotrophic process and provide insights into methylotrophy as a system.

Based on the background described above, we tried to answer the following questions: 1) Which among the 6 MDH-like proteins encoded in the strain 22A genome participates in methylotrophy? Is it possible for other MDHs to participate in the methylotrophic process?; 2) Is the GSH pathway functional in strain 22A as an additional route for formaldehyde oxidation?; 3) Does XoxF or ExaF directly oxidize methanol into formate, and, if it does, are the formaldehyde oxidation pathways still necessary? The presence of multiple formaldehyde oxidation pathways and enzymes that oxidize formaldehyde makes 22A stand out as these features are absent in previously studied strains. Therefore, the primary objective of this work is to study the roles of multiple formaldehyde oxidation pathways and direct oxidation by the Ln-dependent alcohol dehydrogenases XoxF1 and ExaF.

To study the effects of eliminating formaldehyde oxidation pathways, Fae1 and Mch (H4MPT pathway) were chosen for gene deletion as they are known to be essential for AM1. Fae2 was also chosen as a homolog of Fae1. Hgd (GSH pathway) was chosen as its enzymatic activity can be easily measured by NADH generation. Fig. 4 illustrates the target eliminations in this work.

Materials and Methods

The general outline of this work begins with the generation of formaldehyde oxidation gene mutants. The mutants were then grown on either methanol to assess the ability to metabolize methanol for growth, or methanol plus succinate to determine formaldehyde toxicity that occurs when methanol oxidation occurs, but formaldehyde oxidation pathways do not function. As a further diagnosis, formaldehyde accumulation and degradation were also monitored in a resting cell reaction.

Additionally, to confirm the functions of the GSH pathway, Hgd activity was also measured in the cell free extract of the wild type and Δhgd. In addition, H4MPT pathway deficient mutants (Δfae1Δfae2) were also tested to examine whether the deficiency in H4MPT pathway may result in increased Hgd activity. Furthermore, a recombinant XoxF1-His was also purified and characterized to confirm that the enzyme is active on formaldehyde in addition to methanol in vitro. ATP concentration levels in the mutants were also measured in an ATP assay to determine the level of intracellular ATP, which can be used to correlate with the growth phenotypes of the mutants.

2.1. Strains and culture conditions M. aquaticum strain 22A (FERM-BP11078) (Tani et al., 2012) was used throughout this study. Strain 22A was grown on mineral medium (MM) (Table 3) supplemented with 0.5% (v/v) methanol and/or 0.5% (w/v) succinate. The cultures of mxaF mutant strains were supplemented with 30 µM La3+. This is the concentration level that allows mxaF mutants to achieve the maximum growth rate (Masuda et al., 2018). E. coli strains DH5α and S17-1 were grown in Luria-Bertani (LB) medium with addition of antibiotic (25 mg/l kanamycin (Km)) (henceforth LB+Km), when necessary. The transformants of strain 22A with pCM130KmC and its derivatives were grown in methanol-supplemented MM with (MeOH+La) or without La3+ (MeOH-La). Km was also added at 25 mg/l.

2.2. Construction of formaldehyde oxidation gene deletion mutants Mutants of strain 22A deficient in formaldehyde oxidation pathway genes including fae1 (Maq22A_c16490), fae2 (Maq22A_1p31155), mch (Maq22A_c16475) in the H4MPT pathway, and hgd (Maq22A_c21490) in the GSH pathway, were generated. Single and multiple mutants were generated in the wild type (WT), ΔmxaF, and ΔxoxF1Sup backgrounds.

Ca. 1-kilobase upstream and downstream regions of the target gene were amplified and cloned in tandem into EcoRI site of the allele replacement vector pK18mobSacB (Schäfer et al., 1994), using the primers listed in Table 1 with the In-Fusion Cloning kit (Takara Bio Co.) (Alamgir et al., 2015; Masuda et al., 2018). The plasmids were introduced into E. coli DH5α, and the plasmids extracted from the transformants were introduced into E. coli S17-1.

The plasmids were introduced into strain 22A via conjugation using E. coli S17-1 transformed with the vector. Single-crossover mutants (pop-in) were selected based on 10 kanamycin resistance on R2A medium (Difco) (or if appropriate, MM containing 0.5% (v/v) methanol to repress the growth of E. coli), and double-crossover mutants (pop-out) were selected by 10% sucrose resistance. The pop-in and pop-out colonies were picked and suspended in 50 μl BL buffer (40 mM Tris-HCl (pH 8), 10 ml/l Tween 20, 5 ml/l Nonidet P- 40, 1 mM EDTA), then heated at 95°C for 5 minutes before PCR diagnosis.

The PCR mixture consisted of 1 μl DNA template, 12.5 μl KOD FX Neo buffer (Toyobo Co., Ltd), 0.25 μl KOD FX Neo DNA polymerase (Toyobo Co., Ltd), 5 μl dNTP (Toyobo Co., Ltd), 1 μl (10 pmol) each of Up_F and Down_R primers, and 1 μl of the BL buffer-treated cell suspension as a template. The PCR diagnosis was performed under the following conditions: an initial step at 95°C for 5 min, followed by 30 cycles at 95°C for 30 s, then annealing at 60°C for 30 s, and extension at 68°C for 2 min. A final extension was 68°C for 5 min. The PCR products were then electrophoresed with 0.7% agarose gel. The band patterns of the wild type, gene deletion vectors, and the mutants were compared.

The deletion mutants were used for further experiments in Sections 2.3–2.6. The list of the generated mutants is shown in Table 2.

2.3. Growth experiment of the mutants For growth experiments, cell suspensions of strain 22A (wild type) and the generated mutants were adjusted to optical density at 600 nm (OD600) of 1.0. The cell suspension was added to 96-well plates, with 2% cell suspension in 200 μl liquid MM±La. The plates were rotary-shaken at 300 rpm at 28°C. Growth was monitored by measuring OD600 using a microplate reader (PowerScan HT, DS Pharma). The data were collected at least frequency of every 24 hours. Additionally, to determine the sensitivity of mutants towards methanol, the mutants were also tested in a culture medium with 0.5% (v/v) methanol plus 0.5% (w/v) succinate (MeOH+S), in the absence and presence of 30 μM La3+. There are four conditions in total: MeOH+La, MeOH-La, MeOH+S+La, and MeOH+S-La.

This experiment was also performed on MM agar (MM with 15 g/l agar), with the same contents as the liquid medium.

2.4. Formaldehyde accumulation and degradation assay in a resting cell reaction In addition to the growth phenotype of the mutants, formaldehyde accumulation and degradation were also tested to measure contributions of genes and pathways in methanol and formaldehyde oxidation. The accumulation of formaldehyde in the presence of methanol and the degradation of formaldehyde were monitored in a resting cell reaction using the generated mutants, following a lab protocol (Masuda et al., 2018). The cells were grown on solid MM containing 0.5% (w/v) succinate and 0.5% (v/v) methanol in the absence and presence of 30 3+ µM La at 28°C for 3 days. The cells were then collected and washed using 10 mM HEPES buffer (pH 7). The density of the cells was adjusted to OD600 of 0.1 (formaldehyde accumulation) and 0.5 (formaldehyde degradation). The cell suspensions (180 µl) were added 11 to 96-well plates. For formaldehyde accumulation, 20 µl of 20% methanol was added. The plates were incubated at 28°C for 0, 30, 60 min. Trichloroacetic acid (20 µl) was added to terminate the reaction. For formaldehyde degradation, 20 µl of 5 mM of formaldehyde (prepared by autoclaving paraformaldehyde solution at 121°C for 15 min) was added. The plates were incubated at 28°C for 0, 10, 30 min, followed by addition of 20 µl of trichloroacetic acid. The plates after the reaction were centrifuged at 2,000 x g for 5 min, and 100 µl of the supernatant was transferred onto new plates containing 100 µl of 15% (w/v) ammonium acetate, 0.3% (v/v) acetic acid, and 0.2% (v/v) acetylacetone (Nash, 1953). The plates were incubated at 30°C for 30 min and absorbance at 410 nm was measured using a microplate reader. The final accumulation and degradation values are reported based on the difference in formaldehyde concentration before and after the reaction.

2.5. S-hydroxymethyl glutathione dehydrogenase (Hgd) activity Hgd activity was determined to confirm the roles of the GSH pathway, in terms of contribution to growth on methanol and formaldehyde oxidation. WT, Δfae1Δfae2, ΔxoxF1SupΔfae1Δfae2, ΔmxaFΔfae1Δfae2, and Δhgd were used. They were cultured in 500 ml of MM containing MeOH+S±La for 3 days. The cells were collected by centrifugation, suspended in 50 mM potassium phosphate buffer (KPB, pH 7.0), and disrupted using a bead beater (Mini-BeadBeater model 3110BX, BioSpec Products, Inc. 4800 rpm for 30 s, 5 times). The supernatant was collected for enzyme assay.

The assay was modified based on the method by Uotila and Koivusalo (1981). The reaction mixture consisted of 100 µl of 120 mM sodium phosphate (pH 7), 50 µl of 100 mM formaldehyde, and 10 µl of 100 mM glutathione (Uotila and Koivusalo, 1981). The mixture was incubated at 25°C for 10 min. NAD (5 µl of 40 mM NAD, Nacalai Tesque) and an appropriate amount of enzyme was added to start the reaction (total volume 200 µl). The -1 -1 activity was measured at 340 nm (εNADH = 6220 M cm ). One unit of enzyme is defined as the amount that catalyzed the formation of 1 µmol of NADH per minute.

2.6. ATP assay An ATP assay was carried out to determine the amount of intracellular ATP. Formaldehyde oxidation deficient mutants were grown in liquid MeOH+S±La. The cells were collected after 2 days, the OD600 was measured, and the ATP content was immediately measured using equal volumes of cell suspension and BacTiter-GloTM reagent (Promega, Madison, WI) in black 96-well plates. The contents were rotary-shaken and incubated at room temperature for five minutes. The luminescence was measured using a microplate reader (fluorescence sensitivity 0.5 fmol/well, PowerScan HT, DS Pharma). The control wells containing medium without cells were used as negative controls. Luminescence levels were measured and compared against a standard curve to obtain the ATP concentration levels. The ATP standard solutions were prepared using adenosine 5-triphosphate disodium salt hydrate from yeast (Nacalai Tesque). The standard curve was prepared using 10-fold dilutions of ATP standard solutions (1 mM to 0.1 nM) in each experiment. 12

2.7. Expression vector construction pCM130KmC vector used in this experiment was generated from pCM130Km, which was generated in our laboratory from pCM130 vector (Addgene plasmid #45828, Marx and Lidstrom, 2001). The tetAR (tetracycline resistance genes) locus of the pCM130 vector was replaced with km (kanamycin resistance gene) to generate pCM130Km. The XylE and the TrrnB transcription terminators were then eliminated by PCR and self-cyclization using pCM130KmC-F and pCM130Km-R primers to generate pCM130KmC, which contains an EcoRI site for general cloning. The xoxF1 and mxaF regions of strain 22A containing its promoter (ca. 1.2-kb upstream region of xoxF1 containing a part of gloB ORF and mxaF) were PCR-amplified and cloned into the EcoRI site of the pCM130kmC. The 3’-primers contained His-Tag sequences. The resultant plasmids pCM130kmC-xoxF1-His and pCM130kmC-mxaF- His were transformed into ΔxoxF1 and ΔmxaF. The primers are listed in Table 4.

2.8. Purification of recombinant XoxF1 and MxaF ΔxoxF1 (pCM130kmC-xoxF1-His) was grown on methanol in 500 ml MM medium in the presence of 30 µM La3+. ΔmxaF (pCM130kmC-mxaF-His) was grown on the same medium 3+ without La . The cells in mid- to late-log phase (OD600 0.5 to 0.8) were collected by centrifugation, suspended in 50 mM potassium phosphate buffer (KPB, pH 7.0), and disrupted (4800 rpm for 30 s, 5 times) with a bead beater (Mini-BeadBeater model 3110BX, BioSpec Products, Inc.). The homogenate was centrifuged at 20,400 × g at 4°C for 10 min. The supernatant was used as a cell extract and loaded onto the Ni-NTA column (3.5 ml, COSMOGEL His-accept, Nacalai Tesque) pre-equilibrated with buffer A (100 mM Tris-HCl pH 9.0, 150 mM NaCl, and 5 mM imidazole). The column was washed with 20 mL buffer A, and the protein was eluted with elution buffer (buffer A containing 250 mM imidazole), 4 ml per fraction. The fractions were then desalted and concentrated with a 30 kDa-cutoff centrifugal filter tube (Amicon Ultra-15). The fractions were analyzed by SDS-PAGE and gel filtration.

For gel filtration, the fractions (20 μl) were loaded into TSKgel Super SW300 N0087 (4.6 mm × 30 cm) column (Tosoh Bioscience, Tokyo, Japan), and eluted with flow rate 0.35 ml/min at 35°C for 15 minutes using the high-performance liquid chromatography system (Shimadzu, Kyoto, Japan, DGU20A3, LC-20AB, CTO-20A, CBM-20A, SPD-M20A, SIL- 10A). The elution buffer consisted of 100 mM phosphate buffer (pH 7.0), 100 mM Na2SO4, and 0.05% NaN3. The detection wavelength was 280 nm.

The purified protein samples were subjected to LC-MS analysis to confirm the identification of the protein and possibly associated proteins. The proteins were precipitated with 10% trichloroacetic acid, and dissolved in 13-μl reducing solution (RS: 8M Urea, 0.5M Tris-HCl pH 8.5, 25 nM EDTA, 40 mg/ml dithiothreitol), followed by addition of 2-μl IAA solution (40 mg/ml iodoacetic acid (IAA) in RS). Trypsin at 1:50 enzyme:solvent ratio was added and incubated at 37°C overnight.

After trypsin digestion, the samples were sent to the Advanced Science Research Center, Okayama University, where they were analyzed with an HPLC-Chip/QTOF mass 13 spectrometer (Agilent Technologies). The resultant mgf files were analyzed using Mascot (Matrix Science, Boston, MA, USA) (Perkins et al., 1999) and amino acid sequence file of strain 22A genome data. The metal content of the purified XoxF1 was also measured using inductively coupled plasma mass spectrometry (ICP-MS). The purified enzyme (92 µl) was combined with 163 µl 60% HNO3 solution and 1745 µl sterile MQ water (total volume 2 ml).

2.9. MDH activity and enzyme kinetics The purified MDH fraction was used to determine the MDH activity. The MDH assay mixture, which consisted of 158 µl of 100 mM Tris-HCl pH 9.0, 2 µl of 1.5 M ammonium chloride, 10 µl of 6.6 mM phenazine methosulfate (PMS), 10 µl of 1 mM dichlorophenol indophenol (DCPIP), 2 µl of 3 mM LaCl3 and 10 µl of enzyme solution (0.1 mg/ml), was plated in 96-well plates and incubated at 30°C for 30 min (Masuda et al., 2018). Methanol (10 µl of 20 mM) was added to start the reaction. Formaldehyde was also used as a substrate with varying concentration levels. The decrease in absorbance at 600 nm was monitored using a PowerScan HT (DS Pharma) microplate reader. The activity was calculated with the molar extinction coefficient for DCPIP at 600 nm of 19,000 M-1·cm-1 and then multiplied by 1.62 to convert the readings to a 1-cm light path. One unit of activity was defined as the enzyme amount that catalyzed the reduction of 1 µmol DCPIP per minute. The protein concentration was measured according to the method by Bradford (1976) using bovine serum albumin as the standard. The enzyme kinetics of XoxF1 was studied with varied concentrations of methanol and formaldehyde. The resultant data were fitted to non-linear regression and kinetic parameters were calculated according to the Michaelis-Menten equation.

Results and Discussion

3.1. Phylogenetic analysis of GSH-dependent formaldehyde dehydrogenase in Methylobacterium species The GSH pathway is the common pathway in formaldehyde oxidation in many bacteria including methylotrophic and non-methylotrophic bacteria. Interestingly, some gram-negative bacteria do not possess this pathway (Yurimoto et al., 2005). As described in the introduction, strain 22A contains GSH pathway that is absent from strain AM1. The presence of GSH pathway genes was examined in the available genomes of Methylobacterium species using a BLASTP search with Hgd (Maq22A_c21490) and Fgh (Maq22A_c21495). Fig. 5 shows a phylogenetic tree based on the 16S rRNA gene of Methylobacterium species. The analysis revealed the presence of hgd and fgh genes in some Methylobacterium type strains, including M. aquaticum, M. tarhaniae, M. platani, and M. variabile.

Green and Ardley (2018) reported that, based on the 16S rRNA gene sequence analysis of Methylobacterium species, the phylogenetic tree can be divided into three clades: A, B, and C, with a subdivision of C1 and C2. M. aquaticum, along with the other species that contain hgd and fgh, are in Clade C1, while strain AM1 clusters with related Methylorubrum species in Clade B. Based on the survey of multiple methylotrophs and methanotrophs, only 2 strains out of 14 surveyed alphaproteobacteria (Methylocella silvestris and Methylobacterium radiotolerans) and 1 strain out of 8 betaproteobacteria (Burkholderia phymatum) possess both H4MPT and GSH pathways, which means co-presence of these pathways may be relatively rare (Keltjens et al., 2014).

Methylotrophic pathways can be divided into several steps and for each step different pathways exist in different methylotrophic bacteria. Such modular components make up the methylotrophic pathway (Chistoserdova, 2011). Even in the group of Methylobacterium, there is a variation in the formaldehyde oxidation pathway. The uniqueness of strain 22A is highlighted by the presence of GSH pathway with hgd and fgh.

3.2. Characterization of the mutants in formaldehyde oxidation pathways For this work, the following MDH mutants were chosen as genetic backgrounds to further study the formaldehyde oxidation pathways: ΔxoxF1Sup and ΔmxaF. ΔxoxF1Sup can grow moderately under MeOH-La conditions and slowly under MeOH+La conditions, and its growth is mainly dependent on mxaF, while its expression is de-repressed by the mutation in mxbD. This contrasts with ΔmxaF, which uses mainly XoxF1 to grow on methanol only in the presence of La3+. Single and multiple gene deletion mutants of the genes involved in formaldehyde oxidation were then generated. The genes were, fae1, fae2, and mch in the H4MPT pathway and hgd in the GSH pathway. They were grown in liquid and solid MM containing methanol or methanol plus succinate in the presence and absence of La3+. The growth phenotypes of the mutants grown in liquid MM are shown in Fig. 6 (MeOH±La) and 15

Fig.7 (MeOH+S±La). The specific growth rates (SGR) for the mutants grown in the presence (Table 5) and absence (Table 6) of La3+ were also calculated from the growth data. The growth phenotypes of the mutants grown on solid MM are shown in Fig. 8 (methanol) and Fig. 9 (methanol plus succinate) and summarized in Table 7.

3.2.1. Growth of formaldehyde oxidation mutants in liquid medium In the wild type background (Fig. 6A), only Δhgd and Δfae2 grew on methanol irrespective of La3+ with lower growth rates compared to the wild type, suggesting that Hgd and Fae2 participate in the methylotrophy in the wild type. Other mutants in the H4MPT pathway (fae1 and mch) did not grow at all, suggesting the primary importance of the H4MPT pathway for the wild type (Fig. 6A). In ΔxoxF1Sup background (Fig. 6B), interestingly, Δfae1, Δfae1Δfae2, and Δmch could grow at a significantly slower rate than ΔxoxF1Sup (p < 0.05), and to a lower maximum yield, only in the presence of La3+. Since, as explained in the introduction, methylotrophic growth depending on ExaF was almost negligible, their growths were due to the de-repressed MxaF and GSH pathway. In the ΔmxaF background (Fig. 6C), only Δfae2 and Δhgd showed comparable growth to the background in the presence of La3+. These growths were dependent mainly on XoxF1-mediated methanol oxidation and the H4MPT pathway. The FD-5 (ΔxoxF1Δfae1Δfae2ΔmchΔhgd) and FD-6 (ΔexaFΔfae1Δfae2ΔmchΔhgd) mutants have either exaF (FD-5) or xoxF (FD-6) ADHs, which could help determine the role of methanol and formaldehyde oxidation. The results showed that the mutants could not grow on methanol as a sole carbon source. Therefore, NADH generation in formaldehyde oxidation pathways is necessary for the growth, even if XoxF1 or ExaF oxidize methanol to formate.

Methanol plus succinate was used to discriminate the reason for the growth inability of the mutants on methanol, metabolic capacity, or formaldehyde toxicity (Fig. 7). In the wild type background (Fig. 7A), Δfae1, Δfae2, Δfae1Δfae2, Δmch, and Δhgd could grow irrespective of La3+, with growth rates comparable to the wild type. Δfae2 showed decreased growth yield compared to the wild type, again suggesting its participation in methylotrophy. FD-3 (Δfae1Δfae2Δhgd) could not grow, irrespective of La3+. This result suggested the involvement of the GSH pathway for formaldehyde detoxification. Interestingly, FD-4 (Δfae1Δfae2ΔmchΔhgd) could grow slowly, suggesting that additional mch deletion in FD-3 alleviates formaldehyde toxicity, and possibly that methanol oxidation (formaldehyde generation) occurred slowly in FD-4. In ΔxoxF1Sup background (Fig. 7B), only FD-3 could not grow whereas FD-4 could grow, again implying that no formaldehyde toxicity occurs in FD-4. In the ΔmxaF background in the presence of La3+ (Fig. 7C), ΔmchΔhgd and FD-4 showed low-yield growth, suggesting that complete defect of formaldehyde oxidation pathways caused formaldehyde toxicity. This toxicity is less severe than that that occurred in ΔmchΔhgd and FD-3 in the wild type background and ΔxoxF1Sup FD-3, which were unable to grow. This difference was due to the presence of mxaF, suggesting that MxaF produces formaldehyde to a toxic level, and XoxF1 also does so at a lower level. FD-5 (FD-4 plus ΔxoxF1), which has only exaF remaining, did not show toxicity, whereas FD-4 did, suggesting that XoxF1 is indeed causing formaldehyde toxicity in the absence of the formaldehyde oxidation pathways. FD-6 (FD-4 plus ΔexaF), with only xoxF remaining, showed a diauxic 16

(biphasic) growth. This phenomenon could happen when bacteria grow on mixture of two carbon sources (Peyraud et al., 2012; X. Wang et al., 2019) In methanol plus succinate condition, succinate was used first, before switching to methanol (Peyraud et al., 2012), suggesting that XoxF1 causes formaldehyde toxicity to some extent but later degrades formaldehyde. This growth phenotype suggested that XoxF could oxidized formaldehyde. FD- 5 grew normally, formaldehyde toxicity by ExaF did not occur. Based on the results above, XoxF1 produces formaldehyde in vivo but does not oxidize it efficiently.

3.2.2. Growth of the mutants on solid medium The growth phenotypes of the mutants on solid medium are shown in Fig. 8 (MeOH±La) and Fig. 9 (MeOH+S±La). The wild type and ΔxoxF1Sup could grow with or without added succinate, in the presence and absence of La3+. All ΔmxaF mutants could grow only under MeOH+La conditions, due to their dependency on XoxF1.

Δfae1 in the wild type background did not grow on methanol regardless of La3+, suggesting the importance of Fae1 in the H4MPT pathway. However, ΔxoxF1SupΔfae1 exhibited trace levels of growth in the presence of La3+ (Fig. 8A), like the results in the liquid culture that showed slow growth to a lower maximum yield. The deletion of fae2 did not result in a phenotypic change in any of the genetic backgrounds (Fig. 8A-B). These results suggest that fae1 is primarily important. Although these fae homologs share 31% identity and 50% similarity in amino acid sequences, and they likely have different roles. Additionally, Δfae1Δfae2 of WT and ΔxoxF1Sup backgrounds exhibited the same phenotypes as Δfae1. Interestingly, fae1 deletion mutant in ΔmxaF background exhibited growth in the presence of La3+ (Fig. 8C), suggesting that fae1 is not necessary when either of the MDHs is available. This contrasts the results of liquid culture, where mutants lacking fae1 could not grow.

Good et al. (2016) and Roszczenko-Jasińska et al. (2019) reported that lack of fae caused lethal formaldehyde accumulation in strain AM1. This is because H4MPT pathway is the only pathway for formaldehyde oxidation. However, in the case of strain 22A, the GSH pathway could support and detoxify formaldehyde.

Δmch did not grow on methanol, and its growth on methanol plus succinate was weaker than that of the wild type. However, ΔxoxF1SupΔmch exhibited trace levels of growth in the presence of La3+ and grew normally with the addition of succinate (Fig. 9B). The growth of ΔmxaFΔmch on methanol plus succinate was comparable to that of ΔmxaF, suggesting that the growth of ΔxoxF1SupΔmch on methanol is due to the accumulation of formaldehyde or intermediate in the H4MPT pathway. The weak growth of ΔmxaFΔmch suggested the importance of the H4MPT pathway but not its necessity in strain 22A when methanol oxidation is achieved by XoxF1.

The deletion of hgd did not affect the growth of mutants, suggesting that the GSH pathway is less important than the H4MPT pathway. This also occurred in the liquid medium. ΔhgdΔmch in all genetic backgrounds did not grow on methanol regardless of La3+. The same phenotypes were seen also in the case of FD-3 (Δfae1Δfae2Δhgd). Δfae1Δfae2 (in wild type 17 and ΔxoxF1Sup backgrounds) did grow on methanol with added succinate, but Δfae1Δfae2Δhgd (FD-3) did not, suggesting that hgd is functional for formaldehyde oxidation and alleviates formaldehyde toxification. The loss of both formaldehyde oxidation pathways resulted in methanol growth deficiency, suggesting that at least one of them is necessary to generate NADH. Interestingly, however, these mutants in the ΔmxaF background could grow in the presence of added succinate, suggesting that formaldehyde toxicity does not occur in the ΔmxaF background. In other words, MxaF causes formaldehyde toxicity, further suggesting that XoxF1 and ExaF alleviate formaldehyde toxification by oxidizing formaldehyde in vivo.

FD-4 (Δfae1Δfae2ΔhgdΔmch) showed no growth on either medium whereas ΔxoxF1Sup FD-4 could grow in the presence of added succinate. ΔmxaF FD-4 on methanol showed trace levels of growth similar to ΔmxaF FD-3, suggesting that the additional deletion did not further affect the growth of the mutant lacking mxaF.

The trace growth of ΔmxaF FD-4, ΔmxaF FD-5 (ΔxoxF1Δfae1Δfae2ΔhgdΔmch) and ΔmxaF FD-6 (ΔexaFΔfae1Δfae2ΔhgdΔmch) exhibited the same phenotype, showing trace levels of growth in the presence of La3+. Finally, FD-7 lacking all MDH (xoxF1, mxaF, and exaF) and formaldehyde oxidation genes exhibited no growth under +La conditions. Due to the absence of NADH generation in the formaldehyde oxidation pathways, however, these trace growths were dependent on alcohol (possibly ethanol but not methanol) in the laboratory air. To confirm this, ΔmxaF FD-5 and FD-6 were grown in liquid culture or on solid culture isolated in a plastic bag, which resulted in no growth (data not shown). Furthermore, they could grow on a solid culture containing ethanol. Based on these observations, it could be concluded that the observed trace growth was enabled by air ethanol by a means that does not require formaldehyde oxidation pathways.

Comparing the results from the liquid and solid media, the clear difference between them is the growth of ΔmxaFΔfae1. In the presence of La3+, the mutant grew on the solid medium but not in liquid medium. The contrasting results could be caused by different level of exposure to air oxygen or air ethanol. This results in the less-efficient GSH pathway being able to negate formaldehyde production, allowing the cell to grow with added succinate.

3.3. Formaldehyde accumulation and degradation analysis in a resting cell reaction The methanol and formaldehyde oxidation capacity of all mutants grown on methanol plus succinate in +La conditions were evaluated through resting cell reactions (Fig. 10). The wild type showed low levels of formaldehyde accumulation and high degradation capacity. Increased formaldehyde accumulation and reduced degradation were seen in Δfae1 in the wild type background, suggesting that the growth inability of Δfae1 (Table 7) is due to formaldehyde toxicity. Δfae2 showed a slight increase in formaldehyde accumulation, suggesting its involvement (but relative unimportance) in formaldehyde metabolism. The high formaldehyde degradation rate in Δfae2 was considered to represent the compensatory activities of the other enzymes. Δfae1Δfae2 also showed higher formaldehyde accumulation and comparable degradation to the wild type. This result means that the mutant still retains some formaldehyde 18 oxidation capacity even without either fae, but could not grow on methanol due to formaldehyde accumulation. The deletion of mch resulted in increased formaldehyde accumulation (1.7-fold compared to the wild type) and a low formaldehyde degradation rate. This mutant was considered to accumulate methenyl-H4MPT, which also possibly inhibits methenyl-H4F dehydrogenase in the H4F pathway. Therefore, mch deletion might cause the downregulation of other metabolic genes in the mutant. Δhgd showed low accumulation and high degradation, suggesting that GSH pathway is not so important in the wild type background, as also shown in the growth experiments. The ΔmchΔhgd mutant shows increased formaldehyde accumulation and could not degrade formaldehyde at all. FD-3 and FD-4 showed high formaldehyde accumulation and comparable degradation to the wild type. The high accumulation could be due to the loss of formaldehyde oxidation pathways, but the mutants still retain high formaldehyde degradation capacity, which may be due to XoxF1. To make this point clear, the same set of mutants were generated in ΔxoxF1Sup and ΔmxaF backgrounds.

In the ΔxoxF1Sup background, fae1 deletion caused increased formaldehyde accumulation and decreased degradation, again suggesting the importance of fae1. Δfae2 and Δhgd showed no distinctive phenotype regarding growth and activities. Δfae1Δfae2 and Δmch showed activity and growth similar to that of Δfae1. In contrary to ΔmchΔhgd, ΔxoxF1SupΔmchΔhgd could grow with the addition of succinate. FD-3 could not could not grow on either methanol or methanol plus succinate, although it showed formaldehyde accumulation and degradation levels similar to Δhgd. It is possible that the slightly higher accumulation and lower degradation of formaldehyde in FD-3 was the cause of the toxicity. Interestingly, the FD-4 mutant did not show any activity but grew on methanol plus succinate.

The difference between FD-3, which could not grow in either liquid (Fig. 7AB) or solid medium (Fig. 9AB), and FD-4, is the deletion of mch, suggesting that mch is the cause of this difference in growth. Since FD-3 did not grow with added succinate, it can be inferred that FD- 3 is methanol-sensitive, which means MDHs are still oxidizing methanol into formaldehyde, without adequate means to alleviate formaldehyde toxicity. However, further elimination of mch (resulting in FD-4) showed recovered growth on methanol plus succinate, which means that the mutant is growing mainly on succinate without being affected by formaldehyde accumulation and toxicity.

Formaldehyde accumulation and degradation in ΔxoxF1Sup FD-4 were not detected (Fig. 10). The mutant also has a faster growth rate (Table 6, SGR = 0.131 ± 0.005) on methanol plus succinate than WT FD-4, which has reduced specific growth rate (Table 6, SGR = 0.067 ± 0.027). This is likely because oxidation of methanol did not occur in this mutant.

ΔmxaF was considered to express mainly xoxF1 in this condition. Compared to the mutants in the wild type background, the ΔmxaF-background mutant showed lower formaldehyde accumulation and higher degradation, suggesting XoxF1-mediated formaldehyde oxidation. Among the series of the mutants, ΔmchΔhgd, FD-3, and FD-4 mutants showed higher formaldehyde accumulation than their respective genetic backgrounds did, but they did not show formaldehyde toxicity (Table 7). Interestingly, FD-3 in this genetic background was not methanol sensitive. FD-5 did not show formaldehyde accumulation due to 19 the deletion of xoxF1, but still exhibited formaldehyde degradation, possibly due to ExaF. FD- 6 also still exhibited degradation, almost certainly due to XoxF1. Finally, FD-7 showed low levels of degradation, even without the possibility of any functional formaldehyde oxidation pathways/genes. Heat-killed wild type cells did not show any degradation activity (data not shown). Therefore, the low activity level seen in FD-7 was assumed to represent background activity, possibly formaldehyde adhesion/reaction to the heat-labile cellular components, or unknown enzymatic activity.

These results show that survival of the cell depends on the balance between oxidation of methanol, which generates formaldehyde, and the consumption of formaldehyde through the metabolic pathways. In addition to maximizing degradation of formaldehyde, the cell also depends on a balanced regulation of formaldehyde generation by MDHs to avoid formaldehyde toxicity.

3.4. hgd encodes S-hydroxymethylglutathione dehydrogenase. The GSH pathway in strain 22A is catalyzed by Gfa (Maq22A_1p37180) as the first step (Goenrich et al., 2002a), which is expressed at a low level (Masuda et al., 2018), followed by Hgd and Fgh. As a pathway that oxidizes formaldehyde into formate producing NADH, it is metabolically redundant to the H4MPT pathway. To determine the importance and contribution of the GSH pathway to formaldehyde oxidation, the specific enzyme activity of Hgd in the cell-free extract of the cells grown on methanol plus succinate was measured as a supplementary carbon source in the absence and presence of La3+ (Fig. 11).

The wild type, and Δfae1Δfae2 in the wild type, ΔmxaF, and ΔxoxF1Sup background were used for the assay. The wild type showed ca. 0.1 U/mg Hgd activity in both conditions. Δhgd did not show any activity, suggesting that hgd indeed encodes S-hydroxymethylglutathione dehydrogenase. Δfae1Δfae2 showed increased Hgd activity in the absence of La3+. Interestingly, ΔxoxF1SupΔfae1Δfae2 showed four times higher activity than the wild type. However, ΔmxaFΔfae1Δfae2 showed almost no change in Hgd activity. These results suggest that Hgd activity is regulated depending on the formaldehyde level in the cell, which correlates with the increased formaldehyde accumulation in Δfae1Δfae2 mutants (Fig. 10).

As “the most common reaction” in many organisms (Yurimoto et al., 2005), the GSH pathway is used in methylotrophic bacteria such as Paracoccus denitrificans, Burkholderia fungorum and Rhodobacter sphaeroides (Goenrich et al., 2002a; Marx et al., 2004; Keltjens et al., 2014). Based on the activity of Hgd (Fig. 11), it can be confirmed that hgd indeed encodes S-hydroxymethylglutathione-dehydrogenase. Δhgd in the wild type background showed slower growth on methanol. In ΔxoxF1Sup background, Δfae1Δfae2 could grow on methanol slowly but FD-3 could not grow, suggesting that the GSH pathway plays a role in formaldehyde oxidation. The introduction of flhA (GSH-and NAD-dependent formaldehyde dehydrogenase) and fghA (S-formyl-GSH hydrolase) from P. denitrificans complemented methanol growth in the H4MPT pathway-deficient mutant of strain AM1 (Marx et al., 2003), suggesting that its role is metabolically exchangeable with that of the H4MPT pathway. Hgd is reported to have 1.1 U/mg activity (methanol conditions) in P. denitrificans (Goenrich et al., 2002a), whereas it 20 has ca. 0.1 U/mg activity in strain 22A. Taking these findings together, it can also be concluded that the GSH pathway plays only a supportive role in the net formaldehyde oxidation in strain 22A. The patchy distribution of the pathway in Methylobacterium and related species may suggest the diminished importance of the GSH pathway in H4MPT pathway-containing species. The methylotrophic yeast Candida boidinii contains a GSH pathway that participates in the formaldehyde detoxification (Yurimoto et al., 2005) 3.5. ATP assay The intracellular ATP levels of formaldehyde deficient mutants were determined using ATP assay (Fig. 12). Methanol growth is reducing power (NAD(P))-limited while succinate growth is energy (ATP)-limited (Guo and Lidstrom, 2006; Skovran et al., 2010). NADH is generated only by either formaldehyde oxidation pathways or oxidation of formate into carbon dioxide. Meanwhile, if MDHs oxidize formaldehyde, the reducing equivalent achieved by formaldehyde oxidation is used to reduce PQQ in MDH molecules, and transferred to cytochrome c, and further to respiratory chain to generate ATP, without generating NADH (Guo and Lidstrom, 2006). To assimilate formate into H4F pathway, one molecule of ATP and one molecule of NAD(P)H is required (Chistoserdova et al., 2009). Therefore, ATP amount in the cells grown on methanol plus succinate was measured to examine if the ATP level changes depending on the mutants.

The mutants showed different levels of intracellular ATP. In most mutants, the ATP concentration level is higher in the absence of La3+. In some cases, ATP content was significantly high: Δmch and ΔxoxF1SupΔmch showed higher ATP levels than the WT (Fig. 12AB). The mch deletion would cause accumulation of methenyl-H4MPT. It is known that the accumulation leads to inhibition of MtdA, and subsequent restricted carbon flux in the H4F pathway, in which MtdA also functions (Martinez-Gomez et al., 2015). As there is no assimilation of formate into H4F pathway, the excess ATP from this system would result in high total ATP concentration. For ΔmxaF in the presence of La3+, there is a correlation of growth phenotype (maximum OD600) in the liquid medium (Fig. 7C) and the ATP levels (Fig. 12C). The two mutants (ΔmchΔhgd and FD-4) that exhibited lower growth than normal showed the highest ATP levels. Additionally, FD-6 mutant which exhibited a delayed growth also had an elevated ATP concentration.

Since ATP concentration can be affected by multiple factors, ATP measurement alone is not enough for conclusive understanding on metabolic fluxes in these mutants. Application of metabolome analysis would be beneficial. Methylotrophs, including serine pathway bacteria like 22A, require large amounts of NAD(P)H for biosynthesis (Anthony, 1982). Additionally, the H4F pathway leading to serine cycle also requires NAD(P)H to function. It is possible that some mutants may have limited NAD(P)H but an excess of ATP when neither the formaldehyde oxidation pathways nor H4F pathway function. The variety of metabolic pathways in facultative methylotrophs, especially those with multiple formaldehyde oxidation pathways, opens the subject of interactive roles and regulations of multiple pathways to further investigation. 21

3.6. The recombinant XoxF1-His oxidizes methanol and formaldehyde. To characterize the functions of XoxF1 and MxaF from strain 22A, expression vectors based on pCM130KmC were designed and constructed: pCM130kmC-xoxF1-His and pCM130kmC-mxaF-His were introduced into ΔxoxF1 and ΔmxaF. ΔxoxF1 could grow only slowly on methanol in the presence of La3+, but the transformant could grow well, suggesting that the introduced xoxF1 complemented the phenotype and that the His-tagged XoxF1 is catalytically functional in vitro.

The apparent monomeric molecular mass of the purified His-tagged XoxF1 (XoxF1-His) and MxaF (MxaF-His) were ca. 60 kDa and ca. 62 kDa, as revealed by SDS-PAGE (Fig. 13). SDS-PAGE did not detect MxaI small subunit (10 kDa) in MxaF-His purified fraction. The native molecular mass of XoxF1-His and MxaF-His was estimated by gel filtration to be ca. 60 kDa and 107 kDa (Fig. 14).

The LC-MS analysis result for their tryptic digests is summarized in Table 8. Both purified enzymes fractions contained acetolactate synthase, aldehyde-activating protein (Fae1), and copper chaperone. The purified MxaF-His fraction contained MxaI and XoxF1. The reason for this co-purification remains unknown at the moment, except regarding MxaI. The metal content of the purified XoxF1-His was determined to be 0.58 La3+ per monomer protein according to ICP-MS analysis. The enzyme kinetics (Fig. 15) of XoxF1-His were determined using methanol and formaldehyde as substrates. The kinetic constants (Km values were 0.03 -1 and 0.34 mM, Vmax were 1.19 and 1.24 U·mg for methanol and formaldehyde, respectively) indicated that XoxF1 can oxidize both methanol and formaldehyde in vitro. The kinetic parameters were within similar ranges reported for strain AM1, Bradyrhizobium diazoefficiens USDA110, and the methanotroph M. fumariolicum SolV (Table 9). In vitro activity of XoxF toward formaldehyde has also been shown in Methylacidiphilum fumariolicum SolV (Pol et al., 2014), strain AM1 (Schmidt et al., 2010; Good et al., 2018), and Bradyrhizobium diazoefficiens USDA110 (L. Wang et al., 2019). The varying affinity constants (Km) and maximum reaction rates (Vmax) are due to differences in organisms, conditions, and assays, causing varying values.

On the other hand, MxaF-His activity was not detected in the purified fraction in the standard assay system depending on DCPIP and PMS. This might be due to rapid inactivation of the enzyme during purification under the buffer system used, or inappropriate assay conditions. Although the purified MxaF-His fractions contained MxaI, the catalytically important subunit MxaI, whose molecular stoichiometry might not meet the amount of MxaF, was not overexpressed.

Conclusion

Several key findings regarding formaldehyde oxidation in M. aquaticum strain 22A were made in this work. The GSH pathway is functional and is involved in the formaldehyde oxidation process as well as the generation of NADH. However, due to the low expression, it has a supportive role for the net formaldehyde oxidation while the H4MPT performs the primary role. XoxF1 was found to be capable of oxidizing formaldehyde both in vivo and in vitro and can reduce formaldehyde toxicity in formaldehyde-oxidation deficient mutants. However, due to lack of NADH generation, this direct oxidation of methanol to formate does not support methanol growth. ExaF was found to be involved in Ln3+-dependent ethanol growth and formaldehyde detoxification. In a natural environment, these redundant oxidation pathways catalyzed by different MDHs and formaldehyde oxidation pathways would enable cells to control the carbon flux in the redundant pathways, depending on the availability of Ln3+, the intracellular level of formaldehyde, and the required NADH level. This work has provided insights into the functions of the multiple formaldehyde oxidation pathways which should be generalizable to the other types of methylotrophy in the future. It may also serve as a proof of advantage for lifeforms with multiple redundant pathways and enzymes, leading to more sophisticated genetic engineering and synthesis of highly survivable lifeforms. 23

References

Abanda-Nkpwatt, D., Müsch, M., Tschiersch, J., Boettner, M., Schwab, W. (2006). Molecular interaction between Methylobacterium extorquens and seedlings: growth promotion, methanol consumption, and localization of the methanol emission site. Journal of Experimental Botany 57: 4025–4032. doi:10.1093/jxb/erl173.

Alamgir, K. M., Masuda, S., Fujitani, Y., Fukuda, F., and Tani, A. (2015). Production of ergothioneine by Methylobacterium species. Frontiers in Microbiology 6, 1185. doi:10.3389/fmicb.2015.01185.

Anthony, C. (1982). The biochemistry of methylotrophs. London, UK: Academic Press.

Anthony, C., and Williams, P. (2003). The structure and mechanism of methanol dehydrogenase. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1647, 18–23. doi:10.1016/s1570-9639(03)00042-6.

Anthony, C. (2011). How half a century of research was required to understand bacterial growth on C1 and C2 compounds; the story of the serine cycle and the ethylmalonyl-CoA pathway. Science Progress 94(2), 109-137. doi:10.3184/003685011X13044430633960.

Binnemans, K., Jones, P. T., Blanpain, B., Van Gerven, T., Yang, Y., Walton, A., and Buchert, M. (2013). Recycling of rare earths: a critical review. Journal of Cleaner Production 51, 1–22. doi:10.1016/j.jclepro.2012.12.037.

Bogart, J. A., Lewis, A. J., and Schelter, E. J. (2015). DFT study of the active site of the XoxF- type natural, cerium-dependent methanol dehydrogenase enzyme. Chemistry A European Journal 21, 1743-1748. doi:10.1002/chem.201405159.

Bradford, M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248– 254. doi:10.1006/abio.1976.9999.

Chistoserdova, L., Vorholt, J. A., Thauer, R. K., and Lidstrom, M. E. (1998). C1 transfer enzymes and coenzyme linking methylotrophic bacteria and methanogenic archaea. Science 281, 99-102. doi:10.1126/science.281.5373.99.

Chistoserdova, L., Chen, S.-W., Lapidus, A., and Lidstrom, M. E. (2003). Methylotrophy in Methylobacterium extorquens AM1 from a genomic point of view. Journal of Bacteriology 185, 2980–2987. doi:10.1128/jb.185.10.2980-2987.2003.

Chistoserdova, L., Laukel, M., Portais, J.- C., Vorholt, J. A., and Lidstrom, M. E. (2004). Multiple formate dehydrogenase enzymes in the falcultative methylotroph Methylobacterium extorquens AM1 are dispensable for growth on methanol. Journal of Bacteriology 186(1), 22-28. doi:10.1128/JB.186.1.22–28.2004. 24

Chistoserdova, L., Crowther, G. J., Vorholt, J. A., Skovran, E., Portais, J-.C., and Lidstrom, M. E. (2007). Identification of a fourth formate dehydrogenase in Methylobacterium extorquens AM1 and confirmation of the essential role of formate oxidation in methylotrophy. Journal of Bacteriology 189(24), 9076-9081. doi:10.1128/JB.01229-07.

Chistoserdova, L., Kalyuzhnaya, M. G., and Lidstrom, M. E. (2009). The expanding world of methylotrophic metabolism. Annual Review of Microbiology 63, 477-499. doi:10.1146/annurev.micro.091208.073600.

Chistoserdova, L. (2011). Modularity of methylotrophy, revisited. Environmental Microbiology 13, 2603–2622. doi:10.1111/j.1462-2920.2011.02464.x.

Chistoserdova, L. (2018). Applications of methylotrophs: can single carbon be harnessed for biotechnology? Current Opinion in Biotechnology 50, 189–194. doi:10.1016/j.copbio.2018.01.012.

Chu, F., and Lidstrom, M. E. (2016). XoxF acts as the predominant methanol dehydrogenase in the type i methanotroph Methylomicrobium buryatense. Journal of Bacteriology 198, 1317–1325. doi:10.1128/jb.00959-15.

Connelly, N. G., Damhus, T., Hartshorn, R. M., and Hutton, A. T. (2005). Nomenclature of Inorganic Chemistry (IUPAC Recommendations 2005). The Royal Society of Chemistry. isbn: 978-0-85404-438-2.

Crowther, G. J., Kosaly, G., and Lidstrom, M. E. (2008). Formate as the main branch point for methylotrophic metabolism in Methylobacterium extorquens AM1. Journal of Bacteriology 190, 5057–5062. doi:10.1128/jb.00228-08.

D’Aquino, L., and Tommasi, F. (2016). Rare Earth Elements and Microorganisms. In G. Pagano (Ed.), Rare Earth Elements in Human and Environmental Health (pp. 127–141). Pan Stanford. isbn: 9789814745000.

Delmotte, N., Knief, C., Chaffron, S., Innerebner, G., Roschitzki, B., Schlapbach, R., et al. (2009). Community proteogenomics reveals insights into the physiology of phyllosphere bacteria. PNAS 106(38), 16428-16433. doi:10.1073/pnas.0905240106.

Dorokhov, Y. L., Shindyapina, A. V., Sheshukova, E. V., and Komarova, T. V. (2015). Metabolic methanol: Molecular pathways and physiological roles. Physiological Reviews 95(2), 603–644. doi:10.1152/physrev.00034.2014.

Fall, R., and Benson, A. A. (1996). Leaf methanol the simplest natural product from plants. Trends in Plant Science 1, 296–301. doi:10.1016/s1360-1385(96)88175-0. 25

Farhan Ul Haque, M., Kalidass, B., Bandow, N., Turpin, E. A., DiSpirito, A. A., and Semrau, J. D. (2015). Cerium regulates expression of alternative methanol dehydrogenases in Methylosinus trichosporium OB3b. Applied and Environmental Microbiology 81(21), 7546–7552. doi:10.1128/AEM.02542-15.

Featherston, E. R., Rose, H. R., McBride, M. J., Taylor, E. M., Boal, A. K., and Cotruvo,. J. A., Jr. (2019). Biochemical and structural characterization of XoxG and XoxJ and their roles in lanthanide-dependent methanol dehydrogenase activity. ChemBioChem 20(18), 2360-2372. doi:10.1002/cbic.201900184.

Fitriyanto, N. A., Fushimi, M., Matsunaga, M., Pertiwiningrum, A., Iwama, T., and Kawai, K. (2011). Molecular structure and gene analysis of Ce3+-induced methanol dehydrogenase of Bradyrhizobium sp. MAFF211645. Journal of Bioscience and Bioengineering 111, 613–617. doi:10.1016/j.jbiosc.2011.01.015.

Galbally, I. E., and Kirstine, W. (2002). The production of methanol by flowering plants and the global cycle of methanol. Journal of Atmospheric Chemistry 43, 195-229, doi:10.1023/A:1020684815474.

Ghosh, M., Anthony, C., Harlos, K., Goodwin, M. G., and Blake, C. (1995). The refined structure of the quinoprotein methanol dehydrogenase from Methylobacterium extorquens at 1.94 Å. Structure 3, 177–187. doi:10.1016/s0969-2126(01)00148-4.

Goenrich, M., Bartoschek, S., Hagemeier, C. H., Griesinger, C., and Vorholt, J. A. (2002a). A glutathionedependent formaldehyde-activating enzyme (Gfa) from Paracoccus denitrificans detected and purified via two-dimensional proton exchange NMR spectroscopy. The Journal of Biological Chemistry 277(5), 3069-3072. doi:10.1074/jbc.C100579200.

Goenrich, M., Bursy, J., Hübner, E., Linder, D., Schwartz, A. C., and Vorholt, J. A. (2002b). Purification and characterization of the methylene tetrahydromethanopterin dehydrogenase MtdB and the methylene tetrahydrofolate dehydrogenase FolD from Hyphomicrobium zavarzinii ZV580. Archives of Microbiology 177, 299-303. doi:10.1007/s00203-001-0394-y.

Golev, A., Scott, M., Erskine, P. D., Ali, S. H., and Ballantyne, G. R. (2014). Rare earths supply chains: current status, constraints and opportunities. Resources Policy 41, 52-59. doi:10.1016/j.resourpol.2014.03.004.

Good, N. M., Vu, H. N., Suriano, C. J., Subuyuj, G. A., Skovran, E., and Martinez-Gomez, N. C. (2016). Pyrroloquinoline quinone ethanol dehydrogenase in Methylobacterium extorquens AM1 extends lanthanide-dependent metabolism to multicarbon substrates. Journal of Bacteriology 198, 3109–3118. doi:10.1128/jb.00478-16. 26

Good, N. M., Walser, O. N., Moore, R. S., Suriano, C. J., Huff, A. F., and Martı́nez-Gómez, N. C. (2018). Investigation of lanthanide-dependent methylotrophy uncovers complementary roles for alcohol dehydrogenase enzymes. bioRxiv. doi:10.1101/329011.

Good, N. M., Moore, R. S., Suriano, C. J., and Martinez-Gomez, N. C. (2019). Contrasting in vitro and in vivo methanol oxidation activities of lanthanide-dependent alcohol dehydrogenases XoxF1 and ExaF from Methylobacterium extorquens AM1. Scientific Reports 9. doi:10.1038/s41598-019-41043-1.

Guo, X., and Lidstrom, M. E. (2006). Physiological analysis of Methylobacterium extorquens AM1 grown in continuous and batch cultures. Archives of Microbiology 186(2), 139–149. doi:10.1007/s00203-006-0131-7.

Gupta, C.K., and N. Krishnamurthy. (2004). Extractive metallurgy of rare earths. CRC Press, Boca Raton, FL. isbn: 9780415333405.

Green, P. N., and Ardley, J. K. (2018). Review of the genus Methylobacterium and closely related organisms: A proposal that some Methylobacterium species be reclassified into a new genus, Methylorubrum gen. Nov. International Journal of Systematic and Evolutionary Microbiology 68, 2727–2748. doi:10.1099/ijsem.0.002856.

Hagemeier, C. H., Chistoserdova, L., Lidstrom, M. E., Thauer, R. K., and Vorholt, J. A. (2000). Characterization of a second methylene tetrahydromethanopterin dehydrogenase from Methylobacterium extorquens AM1. European Journal of Biochemistry 267, 3762-3769. doi:10.1046/j.1432-1327.2000.01413.x.

Hibi, Y., Asai, K., Arafuka, H., Hamajima, M., Iwama, T., and Kawai, K. (2011). Molecular structure of La3+-induced methanol dehydrogenase-like protein in Methylobacterium radiotolerans. Journal of Bioscience and Bioengineering 111, 547–549. doi:10.1016/j.jbiosc.2010.12.017.

Hiraga, Shota. Master thesis, 2017. Lanthanide-dependent regulation of methanol dehydrogenase genes in Methylobacterim aquaticum strain 22A. (Japanese).

Hu, Z., Haneklaus, S., Sparovek, G., Schnug, E. (2006). Rare Earth Elements in Soils. Communications in Soil Science and Plant Analysis 37, 1381-1420. doi:10.1080/00103620600628680.

Hüve, K., Christ, M. M., Kleist, E., Uerlings, R., Niinemets, U., Walter, A., et al. (2007). Simultaneous growth and emission measurements demonstrate an interactive control of methanol release by leaf expansion and stomata. Journal of Experimental Botany 58(7), 1783-1793. doi:10.1093/jxb/erm038.

IPCC. (2007) Climate Change 2007: The Physical Science Basis. Summary for Policymakers; Contribution of working group i to the fourth assessment report of the intergovernmental panel on climate change; Cambridge University Press: Cambridge, UK. 27

Iguchi, H., Yurimoto, H., and Sakai, Y. (2015). Interactions of methylotrophs with plants and other heterotrophic bacteria. Microorganisms 3(2), 137–151. doi:10.3390/microorganisms3020137.

Jahn, B., Pol, A., Lumpe, H., Barends, T. R. M., Dietl, A., Hogendoorn, C., Op den Camp, H. J. M., and Daumann, L., J. (2018). Similar but not the same: first kinetic and structural analyses of a methanol dehydrogenase containing a europium ion in the active site. ChemBioChem 19(11), 1147-1153. doi:10.1002/cbic.201800130.

Jones, D. T., Taylor, W. R., Thornton, J. M. (1992). The rapid generation of mutation data matrices from protein sequences. Computer Applications in the Biosciences 8, 275-282. doi:10.1093/bioinformatics/8.3.275.

Jorge, G. L., Kisiala, A., Morrison, E., Aoki, M., Nogueira, A. P. O., and Emery, R. J. N. (2019). Endosymbiotic Methylobacterium oryzae mitigates the impact of limited water availability in lentil (Lens culinaris Medik.) by increasing plant cytokinin levels. Environmental and Experimental Botany 162, 525–540. doi:10.1016/j.envexpbot.2019.03.028.

Keltjens, J. T., Pol, A., Reimann, J., Op den Camp, H. J. M. (2014) PQQ-dependent methanol dehydrogenases: Rare-earth elements make a difference. Applied Microbiology and Biotechnology 98, 6163–6183. doi:10.1007/s00253-014-5766-8.

Kumar, S., Stecher, G., and Tamura, K. (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33, 1870–1874. doi:10.1093/molbev/msw054.

Lindow, S. E., and Brandl, M. T. (2003). Microbiology of the phyllosphere. Applied and Environmental Microbiology 69(4), 1875-1883. doi:10.1128/AEM.69.4.1875–1883.2003.

Lumpe, H., Pol, A., Op den Camp, H. J. M., and Daumann, L. J. (2018). Impact of the lanthanide contraction on the activity of a lanthanide-dependent methanol dehydrogenase- a kinetic and DFT study. Dalton Transactions 47(31), 10463–10472. doi:10.1039/c8dt01238e.

Lv, H., Masuda, S., Fujitani, Y., Sahin, N., and Tani, A. (2017). Oharaeibacter diazotrophicus gen. nov., sp. nov., a diazotrophic and facultatively methylotrophic bacterium, isolated from rice rhizosphere. International Journal of Systematic and Evolutionary Microbiology 67, 576–582. doi:10.1099/ijsem.0.001660.

Lv, H., Sahin, N., and Tani, A. (2018). Isolation and genomic characterization of Novimethylophilus kurashikiensis gen. nov. sp. nov., a new lanthanide-dependent methylotrophic species of methylophilaceae. Environmental Microbiology 20, 1204– 1223. doi:10.1111/1462-2920.14062. 28

Lv, H., and Tani, A. (2018). Genomic characterization of methylotrophy of Oharaeibacter diazotrophicus strain SM30T. Journal of Bioscience and Bioengineering 126, 667–675. doi:10.1016/j.jbiosc.2018.05.023.

Martinez-Gomez, N. C., Good, N. M., and Lidstrom, M. E. (2015). Methenyl- dephosphotetrahydromethanopterin is a regulatory signal for acclimation to changes in substrate availability in Methylobacterium extorquens AM1. Journal of Bacteriology 197, 2020–2026. doi:10.1128/jb.02595-14.

Martinez-Gomez, N. C, Vu, H.N., and Skovran, E. (2016). Lanthanide chemistry: from coordination in chemical complexes shaping our technology to coordination in enzymes shaping bacterial metabolism. Inorganic Chemistry 55, 10083-10089. doi:10.1021/acs.inorgchem.6b00919.

Marx, C. J., and Lidstrom, M. E. (2001). Development of improved versatile broad-host-range vectors for use in methylotrophs and other gram-negative bacteria. Microbiology 147, 2065–2075. doi:10.1099/00221287-147-8-2065.

Marx, C. J., Chistoserdova, L., and Lidstrom, M. E. (2003). Formaldehyde-detoxifying role of the tetrahydromethanopterin-linked pathway in Methylobacterium extorquens AM1. Journal of Bacteriology 185, 7160–7168. doi:10.1128/jb.185.23.7160-7168.2003.

Marx, C. J., and Lidstrom, M. E. (2004). Development of an insertional expression vector system for Methylobacterium extorquens AM1 and generation of null mutants lacking mtdA and/or fch. Microbiology 150, 9-19. doi:10.1099/mic.0.26587-0.

Marx, C. J., Miller, J. A., Chistoserdova, L., and Lidstrom, M. E. (2004). Multiple formaldehyde oxidation/detoxification pathways in Burkholderia fungorum LB400. Journal of Bacteriology 186(7), 2173–2178. doi:10.1128/JB.186.7.2173-2178.2004.

Marx, C. J., Van Dien, S. J., and Lidstrom, M. E. (2005). Flux analysis uncovers key role of functional redundancy in formaldehyde metabolism. PLoS Biology 3(2), 0244–0253. doi:10.1371/journal.pbio.0030016.

Masuda, S., Suzuki, Y., Fujitani, Y., Mitsui, R., Nakagawa, T., Shintani, M., et al. (2018). Lanthanide-dependent regulation of methylotrophy in Methylobacterium aquaticum strain 22A. mSphere 3. doi:10.1128/msphere.00462-17.

Nakagawa, T., Mitsui, R., Tani, A., Sasa, K., Tashiro, S., Iwama, T., et al. (2012). A catalytic role of XoxF1 as La3+-dependent methanol dehydrogenase in Methylobacterium extorquens strain AM1. PLOS ONE 7, e50480. doi:10.1371/journal.pone.0050480.

Nakatsuji, Yukari. Master thesis, 2015. Functional analysis of methanol dehydrogenase homologues in Methylobacterim aquaticum strain 22A. (Japanese). 29

Nash, T. (1953). The colorimetric estimation of formaldehyde by means of the Hantzsch reaction. Biochemical Journal 55, 416-421. doi:10.1042/bj0550416.

Nemecek-Marshall, M., MacDonald, R. C., Franzen, J. J., Wojciechowski, C. L., and Fall, R. (1995). Methanol emission from leaves. Plant Physiology 108, 1359-1368. doi:10.1104/pp.108.4.1359.

Ochsner, A. M., Hemmerle, L., Vonderach, T., Nüssli, R., Bortfeld-Miller, M., Hattendorf, B., et al. (2019). Use of rare-earth elements in the phyllosphere colonizer Methylobacterium extorquens PA1. Molecular Microbiology 111, 1152–1166. doi:10.1111/mmi.14208.

Olah, G. A., Goeppert, A., and Surya Prakash, G. K. (2009). Beyond Oil and Gas: The Methanol Economy (2nd ed.). Wiley-VCH. isbn: 978-3-527-32422-4.

Perkins, D.N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. (1999). Probability‐based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis 20(18), 3551-3567. doi:10.1002/(SICI)1522- 2683(19991201)20:18<3551::AID-ELPS3551>3.0.CO;2-2.

Peyraud, R., Schneider, K., Kiefer, P., Massou, S., Vorholt, J. A., and Portais, J.-C. (2011). Genome-scale reconstruction and system level investigation of the metabolic network of Methylobacterium extorquens AM1. BMC Systems Biology 5, 189. doi:10.1186/1752- 0509-5-189.

Peyraud, R., Kiefer, P., Christen, P., Portais, J-. C., and Vorholt, J. A. (2012). Co-consumption of methanol and succinate by Methylobacterium extorquens AM1. PLOS ONE 7(11), e48271. doi:10.1371/journal.pone.0048271.

Pfeifenschneider, J., Brautaset, T., and Wendisch, V. F. (2017). Methanol as carbon substrate in the bio-economy: Metabolic engineering of aerobic methylotrophic bacteria for production of value-added chemicals. Biofuels, Bioproducts and Biorefining 11(4), 719– 731. doi:10.1002/bbb.1773.

Picone, N., and Op den Camp, H. (2019). Role of rare earth elements in methanol oxidation. Current Opinion in Chemical Biology 49, 39-44. doi:10.1016/j.cbpa.2018.09.019.

Pol, A., Barends, T. R. M., Dietl, A., Khadem, A. F., Eygensteyn, J., Jetten, M. S. M., et al. (2014). Rare earth metals are essential for methanotrophic life in volcanic mudpots. Environmental Microbiology 16, 255–264. doi:10.1111/1462-2920.12249.

Pomper, B. K., Vorholt, J. A., Chistoserdova, L., Lidstrom, M. E., Thauer, R. K. (1999). A methenyl tetrahydromethanopterin cyclohydrolase and a methenyl tetrahydrofolate cyclohydrolase in Methylobacterium extorquens AM1. European Journal of Biochrmistry 261, 475-480. doi:10.1046/j.1432-1327.1999.00291.x. 30

Pomper, B. K., and Vorholt, J. A. (2001). Characterization of the formyltransferase from Methylobacterium extorquens AM1. European Journal of Biochemistry 269, 4769-4775. doi:10.1046/j.1432-1327.2001.02401.x.

Pomper, B. K., Saurel, O., Milon, A., and Vorholt, J. A. (2002). Generation of fotmate by the formyltransferase/hydrolase complex (Fhc) from Methylobacteirum extorquens AM1. FEBS Letters 523, 133-137. doi:10.1016/s0014-5793(02)02962-9.

Popov, V. O., and Lamzin, V. S. (1994). NAD+-dependent formate dehydrogenase. Biochemical Journal 301, 625-643. doi:10.1042/bj3010625.

Räuchle, K., Plass, L., Wernicke, H.-J., Bertau, M. (2016). Methanol for renewable energy storage and utilization. Energy Technology 4(1), 193–200. doi:10.1002/ente.201500322.

Roszczenko-Jasińska, P., Vu, H. N., Subuyuj, G. A., Crisostomo, R. V., Cai, J., Raghuraman, C., et al. (2019). Lanthanide transport, storage, and beyond: Genes and processes contributing to XoxF function in Methylorubrum extorquens AM1. bioRxiv. doi:10.1101/647677.

Ryu, J., Madhaiyan, M., Poonguzhali, S., Yim, W., Indiragandhi, P., Kim, K., et al. (2006). Plant growth substances produced by Methylobacterium spp. and their effect on tomato (Lycopersicon esculentum L.) and red pepper (Capsicum annuum L.) growth. Journal of Microbiology and Biotechnology 16(10), 1622-1628.

Saitou, N., and Nei, M. (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425. doi:10.1093/oxfordjournals.molbev.a040454.

Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Theirbach, G., and Pühler, A. (1994). Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutacicum. Gene 145, 69-73. doi:10.1016/0378-1119(94)90324-7.

Schmidt, S., Christen, P., Kiefer, P., and Vorholt, J. A. (2010). Functional investigation of methanol dehydrogenase-like protein XoxF in Methylobacterium extorquens AM1. Microbiology 156, 2575–2586. doi:10.1099/mic.0.038570-0.

Skovran, E., Crowther, G. J., Guo, X., Yang, S., and Lidstrom, E. (2010). A systems biology approach uncovers cellular strategies used by Methylobacterium extorquens AM1 during the switch from multi- to single-carbon growth. PLOS ONE 5(11), e14091. doi:10.1371/journal.pone.0014091.

Skovran, E., Palmer, A. D., Rountree, A. M., Good, N. M., and Lidstrom, M. E. (2011). XoxF is required for expression of methanol dehydrogenase in Methylobacterium extorquens AM1. Journal of Bacteriology 193, 6032–6038. doi:10.1128/jb.05367-11. 31

Skovran, E., and Martinez-Gomez, N. C. (2015). Just add lanthanides. Science 348(6237), 862- 863. doi:10.1126/science.aaa9091.

Skovran, E., Raghuraman, C., and Martinez-Gomez, N. C. (2019). Lanthanides in methylotrophy. Current Issuses in Molecular Biology 33, 101-116. doi:10.21775/cimb.033.101.

Šmejkalová, H., Erb, T. J., and Fuchs, G. (2010). Methanol assimilation in Methylobacterium extorquens AM1: Demonstration of all enzymes and their regulation. PLOS ONE 5, e13001. doi:10.1371/journal.pone.0013001.

Sonntag, F., Müller, J. E. N., Kiefer, P., Vorholt, J. A., Schrader, J., and Buchhaupt, M. (2015). High-level production of ethylmalonyl-CoA pathway-derived dicarboxylic acids by Methylobacterium extorquens under cobalt-deficient conditions and by polyhydroxybutyrate negative strains. Applied Microbiology and Biotechnology 99(8), 3407–3419. doi:10.1007/s00253-015-6418-3.

Sy, A., Timmers, A. C. J., Knief, C., and Vorholt, J. A. (2005). Methylotrophic metabolism is advantageous for Methylobacterium extorquens during colonization of Medicago truncatula under competitive conditions. Applied and Environmental Microbiology 71(11), 7245–7252. doi:10.1128/AEM.71.11.7245-7252.2005.

Springer, A. L., Morris, C. J., and Lidstrom, M. E. (1997). Molecular analysis of mxbD and mxbM, a putative sensor-regulator pair required for oxidation of methanol in Methylobacterium extorquens AM1. Microbiology 143, 1737–1744. doi:10.1099/00221287-143-5-1737.

Subhaswaraj, P., Jobina, R., Parasuraman, P., and Siddhardha, B. (2017). Plant Growth Promoting Activity of Pink Pigmented Facultative methylotroph – Methybacterium extorquens MM2 on Lycopersicon esculentum L. Journal of Applied Biology & Biotechnology 5(1), 42-46. doi:10.7324/JABB.2017.50107.

Tani, A., Akita, M., Murase, H., and Kimbara, K. (2011). Culturable bacteria in hydroponic cultures of moss Racomitrium japonicum and their potential as biofertilizers for moss production. Journal of Bioscience and Bioengineering 112, 32–39. doi:10.1016/j.jbiosc.2011.03.012.

Tani, A., Takai, Y., Suzukawa, I., Akita, M., Murase, H., and Kimbara, K. (2012). Practical application of methanol-mediated mutualistic symbiosis between Methylobacterium species and a roof greening moss, Racomitrium japonicum. PLOS ONE 7, e33800. doi:10.1371/journal.pone.0033800.

Tani, A., Ogura, Y., Hayashi, T., and Kimbara, K. (2015). Complete genome sequence of Methylobacterium aquaticum strain 22A, isolated from Racomitrium japonicum moss. Genome Announcements 3. doi:10.1128/genomea.00266-15. 32

Tsagkari, E., and Sloan, W. T. (2019). Impact of Methylobacterium in the drinking water microbiome on removal of trihalomethanes. International Biodeterioration & Biodegradation 141, 10–16. doi:10.1016/j.ibiod.2018.07.015.

Tyler, G. (2004). Rare earth elements in soil and plant systems – a review. Plant and Soil 267, 191-206. doi:10.1007/s11104-005-4888-2.

Uotila, L., and Koivusalo, M. (1981). “[42] formaldehyde dehydrogenase,” in Methods in enzymology (Elsevier), 314–320. doi:10.1016/s0076-6879(81)77044-7.

Vorholt, J. A., Chistoserdova, L., Lidstrom, M. E., Thauer, R. K. (1998). The NADP-dependent methylene tetrahydromethanopterin dehydrogenase in Methylobacterium extorquens AM1. Journal of Bacteriology 180(20), 5351-5356. doi:10.1128/JB.180.20.5351- 5356.1998.

Vorholt, J. A., Marx, C. J., Lidstrom, M. E., and Thauer, R. K. (2000). Novel formaldehyde- activating enzyme in Methylobacterium extorquens AM1 required for growth on methanol. Journal of Bacteriology 182(23), 6645-6650. doi: 10.1128/JB.182.23.6645- 6650.2000.

Vorholt, J. A. (2002). Cofactor-dependent pathways of formaldehyde oxidaion in methylotrophic bacteria. Archives of Microbiology 178, 239-249. doi:10.1007/s00203- 002-0450-2.

Vorholt, J. A. (2012). Microbial life in the phyllosphere. Nature Reviews Microbiology 10(12), 828–840. doi:10.1038/nrmicro2910.

Vu, H. N., Subuyuj, G. A., Vijayakumar, S., Good, N. M., Martinez-Gomez, N. C., and Skovran, E. (2016). Lanthanide-dependent regulation of methanol oxidation systems in Methylobacterium extorquens AM1 and their contribution to methanol growth. Journal of Bacteriology 198, 1250–1259. doi:10.1128/jb.00937-15.

Wang, X., Xia, K., Yang, X., and Tang, C. (2019). Growth strategy of microbes on mixed carbon sources. Nature Communication 10(1), 1279. doi:10.1038/s41467-019-09261-3.

Wang, L., Suganuma, S., Hibino, A., Mitsui, R., Tani, A., Matsumoto, T., et al. (2019). Lanthanide-dependent methanol dehydrogenase from the legume symbiotic nitrogen- fixing bacterium Bradyrhizobium diazoefficiens strain USDA110. Enzyme and Microbial Technology 130, 109371. doi:10.1016/j.enzmictec.2019.109371.

Wehrmann, M., Billard, P., Martin-Meriadec, A., Zegeye, A., and Klebensberger, J. (2017). Functional role of lanthanides in enzymatic activity and transcriptional regulation of pyrroloquinoline quinone-dependent alcohol dehydrogenase in Pseudomonas putida KT2440. mBio 8(3), e00570-17. doi:10.1128/mBio.00570-17.

Weissermel, K., and Arpe, H.-J. (2008). Industrial Organic Chemistry (3rd ed.). Wiley-VCH. 33

Wu, M. L.; Wessels, H. J. C. T.; Pol, A.; Op den Camp, H. J. M.; Jetten, M. S. M.; Niftrik, L. van, et al. (2015). XoxF-type methanol dehydrogenase from the anaerobic methanotroph “Candidatus methylomirabilis oxyfera”. Applied Environmental Microbiology 81, 1442– 1451, doi:10.1128/aem.03292-14.

Yanpirat, P., Nakatsuji, Y., Hiraga, S., Fujitani, Y., Izumi, T., Masuda, S., Mitsui, R., Nakagawa, T., and Tani, A. (2020). Lanthanide-dependent methanol and formaldehyde oxidation in Methylobacterium aquaticum Strain 22A. Microorganisms 8(6), 822. doi:10.3390/microorganisms8060822.

Yurimoto, H., Kato, N., and Sakai, Y. (2005). Assimilation, dissimilation, and detoxification of formaldehyde, a central metabolic intermediate of methylotrophic metabolism. The Chemical Record 5, 367–375. doi:10.1002/tcr.20056.

Zheng, Y., Huang, J., Zhao, F., and Chistoserdova, L. (2018). Physiological effect of XoxG(4) on lanthanide-dependent methanotrophy. mBio 9, e02430–17. doi:10.1128/mbio.02430- 17. 34

Acknowledgements

Now that my path of Ph.D. has come to an end, a new chapter of my life will begin. Without everyone's support here, I could not have achieved this goal.

Everything started when my supervisor, Associate Professor Akio Tani, accepted me to study here. I would like to express my gratitude for his guidance and support in my education and academic pursuits.

I would like to express my appreciation to my co-supervisors Professor Nobuhiro Suzuki and Professor Ivan Galis for their kind assistance and constructive comments that allowed me to perfect my study.

Mrs. Yoshiko Fujitani, the lab technician, has always assisted me in my experiments and everyday life. For this, a simple word of thanks may not be enough. Additionally, I owe my gratitude to the colleagues at Plant Environmental Microbiology Group for their cooperation during my research, especially Haruna and Wakako for livening up the lab.

Haoxin Lv, first she was my senior, who became my friend, and today she remains my dearest sister even if she is far away. Her feelings always reach me and cheer me up.

I also feel honored and humbled to be a scholar of Rotary Yoneyama Memorial Foundation During my two years of tenure with the Foundation, I participated in many activities which broadened my world. The general meetings at the Okayama-south Rotary Club is something I always look forward to, on the first Tuesday of every month. Between perspectives and experiences, I have learned many things from the Rotarians that cannot be learned otherwise. I am also honored to receive a scholarship from Ohara Syonokai Foundation, the name that gave birth to the Institute of Plant Science and Resources itself.

Mrs. Toshiko Ohara, my counselor at Rotary, feels like my extended family in Japan. Riding a train might be a common thing in Japan, but I have never looked forward to riding a train like when I get to meet a person as important as you. Thank you for the greatest two years that you have looked after me.

Professor Kazuhiko Kusudo, my Japanese language teacher, who taught me more than just the language, but also the culture, helping me open the doors beyond the laboratory and into Japan actual.

Thank you, Annisa, for being my great friend here, for always accepting me. Even if I’m not great at speaking, you have always understood me and gave me great advice both in work and in life. Another greatest friend of mine is Areej. Even if our time together here is so short, every single day, every single lunch together has always been the happy times of my life.

To Chawanat Nakasan, all these years you have always been with me. I cherish all this moment. This greatest moment will always continue forever. 35

Finally, and most importantly, I wish to express my highest gratitude to my dearest parents for their love, encouragement, and support for my studies. Even though there will be more obstacles, I wish this success to be a force that carries me towards the future.

The feeling right now is strange, isn’t it?

With you I've made it here, up to this point.

The feelings from all of you reached me, thank you.

It is time for this little bird to spread her wings and fly towards the future, higher and higher. I won’t ever give up, even beyond the greatest day that will definitely come.

At this point, everything is tied together miraculously. Once again, I am grateful for all the support. That's why I will enjoy this moment.

This moment is the greatest.

Figure 1. A schematic of methylotrophy in strain AM1. 37

Figure 2. A comparison of enzymes and pathways used in the methylotrophy of (A) M. extorquens AM1 and (B) M. aquaticum 22A. 38

72 META1p1740 Methylorubrum extorquens strain AM1 (XoxF1 XoxF5-type) 100 META1p2757 Methylorubrum extorquens strain AM1 (XoxF2 XoxF5-type) c05215 Methylobacterium aquaticum 22A XoxF1 c27990 Methylobacterium aquaticum 22A XoxF2 100 WP 015927174.1 Methylobacterium nodulans (XoxF5) NP 772853 Bradyrhizobium diazoefficiens USDA 110 (XoxF5) XoxF5 group YP 007913380 Hyphomicrobium denitrificans (XoxF5) ZP 05104902 Methylophaga thiooxidans DMS010 (XoxF5) 100 WP 013818199.1 Methylomonas methanica (XoxF5) EFH02991.1 Methylosinus trichosporium OB3b (XoxF5) 81 EDT12687 Paraburkholderia graminis C4D1M (XoxF5) WP 013147907.1 Methylotenera versatilis (XoxF4)

100 100 WP 015832985.1 Methylotenera mobilis (XoxF4) XoxF4 group 100 WP 011480535.1 Methylobacillus flagellatus (XoxF4) WP 013820880.1 Methylomonas methanica (MxaF) EMR11880 Methylophaga lonarensis MPL (MxaF) 100 WP 011749265.1 MULTISPECIES Paracoccus (MxaF) MxaF group 99 1p33165 Methylobacterium aquaticum 22A MxaF 100 META1p4538 Methylorubrum extorquens AM1 (MxaF) 95 WP 020494391.1 Verrucomicrobium sp. 3C (XoxF1)

100 WP 012814374.1 Candidatus ‘Methylomirabilis oxyfera’ (XoxF1) XoxF1 group 100 WP 012592127.1 Methylocella silvestris (XoxF1) 100 ACM16493 Methylacidiphilum fumariolicum SolV (XoxF2)

100 WP 012814383.1 Candidatus ‘Methylomirabilis oxyfera’ (XoxF2) XoxF2 group AAY96669.1 uncultured bacterium BAC10-4 (XoxF2) 83 90 WP 012251923.1 Methylobacterium sp. Leaf119 (XoxF3) XoxF3 group 100 WP 012592359.1 Methylocella silvestris (XoxF3) WP 015666256.1 Bradyrhizobium oligotrophicum (PQQ-ADH type 1) WP 011684813.1 Candidatus ‘Solibacter usitatus’ (PQQ-ADH type 8) BAC15559 Pseudomonas putida (PQQ-ADH type 4 (quinohemoproteins)) 92 AAK27220 Thauera butanivorans (PQQ-ADH type 4 (quinohemoproteins)) EDT10345 Paraburkholderia graminis C4D1M (PQQ-ADH type 7) NP 772847 Bradyrhizobium diazoefficiens USDA 110 (PQQ-ADH type 3) 100 CAA08896 Pseudomonas aeruginosa (PQQ-ADH type 2a) AF326086 Pseudomonas butanovora (butanol dehydrogenase PQQ-ADH type 2a) 100 WP 003602767.1 Methylobacteriaceae (PQQ-ADH type 2b, ExaF of M. extorquens strain AM1) YP 001019670 Methylibium petroleiphilum PM1 (PQQ-ADH type 2b) 97 NP 744823.1 Pseudomonas putida KT2440 (PedH) PQQ-ADH group 100 BAN55012.1 Pseudomonas putida NBRC 14164 PedH (PQQ-ADH type 2b) WP 011829190 Methylibium petroleiphilum (PQQ-ADH type 5) c07235 Methylobacterium aquaticum 22A ExaF 100 WP 012042238.1 Bradyrhizobium sp. BTAi1 (PQQ-ADH type 6b) 94 WP 011490939.1 Paraburkholderia xenovorans (PQQ-ADH type 9) ZP 05104584.1 Methylophaga thiooxidans DMS010 (PQQ-ADH type 9) NP 774279 Bradyrhizobium diazoefficiens USDA 110 (PQQ-ADH type 9) 1p30675 Methylobacterium aquaticum 22A Adh6

100 1p32165 Methylobacterium aquaticum 22A Adh4 71 NP 772860 Bradyrhizobium diazoefficiens USDA 110 (PQQ-ADH type 6a) EFH04530.1 Methylosinus trichosporium OB3b (PQQ-ADH type 9)

0.2 Figure 3. Molecular phylogenetic analysis of MDH-like proteins found in strain 22A and other related sequences. The evolutionary history was inferred by using the maximum likelihood method based on the JTT matrix-based model (Jones et al., 1992). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Evolutionary analyses were conducted in MEGA7 (Kumar et al., 2016). 39

Figure 4. Pathways involved in the methylotrophy of M. aquaticum 22A, showing the target enzymes in this work. 40

Figure 6. Growth of various formaldehyde oxidation-pathway mutants constructed in the (A) wild type, (B) ΔxoxF1Sup, and (C) ΔmxaF backgrounds, in methanol liquid medium in the presence and absence of La3+. The results are presented as average ± SD (technical triplicates). 42

Figure 7. Growth of various formaldehyde oxidation-pathway mutants constructed in the (A) wild type, (B) ΔxoxF1Sup, and (C) ΔmxaF backgrounds, in methanol plus succinate liquid medium in the presence and absence of La3+. The results are presented as average ± SD (technical triplicates).

Figure 9. Growth of various formaldehyde pathway mutants generated in wild type, ΔxoxF1Sup, and ΔmxaF backgrounds on methanol plus succinate solid medium in the presence and absence of La3+. The partitioning of wild type and ΔxoxF1Sup in each plate corresponds to scheme (X) while ΔmxaF corresponds to scheme (Y). 45

Figure 12. Measurement of intracellular ATP levels in the mutants generated from (A) wild type, (B) ΔxoxF1Sup, and (C) ΔmxaF. The mutants were grown on succinate and methanol in the presence (filled bars) and absence (open bars) of La3+. The concentration levels are normalized to OD600. The results are presented as average ± SD (technical triplicates). Compact letter displays are a-f for +La; s-v for -La. 48

Figure 13. Purification of (A) XoxF1-His and (B) MxaF-His expressed in strain 22A. SDS-PAGE of crude cell extract, flow-through fraction through Ni-NTA column, and purified MDH in eluate fractions. Arrows indicate the purified protein bands. MxaF- His was additionally stained using Silver Stain Plus (Bio-Rad).

Figure 14. Gel filtration of MxaF-His (dashed) and XoxF-His (solid) over 20 minutes 49

Table 1. Primer sets for generation of formaldehyde oxidation gene mutants used in this study.

Primer name Forward primer Reverse primer Fae1_Up TATGACATGATTACGCGAACTCGACGACGCGGATG GTTCGCCGCGAAGGGCAGGTGTCGATAAGGTTAGC

Fae1_Down CCCTTCGCGGCGAACGTCGC CCGGGTACCGAGCTCAGCTGGGACCGATTCGGAAC

Fae2_Up TATGACATGATTACGTCTCAGTGGACGACGCGGTG CGTCGAGCACGCCCTGTCGCAGCGTCAACCGCGGC

Fae2_Down AGGGCGTGCTCGACGACGAG CCGGGTACCGAGCTCCCGACCATGCCGGAGCTGTC

Mch_Up TATGACATGATTACGCCCTGGCACCGGTGCCGGAC CGAAGGAGCGCGCCACCCCGAAGGCCGGTCGAATC

Mch_Down TGGCGCGCTCCTTCGCCTGA CCGGGTACCGAGCTCCCCGGGCGATGTCGACGCTC

Hgd_Up TATGACATGATTACGGGTATCTCGGTCGCTCGATC CCACGACCGAGCGGACGGCTCGATCGTTTCGCGTG

Hgd_Down TCCGCTCGGTCGTGGTGTTC CCGGGTACCGAGCTCCGGGCCATGCCCGTCGGATG 51

Table 2. Formaldehyde-oxidation deficient mutants list

Background Mutant combination Δfae1 Δfae2 Δfae1 Δfae2 Δmch WT Δhgd Δmch Δhgd Δfae1 Δfae2 Δhgd Δfae1 Δfae2 Δmch Δhgd Δfae1 Δfae2 Δfae1 Δfae2 Δmch ΔxoxF1Sup Δhgd Δmch Δhgd Δfae1 Δfae2 Δhgd Δfae1 Δfae2 Δmch Δhgd Δfae1 Δfae2 Δfae1 Δfae2 Δmch Δhgd ΔmxaF Δmch Δhgd Δfae1 Δfae2 Δhgd Δfae1 Δfae2 Δmch Δhgd ΔxoxF1 Δfae1 Δfae2 Δmch Δhgd ΔexaF Δfae1 Δfae2 Δmch Δhgd ΔxoxF1 ΔexaF Δfae1 Δfae2 Δmch Δhgd

Table 3. Mineral medium (MM) used in this study.

1. Buffer pH 7.1 300 ml/l 2. Mineral salts 200 ml/l 3. Sterile water 493 ml/l 4. Iron solution 1 ml/l 5. Trace element solution 1 ml/l 6. Vitamin solution 10 ml/l <1. Buffer pH 7.1>

1a. K2HPO4 8.0 g/l

1b. NaH2PO4∙2H2O 3.6 g/l <2. Mineral salts>

2a. NH4Cl 8.1 g/l

2b. MgSO4 0.5 g/l <4. Iron solution> 4a. HCl 1 N

4b. FeSO4∙7H2O 13.0 g/l <5. Trace element solution>

5a. ZnSO4∙7H2O 4.50 g/l

5b. CoCl2∙6H2O 3.00 g/l

5c. MnCl2∙4H2O 0.64 g/l

5d. H3BO3 1.00 g/l

5e. Na2MoO4∙2H2O 0.40 g/l

5f. CuSO4∙5H2O 0.30 g/l

5g. CaCl2∙2H2O 3.00 g/l <6. Vitamin solution> 6a. pantothenate calcium 0.4 g/l 6b. inositol 0.2 g/l 6c. niacin 0.4 g/l 6d. p-aminobenzoic acid 0.2 g/l 6e. pyridoxine hydrochloride 0.4 g/l 6f. thiamin hydrochloride 0.4 g/l 6g. biotin 0.2 g/l 6h. vitamin B12 0.2 g/l 53

Table 4. Primer sets used to generate His-tag protein.

Primer name Forward primer Reverse primer pCM130KmCloning GGGgaattcGCATTCTCAACGAACGATTC GGGgaattcTACTGGGCTATCTGGACAAG

TAGCCCAGTAgaattTCAATGATGATGATGATGATGGTTCGGCAGGTTGAA xoxF1pCM130KmC TTGAGAATGCgaattGCGCAACGACGGCGCCATCG GACCG

TAGCCCAGTAgaattTCAATGATGATGATGATGATGGTTCGCCGCGTAC mxaFpCM130KmC TTGAGAATGCgaattCGAAGTAGTGGAGAGCCACG TCGCCGA 54

Methanol +La Methanol -La SGR Groups Yield SGR Groups Yield WT 0.081 ± 0.003 a 4.00 ± 0.08 0.075 ± 0.000 a 4.54 ± 0.05 Δfae1 0.021 ± 0.002 d NG 0.023 ± 0.003 cd NG Δfae2 0.061 ± 0.011 b 3.88 ± 0.10 0.063 ± 0.015 ab 3.78 ± 0.19 Δfae1Δfae2 0.009 ± 0.004 e NG 0.012 ± 0.001 cd NG Δmch 0.012 ± 0.004 de NG 0.026 ± 0.006 cd NG Δhgd 0.043 ± 0.001 c 4.38 ± 0.06 0.051 ± 0.006 b 4.56 ± 0.06 ΔmchΔhgd 0.002 ± 0.002 e NG 0.009 ± 0.003 d NG Δfae1Δfae2Δhgd 0.009 ± 0.001 e NG 0.009 ± 0.002 d NG Δfae1Δfae2ΔmchΔhgd 0.007 ± 0.001 e NG 0.010 ± 0.003 cd NG ΔxoxF1Sup 0.043 ± 0.004 a 3.40 ± 0.20 0.102 ± 0.019 a 4.04 ± 0.28 ΔxoxF1Sup Δfae1 0.029 ± 0.009 b 1.33 ± 0.05 0.033 ± 0.007 b NG ΔxoxF1Sup Δfae2 0.046 ± 0.005 a 3.45 ± 0.14 0.111 ± 0.006 a 4.20 ± 0.23 ΔxoxF1Sup Δfae1Δfae2 0.025 ± 0.002 bc 1.61 ± 0.06 0.035 ± 0.004 b NG ΔxoxF1Sup Δmch 0.029 ± 0.002 b 0.35 ± 0.08 0.031 ± 0.001 b NG ΔxoxF1Sup Δhgd 0.046 ± 0.002 a 3.62 ± 0.09 0.086 ± 0.010 a 4.44 ± 0.23 ΔxoxF1Sup ΔmchΔhgd 0.014 ± 0.002 c NG 0.017 ± 0.010 b NG ΔxoxF1Sup Δfae1Δfae2Δhgd (FD-3) 0.014 ± 0.006 c NG 0.015 ± 0.005 b NG ΔxoxF1Sup Δfae1Δfae2ΔmchΔhgd (FD-4) 0.015 ± 0.004 c NG 0.019 ± 0.003 b NG

Table 5. (continued)

Methanol +La Methanol -La SGR Groups Yield SGR Groups Yield ΔmxaF 0.094 ± 0.001 a 3.85 ± 0.15 0.021 ± 0.005 a NG ΔmxaFΔfae1 0.023 ± 0.001 c NG 0.021 ± 0.005 a NG ΔmxaFΔfae2 0.088 ± 0.005 a 4.21 ± 0.09 0.020 ± 0.002 a NG ΔmxaFΔfae1Δfae2 0.022 ± 0.001 cd NG 0.016 ± 0.005 a NG ΔmxaFΔmch 0.021 ± 0.001 cd NG 0.019 ± 0.002 a NG ΔmxaFΔhgd 0.078 ± 0.001 b 4.15 ± 0.20 0.024 ± 0.011 a NG ΔmxaFΔmchΔhgd 0.009 ± 0.002 f NG 0.020 ± 0.007 a NG ΔmxaF Δfae1Δfae2Δhgd (FD-3) 0.013 ± 0.003 def NG 0.019 ± 0.002 a NG ΔmxaF Δfae1Δfae2ΔmchΔhgd (FD-4) 0.011 ± 0.003 ef NG 0.021 ± 0.009 a NG ΔmxaF ΔxoxF1Δfae1Δfae2ΔmchΔhgd (FD-5) 0.019 ± 0.003 ce NG 0.024 ± 0.008 a NG ΔmxaF ΔexaFΔfae1Δfae2ΔmchΔhgd (FD-6) 0.013 ± 0.004 ef NG 0.017 ± 0.002 a NG ΔmxaF ΔxoxF1ΔexaFΔfae1Δfae2ΔmchΔhgd (FD-7) 0.014 ± 0.003 def NG 0.012 ± 0.004 a NG

Methanol Succinate +La Methanol Succinate -La SGR Groups Yield SGR Groups Yield WT 0.129 ± 0.010 ab 2.54 ± 0.06 0.155 ± 0.008 a 2.41 ± 0.09 Δfae1 0.088 ± 0.019 bc 2.74 ± 0.17 0.080 ± 0.035 ac 2.62 ± 0.18 Δfae2 0.127 ± 0.002 ab 1.60 ± 0.04 0.111 ± 0.045 ab 1.48 ± 0.04 Δfae1Δfae2 0.100 ± 0.009 ab 2.76 ± 0.15 0.078 ± 0.010 ac 2.72 ± 0.20 Δmch 0.130 ± 0.009 ab 2.09 ± 0.01 0.125 ± 0.021 ab 2.16 ± 0.01 Δhgd 0.137 ± 0.023 bc 3.27 ± 0.13 0.150 ± 0.007 a 3.42 ± 0.32 ΔmchΔhgd 0.035 ± 0.010 e NG 0.047 ± 0.008 bc NG Δfae1Δfae2Δhgd 0.030 ± 0.008 e NG 0.022 ± 0.024 c NG Δfae1Δfae2ΔmchΔhgd 0.067 ± 0.027 cd 1.41 ± 0.24 0.058 ± 0.049 bc 1.48 ± 0.25 ΔxoxF1Sup 0.139 ± 0.011 a 2.02 ± 0.13 0.159 ± 0.044 a 2.58 ± 0.27 ΔxoxF1Sup Δfae1 0.111 ± 0.011 a 2.07 ± 0.27 0.115 ± 0.032 a 2.50 ± 0.29 ΔxoxF1Sup Δfae2 0.140 ± 0.015 a 1.73 ± 0.19 0.159 ± 0.038 a 2.70 ± 0.34 ΔxoxF1Sup Δfae1Δfae2 0.120 ± 0.013 a 2.04 ± 0.21 0.115 ± 0.003 a 2.44 ± 0.33 ΔxoxF1Sup Δmch 0.146 ± 0.015 a 1.72 ± 0.14 0.137 ± 0.010 a 1.83 ± 0.19 ΔxoxF1Sup Δhgd 0.123 ± 0.022 a 2.08 ± 0.11 0.137 ± 0.027 a 3.09 ± 0.22 ΔxoxF1Sup ΔmchΔhgd 0.130 ± 0.011 a 1.32 ± 0.03 0.133 ± 0.013 a 1.33 ± 0.06 ΔxoxF1Sup Δfae1Δfae2Δhgd (FD-3) 0.031 ± 0.006 b NG 0.029 ± 0.020 b NG ΔxoxF1Sup Δfae1Δfae2ΔmchΔhgd (FD-4) 0.131 ± 0.005 a 1.44 ± 0.02 0.141 ± 0.033 a 1.45 ± 0.04

Table 6. (continued)

Methanol Succinate +La Methanol Succinate -La SGR Groups Yield SGR Groups Yield ΔmxaF 0.138 ± 0.013 a 1.73 ± 0.08 0.146 ± 0.010 a 1.36 ± 0.16 ΔmxaFΔfae1 0.131 ± 0.008 a 1.42 ± 0.07 0.131 ± 0.042 a 1.28 ± 0.09 ΔmxaFΔfae2 0.140 ± 0.024 a 1.47 ± 0.09 0.175 ± 0.017 a 1.32 ± 0.08 ΔmxaFΔfae1Δfae2 0.122 ± 0.012 a 1.44 ± 0.09 0.120 ± 0.031 a 1.26 ± 0.08 ΔmxaFΔmch 0.123 ± 0.012 a 2.09 ± 0.01 0.151 ± 0.018 a 1.29 ± 0.08 ΔmxaFΔhgd 0.155 ± 0.013 a 1.50 ± 0.11 0.154 ± 0.005 a 1.26 ± 0.09 ΔmxaFΔmchΔhgd 0.111 ± 0.003 a 0.27 ± 0.05 0.133 ± 0.021 a 1.35 ± 0.06 ΔmxaF Δfae1Δfae2Δhgd (FD-3) 0.141 ± 0.008 a 1.65 ± 0.17 0.129 ± 0.005 a 1.50 ± 0.03 ΔmxaF Δfae1Δfae2ΔmchΔhgd (FD-4) 0.117 ± 0.004 a 0.34 ± 0.03 0.138 ± 0.008 a 1.56 ± 0.04 ΔmxaF ΔxoxF1Δfae1Δfae2ΔmchΔhgd (FD-5) 0.109 ± 0.008 a 1.46 ± 0.04 0.130 ± 0.007 a 1.48 ± 0.02 ΔmxaF ΔexaFΔfae1Δfae2ΔmchΔhgd (FD-6) 0.139 ± 0.023 a 1.46 ± 0.04 0.134 ± 0.019 a 1.54 ± 0.11 ΔmxaF ΔxoxF1ΔexaFΔfae1Δfae2ΔmchΔhgd (FD-7) 0.161 ± 0.024 a 1.44 ± 0.06 0.152 ± 0.056 a 1.43 ± 0.06 58

WT ΔxoxF1Sup ΔmxaF

+La -La +La -La +La -La

++ ++ ++ ++ ++ - Background ++ ++ ++ ++ ++ - - - tr - ++ - Δfae1 ++ ++ ++ ++ ++ - ++ ++ ++ ++ ++ - Δfae2 ++ ++ ++ ++ ++ - - - tr - ++ - Δfae1Δfae2 ++ ++ ++ ++ ++ - - - tr - + - Δmch ++ ++ ++ ++ ++ - ++ ++ ++ ++ ++ - Δhgd ++ ++ ++ ++ ++ - - - - - tr - ΔhgdΔmch - - - - ++ - Δfae1Δfae2Δhgd - - - - tr - (FD-3) - - - - ++ - Δfae1Δfae2ΔhgdΔmch - - - - tr - (FD-4) - - ++ ++ ++ - ΔxoxF1Δfae1Δfae2ΔhgdΔmch tr - n.d n.d n.d n.d (FD-5) ++ - ΔexaFΔfae1Δfae2ΔhgdΔmch tr - n.d n.d n.d n.d (FD-6) ++ - ΔxoxF1ΔexaFΔfae1Δfae2ΔhgdΔmch - - n.d n.d n.d n.d (FD-7) ++ -

Table 8. LC-MS analysis of purified His-tagged MxaF and XoxF

Mascot Mass Matches* Hits Annotation score (Da) MxaF Maq22A_1p33165 methanol dehydrogenase large subunit protein 3154 68,416 175 (118) Maq22A_c05215 methanol dehydrogenase XoxF1 108 66,143 5 (4) Maq22A_1p33180 methanol dehydrogenase small subunit 88 10,470 11 (4) Maq22A_c26865 acetolactate synthase 173 19,455 6 (5) Maq22A_1p31200 urease accessory protein UreE 104 23,667 4 (3) Maq22A_c15075 2-isopropylmalate synthase 45 56,793 2 (1) Maq22A_c12785 aldolase 36 23,688 3 (2) Maq22A_c16490 aldehyde-activating protein 30 18,404 1 (1) Maq22A_c24890 copper chaperone 27 33,029 2 (1) XoxF Maq22A_c05215 methanol dehydrogenase XoxF1 3000 66,143 173 (94) Maq22A_c26865 acetolactate synthase 252 19,455 11 (7) Maq22A_c07450 mannose-6-phosphate isomerase 152 19,562 3 (3) Maq22A_c24890 copper chaperone 134 33,029 12 (9) Maq22A_c20570 nitrile hydratase 107 21,356 4 (3) Maq22A_c15075 2-isopropylmalate synthase 98 56,793 5 (3) Maq22A_c18170 hypothetical protein 72 14,091 4 (3) Maq22A_1p37470 acetoacetyl-CoA reductase 54 25,520 4 (2) Maq22A_c25840 histidine phosphotransferase 43 24,789 2 (2) Maq22A_c03360 elongation factor Tu 32 43,509 1 (1) Maq22A_c16490 aldehyde-activating protein 31 18,404 5 (1) Maq22A_1p31200 urease accessory protein UreE 31 23,667 1 (1) Maq22A_c12785 aldolase 29 23,688 3 (2) * The numbers in the parentheses indicate the number of peptides matched with scores above the threshold.

Table 9. Comparison of XoxF and ExaF enzyme kinetics (Km and Vmax) from various methylotrophic and methanotrophic strains on methanol

and formaldehyde. Vmax unit “U” are referenced as defined by each source.

Substrate ADH Strain Ln Element Km (uM) Vmax Reference Methanol XoxF M. aquaticum 22A La3+ 30 1.19 U/mg This work 3+ Formaldehyde XoxF M. aquaticum 22A La 340 1.24 U/mg This work Methanol XoxF Bradyrhizobium sp. Ce3+ 29 Fitriyanto et al., 2011 Methanol XoxF Bradyrhizobium diazoefficiens Ce3+ 67 12.9 U/mg Wang et al., 2019 USDA110 Methanol XoxF M. fumariolicum SolV La3+, Ce3+, 0.8 ± 0.3 Pol et al., 2014 3+ 3+ Pr , Nd Methanol XoxF M. fumariolicum SolV Eu3+ 3.6 ± 0.4 Jahn et al., 2018 Methanol XoxF M. fumariolicum SolV Eu3+ 0.91 ± 0.24 0.043 ± 0.002 Lumpe et al., 2018 μmol min-1mg-1 Methanol XoxF M. fumariolicum SolV Eu3+, Lu3+ 0.82 ± 0.39 0.020 ± 0.002 Lumpe et al., 2018 μmol min-1mg-1 Methanol XoxF M. fumariolicum SolV Eu3+, La3+ 1.3 ± 0.21 0.151 ± 0.005 Lumpe et al., 2018 μmol min-1mg-1 Methanol XoxF M. extorquens AM1 La3+ 44 5.72 ± 0.13 U/mg Good et al., 2019 Methanol XoxF M. extorquens AM1 Nd3+ 29 2.42 ± 0.03 U/mg Good et al., 2019 Methanol XoxF M. extorquens AM1 La3+ 22 ± 3 1860 ± 110 Featherston et al., 2019 nmol min-1mg-1 Methanol XoxF M. extorquens AM1 Ce3+ 49 ± 11 1290 ± 100 Featherston et al., 2019 nmol min-1mg-1

Table 9. (continued)

Substrate ADH Strain Ln Element Km (uM) Vmax Reference Methanol XoxF M. extorquens AM1 Nd3+ 18 ± 5 560 ± 30 Featherston et al., 2019 nmol min-1mg-1 Methanol ExaF M. extorquens AM1 La3+ 5980 6.6 U/mg Good et al., 2016 Formaldehyde XoxF M. extorquens AM1 La3+ 96 5 ± 0.07 U/mg Good et al., 2019 Formaldehyde XoxF M. extorquens AM1 Nd3+ 133 2.33 ± 0.05 U/mg Good et al., 2019 Formaldehyde ExaF M. extorquens AM1 La3+ 66 8.1 U/mg Good et al., 2016