DOCSLIB.ORG

A Potential Role for Targeted Therapy in a Subset of Metastasizing Adnexal Carcinomas

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Potential Role for Targeted Therapy in a Subset of Metastasizing Adnexal Carcinomas Modern Pathology (2011) 24, 974–982 974 & 2011 USCAP, Inc. All rights reserved 0893-3952/11 $32.00 A potential role for targeted therapy in a subset of metastasizing adnexal carcinomas Dora Dias-Santagata1, Quynh Lam1, Kristin Bergethon1, Gabrielle M Baker1, A John Iafrate1, Dinesh Rakheja2 and Mai P Hoang1 1Department of Pathology, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA and 2Department of Pathology, University of Texas Southwestern Medical School and Children’s Medical Center, Dallas, Texas, USA Metastasizing adnexal carcinomas are rare; thus, currently there is no uniform treatment guideline. Chemotherapeutic drugs that selectively target cancer-promoting pathways may complement conventional therapeutic approaches. We performed immunohistochemistry (epidermal growth factor receptor (EGFR), HER2, and CD117), EGFR and ERBB2 fluorescence in situ hybridization (FISH), and multiplexed SNaPshots genotyping (testing for recurrent mutations in 15 cancer genes including BRAF, EGFR, KRAS, PIK3CA, and TP53) on primary tumors and corresponding metastases of 14 metastasizing adnexal carcinomas (three apocrine, six eccrine, two hidradenocarcinomas, two porocarcinomas, and one aggressive digital papillary adenocarcinoma). Metastasis to regional lymph node was most common, followed by skin and then lungs. Follow-up was available in 12 patients (5 months to 8 years) with 1 died of widespread metastases. Although EGFR overexpression was a prevalent feature in this cohort, seen in 7/11 (64%) primary tumors and 10/14 (71%) metastases; FISH for EGFR gene amplification was negative in 9 tested primary tumors and 12 metastases. FISH of the one primary tumor and three metastases with 2 þ HER2 overexpression revealed a low level of ERBB2 gene amplification in one apocrine carcinoma and corresponding metastasis. CD117 expression was seen only in rare cases. PIK3CA (2/12, 17%) and TP53 (3/12, 25%) mutations were detected in two (one hidradenocarcinoma, one porocarcinoma) and three (one eccrine, one hidradenocarcinoma, and one aggressive digital papillary adenocarcinoma) cases, respectively. The role of EGFR inhibitor therapy in metastasizing adnexal carcinomas with protein overexpression remains unclear. Targeted therapy including PI3K pathway inhibitors might be a potential treatment for rare cases of adnexal carcinomas with metastases. Modern Pathology (2011) 24, 974–982; doi:10.1038/modpathol.2011.48; published online 18 March 2011 Keywords: adnexal neoplasm; EGFR; gene mutation; metastasis; PIK3CA; TP53 Adnexal carcinomas are rare and associated with metastases despite local excision, radiation, and poor prognosis. Currently, there is no uniform chemotherapy. guideline concerning their treatment, especially for Targeted therapy may be a potential treatment those with metastases. Wide surgical excision option in patients whose tumors are characterized remains the treatment of choice; but treatment by a relevant oncogene mutation. In a growing success has been documented only in isolated case number of tumor types including breast and colo- reports.1–3 Three of nine cases of clear cell eccrine rectal and lung cancer, selective agents that target carcinomas reported by Wong et al4 developed critical cancer-promoting pathways are now the treatment of choice for those patients carrying the genetic changes recognized by the drugs.4–7 ERBB2 (v-erb-b2 erythroblastic leukemia viral Correspondence: Dr MP Hoang, MD, Dermatopathology Unit, Massachusetts General Hospital, 55 Fruit Street, Warren 820, oncogene homolog 2) gene amplification and re- Boston, MA 02114, USA. sponse to trastuzumab were documented in a case of E-mail: [email protected] metastasizing hidradenocarcinoma.2 Members of the The results have been presented in part at the 31st Symposium of ERBB receptor tyrosine kinase family, including the International Society of Dermatopathology, Barcelona, Spain epidermal growth factor receptor (EGFR), HER2, on October 2010. Received 16 November 2010; revised 3 January 2011; accepted 4 HER3, and HER4, present possible targeted thera- January 2011; published online 18 March 2011 peutic options.8 The membranous expression of www.modernpathology.org Metastasizing adnexal carcinoma D Dias-Santagata et al 975 these markers has therapeutic implications and Evaluation of the membranous EGFR expression second-generation EGFR tyrosine kinase inhi- was performed using a combined scoring system bitors such as HKI-272, XL647, and BIBW2992 have based on both the staining intensity (0 ¼ no staining, dual activity, inhibiting both EGFR and HER2 1 ¼ weak, 2 ¼ moderate, and 3 ¼ strong staining) receptors.9,10 as well as the percentage of positive cells (0% ¼ 0, Another case of metastasizing clear cell hidrade- o25% ¼ 1, 26–50% ¼ 2, 51–75% ¼ 3, and 475% ¼ 4), nocarcinoma was reported to be stabilized over 8 similar to that outlined by Janisson-Dargaud et al.16 months with Sunitinib treatment, an oral multi- The sum of these two scores yielded a total score from targeted tyrosine kinase inhibitor.3 KIT (CD117) is 0to7(1–3¼ weak and 4–7 ¼ strong). known to be expressed in normal adnexal tissue.11 Overexpression of HER2 was defined as positive Moreover, KIT-activating (v-kit Hardy–Zuckerman 4 membranous staining in 410% of the neoplastic feline sarcoma viral oncogene homolog) mutations cells. Partial and faint, weak or thin, and intense or are reported to be associated with a variety of malig- thick circumferential membrane staining in 410% nant neoplasms and specific chemotherapeutic of the tumor cells were scored as 1 þ (negative), 2 þ agents (imatinib and sorafenib) are available.12,13 (equivocal), and 3 þ (positive), respectively. Evalua- Clinical experience in patients with gastrointestinal tion of CD117-positive cells were recorded as stromal tumor indicates that the presence and o10% ¼ negative, 10–50% ¼ 1 þ , 51–75% ¼ 2 þ , location of specific KIT mutations can predict and 475% ¼ 3 þ .17 sensitivity and resistance patterns to KIT kinase inhibitors.14 To investigate whether metastasizing adnexal Mutational Analysis and EGFR and ERBB2 FISH carcinomas possess activation of oncogenic pathways A SNaPshots genotyping assay recently developed that can be targeted by available chemotherapeutic by our group was performed on primary tumors and agent, we performed immunohistochemistry for corresponding metastases of 14 metastasizing EGFR, HER2, and CD117 (KIT) expression; fluores- adnexal carcinomas with available archival materi- cence in situ hybridization (FISH) for EGFR and als.15 This assay consists of multiplexed PCR ERBB2 gene amplification; and molecular analyses followed by a single-base extension reaction and for recurrent mutations in 15 cancer genes including uses the commercially available SNaPshot platform BRAF, EGFR, KRAS, PIK3CA,andTP53 on cases of (Applied Biosystems). The original tumor geno- adnexal carcinomas with metastases.15 typing panel described by Dias-Santagata et al15 was expanded to include three additional assays Materials and methods (AKT1.49, testing for the AKT1 E17K mutation; IDH1.394 and IDH1.395, testing for hotspot muta- The study has been approved by the Massachusetts tions in IDH1, which affect codon R132). The full General Hospital institutional review board (IRB No. panel and tests for common mutations in 15 cancer 2009P001738). Archival materials of all metastasiz- genes are outlined in Table 1. SNaPshots genotyp- ing adnexal carcinomas including aggressive digital ing was performed using previously described papillary adenocarcinoma, apocrine carcinomas, conditions,15 and included the following additional eccrine ductal carcinoma, hidradenocarcinoma, primers for AKT1 and IDH1 (PCR: AKT1 exon 3 and porocarcinoma, diagnosed between 1987 and Forward, 50-ACGTTGGATGGGTAGAGTGTGCGTGG 2010 were retrieved from the pathology files of the CTCT-30; AKT1 exon 3 Reverse, 50-ACGTTGGATGA Massachusetts General Hospital, Boston, MA, USA. GGTGCCATCATTCTTGAGG-30; IDH1 exon 4 Forward, Age, gender, tumor site, tumor size, and clinical 50-ACGTTGGATGGGCTTGTGAGTGGATGGGTA-30, follow-up information (such as local recurrence IDH1 exon 4 Reverse 50-ACGTTGGATGgcaaaatcaca or metastasis) were extracted from the patients’ ttattgccaac-30. Extension: AKT1.49 extR 50-CTGACT medical records. All patient data were de-identified. GACTGACTGACTGACTGACTGACTGACTGACTG The histological sections of all cases were ACTGACTGACTGACTGACTGACTGACTGACTGA re-examined and the diagnoses were confirmed. GCCAGGTCTTGATGTACT-30IDH1.394 extR 50-GA CTGACTGGACTGACTGACTGACTGACTGGACTG ACTGACTGAGATCCCCATAAGCATGAC-30, IDH1.395 Immunohistochemistry extR 50-TGATCCCCATAAGCATGA-30). EGFR gene copy number was assessed in 9 primary tumors and Immunohistochemical studies were performed on 12 metastases by FISH as previously published.18 5-mm-thick sections of formalin-fixed, paraffin- ERBB2 gene copy number was also assessed in four embedded tissue, using the standard techniques, cases with HER2 IHC overexpression. heat-induced epitope retrieval buffer, and primary antibodies against CD117 (1:200, Dakocytomation, Carpinteria, CA, USA), EGFR (3C6, 1:2, Ventana Results Medical Systems, Tucson, AZ, USA), and HER2 (4B5, predilute, Ventana Medical Systems). Appro- A total of 14 cases were identified: 3 apocrine carci- priate positive and negative controls were included. nomas, 6 eccrine ductal carcinomas, 2 hidradeno- Modern Pathology (2011) 24, 974–982 Metastasizing adnexal carcinoma 976 D Dias-Santagata et al Table 1 SNaPshots mutational assays15 Gene Amino acid–cDNA
Load more

Recommended publications
  • Promoter Janus Kinase 3 Proximal Characterization and Analysis Of
    The Journal of Immunology Characterization and Analysis of the Proximal Janus Kinase 3 Promoter1 Martin Aringer,2*† Sigrun R. Hofmann,2* David M. Frucht,* Min Chen,* Michael Centola,* Akio Morinobu,* Roberta Visconti,* Daniel L. Kastner,* Josef S. Smolen,† and John J. O’Shea3* Janus kinase 3 (Jak3) is a nonreceptor tyrosine kinase essential for signaling via cytokine receptors that comprise the common ␥-chain (␥c), i.e., the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. Jak3 is preferentially expressed in hemopoietic cells and is up-regulated upon cell differentiation and activation. Despite the importance of Jak3 in lymphoid development and immune function, the mechanisms that govern its expression have not been defined. To gain insight into this issue, we set out to characterize the Jak3 promoter. The 5؅-untranslated region of the Jak3 gene is interrupted by a 3515-bp intron. Upstream of this intron and the transcription initiation site, we identified an ϳ1-kb segment that exhibited lymphoid-specific promoter activity and was responsive to TCR signals. Truncation of this fragment revealed that core promoter activity resided in a 267-bp fragment that contains putative Sp-1, AP-1, Ets, Stat, and other binding sites. Mutation of the AP-1 sites significantly diminished, whereas mutation of the Ets sites abolished, the inducibility of the promoter construct. Chromatin immunoprecipitation assays showed that histone acetylation correlates with mRNA expression and that Ets-1/2 binds this region. Thus, transcription factors that bind these sites, especially Ets family members, are likely to be important regulators of Jak3 expression.
    [Show full text]
  • Atypical Compound Nevus Arising in Mature Cystic Ovarian Teratoma
    J Cutan Pathol 2005: 32: 71–123 Copyright # Blackwell Munksgaard 2005 Blackwell Munksgaard. Printed in Denmark Journal of Cutaneous Pathology Abstracts of the Papers Presented at the 41st Annual Meeting of The American Society of Dermatopathology Westin Copley Place Boston, Massachusetts, USA October 14–17, 2004 These abstracts were presented in oral or poster format at the 41st Annual Meeting of The American Society of Dermatopathology on October 14–17, 2004. They are listed on the following pages in alphabetical order by the first author’s last name. 71 Abstracts IN SITU HYBRIDIZATION IS A VALUABLE DIAGNOSTIC A 37-year-old woman with diagnosis of Sjogren’s syndrome (SS) TOOL IN CUTANEOUS DEEP FUNGAL INFECTIONS presented with asymptomatic non-palpable purpura of the lower J.J. Abbott1, K.L. Hamacher2,A.G.Bridges2 and I. Ahmed1,2 extremities. Biopsy of a purpuric macule revealed a perivascular Departments of Laboratory Medicine and Pathology1 and and focally nodular lymphocytic infiltrate with large numbers of Dermatology2, plasma cells, seemingly around eccrine glands. There was no vascu- litis. The histologic findings in the skin were strikingly similar to those Mayo Clinic and Mayo Foundation, Rochester, MN, USA of salivary, parotid, and other ‘‘secretory’’ glands affected in SS. The cutaneous manifestations of SS highlighted in textbooks include Dimorphic fungal infections (histoplasmosis, blastomycosis, coccidiomy- xerosis, annular erythema, small-vessel vasculitis, and pigmented cosis, and cryptococcosis) can occur in immunocompromised and purpura. This case illustrates that purpura in skin of patients with healthy individuals. Cutaneous involvement is often secondary and SS may be caused by a peri-eccrine plasma-rich infiltrate.
    [Show full text]
  • Malignant Hidradenoma: a Report of Two Cases and Review of the Literature
    ANTICANCER RESEARCH 26: 2217-2220 (2006) Malignant Hidradenoma: A Report of Two Cases and Review of the Literature I.E. LIAPAKIS1, D.P. KORKOLIS2, A. KOUTSOUMBI3, A. FIDA3, G. KOKKALIS1 and P.P. VASSILOPOULOS2 1Department of Plastic and Reconstructive Surgery, 2First Department of Surgical Oncology and 3Department of Surgical Pathology, Hellenic Anticancer Institute, "Saint Savvas" Hospital, Athens, Greece Abstract. Introduction: Malignant tumors of the sweat glands difficult (1). Clear cell hidradenoma is an extremely rare are very rare. Clear cell hidradenoma is a lesion with tumor with less than 50 cases reported (2, 3). histopathological features resembling those of eccrine poroma The cases of two patients, suffering from aggressive and eccrine spiradenoma. The biological behavior of the tumor dermal lesions invading the abdominal wall and the axillary is aggressive, with local recurrences reported in more than 50% region, are described here. Surgical resection and of the surgically-treated cases. Materials and Methods: Two histopathological examination ascertained the presence of patients are presented, the first with tumor in the right axillary malignant clear cell hidradenoma. In addition to these region, the second with a recurrent tumor of the abdominal cases, a review of the literature is also presented. wall. The first patient underwent wide excision with clear margins and axillary lymph node dissection and the second Case Reports patient underwent wide excision of the primary lesion and bilateral inguinal node dissection due to palpable nodes. Patient 1. Patient 1 was a 68-year-old Caucasian male who had Results: The patients had uneventful postoperative courses. No undergone excision of a rapidly growing, ulcerous lesion of the additional treatment was administered.
    [Show full text]
  • Genomic Landscape of a Metastatic Malignant Proliferating Tricholemmal Tumor and Its Response to PI3K Inhibition
    www.nature.com/npjprecisiononcology CASE REPORT OPEN Genomic landscape of a metastatic malignant proliferating tricholemmal tumor and its response to PI3K inhibition Jean-Nicolas Gallant1, Andrew Sewell2,8, Karinna Almodovar1, Qingguo Wang3,9, Kimberly B. Dahlman1, Richard G. Abramson4, Meghan E. Kapp5, Brandee T. Brown2, Kelli L. Boyd5, Jill Gilbert1, Daniel N. Cohen5,10, Wendell G. Yarbrough2,9,6, Zhongming Zhao 3,7,11 and Christine M. Lovly1,7 Proliferating tricholemmal tumors (PTTs) are rare benign neoplasms that arise from the outer sheath of a hair follicle. Occasionally, these PTTs undergo malignant transformation to become malignant proliferating tricholemmal tumors (MPTTs). Little is known about the molecular alterations, malignant progression, and management of MPTTs. Here, we describe the case of a 58-year-old female that had a widely metastatic MPTT that harbored an activating PIK3CA mutation and was sensitive to the PI3K inhibitor, alpelisib (BYL719). We review the available literature on metastatic MPTT, detail the patient’s course, and present a whole genome analysis of this rare tumor. npj Precision Oncology (2019) 3:5 ; https://doi.org/10.1038/s41698-019-0077-2 INTRODUCTION posterior scalp cyst for cosmesis. This non-inflamed, non-draining, Proliferating tricholemmal tumors (PTTs) are benign neoplasms of painless, 1–2 cm cyst had been present for close to 10 years the external hair sheath.1 PTTs have the potential for malignant without change in size or fluctuance. The cyst was initially drained transformation, and, when characterized by cytologic atypia, by the PCP, but, when it recurred 6 months later, the PCP excised abnormal mitoses, and infiltrating margins, are termed malignant the cyst and sent the specimen for routine pathology.
    [Show full text]
  • Malignant Nodular Hidradenoma-Inguinal Region Clinically Masquerading As Squamous Cell Carcinoma: a Case Report
    International Journal of Research in Medical Sciences Vernekar S et al. Int J Res Med Sci. 2019 Jul;7(7):2848-2852 www.msjonline.org pISSN 2320-6071 | eISSN 2320-6012 DOI: http://dx.doi.org/10.18203/2320-6012.ijrms20192933 Case Report Malignant nodular hidradenoma-inguinal region clinically masquerading as squamous cell carcinoma: a case report Sunita S. Vernekar, Priyadharshini Bargunam* Department of Pathology, Karnataka Institute of Medical Sciences, Hubballi, Karnataka, India Received: 24 April 2019 Accepted: 05 June 2019 *Correspondence: Dr. Priyadharshini Bargunam, E-mail: [email protected] Copyright: © the author(s), publisher and licensee Medip Academy. This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. ABSTRACT Malignant Nodular hidradenoma is an extremely rare aggressive tumour originating from eccrine sweat glands with an incidence of <.001%. So far less than 80 cases have been reported in the literature. It’s known for its local recurrence (50%) and metastasis (60%) and hence early diagnosis and radical treatment is mandatory. But differentiating it from its benign counterparts and other skin tumour mimics is challenging, due to its histopathological similarity & lack of diagnostic immunomarkers. Authors report a case of 65-year-old female who presented with a short 4-month history of rapidly growing ulceroproliferative growth in the right inguinal region with bilateral inguinal node enlargement, associated with pain and discharge. Wedge biopsy of left inguinal lymph node showed malignant cutaneous adnexal tumour deposits, which after excision was typed as malignant nodular hidradenoma.
    [Show full text]
  • Sample Research Poster
    Surgical management and lymph node biopsy of rare malignant cutaneous adnexal carcinomas: a population-based analysis of 7591 patients Amrita Goyal MD, 1 Theodore Marghitu,2 Nikhil Goyal BS,3 Nathan Rubin MS,4 Krishnan Patel MD,6 Kavita Goyal MD,1 Daniel O’Leary MD,5 Kimberly Bohjanen MD, 1 Ian Maher MD 1 1Department of Dermatology, University of Minnesota, Minneapolis, MN 2University of Minnesota Medical School, Minneapolis, MN 3National Institutes of Health/National Cancer Institute, Bethesda, MD 4Biostatistics Core, Masonic Cancer Center, University of Minnesota, Minneapolis MN 5Division of Hematology, Oncology, and Transplantation, Department of Medicine, University of Minnesota, Minneapolis, MN 6Department of Radiation Oncology, University of Minnesota, Minneapolis, MN Background Overall and Disease-Specific Survival Lymph Node Biopsy and Survival Cutaneous adnexal carcinomas comprise a group of Vital status* All Sweat Hidradenocarc Spiradenocarci Sclerosin Porocarcin Eccrine Sebaceous Lymph Nodes All adnexal tumors adnexal gland inoma noma g sweat oma adenocarci carcinoma Lymph Nodes Examined carcino duct noma Nodes not examined 6592 (91.9) rare cutaneous malignancies that are generally ma tumor Nodes examined 578 (8.1) (MAC) Positive (% of examined) 138 (23.9) considered non-aggressive. Guidelines for the Stage (Derived AJCC N=1863 N=70 N=127 N=46 N=236 N=229 N=187 N=968 Negative (% of examined) 440 (76.1) Stage Group, 6th ed treatment of many of these malignancies are sparse, (2004-2015) Total N=1221 5-year OS 5-year DSS 1,2 I 1221 40 (57.1) 56 (44.1) 14 (30.4) 150 140 (61.1) 103 (55.1) 718 (74.2) Stage I Examined N=112 including guidance on surgical management (65.5) (63.6) Nodes not examined (% of total) 1109 (90.8) 69.7 (66.1-72.4) 99.3 (99.6-100) 3,4 II 440 14 (20.0) 54 (47.5) 28 (60.9) 47 (19.9) 64 (27.9) 51 (27.3) 182 (18.8) Nodes positive (% of examined) 0 (0) -- -- including the utility of lymph node biopsy.
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • Adnexal Tumors
    10/24/2019 What’s a gland like you doing in a place like this? A practical approach to cutaneous adnexal neoplasms Hafeez Diwan, MD, PhD Departments of Pathology & Immunology and Dermatology Baylor College of Medicine 1 Conflict of interest • None 2 Disclosures • I have nothing to disclose 3 1 10/24/2019 Is the adnexal neoplasm glandular? And if so, where is it located? • Hands and Feet: Digital papillary adenocarcinoma 4 5 6 2 10/24/2019 7 8 Digital Papillary Adenocarcinoma • Solitary • Fingers/toes/palms/soles • Recurrence/metastases 9 3 10/24/2019 10 11 12 4 10/24/2019 3 Points about digital papillary adenocarcinoma • 1. Atypia doesn’t matter – if there is no atypia, it doesn’t mean that it isn’t digital papillary adenocarcinoma 13 3 Points about digital papillary adenocarcinoma • 1. Atypia doesn’t matter – if there is no atypia, it doesn’t mean that it isn’t digital papillary adenocarcinoma • 2. How high can the glandular lesion go up the extremity? • Example of one case that occurred on the thigh? (Alomari A, Douglas S, Galan A, Narayan D, Ko C. Atypical Presentation of digital papillary adenocarcinoma (abstract) J Cutan Pathol. 2014;41:221) 14 3 Points about digital papillary adenocarcinoma (cont’d) • 3. What if you don’t see glands • Hidradenoma on hands and feet • Hunt for a gland? If you see a gland, then what? • Probably best to err on the side of caution and say that a digital papillary adenocarcinoma is not ruled out 15 5 10/24/2019 16 17 18 6 10/24/2019 19 20 21 7 10/24/2019 3 Points about digital papillary adenocarcinoma (cont’d) • 3.
    [Show full text]
  • Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
    Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene,
    [Show full text]
  • Crystal Structure of the Jak3 Kinase Domain in Complex with a Staurosporine Analog
    From www.bloodjournal.org by guest on September 11, 2016. For personal use only. TRANSPLANTATION Crystal structure of the Jak3 kinase domain in complex with a staurosporine analog Titus J. Boggon, Yiqun Li, Paul W. Manley, and Michael J. Eck Jak (Janus kinase) family nonreceptor target for development of lymphocyte- tion of the activation loop. Such a direct tyrosine kinases are central mediators of specific immunosuppressants. Here, we coupling has not been previously ob- cytokine signaling. The Jak kinases ex- present the crystal structure of the Jak3 served in tyrosine kinases and may be hibit distinct cytokine receptor associa- kinase domain in complex with stauro- unique to Jak kinases. The crystal struc- tion profiles and so transduce different sporine analog AFN941. The kinase do- ture provides a detailed view of the Jak3 signals. Jak3 expression is limited to the main is in the active conformation, with active site and will facilitate computa- immune system, where it plays a key role both activation loop tyrosine residues tional and structure-directed approaches in signal transduction from cytokine re- phosphorylated. The phosphate group on to development of Jak3-specific inhibi- ceptors containing the common gamma- pTyr981 in the activation loop is in part tors. (Blood. 2005;106:996-1002) chain, ␥c. Patients unable to signal via ␥c coordinated by an arginine residue in the present with severe combined immunode- regulatory C-helix, suggesting a direct ficiency (SCID). The finding that Jak3 mechanism by which the active position mutations result in SCID has made it a of the C-helix is induced by phosphoryla- © 2005 by The American Society of Hematology Introduction The Janus kinase (Jak) family of cytoplasmic tyrosine kinases are regulation of diverse cell processes, including proliferation, differ- essential for signal transduction from a wide variety of cell-surface entiation, migration, and apoptosis.1,2 receptors.
    [Show full text]
  • JAK3 Deficiency, (SCID T-B+)
    JAK3 deficiency, (SCID T-B+) Author: Professor Luigi D. Notarangelo1,2 Creation Date: November 2001 Update: January 2005 1member of the European editorial committee of Orphanet encyclopedia 2Department of Pediatrics, University of Brescia, Spedali Civil, 25123 Brescia, Italy. [email protected] Abstract Keywords Diagnosis criteria/definition Differential diagnosis Prevalence Clinical description Treatment Etiology Diagnostic methods Genetic counseling Antenatal diagnosis Unresolved questions References Abstract JAK3 (Janus Kinase 3) deficiency is an autosomal recessive form of severe combined immune deficiency (SCID). It is characterized by lack of circulating T and NK (Natural Killer) cells and normal number of B lymphocytes. The disease is due to mutations in the JAK3 gene encoding an intracellular tyrosine kinase that is physically and functionally coupled with several cytokine receptors. Identification of gene anomalies has allowed physicians to make the diagnosis (even prenatal), and may prompt novel forms of treatment based on gene therapy. Although a relatively low number of JAK3-deficient subjects have been diagnosed, JAK3 deficiency represents an important cause of autosomal recessive SCID in the United States and its prevalence in Europe appears to be even higher. However it is considered as a rare disease (incidence is between 1/100,000 and 1/1,000,000 live births). JAK3-deficient patients present with the classical clinical features of SCID in the first few months of life, i.e. chronic diarrhea, failure to thrive, recurrent respiratory infection and/or generalized infections from opportunistic pathogens, or signs of graft-versus-host reaction (skin rash, abnormalities of liver function, pancytopenia) from transplacental acquired maternal T cells.
    [Show full text]
  • Malignant Nodular Hidradenocarcinoma Arising on The
    genesi ino s & rc a M C u t f a o g l Journal of Carcinogenesis & e Giorgini et al., J Carcinogene Mutagene 2012, 3:1 a n n e r s DOI: 4172/2157-2518.1000129 u i s o J Mutagenesis ISSN: 2157-2518 ReviewResearch Article Article OpenOpen Access Access Malignant Nodular Hidradenocarcinoma Arising on the Areola of a Male Patient: Case Report of an “Orphan Disease” and Review of the Literature Eleonora Giorgini1*, Gregorio Tugnoli1, Silvia Aprile1, Guido Collina2, Silvia Villani1, Andrea Biscardi1,Simone Maggioli1, Eli Avisar3 and Salomone Di Saverio1 1Department of Emergency & Surgery, Maggiore Hospital, Bologna Local Health District Largo Nigrisoli 2, 40100 Bologna, Emergency Surgery and Trauma Surgery Unit, Italy 2Department of Pathology, Maggiore Hospital, Bologna Local Health District Largo Nigrisoli 2, 40100 Bologna, Italy 3Department of Surgery, Sylvester Comprehensive Cancer Center, Miller School of Medicine, University of Miami, UM/SCCC 1475 NW 12th Avenue, Rm, 3550, Miami, FL ZIP 33136, USA Abstract Herein we describe a rare case of an “orphan” neoplasm arising on an unusual site. During the clinical examination, a mass of 3 cm was found on the left areola of a male patient. It was a solid, sliding on the deep layer, with a bluish color mass; therefore an excisional biopsy was performed. The histopathological diagnosis was nodular malignant hidradenoma. An oncological consulting recommended a surgical radicalization through a radical mastectomy. No adjuvant therapy has been given. The patient is alive with no evidence of disease after one-year follow up. Keywords: Male breast cancer; Eccrine gland-derived carcinoma; highly vascularized.
    [Show full text]