Modern Pathology (2011) 24, 974–982 974 & 2011 USCAP, Inc. All rights reserved 0893-3952/11 $32.00 A potential role for targeted therapy in a subset of metastasizing adnexal carcinomas Dora Dias-Santagata1, Quynh Lam1, Kristin Bergethon1, Gabrielle M Baker1, A John Iafrate1, Dinesh Rakheja2 and Mai P Hoang1 1Department of Pathology, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA and 2Department of Pathology, University of Texas Southwestern Medical School and Children’s Medical Center, Dallas, Texas, USA Metastasizing adnexal carcinomas are rare; thus, currently there is no uniform treatment guideline. Chemotherapeutic drugs that selectively target cancer-promoting pathways may complement conventional therapeutic approaches. We performed immunohistochemistry (epidermal growth factor receptor (EGFR), HER2, and CD117), EGFR and ERBB2 fluorescence in situ hybridization (FISH), and multiplexed SNaPshots genotyping (testing for recurrent mutations in 15 cancer genes including BRAF, EGFR, KRAS, PIK3CA, and TP53) on primary tumors and corresponding metastases of 14 metastasizing adnexal carcinomas (three apocrine, six eccrine, two hidradenocarcinomas, two porocarcinomas, and one aggressive digital papillary adenocarcinoma). Metastasis to regional lymph node was most common, followed by skin and then lungs. Follow-up was available in 12 patients (5 months to 8 years) with 1 died of widespread metastases. Although EGFR overexpression was a prevalent feature in this cohort, seen in 7/11 (64%) primary tumors and 10/14 (71%) metastases; FISH for EGFR gene amplification was negative in 9 tested primary tumors and 12 metastases. FISH of the one primary tumor and three metastases with 2 þ HER2 overexpression revealed a low level of ERBB2 gene amplification in one apocrine carcinoma and corresponding metastasis. CD117 expression was seen only in rare cases. PIK3CA (2/12, 17%) and TP53 (3/12, 25%) mutations were detected in two (one hidradenocarcinoma, one porocarcinoma) and three (one eccrine, one hidradenocarcinoma, and one aggressive digital papillary adenocarcinoma) cases, respectively. The role of EGFR inhibitor therapy in metastasizing adnexal carcinomas with protein overexpression remains unclear. Targeted therapy including PI3K pathway inhibitors might be a potential treatment for rare cases of adnexal carcinomas with metastases. Modern Pathology (2011) 24, 974–982; doi:10.1038/modpathol.2011.48; published online 18 March 2011 Keywords: adnexal neoplasm; EGFR; gene mutation; metastasis; PIK3CA; TP53 Adnexal carcinomas are rare and associated with metastases despite local excision, radiation, and poor prognosis. Currently, there is no uniform chemotherapy. guideline concerning their treatment, especially for Targeted therapy may be a potential treatment those with metastases. Wide surgical excision option in patients whose tumors are characterized remains the treatment of choice; but treatment by a relevant oncogene mutation. In a growing success has been documented only in isolated case number of tumor types including breast and colo- reports.1–3 Three of nine cases of clear cell eccrine rectal and lung cancer, selective agents that target carcinomas reported by Wong et al4 developed critical cancer-promoting pathways are now the treatment of choice for those patients carrying the genetic changes recognized by the drugs.4–7 ERBB2 (v-erb-b2 erythroblastic leukemia viral Correspondence: Dr MP Hoang, MD, Dermatopathology Unit, Massachusetts General Hospital, 55 Fruit Street, Warren 820, oncogene homolog 2) gene amplification and re- Boston, MA 02114, USA. sponse to trastuzumab were documented in a case of E-mail: [email protected] metastasizing hidradenocarcinoma.2 Members of the The results have been presented in part at the 31st Symposium of ERBB receptor tyrosine kinase family, including the International Society of Dermatopathology, Barcelona, Spain epidermal growth factor receptor (EGFR), HER2, on October 2010. Received 16 November 2010; revised 3 January 2011; accepted 4 HER3, and HER4, present possible targeted thera- January 2011; published online 18 March 2011 peutic options.8 The membranous expression of www.modernpathology.org Metastasizing adnexal carcinoma D Dias-Santagata et al 975 these markers has therapeutic implications and Evaluation of the membranous EGFR expression second-generation EGFR tyrosine kinase inhi- was performed using a combined scoring system bitors such as HKI-272, XL647, and BIBW2992 have based on both the staining intensity (0 ¼ no staining, dual activity, inhibiting both EGFR and HER2 1 ¼ weak, 2 ¼ moderate, and 3 ¼ strong staining) receptors.9,10 as well as the percentage of positive cells (0% ¼ 0, Another case of metastasizing clear cell hidrade- o25% ¼ 1, 26–50% ¼ 2, 51–75% ¼ 3, and 475% ¼ 4), nocarcinoma was reported to be stabilized over 8 similar to that outlined by Janisson-Dargaud et al.16 months with Sunitinib treatment, an oral multi- The sum of these two scores yielded a total score from targeted tyrosine kinase inhibitor.3 KIT (CD117) is 0to7(1–3¼ weak and 4–7 ¼ strong). known to be expressed in normal adnexal tissue.11 Overexpression of HER2 was defined as positive Moreover, KIT-activating (v-kit Hardy–Zuckerman 4 membranous staining in 410% of the neoplastic feline sarcoma viral oncogene homolog) mutations cells. Partial and faint, weak or thin, and intense or are reported to be associated with a variety of malig- thick circumferential membrane staining in 410% nant neoplasms and specific chemotherapeutic of the tumor cells were scored as 1 þ (negative), 2 þ agents (imatinib and sorafenib) are available.12,13 (equivocal), and 3 þ (positive), respectively. Evalua- Clinical experience in patients with gastrointestinal tion of CD117-positive cells were recorded as stromal tumor indicates that the presence and o10% ¼ negative, 10–50% ¼ 1 þ , 51–75% ¼ 2 þ , location of specific KIT mutations can predict and 475% ¼ 3 þ .17 sensitivity and resistance patterns to KIT kinase inhibitors.14 To investigate whether metastasizing adnexal Mutational Analysis and EGFR and ERBB2 FISH carcinomas possess activation of oncogenic pathways A SNaPshots genotyping assay recently developed that can be targeted by available chemotherapeutic by our group was performed on primary tumors and agent, we performed immunohistochemistry for corresponding metastases of 14 metastasizing EGFR, HER2, and CD117 (KIT) expression; fluores- adnexal carcinomas with available archival materi- cence in situ hybridization (FISH) for EGFR and als.15 This assay consists of multiplexed PCR ERBB2 gene amplification; and molecular analyses followed by a single-base extension reaction and for recurrent mutations in 15 cancer genes including uses the commercially available SNaPshot platform BRAF, EGFR, KRAS, PIK3CA,andTP53 on cases of (Applied Biosystems). The original tumor geno- adnexal carcinomas with metastases.15 typing panel described by Dias-Santagata et al15 was expanded to include three additional assays Materials and methods (AKT1.49, testing for the AKT1 E17K mutation; IDH1.394 and IDH1.395, testing for hotspot muta- The study has been approved by the Massachusetts tions in IDH1, which affect codon R132). The full General Hospital institutional review board (IRB No. panel and tests for common mutations in 15 cancer 2009P001738). Archival materials of all metastasiz- genes are outlined in Table 1. SNaPshots genotyp- ing adnexal carcinomas including aggressive digital ing was performed using previously described papillary adenocarcinoma, apocrine carcinomas, conditions,15 and included the following additional eccrine ductal carcinoma, hidradenocarcinoma, primers for AKT1 and IDH1 (PCR: AKT1 exon 3 and porocarcinoma, diagnosed between 1987 and Forward, 50-ACGTTGGATGGGTAGAGTGTGCGTGG 2010 were retrieved from the pathology files of the CTCT-30; AKT1 exon 3 Reverse, 50-ACGTTGGATGA Massachusetts General Hospital, Boston, MA, USA. GGTGCCATCATTCTTGAGG-30; IDH1 exon 4 Forward, Age, gender, tumor site, tumor size, and clinical 50-ACGTTGGATGGGCTTGTGAGTGGATGGGTA-30, follow-up information (such as local recurrence IDH1 exon 4 Reverse 50-ACGTTGGATGgcaaaatcaca or metastasis) were extracted from the patients’ ttattgccaac-30. Extension: AKT1.49 extR 50-CTGACT medical records. All patient data were de-identified. GACTGACTGACTGACTGACTGACTGACTGACTG The histological sections of all cases were ACTGACTGACTGACTGACTGACTGACTGACTGA re-examined and the diagnoses were confirmed. GCCAGGTCTTGATGTACT-30IDH1.394 extR 50-GA CTGACTGGACTGACTGACTGACTGACTGGACTG ACTGACTGAGATCCCCATAAGCATGAC-30, IDH1.395 Immunohistochemistry extR 50-TGATCCCCATAAGCATGA-30). EGFR gene copy number was assessed in 9 primary tumors and Immunohistochemical studies were performed on 12 metastases by FISH as previously published.18 5-mm-thick sections of formalin-fixed, paraffin- ERBB2 gene copy number was also assessed in four embedded tissue, using the standard techniques, cases with HER2 IHC overexpression. heat-induced epitope retrieval buffer, and primary antibodies against CD117 (1:200, Dakocytomation, Carpinteria, CA, USA), EGFR (3C6, 1:2, Ventana Results Medical Systems, Tucson, AZ, USA), and HER2 (4B5, predilute, Ventana Medical Systems). Appro- A total of 14 cases were identified: 3 apocrine carci- priate positive and negative controls were included. nomas, 6 eccrine ductal carcinomas, 2 hidradeno- Modern Pathology (2011) 24, 974–982 Metastasizing adnexal carcinoma 976 D Dias-Santagata et al Table 1 SNaPshots mutational assays15 Gene Amino acid–cDNA