P4HA2 Promotes Cell Proliferation and Migration in Glioblastoma

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ONCOLOGY LETTERS 22: 601, 2021 P4HA2 promotes cell proliferation and migration in glioblastoma YUYING WU1, XUNRUI ZHANG2, JUE WANG1, RUIJIE JI1,2, LEI ZHANG1, JIANBING QIN1, MEILING TIAN1, GUOHUA JIN1 and XINHUA ZHANG1 1Department of Anatomy, Medical School and Co‑innovation Center of Neuroregeneration, Nantong University, Nantong, Jiangsu 226001; 2Department of Clinical Medicine, Faculty of Medicine, Xinglin College, Nantong University, Nantong, Jiangsu 226008, P.R. China Received October 16, 2020; Accepted April 8, 2021 DOI: 10.3892/ol.2021.12862 Abstract. Glioblastoma (GBM) is a primary malignant tumor assays demonstrated that the cell proliferation and migration characterized by high infiltration and angiogenesis in the brain increased after P4HA2 overexpression and decreased after parenchyma. Glioma stem cells (GSCs), a heterogeneous GBM P4HA2‑knockdown. In conclusion, the present study demon‑ cell type with the potential for self‑renewal and differentia‑ strated that low P4HA2 expression in GSCs promoted GBM tion to tumor cells, are responsible for the high malignancy of cell proliferation and migration, suggesting that P4HA2 may GBM. The purpose of the present study was to investigate the act as a switch in the transition from GSCs to GBM cells. roles of significantly differentially expressed genes between GSCs and GBM cells in GBM progression. The gene profiles Introduction GSE74304 and GSE124145, containing 10 GSC samples and 12 GBM samples in total, were obtained from the Gene Glioma, the most common primary malignant brain tumor in Expression Omnibus (GEO) database. The overlapping differ‑ the central nervous system, is characterized by a high degree entially expressed genes were identified with GEO2R tools of angiogenesis (1). Among gliomas, glioblastoma (GBM) is and Venn software online. Subsequently, Gene Ontology and the most malignant type, with a median survival time of only Kyoto Encyclopedia of Genes and Genomes pathway analysis 12‑15 months (2,3). Considerable heterogeneity exists among was performed on the 41 upregulated and 142 downregulated tumor cells, and the cell types, gene expression patterns and differentially expressed genes in GSCs compared with in cell proliferation potential can vary (4). One type of tumor GBM cells via the DAVID website. Protein‑protein interaction cells, known as cancer stem cells, have the characteristics of and module analyses in Cytoscape with the STRING database stem cells, which can proliferate indefinitely, produce tumor revealed 21 hub genes that were downregulated in GSCs cells and drive tumor progression, as well as having important compared with in GBM cells. Survival analysis conducted effects on tumor recurrence, metastasis and chemoradio‑ via the GEPIA2 website revealed that low expression levels therapy resistance (5). These cells in GBM are called glioma of the hub genes prolyl 4‑hydroxylase subunit α2 (P4HA2), stem cells (GSCs). GSCs have the potential for self‑renewal TGF‑β induced, integrin subunit α3 and thrombospondin 1 and multidirectional differentiation, and also promote tumor were associated with significantly prolonged survival time angiogenesis, trigger immune escape and drive the occurrence in patients with GBM. Further experiments were performed and development of GBM (6). These cells are at the root of the focusing on P4HA2. Reverse transcription‑quantitative PCR continuous cell proliferation, high invasion, infiltration, metas‑ was used to detect P4HA2 gene expression. In agreement with tasis and treatment resistance observed in GBM (7). Therefore, the bioinformatics analysis, P4HA2 expression was higher therapies targeting GSCs have shown great potential and have in U87 cells than in GSCs. Cell Counting Kit‑8, EdU incor‑ been at the forefront of GBM research. At present, although poration, cell cycle analysis, wound healing and Transwell many GSC‑associated markers, such as CD133 and A2B5, and the signaling pathways regulating the stemness of GSCs have been revealed (8), the mechanism underlying the continuous conversion of GSCs to GBM cells remains unclear. The present study selected two gene microarrays from Correspondence to: Professor Xinhua Zhang, Department the Gene Expression Omnibus (GEO) database to detect the of Anatomy, Medical School and Co‑innovation Center of Neuroregeneration, Nantong University, 19 Qixiu Road, Nantong, mRNA expression levels in GSCs and GBM cells and to Jiangsu 226001, P.R. China analyze the overlapping differentially expressed genes (DEGs) E‑mail: [email protected] between the two types of cells. Subsequently, the genes that may play an essential role in the malignant progression of Key words: bioinformatics analysis, glioblastoma, glioma stem human GBM were obtained through bioinformatics analysis. cells, microarray, prolyl 4‑hydroxylase subunit α2 Next, several experiments were performed to verify the effects of the selected gene on the proliferation and migration of GBM cells. The current findings may provide new insights for studying the association between GSCs and GBM cells. 2 WU et al: P4HA2 PROMOTES GBM CELL PROLIFERATION AND MIGRATION Materials and methods 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% peni‑ cillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.) and Microarray data information. To analyze the differences cult ured at 37˚C with 5% CO 2. GSCs were maintained in stem cell between GSCs and GBM cells, gene microarray data were medium as previously described (9,12,13). After being cultured obtained from GSE74304 (9) and GSE124145 (10) in the NCBI at 37˚C in a humidified 5% CO2 incubator for 12 h, U87 cells GEO database (http://www.ncbi.nlm.nih.gov/geo/). Both gene were infected with negative control lentivirus (GV341; empty profiles were from the GPL570 platform [(HG‑U133_Plus_2) vector) or prolyl 4‑hydroxylase subunit α2 (P4HA2) overexpres‑ Affymetrix Human Genome U133 Plus 2.0 Array], a typical sion lentivirus at a multiplicity of infection of 5 for 12‑16 h. The array for detecting mRNA expression levels. GSE74304 virus was purchased from Shanghai GeneChem Co., Ltd. P4HA2 contained data from two patient‑derived GSC lines and corre‑ siRNA‑1 (sense, 5'‑GAACCAAGUACCAGGCAAUTT‑3' sponding GBM cell lines, and GSE124145 contained data from and antisense, 5'‑AUUGCCUGGUACUUGGUUCTT‑3'), two human GSC lines (X01 and X03), one human GBM tissue siRNA‑2 (sense, 5'‑GCAGCAUAUCACAGGGUUATT‑3' and and the GBM U251 cell line. Each sample contained two or antisense, 5'‑UAACCCUGUGAUAUGCUGCTT‑3'), siRNA‑3 three replicates. Thus, a total of 10 GSC samples and 12 GBM (sense, 5'‑GCAAGUGGGUCUCCAAUAATT‑3' and antisense, samples were available for experiments. Profiles filter criteria 5'‑UUAUUGGAGACCCACUUGCTT‑3') and scrambled nega‑ were as follows: GPL570 platform, publication date between tive control (sense, 5'‑UUCUCCGAACGUGUCACGUTT‑3' 2015 and 2019, no previous drug treatment and ≥500 DEGs. and antisense, 5'‑ACGUGACACGUUCGGAGAATT‑3') were synthesized by OBiO Technology (Shanghai) Corp., Ltd. After Acquisition of DEGs. DEGs were identified using the GEO2R being cultured at 37˚C in a humidified 5% CO2 incubator for online tools (https://www.ncbi.nlm.nih.gov/geo/geo2r) between 12 h, U87 cells were transfected with siRNAs (50 nM) using two GSC lines and two GBM cell lines in GSE74304, and two Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.) according GSC lines and GBM tissue or cell lines in GSE124145 with to the manufacturer's protocol for 12 h at 37˚C. Subsequent an adjusted P<0.05 and ǀlog (fold‑change) FCǀ >2. Overlapping experiments were performed 48 h after lentivirus infection or genes were obtained by uploading the DEGs from the two 24 h after siRNA transfection. datasets to Venn software online (http://bioinformatics.psb. ugent.be/webtools/Venn/). The DEGs with log FC >0 were RNA extraction and reverse transcription‑quantitative considered as upregulated genes and those with log FC <0 (RT‑q)PCR. Total RNA was extracted using TRIzol® were considered as downregulated genes in GSCs compared reagent (Thermo Fisher Scientific, Inc.), cDNA synthesis was with in GBM cells. performed with a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) according to the manu‑ Gene Ontology (GO) and Kyoto Encyclopedia of Genes and facturer's protocol and qPCR was performed with Universal Genomes (KEGG) pathway analysis. GO and KEGG pathway SYBR Green Master Mix (Roche Diagnostics) according to analysis was performed via the DAVID website (https://david. the manufacturer's protocol using the following PCR condi‑ ncifcrf.gov/) to identify significantly enriched molecular func‑ tions: 95˚C for 10 min, followed by 40 cycles of 95˚C for tions, cellular components, biological processes and biological 30 sec, 60˚C for 30 sec and 72˚C for 40 sec, followed by a pathways [P<0.05; enrichment score = ‑lg (P‑value)] final elongation step of 10 min at 72˚C. P4HA2 expression was normalized to GAPDH expression calculated using the Protein‑protein interaction (PPI) and module analysis. PPI 2‑ΔΔCq method (14). The primer sequences were as follows: analysis among overlapping DEGs was performed using P4HA2 forward, 5'‑GCCAAAGCCCTGATGAGACT‑3' and the STRING database (https://string‑db.org/), and network reverse, 5'‑GCTCCATCCACAACACCGTA‑3'; and GAPDH diagrams were constructed via Cytoscape software (v3.6.1; forward, 5'‑TCATCATCTCTGCCCCCTCT‑3' and reverse, http://www.cytoscape.org/) (maximum number of interac‑ 5'‑GTGATGGCATGGACTGTGGT‑3'. tors =0; confidence score ≥0.4). The hub genes were obtained by
Recommended publications
  • Anti-P4HA2 (Aa 289-338) Polyclonal Antibody (DPABH-10980) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

    Anti-P4HA2 (Aa 289-338) Polyclonal Antibody (DPABH-10980) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

    Anti-P4HA2 (aa 289-338) polyclonal antibody (DPABH-10980) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description Catalyzes the post-translational formation of 4-hydroxyproline in -Xaa-Pro-Gly- sequences in collagens and other proteins. Immunogen Synthetic peptide corresponding to a region within C terminal amino acids 289-338 (VYESLCRGEG VKLTPRRQKR LFCRYHHGNR APQLLIAPFK EEDEWDSPHI) of Human P4HA2, isoform 2 (NP_001017973). Isotype IgG Source/Host Rabbit Species Reactivity Human Purification Immunogen affinity purified Conjugate Unconjugated Applications IHC - Wholemount, WB Format Liquid Size 50 μg Buffer Constituents: 97% PBS, 2% Sucrose Preservative None Storage Shipped at 4°C. Upon delivery aliquot and store at -20°C. Avoid repeated freeze / thaw cycles. GENE INFORMATION Gene Name P4HA2 prolyl 4-hydroxylase, alpha polypeptide II [ Homo sapiens ] Official Symbol P4HA2 Synonyms P4HA2; prolyl 4-hydroxylase, alpha polypeptide II; procollagen proline, 2 oxoglutarate 4 dioxygenase (proline 4 hydroxylase), alpha polypeptide II; prolyl 4-hydroxylase subunit alpha-2; 4 PH alpha 2; C P4Halpha(II); collagen prolyl 4 hydroxylase alpha(II); 4-PH alpha 2; 4-PH alpha-2; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved C-P4Halpha(II); collagen prolyl 4-hydroxylase alpha(II); procollagen-proline,2-oxoglutarate-4- dioxygenase subunit alpha-2; procollagen-proline, 2-oxoglutarate
  • Endothelial Perspective on Tumor Development

    Endothelial Perspective on Tumor Development

    www.oncotarget.com Oncotarget, 2020, Vol. 11, (No. 36), pp: 3387-3404 Research Paper Down syndrome iPSC model: endothelial perspective on tumor development Mariana Perepitchka1,2, Yekaterina Galat1,2,3,*, Igor P. Beletsky3, Philip M. Iannaccone1,2,4,5 and Vasiliy Galat2,3,4,5,6 1Department of Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, IL, USA 2Developmental Biology Program, Stanley Manne Children’s Research Institute, Ann & Robert H. Lurie Children’s Hospital, Chicago, IL, USA 3Institute of Theoretical and Experimental Biophysics, Russian Academy of Sciences, Pushchino, Russia 4Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL, USA 5Robert H. Lurie Comprehensive Cancer Center, Northwestern University Feinberg School of Medicine, Chicago, IL, USA 6ARTEC Biotech Inc, Chicago, IL, USA *Co-first author Correspondence to: Mariana Perepitchka, email: [email protected] Yekaterina Galat, email: [email protected] Vasiliy Galat, email: [email protected] Keywords: Down syndrome; iPSC-derived endothelial model; T21 genome-wide Implications; meta-analysis; tumor microenvironment Received: July 10, 2019 Accepted: August 01, 2020 Published: September 08, 2020 Copyright: Perepitchka et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Trisomy 21 (T21), known as Down syndrome (DS), is a widely studied chromosomal abnormality. Previous studies have shown that DS individuals have a unique cancer profile. While exhibiting low solid tumor prevalence, DS patients are at risk for hematologic cancers, such as acute megakaryocytic leukemia and acute lymphoblastic leukemia.
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts

    Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts

    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation

    Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation

    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
  • A Genome-Wide Association Study Identifies Risk Alleles in Plasminogen and P4HA2 Associated with Giant Cell Arteritis

    A Genome-Wide Association Study Identifies Risk Alleles in Plasminogen and P4HA2 Associated with Giant Cell Arteritis

    This is a repository copy of A genome-wide association study identifies risk alleles in plasminogen and P4HA2 associated with giant cell arteritis. White Rose Research Online URL for this paper: https://eprints.whiterose.ac.uk/108046/ Version: Accepted Version Article: Carmona, DF, Vaglio, A, Mackie, SL orcid.org/0000-0003-2483-5873 et al. (53 more authors) (2017) A genome-wide association study identifies risk alleles in plasminogen and P4HA2 associated with giant cell arteritis. American Journal of Human Genetics, 100 (1). pp. 64-74. ISSN 0002-9297 https://doi.org/10.1016/j.ajhg.2016.11.013 �© 2017, American Society of Human Genetics. This is an author produced version of a paper published in American Journal of Human Genetics. Uploaded in accordance with the publisher's self-archiving policy. Reuse Items deposited in White Rose Research Online are protected by copyright, with all rights reserved unless indicated otherwise. They may be downloaded and/or printed for private study, or other acts as permitted by national copyright laws. The publisher or other rights holders may allow further reproduction and re-use of the full text version. This is indicated by the licence information on the White Rose Research Online record for the item. Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ A genome-wide association study identifies risk alleles in plasminogen and P4HA2 associated with giant cell arteritis F.
  • Nucleic Acids Research, 2009, Vol

    Nucleic Acids Research, 2009, Vol

    Published online 2 June 2009 Nucleic Acids Research, 2009, Vol. 37, No. 14 4587–4602 doi:10.1093/nar/gkp425 An integrative genomics approach identifies Hypoxia Inducible Factor-1 (HIF-1)-target genes that form the core response to hypoxia Yair Benita1, Hirotoshi Kikuchi2, Andrew D. Smith3, Michael Q. Zhang3, Daniel C. Chung2 and Ramnik J. Xavier1,2,* 1Center for Computational and Integrative Biology, 2Gastrointestinal Unit, Center for the Study of Inflammatory Bowel Disease, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114 and 3Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA Received April 20, 2009; Revised May 6, 2009; Accepted May 8, 2009 ABSTRACT the pivotal mediators of the cellular response to hypoxia is hypoxia-inducible factor (HIF), a transcription factor The transcription factor Hypoxia-inducible factor 1 that contains a basic helix-loop-helix motif as well as (HIF-1) plays a central role in the transcriptional PAS domain. There are three known members of the response to oxygen flux. To gain insight into HIF family (HIF-1, HIF-2 and HIF-3) and all are a/b the molecular pathways regulated by HIF-1, it is heterodimeric proteins. HIF-1 was the first factor to be essential to identify the downstream-target genes. cloned and is the best understood isoform (1). HIF-3 is We report here a strategy to identify HIF-1-target a distant relative of HIF-1 and little is currently known genes based on an integrative genomic approach about its function and involvement in oxygen homeosta- combining computational strategies and experi- sis.
  • UC San Francisco Electronic Theses and Dissertations

    UCSF UC San Francisco Electronic Theses and Dissertations Title Uncovering virulence pathways facilitated by proteolysis in HIV and a HIV associated fungal pathogen, Cryptococcus neoformans Permalink https://escholarship.org/uc/item/7vv2p2fh Author Clarke, Starlynn Cascade Publication Date 2015 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California ii Acknowledgments I would first like to thank my thesis advisor, Dr. Charles Craik. Throughout my PhD Charly has been unfailingly optimistic and enthusiastic about my projects, but most importantly, he has always had confidence in my abilities. During the course of graduate school I have doubted myself and my capabilities almost daily, but Charly has always believed that I would be successful in my scientific endeavors and I cannot thank him enough for that. Charly is the most enthusiastic scientist that I have ever met and he has the capacity to find a silver lining to almost any event. He also understands the importance of presentation and has the resourcefulness to transform almost any situation into an opportunity. These are all traits that do not come naturally to me, but having Charly as a mentor has helped me to learn some of these important skills. I would also like to thank my thesis committee members, Dr. Raul Andino and Dr. John Gross who have both been incredibly supportive over the years. Despite the fact that my research ended up veering away from the original focus that was more in line with their expertise, they have continued to provide me with encouragement and thoughtful feedback during my thesis committee meetings as well as at other times that I sought their advice.
  • Single-Cell Transcriptome Analysis Reveals Mesenchymal Stem Cells In

    bioRxiv preprint doi: https://doi.org/10.1101/2021.09.02.458742; this version posted September 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Single-cell transcriptome analysis reveals mesenchymal stem cells 2 in cavernous hemangioma 3 Fulong Ji1$, Yong Liu2$, Jinsong Shi3$, Chunxiang Liu1, Siqi Fu1 4 Heng Wang1, Bingbing Ren1, Dong Mi4, Shan Gao2*, Daqing Sun1* 5 1 Department of Paediatric Surgery, Tianjin Medical University General Hospital, Tianjin 300052, P.R. China. 6 China. 7 2 College of Life Sciences, Nankai University, Tianjin, Tianjin 300071, P.R. China; 8 3 National Clinical Research Center of Kidney Disease, Jinling Hospital, Nanjing University School of 9 Medicine, Nanjing, Jiangsu 210016, P.R. China; 10 4 School of Mathematical Sciences, Nankai University, Tianjin, Tianjin 300071, P.R. China; 11 12 13 $ These authors contributed equally to this paper. 14 * Corresponding authors. 15 SG:[email protected] 16 DS:[email protected] 17 bioRxiv preprint doi: https://doi.org/10.1101/2021.09.02.458742; this version posted September 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 18 Abstract 19 A cavernous hemangioma, well-known as vascular malformation, is present at birth, grows 20 proportionately with the child, and does not undergo regression.
  • Mutations of P4HA2 Encoding Prolyl 4-Hydroxylase 2 Are Associated with Nonsyndromic High Myopia

    Mutations of P4HA2 Encoding Prolyl 4-Hydroxylase 2 Are Associated with Nonsyndromic High Myopia

    ORIGINAL RESEARCH ARTICLE © American College of Medical Genetics and Genomics Mutations of P4HA2 encoding prolyl 4-hydroxylase 2 are associated with nonsyndromic high myopia Hui Guo, PhD1, Ping Tong, PhD2, Yanling Liu, BS1, Lu Xia, BS1, Tianyun Wang, BS1, Qi Tian, BS1, Ying Li, BS1, Yiqiao Hu, BS1, Yu Zheng, BS1, Xuemin Jin, MD3, Yunping Li, MD1,2, Wei Xiong, MD2, Beisha Tang, MD4, Yong Feng, MD4, Jiada Li, PhD1,5, Qian Pan, PhD1, Zhengmao Hu, PhD1 and Kun Xia, PhD1,5,6 Purpose: High myopia is one of the leading causes of blindness 186 cases identified an additional four mutations in 5 cases, includ- worldwide, with high heritability. However, only a few causative ing the frameshift mutation c.1349_1350delGT (p.Arg451Glyfs*8), genes have been identified, and the pathogenesis is still unclear. Our the nonsense mutation c.1327A>G (p.Lys443*), and two deleteri- aim was to identify a novel causative gene in a family with autosomal- ous missense mutations, c.419A>G (p.Gln140Arg) and c.448A>G dominant, nonsyndromic high myopia. (p.Ile150Val). The missense mutation c.419A>G (p.Gln140Arg) was recurrently identified in a sporadic case and was segregating in a Methods: Whole-genome linkage and whole-exome sequencing three-generation family. were conducted on the family. Real-time quantitative polymerase chain reaction and immunoblotting were applied to test the func- Conclusion: P4HA2 was identified as a novel causative gene for tional consequence of the candidate mutation. Sanger sequencing nonsyndromic high myopia. This study also indicated that the dis- was performed to screen for the candidate gene in other families or ruption of posttranslational modifications of collagen is an important sporadic cases.
  • Sept8/SEPTIN8 Involvement in Cellular Structure and Kidney Damage Is Identified by Genetic Mapping and a Novel Human Tubule Hypo

    Sept8/SEPTIN8 Involvement in Cellular Structure and Kidney Damage Is Identified by Genetic Mapping and a Novel Human Tubule Hypo

    www.nature.com/scientificreports OPEN Sept8/SEPTIN8 involvement in cellular structure and kidney damage is identifed by genetic mapping and a novel human tubule hypoxic model Gregory R. Keele1,10, Jeremy W. Prokop2,3,10, Hong He4, Katie Holl4, John Littrell4, Aaron W. Deal5, Yunjung Kim6, Patrick B. Kyle8,9, Esinam Attipoe8, Ashley C. Johnson8, Katie L. Uhl3, Olivia L. Sirpilla3, Seyedehameneh Jahanbakhsh3, Melanie Robinson2, Shawn Levy2, William Valdar6,7, Michael R. Garrett8,11 & Leah C. Solberg Woods5,11* Chronic kidney disease (CKD), which can ultimately progress to kidney failure, is infuenced by genetics and the environment. Genes identifed in human genome wide association studies (GWAS) explain only a small proportion of the heritable variation and lack functional validation, indicating the need for additional model systems. Outbred heterogeneous stock (HS) rats have been used for genetic fne-mapping of complex traits, but have not previously been used for CKD traits. We performed GWAS for urinary protein excretion (UPE) and CKD related serum biochemistries in 245 male HS rats. Quantitative trait loci (QTL) were identifed using a linear mixed efect model that tested for association with imputed genotypes. Candidate genes were identifed using bioinformatics tools and targeted RNAseq followed by testing in a novel in vitro model of human tubule, hypoxia-induced damage. We identifed two QTL for UPE and fve for serum biochemistries. Protein modeling identifed a missense variant within Septin 8 (Sept8) as a candidate for UPE. Sept8/SEPTIN8 expression increased in HS rats with elevated UPE and tubulointerstitial injury and in the in vitro hypoxia model. SEPTIN8 is detected within proximal tubule cells in human kidney samples and localizes with acetyl-alpha tubulin in the culture system.
  • Prolyl 4-Hydroxylases, Key Enzymes Regulating Hypoxia

    Prolyl 4-Hydroxylases, Key Enzymes Regulating Hypoxia

    D 1197 OULU 2013 D 1197 UNIVERSITY OF OULU P.O.B. 7500 FI-90014 UNIVERSITY OF OULU FINLAND ACTA UNIVERSITATIS OULUENSIS ACTA UNIVERSITATIS OULUENSIS ACTA SERIES EDITORS DMEDICA Ellinoora Aro ASCIENTIAE RERUM NATURALIUM Aro Ellinoora Senior Assistant Jorma Arhippainen PROLYL 4-HYDROXYLASES, BHUMANIORA KEY ENZYMES REGULATING University Lecturer Santeri Palviainen CTECHNICA HYPOXIA RESPONSE AND Docent Hannu Heusala COLLAGEN SYNTHESIS DMEDICA Professor Olli Vuolteenaho THE ROLES OF SPECIFIC ISOENZYMES IN SCIENTIAE RERUM SOCIALIUM THE CONTROL OF ERYTHROPOIESIS AND E SKELETOGENESIS University Lecturer Hannu Heikkinen FSCRIPTA ACADEMICA Director Sinikka Eskelinen GOECONOMICA Professor Jari Juga EDITOR IN CHIEF Professor Olli Vuolteenaho PUBLICATIONS EDITOR Publications Editor Kirsti Nurkkala UNIVERSITY OF OULU GRADUATE SCHOOL; UNIVERSITY OF OULU, FACULTY OF MEDICINE, ISBN 978-952-62-0082-8 (Paperback) INSTITUTE OF BIOMEDICINE, ISBN 978-952-62-0083-5 (PDF) DEPARTMENT OF MEDICAL BIOCHEMISTRY AND MOLECULAR BIOLOGY; ISSN 0355-3221 (Print) BIOCENTER OULU; ISSN 1796-2234 (Online) CENTER FOR CELL-MATRIX RESEARCH ACTA UNIVERSITATIS OULUENSIS D Medica 1197 ELLINOORA ARO PROLYL 4-HYDROXYLASES, KEY ENZYMES REGULATING HYPOXIA RESPONSE AND COLLAGEN SYNTHESIS The roles of specific isoenzymes in the control of erythropoiesis and skeletogenesis Academic dissertation to be presented with the assent of the Doctoral Training Committee of Health and Biosciences of the University of Oulu for public defence in Auditorium A101 of the Department of Anatomy and Cell Biology (Aapistie 7 A), on 1 March 2013, at 12 noon UNIVERSITY OF OULU, OULU 2013 Copyright © 2013 Acta Univ. Oul. D 1197, 2013 Supervised by Professor Johanna Myllyharju Reviewed by Doctor Erinn Rankin Docent Anna-Marja Säämänen ISBN 978-952-62-0082-8 (Paperback) ISBN 978-952-62-0083-5 (PDF) ISSN 0355-3221 (Printed) ISSN 1796-2234 (Online) Cover Design Raimo Ahonen JUVENES PRINT TAMPERE 2013 Aro, Ellinoora, Prolyl 4-hydroxylases, key enzymes regulating hypoxia response and collagen synthesis.
  • The Glomerular Transcriptome and a Predicted Protein–Protein Interaction Network

    The Glomerular Transcriptome and a Predicted Protein–Protein Interaction Network

    BASIC RESEARCH www.jasn.org The Glomerular Transcriptome and a Predicted Protein–Protein Interaction Network Liqun He,* Ying Sun,* Minoru Takemoto,* Jenny Norlin,* Karl Tryggvason,* Tore Samuelsson,† and Christer Betsholtz*‡ *Division of Matrix Biology, Department of Medical Biochemistry and Biophysics, and ‡Department of Medicine, Karolinska Institutet, Stockholm, and †Department of Medical Biochemistry, Go¨teborg University, Go¨teborg, Sweden ABSTRACT To increase our understanding of the molecular composition of the kidney glomerulus, we performed a meta-analysis of available glomerular transcriptional profiles made from mouse and man using five different methodologies. We generated a combined catalogue of glomerulus-enriched genes that emerged from these different sources and then used this to construct a predicted protein–protein interaction network in the glomerulus (GlomNet). The combined glomerulus-enriched gene catalogue provides the most comprehensive picture of the molecular composition of the glomerulus currently available, and GlomNet contributes an integrative systems biology approach to the understanding of glomerular signaling networks that operate during development, function, and disease. J Am Soc Nephrol 19: 260–268, 2008. doi: 10.1681/ASN.2007050588 Many kidney diseases and, importantly, approxi- nins have been shown to be mutated in Alport syn- mately two thirds of all cases of ESRD originate with drome and Pierson congenital nephrotic syndromes, glomerular disease. Most cases of glomerular disease respectively.11,12 Genetic studies in mice have further are caused by systemic disorders (e.g., diabetes, hyper- revealed genes and proteins of importance for glomer- tension, lupus, obesity) for which the molecular ulus development and function, such as podoca- pathogeneses of the glomerular complications are un- lyxin,13 CD2AP,14 NEPH1,15 FAT1,16 forkhead box known.