ONCOLOGY LETTERS 22: 601, 2021 P4HA2 promotes cell proliferation and migration in glioblastoma YUYING WU1, XUNRUI ZHANG2, JUE WANG1, RUIJIE JI1,2, LEI ZHANG1, JIANBING QIN1, MEILING TIAN1, GUOHUA JIN1 and XINHUA ZHANG1 1Department of Anatomy, Medical School and Co‑innovation Center of Neuroregeneration, Nantong University, Nantong, Jiangsu 226001; 2Department of Clinical Medicine, Faculty of Medicine, Xinglin College, Nantong University, Nantong, Jiangsu 226008, P.R. China Received October 16, 2020; Accepted April 8, 2021 DOI: 10.3892/ol.2021.12862 Abstract. Glioblastoma (GBM) is a primary malignant tumor assays demonstrated that the cell proliferation and migration characterized by high infiltration and angiogenesis in the brain increased after P4HA2 overexpression and decreased after parenchyma. Glioma stem cells (GSCs), a heterogeneous GBM P4HA2‑knockdown. In conclusion, the present study demon‑ cell type with the potential for self‑renewal and differentia‑ strated that low P4HA2 expression in GSCs promoted GBM tion to tumor cells, are responsible for the high malignancy of cell proliferation and migration, suggesting that P4HA2 may GBM. The purpose of the present study was to investigate the act as a switch in the transition from GSCs to GBM cells. roles of significantly differentially expressed genes between GSCs and GBM cells in GBM progression. The gene profiles Introduction GSE74304 and GSE124145, containing 10 GSC samples and 12 GBM samples in total, were obtained from the Gene Glioma, the most common primary malignant brain tumor in Expression Omnibus (GEO) database. The overlapping differ‑ the central nervous system, is characterized by a high degree entially expressed genes were identified with GEO2R tools of angiogenesis (1). Among gliomas, glioblastoma (GBM) is and Venn software online. Subsequently, Gene Ontology and the most malignant type, with a median survival time of only Kyoto Encyclopedia of Genes and Genomes pathway analysis 12‑15 months (2,3). Considerable heterogeneity exists among was performed on the 41 upregulated and 142 downregulated tumor cells, and the cell types, gene expression patterns and differentially expressed genes in GSCs compared with in cell proliferation potential can vary (4). One type of tumor GBM cells via the DAVID website. Protein‑protein interaction cells, known as cancer stem cells, have the characteristics of and module analyses in Cytoscape with the STRING database stem cells, which can proliferate indefinitely, produce tumor revealed 21 hub genes that were downregulated in GSCs cells and drive tumor progression, as well as having important compared with in GBM cells. Survival analysis conducted effects on tumor recurrence, metastasis and chemoradio‑ via the GEPIA2 website revealed that low expression levels therapy resistance (5). These cells in GBM are called glioma of the hub genes prolyl 4‑hydroxylase subunit α2 (P4HA2), stem cells (GSCs). GSCs have the potential for self‑renewal TGF‑β induced, integrin subunit α3 and thrombospondin 1 and multidirectional differentiation, and also promote tumor were associated with significantly prolonged survival time angiogenesis, trigger immune escape and drive the occurrence in patients with GBM. Further experiments were performed and development of GBM (6). These cells are at the root of the focusing on P4HA2. Reverse transcription‑quantitative PCR continuous cell proliferation, high invasion, infiltration, metas‑ was used to detect P4HA2 gene expression. In agreement with tasis and treatment resistance observed in GBM (7). Therefore, the bioinformatics analysis, P4HA2 expression was higher therapies targeting GSCs have shown great potential and have in U87 cells than in GSCs. Cell Counting Kit‑8, EdU incor‑ been at the forefront of GBM research. At present, although poration, cell cycle analysis, wound healing and Transwell many GSC‑associated markers, such as CD133 and A2B5, and the signaling pathways regulating the stemness of GSCs have been revealed (8), the mechanism underlying the continuous conversion of GSCs to GBM cells remains unclear. The present study selected two gene microarrays from Correspondence to: Professor Xinhua Zhang, Department the Gene Expression Omnibus (GEO) database to detect the of Anatomy, Medical School and Co‑innovation Center of Neuroregeneration, Nantong University, 19 Qixiu Road, Nantong, mRNA expression levels in GSCs and GBM cells and to Jiangsu 226001, P.R. China analyze the overlapping differentially expressed genes (DEGs) E‑mail: [email protected] between the two types of cells. Subsequently, the genes that may play an essential role in the malignant progression of Key words: bioinformatics analysis, glioblastoma, glioma stem human GBM were obtained through bioinformatics analysis. cells, microarray, prolyl 4‑hydroxylase subunit α2 Next, several experiments were performed to verify the effects of the selected gene on the proliferation and migration of GBM cells. The current findings may provide new insights for studying the association between GSCs and GBM cells. 2 WU et al: P4HA2 PROMOTES GBM CELL PROLIFERATION AND MIGRATION Materials and methods 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% peni‑ cillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.) and Microarray data information. To analyze the differences cult ured at 37˚C with 5% CO 2. GSCs were maintained in stem cell between GSCs and GBM cells, gene microarray data were medium as previously described (9,12,13). After being cultured obtained from GSE74304 (9) and GSE124145 (10) in the NCBI at 37˚C in a humidified 5% CO2 incubator for 12 h, U87 cells GEO database (http://www.ncbi.nlm.nih.gov/geo/). Both gene were infected with negative control lentivirus (GV341; empty profiles were from the GPL570 platform [(HG‑U133_Plus_2) vector) or prolyl 4‑hydroxylase subunit α2 (P4HA2) overexpres‑ Affymetrix Human Genome U133 Plus 2.0 Array], a typical sion lentivirus at a multiplicity of infection of 5 for 12‑16 h. The array for detecting mRNA expression levels. GSE74304 virus was purchased from Shanghai GeneChem Co., Ltd. P4HA2 contained data from two patient‑derived GSC lines and corre‑ siRNA‑1 (sense, 5'‑GAACCAAGUACCAGGCAAUTT‑3' sponding GBM cell lines, and GSE124145 contained data from and antisense, 5'‑AUUGCCUGGUACUUGGUUCTT‑3'), two human GSC lines (X01 and X03), one human GBM tissue siRNA‑2 (sense, 5'‑GCAGCAUAUCACAGGGUUATT‑3' and and the GBM U251 cell line. Each sample contained two or antisense, 5'‑UAACCCUGUGAUAUGCUGCTT‑3'), siRNA‑3 three replicates. Thus, a total of 10 GSC samples and 12 GBM (sense, 5'‑GCAAGUGGGUCUCCAAUAATT‑3' and antisense, samples were available for experiments. Profiles filter criteria 5'‑UUAUUGGAGACCCACUUGCTT‑3') and scrambled nega‑ were as follows: GPL570 platform, publication date between tive control (sense, 5'‑UUCUCCGAACGUGUCACGUTT‑3' 2015 and 2019, no previous drug treatment and ≥500 DEGs. and antisense, 5'‑ACGUGACACGUUCGGAGAATT‑3') were synthesized by OBiO Technology (Shanghai) Corp., Ltd. After Acquisition of DEGs. DEGs were identified using the GEO2R being cultured at 37˚C in a humidified 5% CO2 incubator for online tools (https://www.ncbi.nlm.nih.gov/geo/geo2r) between 12 h, U87 cells were transfected with siRNAs (50 nM) using two GSC lines and two GBM cell lines in GSE74304, and two Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.) according GSC lines and GBM tissue or cell lines in GSE124145 with to the manufacturer's protocol for 12 h at 37˚C. Subsequent an adjusted P<0.05 and ǀlog (fold‑change) FCǀ >2. Overlapping experiments were performed 48 h after lentivirus infection or genes were obtained by uploading the DEGs from the two 24 h after siRNA transfection. datasets to Venn software online (http://bioinformatics.psb. ugent.be/webtools/Venn/). The DEGs with log FC >0 were RNA extraction and reverse transcription‑quantitative considered as upregulated genes and those with log FC <0 (RT‑q)PCR. Total RNA was extracted using TRIzol® were considered as downregulated genes in GSCs compared reagent (Thermo Fisher Scientific, Inc.), cDNA synthesis was with in GBM cells. performed with a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) according to the manu‑ Gene Ontology (GO) and Kyoto Encyclopedia of Genes and facturer's protocol and qPCR was performed with Universal Genomes (KEGG) pathway analysis. GO and KEGG pathway SYBR Green Master Mix (Roche Diagnostics) according to analysis was performed via the DAVID website (https://david. the manufacturer's protocol using the following PCR condi‑ ncifcrf.gov/) to identify significantly enriched molecular func‑ tions: 95˚C for 10 min, followed by 40 cycles of 95˚C for tions, cellular components, biological processes and biological 30 sec, 60˚C for 30 sec and 72˚C for 40 sec, followed by a pathways [P<0.05; enrichment score = ‑lg (P‑value)] final elongation step of 10 min at 72˚C. P4HA2 expression was normalized to GAPDH expression calculated using the Protein‑protein interaction (PPI) and module analysis. PPI 2‑ΔΔCq method (14). The primer sequences were as follows: analysis among overlapping DEGs was performed using P4HA2 forward, 5'‑GCCAAAGCCCTGATGAGACT‑3' and the STRING database (https://string‑db.org/), and network reverse, 5'‑GCTCCATCCACAACACCGTA‑3'; and GAPDH diagrams were constructed via Cytoscape software (v3.6.1; forward, 5'‑TCATCATCTCTGCCCCCTCT‑3' and reverse, http://www.cytoscape.org/) (maximum number of interac‑ 5'‑GTGATGGCATGGACTGTGGT‑3'. tors =0; confidence score ≥0.4). The hub genes were obtained by