DOCSLIB.ORG

Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulatory Factor 1 in IFN-γ-Mediated Inhibition of Norovirus Replication Washington University School of Medicine Digital Commons@Becker Open Access Publications 2012 Essential cell-autonomous role for interferon (IFN) regulatory factor 1 in IFN-γ-mediated inhibition of norovirus replication in macrophages Nicole S. Maloney Washington University School of Medicine in St. Louis Larissa B. Thackray Washington University School of Medicine in St. Louis Gautam Goel Harvard Medical School Seungmin Hwang Washington University School of Medicine in St. Louis Erning Duan Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Maloney, Nicole S.; Thackray, Larissa B.; Goel, Gautam; Hwang, Seungmin; Duan, Erning; Vachharajani, Punit; Xavier, Ramnik; and Virgin, Herbert W., ,"Essential cell-autonomous role for interferon (IFN) regulatory factor 1 in IFN-γ-mediated inhibition of norovirus replication in macrophages." The ourJ nal of Virology.86,23. 12655-64. (2012). https://digitalcommons.wustl.edu/open_access_pubs/3519 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Nicole S. Maloney, Larissa B. Thackray, Gautam Goel, Seungmin Hwang, Erning Duan, Punit Vachharajani, Ramnik Xavier, and Herbert W. Virgin This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3519 Essential Cell-Autonomous Role for Interferon (IFN) Regulatory Factor 1 in IFN-␥-Mediated Inhibition of Norovirus Replication in Macrophages Nicole S. Maloney,a Larissa B. Thackray,a Gautam Goel,b,c Seungmin Hwang,a Erning Duan,a Punit Vachharajani,a Ramnik Xavier,b,c Downloaded from and Herbert W. Virgina Departments of Pathology and Immunology and Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri, USAa; Center for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USAb; and Center for the Study of Inflammatory Bowel Disease, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USAc Noroviruses (NVs) cause the majority of cases of epidemic nonbacterial gastroenteritis worldwide and contribute to endemic enteric disease. However, the molecular mechanisms responsible for immune control of their replication are not completely un- derstood. Here we report that the transcription factor interferon regulatory factor 1 (IRF-1) is required for control of murine NV http://jvi.asm.org/ (MNV) replication and pathogenesis in vivo. This led us to studies documenting a cell-autonomous role for IRF-1 in gamma in- terferon (IFN-␥)-mediated inhibition of MNV replication in primary macrophages. This role of IRF-1 in the inhibition of MNV replication by IFN-␥ is independent of IFN-␣␤ signaling. While the signal transducer and activator of transcription STAT-1 was also required for IFN-␥-mediated inhibition of MNV replication in vitro, class II transactivator (CIITA), interferon regulatory factor 3 (IRF-3), and interferon regulatory factor 7 (IRF-7) were not required. We therefore hypothesized that there must be a subset of IFN-stimulated genes (ISGs) regulated by IFN-␥ in a manner dependent only on STAT-1 and IRF-1. Analysis of tran- scriptional profiles of macrophages lacking various transcription factors confirmed this hypothesis. These studies identify a key on December 10, 2014 by Washington University in St. Louis role for IRF-1 in IFN-␥-dependent control of norovirus infection in mice and macrophages. oroviruses (NVs) are a genus of positive-sense RNA viruses IFN-␣␤ and IFN-␥ signaling pathways, and a key role for STAT-1 Nthat are the major etiologic agent of epidemic nonbacterial in control of MNV replication is well established. STAT-1-defi- gastroenteritis worldwide (11, 12). Symptoms of human norovi- cient mice (STAT-1Ϫ/Ϫ), like mice lacking both the IFN-␣␤R and rus infection are generally self-limiting and typically resolve the IFN-␥R (IFN-␣␤␥RϪ/Ϫ), succumb to MNV infection and within 72 h (12), which is consistent with a role for innate antiviral have elevated viral titers in multiple tissues (17, 27). Moreover, mechanisms such as interferons (IFNs) in control of symptoms similar to cells lacking the IFN-␣␤R, cells lacking STAT-1 repli- and replication. Both type I (IFN-␣␤) and II (IFN-␥) IFNs de- cate MNV to a higher level than wild-type (WT) cells (41). In crease viral RNA and protein expression from a human norovirus addition to STAT-1, the autophagy proteins Atg5, Atg16, and replicon (6, 7). Murine noroviruses (MNVs) are culturable viruses Atg7, but not the degradative function of autophagy, are required that share structural, biochemical, and genetic features with hu- for IFN-␥-dependent control of MNV replication in macrophages man noroviruses and provide a tractable small-animal model for (15). However, factors other than STAT-1 and specific autophagy investigation of NV immunity, pathogenesis, and IFN-mediated proteins that are involved in IFN-mediated control of MNV rep- control of NV replication (4, 8, 17, 41, 42). lication are less well defined. MNVs replicate in myeloid cells in culture and in vivo (40, 41). Interferon regulatory factor 1 (IRF-1) is induced by IFNs via Both IFN-␥ and IFN-␣␤ play key roles in control of MNV infec- STAT-1 signaling (1). IRF-1 is a transcription factor that has a role tion in vivo, since mice deleted of both the IFN-␥ receptor (IFN- in the stimulation of cytokines, chemokines, and some ISGs in ␥RϪ/Ϫ) and the IFN-␣␤ receptor (IFN-␣␤RϪ/Ϫ) are more suscep- response to IFN-␥ (18–20). Importantly, IRF-1 is capable of acti- tible to lethal infection than mice deleted of either IFN receptor vating antiviral programs against a diverse range of RNA viruses individually (15, 17). Pretreatment with either IFN-␣␤ or IFN-␥ (16, 29, 31) and is required for IFN-␥-mediated inhibition of en- limits MNV replication in cultured macrophages and dendritic cephalomyocarditis virus (EMCV) and West Nile virus (WNV) cells (8, 15). These studies show, together with studies of human replication in cultured cells (2, 18). In addition, IRF-1 has been norovirus replicons (6, 7), that IFNs exert direct antiviral effects implicated in IFN-␣␤-mediated direct antiviral effects against that inhibit NV replication in permissive cells. Furthermore, EMCV (18) and is important for IFN-␣␤ production in response IFN-␣␤ exerts autocrine control of MNV replication in primary to poly(I)-poly(C) in vitro but not in response to Newcastle dis- cell cultures, as MNV replicates to a higher titer in cells lacking the IFN-␣␤R than in control cells (41). IFNs exert direct antiviral effects via induction of the transcrip- Received 20 June 2012 Accepted 4 September 2012 tion of multiple potentially antiviral genes (IFN-stimulated genes Published ahead of print 12 September 2012 [ISGs]). After binding to their respective receptors, IFN-␣␤ and Address correspondence to Herbert W. Virgin, [email protected]. IFN-␥ induce cellular transcription via Janus kinase (JAK)-signal Copyright © 2012, American Society for Microbiology. All Rights Reserved. transducer and activator of transcription (STAT) signaling path- doi:10.1128/JVI.01564-12 ways (1, 25, 33). STAT-1 is an essential component of both the December 2012 Volume 86 Number 23 Journal of Virology p. 12655–12664 jvi.asm.org 12655 Maloney et al. ease virus (24), WNV (2), or poly(I)-poly(C) (30) in vivo. IRF-1 TABLE 1 Primers used in this study plays additional roles in innate and adaptive immunity. IRF-1- Gene Orientation Primer sequence (5=–3=) deficient (IRF-1Ϫ/Ϫ) mice exhibit defects in CD8 T cell and natu- EG634650 Forward AGTGGAGCAGTGCCTTGTCTGC ral killer (NK) cells (24, 28) and exhibit increased TH2 skewing Reverse TGGAGCGTTTCTGTGGGAAGCC and decreased production of IFN-␥ by CD4 T cells as a result of dysregulation of interleukin-12 (22). Thus, the in vivo role of CH25H Forward ACGTCCTGATCTGCCTGCTGC IRF-1 during a given viral infection could reflect a combination Reverse TATTGGGTCGCCAGCGCGAAG of direct effects on viral replication in permissive cells and effects on the cellular innate and adaptive immune responses to infec- PXMP2 Forward TGCTGGATCGCCTGTTCTTTGCC Downloaded from tion. Reverse TTTGCAGTGCGGGCCAGAAG Here we demonstrate that IRF-1 has important in vivo effects COLEC12 Forward ACCACCTGGTCCAACTGGCAAC on MNV replication and pathogenesis that are independent of Reverse ATCCTTTGCTGCCACGCTCTCC effects of IFN-␣␤ and are consistent with a direct antiviral role for IRF-1 in IFN-␥-mediated inhibition of MNV replication in pri- FABP4 Forward TGCTGCAGCCTTTCTCACCTGG mary macrophages. Studies in cultured macrophages confirm a Reverse TTGTGGCAAAGCCCACTCCC key cell-autonomous role for IRF-1 in IFN-␥-mediated inhibition of MNV replication, and this role does not require autocrine se- GPR33 Forward CATCAGCAACGGCCTCTATCT http://jvi.asm.org/ Reverse AGACCCAGTGATTGTCCTGAA cretion of IFN-␣␤. Importantly, the role for IRF-1 is highly spe- ␥ cific, since IFN- does not require other signaling pathways, in- GBP2 Forward CTGCACTATGTGACGGAGCTA cluding those dependent on class II transactivator (CIITA), Reverse GAGTCCACACAAAGGTTGGAAA interferon regulatory factor 3 (IRF-3), or interferon regulatory factor 7 (IRF-7), to elicit an antiviral state for MNV. Confirming CCL3 Forward TTCTCTGTACCATGACACTCTGC
Load more

Recommended publications
  • C57BL/6 and 129 Inbred Mouse Strains Differ in Gbp2 and Gbp2b
    Wellcome Open Research 2019, 4:124 Last updated: 30 JAN 2020 RESEARCH ARTICLE C57BL/6 and 129 inbred mouse strains differ in Gbp2 and Gbp2b expression in response to inflammatory stimuli in vivo [version 1; peer review: 2 approved] Barbara Clough 1*, Ryan Finethy2*, Rabia T. Khan1*, Daniel Fisch 1*, Sarah Jordan1, Harshil Patel 3, Jörn Coers 2,4*, Eva-Maria Frickel 1* 1Host-Toxoplasma Interaction Laboratory, The Francis Crick Institute, London, NW1 1AT, UK 2Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 3Bioinformatics and Biostatistics, The Francis Crick Institute, London, NW1 1AT, UK 4Department of Immunology, Duke University Medical Center, Durham, North Carolina, USA * Equal contributors First published: 20 Aug 2019, 4:124 ( Open Peer Review v1 https://doi.org/10.12688/wellcomeopenres.15329.1) Latest published: 20 Aug 2019, 4:124 ( https://doi.org/10.12688/wellcomeopenres.15329.1) Reviewer Status Abstract Invited Reviewers Background: Infections cause the production of inflammatory cytokines 1 2 such as Interferon gamma (IFNγ). IFNγ in turn prompts the upregulation of a range of host defence proteins including members of the family of version 1 guanylate binding proteins (Gbps). In humans and mice alike, GBPs restrict 20 Aug 2019 report report the intracellular replication of invasive microbes and promote inflammation. To study the physiological functions of Gbp family members, the most commonly chosen in vivo models are mice harbouring loss-of-function mutations in either individual Gbp genes or the entire Gbp gene cluster on 1 Peter Staeheli, University of Freiburg, Freiburg, mouse chromosome 3. Individual Gbp deletion strains differ in their design, Germany as some strains exist on a pure C57BL/6 genetic background, while other strains contain a 129-derived genetic interval encompassing the Gbp gene 2 Igor Kramnik , Boston University School of cluster on an otherwise C57BL/6 genetic background.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Chlamydia Cell Biology and Pathogenesis
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Rev Manuscript Author Microbiol. Author Manuscript Author manuscript; available in PMC 2016 June 01. Published in final edited form as: Nat Rev Microbiol. 2016 June ; 14(6): 385–400. doi:10.1038/nrmicro.2016.30. Chlamydia cell biology and pathogenesis Cherilyn Elwell, Kathleen Mirrashidi, and Joanne Engel Departments of Medicine, Microbiology and Immunology, University of California, San Francisco, California 94143, USA Abstract Chlamydia spp. are important causes of human disease for which no effective vaccine exists. These obligate intracellular pathogens replicate in a specialized membrane compartment and use a large arsenal of secreted effectors to survive in the hostile intracellular environment of the host. In this Review, we summarize the progress in decoding the interactions between Chlamydia spp. and their hosts that has been made possible by recent technological advances in chlamydial proteomics and genetics. The field is now poised to decipher the molecular mechanisms that underlie the intimate interactions between Chlamydia spp. and their hosts, which will open up many exciting avenues of research for these medically important pathogens. Chlamydiae are Gram-negative, obligate intracellular pathogens and symbionts of diverse 1 organisms, ranging from humans to amoebae . The best-studied group in the Chlamydiae phylum is the Chlamydiaceae family, which comprises 11 species that are pathogenic to 1 humans or animals . Some species that are pathogenic to animals, such as the avian 1 2 pathogen Chlamydia psittaci, can be transmitted to humans , . The mouse pathogen 3 Chlamydia muridarum is a useful model of genital tract infections . Chlamydia trachomatis and Chlamydia pneumoniae, the major species that infect humans, are responsible for a wide 2 4 range of diseases , and will be the focus of this Review.
    [Show full text]
  • GBP2 As a Potential Prognostic Biomarker in Pancreatic Adenocarcinoma
    GBP2 as a potential prognostic biomarker in pancreatic adenocarcinoma Bo Liu1,2,3,*, Rongfei Huang4,*, Tingting Fu5, Ping He1,2, Chengyou Du3, Wei Zhou6, Ke Xu7 and Tao Ren7 1 Department of Hepatobiliary Surgery, Pidu District People's Hospital of Chengdu, Chengdu, China 2 Department of Hepatobiliary Surgery, The Third Affiliated Hospital of Chengdu Medical College, Chengdu, China 3 Department of Hepatobiliary Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China 4 Department of Pathology, Clinical Medical College and The First Affiliated Hospital of Chengdu Medical College, Chengdu, China 5 Department of Nosocomial Infection Control, The Third Affiliated Hospital of Chengdu Medical College, Chengdu, China 6 Department of Radiology, Clinical Medical College and The First Affiliated Hospital of Chengdu Medical College, Chengdu, China 7 Department of Oncology, Clinical Medical College and The First Affiliated Hospital of Chengdu Medical College, Chengdu, China * These authors contributed equally to this work. ABSTRACT Background. Pancreatic adenocarcinoma (PAAD) is a disease with atypical symptoms, an unfavorable response to therapy, and a poor outcome. Abnormal guanylate-binding proteins (GBPs) play an important role in the host's defense against viral infection and may be related to carcinogenesis. In this study, we sought to determine the relationship between GBP2 expression and phenotype in patients with PAAD and explored the possible underlying biological mechanism. Method. We analyzed the expression of GBP2 in PAAD tissues using a multiple gene expression database and a cohort of 42 PAAD patients. We evaluated GBP2's prognostic value using Kaplan–Meier analysis and the Cox regression model. GO and KEGG Submitted 13 January 2021 enrichment analysis, co-expression analysis, and GSEA were performed to illustrate the Accepted 16 April 2021 possible underlying biological mechanism.
    [Show full text]
  • Modulating Antiviral Response Via CRISPR–Cas Systems
    viruses Review Immunity and Viral Infections: Modulating Antiviral Response via CRISPR–Cas Systems Sergey Brezgin 1,2,3,† , Anastasiya Kostyusheva 1,†, Ekaterina Bayurova 4 , Elena Volchkova 5, Vladimir Gegechkori 6 , Ilya Gordeychuk 4,7, Dieter Glebe 8 , Dmitry Kostyushev 1,3,*,‡ and Vladimir Chulanov 1,3,5,‡ 1 National Medical Research Center of Tuberculosis and Infectious Diseases, Ministry of Health, 127994 Moscow, Russia; [email protected] (S.B.); [email protected] (A.K.); [email protected] (V.C.) 2 Institute of Immunology, Federal Medical Biological Agency, 115522 Moscow, Russia 3 Scientific Center for Genetics and Life Sciences, Division of Biotechnology, Sirius University of Science and Technology, 354340 Sochi, Russia 4 Chumakov Federal Scientific Center for Research and Development of Immune-and-Biological Products of Russian Academy of Sciences, 108819 Moscow, Russia; [email protected] (E.B.); [email protected] (I.G.) 5 Department of Infectious Diseases, Sechenov University, 119991 Moscow, Russia; [email protected] 6 Department of Pharmaceutical and Toxicological Chemistry, Sechenov University, 119991 Moscow, Russia; [email protected] 7 Department of Organization and Technology of Immunobiological Drugs, Sechenov University, 119991 Moscow, Russia 8 National Reference Center for Hepatitis B Viruses and Hepatitis D Viruses, Institute of Medical Virology, Justus Liebig University of Giessen, 35392 Giessen, Germany; [email protected] * Correspondence: [email protected] † Co-first authors. Citation: Brezgin, S.; Kostyusheva, ‡ Co-senior authors. A.; Bayurova, E.; Volchkova, E.; Gegechkori, V.; Gordeychuk, I.; Glebe, Abstract: Viral infections cause a variety of acute and chronic human diseases, sometimes resulting D.; Kostyushev, D.; Chulanov, V. Immunity and Viral Infections: in small local outbreaks, or in some cases spreading across the globe and leading to global pandemics.
    [Show full text]
  • 679514V2.Full.Pdf
    bioRxiv preprint doi: https://doi.org/10.1101/679514; this version posted August 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The large GTPase, mGBP-2, regulates Rho family GTPases to inhibit migration and invadosome formation in Triple-Negative Breast Cancer cells. Geoffrey O. Nyabuto, John P. Wilson, Samantha A. Heilman, Ryan C. Kalb, Ankita V. Abnave, and Deborah J. Vestal* Department of Biological Sciences, University of Toledo, Toledo, OH, USA 43606 *Corresponding author: Deborah J. Vestal, Department of Biological Sciences, University of Toledo, 2801 West Bancroft St., MS 1010, Toledo, OH 43606. Phone: 1-419-383-4134. FAX: 1-419-383-6228. Email: [email protected]. Running title: mGBP-2 inhibits breast cancer cell migration. Key words: Guanylate-Binding Protein, Triple-Negative Breast Cancer, migration, CDC42, Rac1. This work was supported by funding from the University of Toledo to D.J.V. Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed. 1 bioRxiv preprint doi: https://doi.org/10.1101/679514; this version posted August 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Breast cancer is the most common cancer in women. Despite advances in early detection and treatment, it is predicted that over 40,000 women will die of breast cancer in 2019. This number of women is still too high. To lower this number, more information about the molecular players in breast cancer are needed.
    [Show full text]
  • GBP5 Repression Suppresses the Metastatic Potential and PD-L1 Expression in Triple-Negative Breast Cancer
    biomedicines Article GBP5 Repression Suppresses the Metastatic Potential and PD-L1 Expression in Triple-Negative Breast Cancer Shun-Wen Cheng 1, Po-Chih Chen 2,3,4 , Min-Hsuan Lin 5, Tzong-Rong Ger 1, Hui-Wen Chiu 5,6,7,* and Yuan-Feng Lin 5,8,* 1 Department of Biomedical Engineering, Chung Yuan Christian University, Taoyuan City 32023, Taiwan; [email protected] (S.-W.C.); [email protected] (T.-R.G.) 2 Neurology Department, Shuang-Ho Hospital, Taipei Medical University, New Taipei City 23561, Taiwan; [email protected] 3 Taipei Neuroscience Institute, Taipei Medical University, New Taipei City 23561, Taiwan 4 Department of Neurology, School of Medicine, College of Medicine, Taipei Medical University, Taipei 11031, Taiwan 5 Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei 11031, Taiwan; [email protected] 6 Department of Medical Research, Shuang Ho Hospital, Taipei Medical University, New Taipei City 23561, Taiwan 7 TMU Research Center of Urology and Kidney, Taipei Medical University, Taipei 11031, Taiwan 8 Cell Physiology and Molecular Image Research Center, Wan Fang Hospital, Taipei Medical University, Taipei 11696, Taiwan * Correspondence: [email protected] (H.-W.C.); [email protected] (Y.-F.L.); Tel.: +886-2-22490088 (H.-W.C.); +886-2-2736-1661 (ext. 3106) (Y.-F.L.) Citation: Cheng, S.-W.; Chen, P.-C.; Abstract: Triple-negative breast cancer (TNBC) is the most aggressive breast cancer subtype because Lin, M.-H.; Ger, T.-R.; Chiu, H.-W.; of its high metastatic potential. Immune evasion due to aberrant expression of programmed cell Lin, Y.-F.
    [Show full text]
  • Regulated Host Pathways for the Parasite Development
    nature publishing group ARTICLES Eimeria falciformis infection of the mouse caecum identifies opposing roles of IFNg-regulated host pathways for the parasite development Manuela Schmid1, Emanuel Heitlinger1, Simone Spork1, Hans-Joachim Mollenkopf2, Richard Lucius1 and Nishith Gupta1,3 Intracellular parasites reprogram host functions for their survival and reproduction. The extent and relevance of parasite- mediated host responses in vivo remains poorly studied, however. We utilized Eimeria falciformis, a parasite infecting the mouse intestinal epithelium, to identify and validate host determinants of parasite infection. Most prominent mouse genes induced during the onset of asexual and sexual growth of parasite comprise interferon c (IFNc)-regulated factors, e.g., immunity-related GTPases (IRGA6/B6/D/M2/M3), guanylate-binding proteins (GBP2/3/5/6/8), chemokines (CxCL9-11), and several enzymes of the kynurenine pathway including indoleamine 2,3-dioxygenase 1 (IDO1). These results indicated a multifarious innate defense (tryptophan catabolism, IRG, GBP, and chemokine signaling), and a consequential adaptive immune response (chemokine-cytokine signaling and lymphocyte recruitment). The inflammation- and immunity-associated transcripts were increased during the course of infection, following influx of B cells, Tcells, and macrophages to the parasitized caecum tissue. Consistently, parasite growth was enhanced in animals inhibited for CxCr3, a major receptor for CxCL9-11 present on immune cells. Interestingly, despite a prominent induction, mouse IRGB6 failed to bind and disrupt the parasitophorous vacuole, implying an immune evasion by E. falciformis. Furthermore, oocyst output was impaired in IFNc-R À / À and IDO1 À / À mice, both of which suggest a subversion of IFNc signaling by the parasite to promote its growth.
    [Show full text]
  • Engineered Type 1 Regulatory T Cells Designed for Clinical Use Kill Primary
    ARTICLE Acute Myeloid Leukemia Engineered type 1 regulatory T cells designed Ferrata Storti Foundation for clinical use kill primary pediatric acute myeloid leukemia cells Brandon Cieniewicz,1* Molly Javier Uyeda,1,2* Ping (Pauline) Chen,1 Ece Canan Sayitoglu,1 Jeffrey Mao-Hwa Liu,1 Grazia Andolfi,3 Katharine Greenthal,1 Alice Bertaina,1,4 Silvia Gregori,3 Rosa Bacchetta,1,4 Norman James Lacayo,1 Alma-Martina Cepika1,4# and Maria Grazia Roncarolo1,2,4# Haematologica 2021 Volume 106(10):2588-2597 1Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 2Stanford Institute for Stem Cell Biology and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 3San Raffaele Telethon Institute for Gene Therapy, Milan, Italy and 4Center for Definitive and Curative Medicine, Stanford School of Medicine, Stanford, CA, USA *BC and MJU contributed equally as co-first authors #AMC and MGR contributed equally as co-senior authors ABSTRACT ype 1 regulatory (Tr1) T cells induced by enforced expression of interleukin-10 (LV-10) are being developed as a novel treatment for Tchemotherapy-resistant myeloid leukemias. In vivo, LV-10 cells do not cause graft-versus-host disease while mediating graft-versus-leukemia effect against adult acute myeloid leukemia (AML). Since pediatric AML (pAML) and adult AML are different on a genetic and epigenetic level, we investigate herein whether LV-10 cells also efficiently kill pAML cells. We show that the majority of primary pAML are killed by LV-10 cells, with different levels of sensitivity to killing. Transcriptionally, pAML sensitive to LV-10 killing expressed a myeloid maturation signature.
    [Show full text]
  • Dnp63a Represses Anti-Proliferative Genes Via H2A.Z Deposition
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press DNp63a represses anti-proliferative genes via H2A.Z deposition Corrie L. Gallant-Behm,1,2 Matthew R. Ramsey,3 Claire L. Bensard,1,2 Ignacio Nojek,1,2 Jack Tran,1,2 Minghua Liu,1,2 Leif W. Ellisen,3 and Joaquı´n M. Espinosa1,2,4 1Howard Hughes Medical Institute, 2Department of Molecular, Cellular, and Developmental Biology, University of Colorado at Boulder, Boulder, Colorado 80309, USA; 3Massachusetts General Hospital Cancer Center, Harvard Medical School, Boston, Massachusetts 02114, USA DNp63a is a member of the p53 family of transcription factors that functions as an oncogene in squamous cell carcinomas (SCCs). Because DNp63a and p53 bind virtually identical DNA sequence motifs, it has been proposed that DNp63a functions as a dominant-negative inhibitor of p53 to promote proliferation and block apoptosis. However, most SCCs concurrently overexpress DNp63a and inactivate p53, suggesting the autonomous action of these oncogenic events. Here we report the discovery of a novel mechanism of transcriptional repression by DNp63a that reconciles these observations. We found that although both proteins bind the same genomic sites, they regulate largely nonoverlapping gene sets. Upon activation, p53 binds all enhancers regardless of DNp63a status but fails to transactivate genes repressed by DNp63a. We found that DNp63a associates with the SRCAP chromatin regulatory complex involved in H2A/H2A.Z exchange and mediates H2A.Z deposition at its target loci. Interestingly, knockdown of SRCAP subunits or H2A.Z leads to specific induction of DNp63a-repressed genes. We identified SAMD9L as a key anti-proliferative gene repressed by DNp63a and H2A.Z whose depletion suffices to reverse the arrest phenotype caused by DNp63a knockdown.
    [Show full text]
  • RET/PTC-Induced Gene Expression in Thyroid PCCL3 Cells Reveals Early Activation of Genes Involved in Regulation of the Immune Response
    Endocrine-Related Cancer (2005) 12 319–334 RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response E Puxeddu1,4, J A Knauf1, M A Sartor2, N Mitsutake1, E P Smith1, M Medvedovic2, C R Tomlinson3, S Moretti4 and J A Fagin1 1Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267, USA 2Center for Biostatistic Service, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267, USA 3Center for Environmental Genetics, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267, USA 4Dipartimento di Medicina Interna, Universita` degli Studi di Perugia, Perugia 06126, Italy (Requests for offprints should be addressed to J A Fagin; Email: [email protected]) Abstract RET/PTC rearrangements represent key genetic events involved in papillary thyroid carcinoma (PTC) initiation. The aim of the present study was to identify the early changes in gene expression induced by RET/PTC in thyroid cells. For this purpose, microarray analysis was conducted on PCCL3 cells conditionally expressing the RET/PTC3 oncogene. Gene expression profiling 48 h after activation of RET/PTC3 identified a statistically significant modification of expression of 270 genes. Quantitative PCR confirmation of 20 of these demonstrated 90% accuracy of the microarray. Functional clustering of genes with greater than or less than 1.75-fold expression change (86 genes) revealed RET/PTC3-induced regulation of genes with key functions in apoptosis (Ripk3, Tdga), cell–cell signaling (Cdh6, Fn1), cell cycle (Il24), immune and inflammation response (Cxcl10, Scya2, Il6, Gbp2, Oas1, Tap1, RT1Aw2, C2ta, Irf1, Lmp2, Psme2, Prkr), metabolism (Aldob, Ptges, Nd2, Gss, Gstt1), signal transduction (Socs3, Nf1, Jak2, Cpg21, Dusp6, Socs1, Stat1, Stat3, Cish) and transcription (Nr4a1, Junb, Hfh1, Runx1, Foxe1).
    [Show full text]
  • Loss of Mitochondrial Protease CLPP Activates Type I Interferon Responses Through The
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.30.274712; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Loss of mitochondrial protease CLPP activates type I interferon responses through the 2 mtDNA-cGAS-STING signaling axis. 3 4 Sylvia Torres-Odio*, Yuanjiu Lei*, Suzana Gispert†, Antonia Maletzko†, Jana Key†, Saeed 5 Menissy*, Ilka Wittig‡, Georg Auburger†, A. Phillip West*# 6 7 *Department of Microbial Pathogenesis and Immunology, College of Medicine, Texas A&M 8 University Health Science Center, Bryan, TX 77807, USA 9 †Experimental Neurology and ‡Functional Proteomics, Faculty of Medicine, Goethe University, 10 60590 Frankfurt am Main, Germany 11 12 # Correspondence to: [email protected] 13 14 Abstract 15 Caseinolytic mitochondrial matrix peptidase proteolytic subunit, CLPP, is a serine protease that 16 degrades damaged or misfolded mitochondrial proteins. CLPP null mice exhibit growth 17 retardation, deafness, and sterility, resembling human Perrault syndrome (PS), but also display 18 immune system alterations. However, the molecular mechanisms and signaling pathways 19 underlying immunological changes in CLPP null mice remain unclear. Here we report the steady 20 state activation of type I interferon (IFN-I) signaling and antiviral gene expression in CLPP 21 deficient cells and tissues. Depletion of the cyclic GMP-AMP (cGAS)-Stimulator of Interferon 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.30.274712; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]