Identification and Characterization of Amelogenin Genes in Monotremes, Reptiles, and Amphibians (Tooth Formation͞evolutionary Innovations)

Proc. Natl. Acad. Sci. USA Vol. 95, pp. 13056–13061, October 1998 Evolution

Identification and characterization of amelogenin genes in monotremes, reptiles, and amphibians (tooth formation͞evolutionary innovations)

SATORU TOYOSAWA*†,COLM O’HUIGIN*, FELIPE FIGUEROA*, HERBERT TICHY*, AND JAN KLEIN*‡

*Max-Planck-Institut fu¨r Biologie, Abteilung Immungenetik, Corrensstrasse 42, D-72076 Tu¨bingen, Germany

Edited by Susumu Ohno, Beckman Research Institute of the City of Hope, Duarte, CA, and approved August 25, 1998 (received for review June 8, 1998)

ABSTRACT Two features make the tooth an excellent tified, one on the X and the other on the Y chromosome model in the study of evolutionary innovations: the relative (10–15); in rodents, only the X linked gene has been found (14, simplicity of its structure and the fact that the major tooth- 15). Immunohistochemical analysis has indicated the possible forming genes have been identified in eutherian mammals. To existence of amelogenin-like compounds in reptiles and am- understand the nature of the innovation at the molecular level, phibians (16, 17). The nature of an enamel-like material, it is necessary to identify the homologs of tooth-forming genes sometimes referred to as enameloid, remains unresolved and in other vertebrates. As a first step toward this goal, homologs controversial. As part of a systematic effort to elucidate the of the eutherian amelogenin gene have been cloned and emergence of teeth in evolution, we have initiated a study characterized in selected species of monotremes (platypus and aimed at cloning the major tooth-forming genes of species echidna), reptiles (caiman), and amphibians (African clawed representing gnathostome classes. Here we describe ameloge- toad). Comparisons of the homologs reveal that the amelogenin-encoding cDNA clones isolated from reptiles and amphib- nin gene evolves quickly in the repeat region, in which ians as well as single-exon PCR products from monotremes. numerous insertions and deletions have obliterated any similarity among the genes, and slowly in other regions. The gene organization, the distribution of hydrophobic and hydrophilic MATERIALS AND METHODS segments in the encoded protein, and several other features Source and Isolation of DNA. DNA samples from platypus have been conserved throughout the evolution of the tetrapod (Ornithorhynchus anatinus) and the short-nosed echidna amelogenin gene. Clones corresponding to one locus only were (Tachyglossus aculeatus) were provided by Robert W. Slade found in caiman, whereas the clawed toad possesses at least (Queensland Institute for Medical Research, Royal Brisbane two amelogenin-encoding loci. Hospital, Australia). Tissue samples from 3-day-old smooth- fronted caimans (Paleosuchus palpebrosus) and adult African One of the major innovations accompanying the emergence of clawed toads (Xenopus laevis) were kept frozen at Ϫ70°C until jawed vertebrates was the development of teeth, presumably their use. Genomic DNA was isolated from the tissues by from dermal scales (1). The concurrent development of jaws phenol-chloroform extraction (18). and teeth generated a new type of feeding device—biting cDNA Library Construction and Screening. The caimans and structures that enabled gnathostomes to colonize new envi- the African clawed toads were killed under anesthesia, and their ronmental niches and thus allow their adaptive radiation. To jaws were removed and immediately frozen in liquid nitrogen. understand how this innovation occurred, it is necessary to The frozen tissues were homogenized to a fine powder, and total delineate the evolutionary history of the genes involved in RNA was extracted (19). Poly(A)ϩ RNA isolation and cDNA tooth development, in particular those responsible for the synthesis were performed with the mRNA purification kit (Phar- formation of the two characteristic tooth components, the macia) and the TimeSaver cDNA synthesis kit (Pharmacia), enamel and the dentin. Tooth enamel is one of the most highly respectively. The cDNA was inserted into the EcoRI-digested ␭ mineralized tissues known (2). It is formed in the early stages gt10 vector (Stratagene), and the cDNA library was in vitro- of odontogenesis by ameloblasts, which synthesize and secrete packaged with the help of the Gigapack cloning kit (Stratagene) several matrix proteins. Later, during the stage of enamel and used to transform competent Escherichia coli NM514 bac- maturation, the production of matrix proteins wanes, and the teria. The initial titers of the libraries were 1.2 ϫ 106 plaque- proteins already produced are gradually replaced by hydroxy- forming units (pfu) for the caiman, and 6 ϫ 105 pfu for the apatite crystals. The main matrix protein, amelogenin, is African clawed toad. The caiman and African clawed toad thought to be involved in the regulation of enamel crystallite libraries were amplified once to a titer of 1.5 ϫ 1011 pfu͞ml and formation, presumably by providing the hydrophobic environ- 1.8 ϫ 1011 pfu͞ml, respectively. ment necessary for the initiation and growth of calcium PCR Amplification. hydroxyapatite crystals (2). The amelogenin genes of the Amelogenin-encoding cDNA clones have been isolated monotremes (platypus, echidna) and the caiman were ampli- from several representatives of mammals, including humans fied by using primers based on a comparison of human, cattle, (3), cattle (4), pig (5), rat (6), mouse (7), and opossum (8). The presence of amelogenin-encoding genes in wallaby (9) and This paper was submitted directly (Track II) to the Proceedings office. platypus (9) has been indicated by Southern blot hybridization, Abbreviations: Myr, million years; pfu, plaque-forming units; UTR, untranslated region. but no sequence has been presented to date. In the bovids and Data deposition: The sequences reported in this paper have been anthropoid primates, two amelogenin genes have been iden- deposited in the GenBank database [accession nos. AF095566 (platypus), AF095567 (echidna), AF095568 (caiman), AF095569 (toad-1), The publication costs of this article were defrayed in part by page charge and AF095570 (toad-2)]. †Permanent address: Department of Oral Pathology, Osaka Univer- payment. This article must therefore be hereby marked ‘‘advertisement’’ in sity Faculty of Dentistry, 1-8 Yamadaoka, Suita, Osaka 565-0871, accordance with 18 U.S.C. §1734 solely to indicate this fact. Japan. © 1998 by The National Academy of Sciences 0027-8424͞98͞9513056-6$2.00͞0 ‡To whom reprint requests should be addressed. e-mail: jan.klein@ PNAS is available online at www.pnas.org. tuebingen.mpg.de.

13056 Downloaded by guest on October 2, 2021 Evolution: Toyosawa et al. Proc. Natl. Acad. Sci. USA 95 (1998) 13057

pig, rat, mouse, and marsupial sequences. In the case of the broth, and minipreps were prepared according to the standard monotremes, primers AM1 (sense; 5Ј-TATGGTTACGAA- protocol (20). Two to five micrograms of DNA were used in the CCCATGGGTGGATGG-3Ј) and AM2 (antisense; 5Ј- dideoxy sequencing reactions with the AutoRead sequencing ATCCACTTCTTCCCGCTTGGTCTTGTC-3Ј) were used to kit (Pharmacia). The reactions were then processed by the amplify 420-bp fragments of the amelogenin exon 6 sequence. Automated Laser Fluorescent (ALF) sequencer (Pharmacia). In the caiman, primers AM6 (sense; 5Ј-GAA-CCCATGGGT- To determine the exon-intron organization of the caiman and GGATGGCTGCACCA-3Ј) and AM2 were used for the orig- toad amelogenin genes, the genomic sequence data were inal amplification, and primers AM6 and Tu1360 (antisense; compared with the cDNA sequences and exon–intron bound- 5Ј-GGCAGCAGTGGGGGCAGAGGCTG-3Ј) were then aries were identified by comparison with the published con- used for half-nested PCR to amplify a 370-bp fragment of sensus sequences (21). amelogenin exon 6 sequence from genomic DNA. The primers For Southern blots, 10 ␮g of genomic DNA was digested with AM8 (sense; 5Ј-CAGACTCTCACACCTCACCACCA-3Ј) the appropriate restriction enzyme, and the resulting fragments and AM7 (antisense; 5Ј-TTGTTGCTGTGGTATAGGCAT- were separated in 0.8% agarose gels (Gibco͞BRL) and trans- CAT-3Ј), designed within the 370-bp product amplified by the ferred to a hybridization membrane (Hybond-Nϩ, Amersham) by primers above, were used to recover inserts by anchored PCR. using the VacuGene blotting system (Pharmacia). The filters In the case of the African clawed toad, primer AM10 (sense; were incubated for5hinaprehybridization solution containing 5Ј-CCTGGTTATGTCAACTTCAGTTATGA-3Ј), based on 1ϫ Denhardt’s solution (0.02% polyvinylpyrrolidone͞0.02% Fi- the caiman amelogenin sequence, was used to amplify a coll͞0.02% BSA)͞5ϫ standard saline citrate (SSC, 1ϫ SSC ϭ fragment of about 600 bp by anchored PCR. The primer AM22 0.15 M sodium chloride͞0.015 M sodium citrate, pH 7)͞0.2% (antisense; 5Ј-CATCATAGATTGGTA-CCATTT-3Ј), de- SDS͞5 ϫ 106 cpm of the probe, which was labeled by using the signed within the fragment of the toad amelogenin product random-priming method with 32P to a specific activity of 1 ϫ 109 amplified by the above primers, was used to recover the 5Ј cpm͞␮g with the Ready-To-Go DNA labeling kit (Pharmacia). region of the inserts by anchored PCR. To determine the Filters were washed in 2ϫ SSC͞0.1% SDS for 20 min at room organization of the caiman and toad amelogenin genes, prim- temperature and then used to expose XAR5 film (Kodak) with ers were designed to amplify regions of the individual exon– intensifying screens for 3–5 days. intron boundaries (Table 1). The primer AM57 (antisense; Data Analysis. The nucleotide sequences and inferred pro- 5Ј-ATTCTGGCTCTCGTGGTCAGGTTT-3Ј) was used to tein sequences were aligned with the aid of the GCG package confirm the identities of the second toad amelogenin clone. (Genetic Computer Group, Madison, WI) and the SEQPUP (ref. Genomic DNA (100 ng͞␮l) or lysate of the cDNA libraries (1 22; available at http:͞͞iubio.bio.indiana.edu͞soft͞molbio) ␮l) were amplified by PCR in 50 ␮l of PCR buffer (1.5 mM computer program. The evolutionary relationships were then ͞ ␮ ͞ MgCl2 200 M dNTP 10 mM Tris, pH 8.5) in the presence evaluated by the neighbor-joining algorithm (23). of the sense and antisense primers and 2.5 units of Taq polymerase (Pharmacia). Amplifications were performed in RESULTS AND DISCUSSION the RoboCycler Gradient 96 (Stratagene) in 35 cycles, each cycle consisting of 1 min of denaturation at 94°C, 1 min of PCR amplification of platypus and echidna genomic DNA annealing at the annealing temperature, and 3 min of extension using the primer pair AM1͞AM2 yielded in both instances a at 72°C. The final extension was for 10 min at 72°C. 420-bp fragment that cloning and sequencing revealed to be Cloning, Sequencing, and Blotting. One microgram of a homologous to part of exon 6 of the amelogenin gene (Figs. 1 PCR product was isolated from an agarose gel (Gibco͞BRL) and 2). Half-nested PCR with the primer pairs AM6͞AM2 by using the Qiagen (Hilden, Germany) extraction kit. The and AM6͞Tu1360 and caiman genomic DNA yielded a 370-bp isolated DNA was ligated to SmaI-digested pUC18 plasmid amplification product; the product’s sequence, homologous to vector with the SureClone ligation kit (Pharmacia) and used to amelogenin exon 6 sequence, was then used to design primers transform competent E. coli XL-1 blue bacteria. Transfor- AM7 and AM8 for the amplification of a cDNA clone by mants were grown overnight in Luria–Bertani (LB)-ampicillin anchored PCR. Four clones could be amplified from the

Table 1. Oligonucleotide primers used in the determination of exon-intron boundaries Primer Specificity designation Sequence exon, codon Orientation Caiman AM-19 TAGAGAATTTAGCTGGAGTACTTC E1, 5ЈUTR S AM-20 AGTGATCAACATCCAGCCCTCCAT E2, 1–8 A AM-14 ATCACTTGCCTACTAGGTGCA E2, 7–13 S AM-16 TCATAACTGAAGTTGACATAACC E3, 27–34 A AM-9 CATCATCCTGGTTATGTCAACTT E3, 24–31 S AM-15 TTGTCTCATCAGGCTCTGGTACCA E5, 41–48 A AM-12 TTAACACCTTTGAAATGGTACCA E5, 36–43 S AM-13 TAACATTGGCTGGTGTAGCCATCC E6, 60–67 A AM-17 TGGCGGCCAATGGACAAGACCAA E6, 209–216 S AM-18 ACTCCAGTGGAATGATGGATTCTTGA E7, 3ЈUTR A African clawed toad (toad 1) AM-24 CTAATGCTAACAGCTCTCATT E2, 5–11 S AM-25 CTCATAACTGAAGTTCACATACCC E3, 27–34 A AM-26 CAGCATCCTGGGTATGTGAACTT E3, 24–31 S AM-27 CTGATGTGTCATCATAGATTGGTA E4, 42–49 A AM-28 TTATCACCTTTGAAATGGTACCAA E5, 36–43 S AM-29 AATTGGGTTCTGAAGCCAGCCAGA E6, 59–66 A AM-40 TATCCAAATTACGGCTATGAACCT E6, 50–57 S AM-39 AAAGTACAGTAAACAATATTCTG E7, 3ЈUTR A A, antisense; S, sense; E, exon; UTR, untranslated region. Downloaded by guest on October 2, 2021 13058 Evolution: Toyosawa et al. Proc. Natl. Acad. Sci. USA 95 (1998)

FIG. 1. Structural organization of the human, caiman, and African clawed toad amelogenin genes. Exons, indicated by boxes, are numbered 1–7, and the numbers below exons indicate the length in base pairs. The variable length of human X and Y exons is indicated by two numbers separated by a slash. Exons known to be alternatively spliced are indicated by hatched boxes. The first exon–intron boundary in the toad amelogenin genes has not been identified.

cDNA library. One, amplified with the AM8 primer, was 600 amelogenin gene (10, 12) except for the boundary between bp long and contained the 3Ј untranslated region (UTR). exon 1 and intron 1 (part of the 5ЈUTR), which in the caiman Another, amplified with the AM7 primer, was 420 bp long and gene is 7 bp upstream of the mammalian splice site. The encompassed a portion of the 5ЈUTR 48 bp upstream from the putative AATAAA polyadenylation signal of the caiman gene initiation codon to the coding sequence to codon 110. The is located 13 bp upstream from the poly(A) tail. third clone, amplified by the same primer as the second clone, The caiman-based primer AM10 was also used in anchored was 390 bp long and encompassed roughly the same cDNA PCR to amplify two clones from a toad cDNA library. The segment as the second clone (it started 63 bp upstream from clones were of similar length, 650 bp and 680 bp, respectively, the initiation codon); the shorter length of the third clone and encompassed the same region, from codon 35 to the resulted from the deletion of exon 3, presumably by alternative 3ЈUTR. The 5Ј ends of the two transcripts were obtained by splicing. Several isoforms generated by alternative splicing anchored PCR with the primer AM22 positioned to give a have been described for amelogenin transcripts in human, 16-bp overlap with each of the two clones. The two clones cattle, pig, rat, and mouse (5, 7, 11, 12, 24). Apart from the differed by numerous substitutions, as well as by some inser- difference in exon 3, the two clones were identical in their tions and deletions (Fig. 2). To establish their identities, primer sequence and were probably derived from the same gene. The AM39, based on the sequence of the 3ЈUTR, was used in fourth clone, amplified by the use of primer AM18 designed on anchored PCR to amplify a full-length coding sequence of the the basis of the 3ЈUTR sequence of the first clone, was 790 bp toad-1 clone, and the primer AM57 was used to amplify almost long and extended from the 5ЈUTR to the 3ЈUTR. The coding the entire coding sequence of the toad-2 clone. The differences sequence of this clone consisted of 597 bp encoding a polypep- between the two clones could thus be verified, and hence it tide chain of 199 amino acid residues (Figs. 1 and 2). Exon– could be established that the clones were derived from differ- intron boundaries of the caiman amelogenin gene were deter- ent genes. The full-length sequence of the toad-1 contained mined by sequencing the relevant regions of genomic DNA. 519 bp of coding sequence specifying a polypeptide 173 They corresponded to the borders reported for the mammalian residues long, whereas the full-length sequence of the toad-2

FIG. 2. Amino acid alignment of amelogenin sequences. A simple- majority consensus sequence is shown at the top. Identity with the consensus is indicated by a dash (-); an asterisk indicates an alignment gap, and a (ء) dot (⅐) indicates an unknown sequence. The common names of the species are shown together with accession codes for sequences obtained from databases. Downloaded by guest on October 2, 2021 Evolution: Toyosawa et al. Proc. Natl. Acad. Sci. USA 95 (1998) 13059

comprised 552 bp of coding sequence translatable into a polypeptide chain 184 residues long (Fig. 2). Exon–intron boundaries of the toad-1 amelogenin gene were determined by the same method as was the caiman gene. The boundaries were the same as in the mammalian amelogenin gene, with the intron length ranging from 1.2–1.5 kb (Table 2), and the AATAAA polyadenylation signals of toad-1 and -2 genes were located 19 bp and 20 bp upstream of the poly(A) tail, respectively. To test whether the two toad amelogenin genes are alleles or whether they are derived from two loci, we performed Southern blot analyses. We digested genomic toad DNA with the HindIII, EcoRI, and TaqI restriction endonucleases, blot- ted the digests, and hybridized the blots with a 32P-labeled, nearly full-length cDNA probe. In all three blots, two distinct hybridizing bands were clearly recognizable, their sizes being 4.5 and 1.5 kb, 2.4 and 1.8 kb, and 3.2 and 2.0 kb for the HindIII, EcoRI, and TaqI digests, respectively (data not shown). This result is consistent with the presence of two amelogenin loci in the toad genome. In eutherian mammals, the amelogenin molecule has been described as consisting of three regions (26): the N-terminal tyrosine-rich amelogenin protein (TRAP) sequence of some 44–45 residues; the hydrophobic core sequence of some 100–130 residues; and the acidic hydrophilic C-terminal sequence of some 15 residues. The amino acid alignments of the monotreme, reptilian, and amphibian amelogenin sequences with the sequences of the eutherian mammals (Fig. 2), as well as the hydrophilicity plots of all of these molecules (Fig. 3) indicate that this division is a general feature of the amelogenin molecule. The six tyrosine residues of the TRAP region are FIG. 3. Hydrophilicity plot of amelogenins from selected species conserved in all of the amelogenins for which sequence prepared by using the method of Kyte and Doolittle (25). The plots share the following characteristics: the hydrophobic leader peptide of information is available. This region also contains two other about 20 amino acid residues is followed by a short hydrophilic segment conserved features, the N-linked glycosylation site at residue (10 residues), another short hydrophobic segment (10 residues), and a 30 and the serine phosphorylation site at position 32 (Fig. 2). larger hydrophilic segment (about 20 residues). The conserved ␣-he- Whether amelogenins are glycosylated remains controversial lical segment lies on the border of the hydrophobic and hydrophilic (27). The conservation of the one glycosylation site suggests, domains (approximately corresponding to residues 35–45). This however, that it may be functional. Like the eutherian mam- shared hydrophobicity signature is followed by a more variable internal mals, the reptiles and amphibians possess a hydrophobic core segment (residues 60–110) of irregularly alternating hydrophilicity and region rich in Pro and Gln residues in their amelogenin hydrophobicity. The repeat region (residues 110–190) and the C- terminal region are hydrophilic. Although the primary sequence of molecules (caiman 27% Pro, 14% Gln; toad-1 product 22% amelogenin varies greatly between species, the hydropathy pattern is Pro, 11% Gln; and toad-2 product 20% Pro, 13% Gln, as well conserved. compared with 23–28% Pro and 13–17% Gln in the amelogenin of eutherian mammals). The application of the 3D-1D terminal region of the amelogenin molecule has been con- compatibility algorithm (28) to this region has revealed the served during the entire period of tetrapod evolution (Fig. 3). presence of a conserved ␣-helix extending between positions In some eutherians (human, cattle) the amelogenin genes 39 and 48 (Fig. 2). The C-terminal portion of the core region exist as copies on both the X and Y chromosomes. The X and contains multiple tripeptide repeat sequences (Pro-X-Gln)n Y linked loci do not evolve in concert, and several differences, that are apparently responsible for the variability observed including substitutions and indels, have arisen between the among the different proteins. The hydrophilicity of the C- copies. It has been suggested that the human X and Y linked

Table 2. Exon-intron organization of caiman and African clawed toad amelogenin genes Size Sequence of exon-intron junctions Exon, Intron, Gene bases kb 5Ј Boundary Intron 3Ј Boundary Caiman 1 1.3 TTC TAC AG gtaaacct.....tttttcag G TAC TAT 2 73 0.6 GCT ATA CCA gtgagtat.....tttaacag TTG CCT CCC 3 48 1.5 AGT TAT GAG gtaaaaca.....ccctgaag GTG TTA ACA 5 45 0.8 AGA CAA CCG gtaaacat.....ccctgtag TAT TCA TCC 6 447 1.3 GAG GAA ATA gtaagaag.....tctttcag GAT TAA AGA 7 Ͼ200 African clawed toad (toad 1) 2 1.2 TCT GTT CCT gtaagtat.....atttgcag CTT CCG CCT 3 48 1.5 AGT TAT GAG gtatgtca.....tatccaag ATA TTA TCA 5 45 1.5 ACA CAT CAG gtaagaat.....tttcccag TAT CCA AAT 6 369 1.3 GAG GAA CTG gtaaatat.....ttttatag GAT TAG AAG 7 Ͼ160 Downloaded by guest on October 2, 2021 13060 Evolution: Toyosawa et al. Proc. Natl. Acad. Sci. USA 95 (1998)

FIG. 4. Plot of nonsynonymous substitution percent (Ka%) against amino acid residue position (num- bering follows that of Fig. 2) in selected pairwise comparisons of human (H), cattle (Ct), rat (R), caiman (C), and toad-2 (T) amelogenin sequences. An initial sliding window of 30 codons was used to estimate Ka by the method of Li et al. (32), and a further sliding window of 30 codons was used to smooth the values obtained. Small alignment gaps (Ͻ8 residues) were ignored in the plot; larger gaps are indicated by vertical lines.

genes have been independently evolving for 45 million years identity of inferred mouse and rat amelogenin amino acid (Myr) (14, 29). It is also probable that the Y linked gene, sequences; the species might have diverged as long as 40 Myr although containing no inactivating mutation, is not under ago (33). The synonymous substitution rate of the amelogenin strong functional constraint because it is normally masked by gene is also low. In human-rodent comparisons the number of the X linked gene and cannot provide protection when the X synonymous substitutions per site averages 23.1%, which is linked gene is inactive, as in X linked amelogenesis imperfecta lower than similar comparisons for 28 human-rodent gene (30). The eutherian Y linked copy may therefore be tending pairs made by O’hUigin and Li (34). toward pseudogene status. Even if the amelogenin gene is Although the overall evolutionary rate for amelogenin is autosomal, as in marsupials and monotremes, there is some slow, some regions of the polypeptide appear to evolve rapidly evidence for the presence of multiple amelogenin loci (9). The and undergo insertions or deletions of codons readily. This is present work indicates that at least two amelogenin loci exist apparent in the proline͞glutamine repeat region (residues in the toad, a known polyploid (31). On the other hand, there 120–200) of exon 6. The cattle X linked, as well as the opossum is no evidence for multiple expressed loci in the caiman. and caiman sequences, are up to 28 aa longer in this region In eutherian mammals, the average nonsynonymous evolu- than other sequences. Because the repeat region lies within an tionary rate of the amelogenin genes (0.5 ϫ 10Ϫ9 per nonsyn- exon, these indels are not a result of alternative splicing. The onymous site per year) is less than the average found for 40 lack of constraint in the repeat region is seen in the absence of genes (0.9 ϫ 10Ϫ9 per site per year) by Li et al. (32). Slow similarity between mammalian, caiman, and toad sequences at evolution of the gene in eutherians is also indicated by the positions 70–190 of the alignment (Fig. 2). The variability of

FIG. 5. Neighbor-joining tree of sequences shown in Fig. 2. Distances were estimated from the proportion of differences in pairwise comparisons following exclusion of gaps. The common names of the species are indicated together with accession codes for sequences obtained from the databases. Numbers on the nodes indicate the percent recovery of that node in 500 bootstrap replications. Downloaded by guest on October 2, 2021 Evolution: Toyosawa et al. Proc. Natl. Acad. Sci. USA 95 (1998) 13061

the repeat region even between closely related genes suggests 3. Shimokawa, H., Tamura, H., Ibaraki, K. & Sasaki, S. (1989) in that there is a strong propensity for indels to occur frequently, Tooth Enamel V, ed. Fearnhead, R. W. (Florence Publishers, perhaps by replication slippage between the repeat motifs. Yokohama, Japan), pp. 301–305. To determine whether functional constraints limit the evo- 4. Shimokawa, H., Sobel, M. E., Sasaki, M., Termine, J. D. & lutionary rates in any particular part of the gene, the depen- Young, M. F. (1987) J. Biol. Chem. 262, 4042–4047. 5. Hu, C.-C., Bartlett, J. D., Zhang, C. H., Qian, Q., Ryu, O. H. & dence of nonsynonymous substitution rates on their position Simmer, J. P. (1996) J. Dent. Res. 75, 1735–1741. within the gene was examined. A sliding window of 30 codons 6. Bonass, W. A., Robinson, P. A., Kirkham, J., Shore, R. C. & was used within which nonsynonymous substitution rates were Robinson, C. (1994) Biochem. Biophys. Res. Commun. 198, 755–763. measured for several gene pairs. In this way, tendencies 7. Lau, E. C., Simmer, J. P., Bringas, P., Jr., Hsu, D. D.-J., Hu, C.-C., apparent in particular pairwise comparisons can be verified by Zeichner-David, M., Thiemann, F., Snead, M. L., Slavkin, H. C. checking for the same tendency in other comparisons. Because & Fincham, A. G. (1992) Biochem. Biophys. Res. Commun. 188, of their uncertain functional status, the Y linked genes were 1253–1260. omitted from the study. The analysis shows that the region 8. Hu, C.-C., Zhang, C., Qian, Q., Ryu, O. H., Moradian-Oldak, J., from residues 30–40 (Fig. 4) and involving the C-terminal part Fincham, A. G. & Simmer, J. P. (1996) J. Dent. Res. 75, 1728–1734. (residues 200–220) tends toward conservation in pairwise 9. Watson, J. M., Spencer, J. A., Marshall-Graves, J. A., Snead, M. L. & Lau, E. C. (1992) Genomics 14, 785–789. comparisons involving caiman, toad, human, rat, and cattle. ␣ 10. Gibson, C. W., Golub, E., Herold, R., Risser, M., Ding, W., Analysis of peptide secondary structure predicts that -helices Shimokawa, H., Young, M. F., Termine, J. D. & Rosenbloom, J. form in the first conserved region (residues 35–45) in all (1991) Biochemistry 30, 1075–1079. eutherian as well as in reptilian and amphibian amelogenins 11. Gibson, C. W., Golub, E., Abrams, W. R., Shen, G., Ding, W. & (not shown), and that this structure is subject to strong Rosenbloom, J. (1992) Biochemistry 31, 8384–8388. functional constraint. The repeat region and its flanks (resi- 12. Salido, E. C., Yen, P. H., Koprivnikar, K., Yu, L.-C. & Shapiro, dues 60–200) is most divergent in all comparisons. By contrast, L. J. (1992) Am. J. Hum. Genet. 50, 303–316. comparisons of human or cattle X and Y linked genes show 13. Bailey, D. M. D., Affara, N. A. & Ferguson-Smith, M. A. (1992) that not all of these regions are well conserved, presumably Genomics 14, 203–205. 14. Lau, E. C., Mohandas, T. K., Shapiro, L. J., Slavkin, H. C. & because of reduced functional constraints in the Y linked Snead, M. L. (1989) Genomics 4, 162–168. genes. 15. Nakahori, Y., Takenaka, O. & Nakagome, Y. (1991) Genomics A phylogenetic tree based on protein sequences of all 9, 264–269. available amelogenin sequences (Fig. 5) shows that the se- 16. Slavkin, H. C., Zeichner-David, M., Snead, M. L., Graham, E. A., quences group as expected, giving distinct clades for eutherian Samuel, N. & Ferguson, M. W. J. (1984) in The Structure, and noneutherian mammals, as well as a branch containing the Development, and Evolution of Reptiles, ed. Ferguson, M. W. J. caiman sequence only and a clade of the two toad sequences. (Academic, London), pp. 275–304. We interpret the tree as indicating that the multiple copies of 17. Herold, R., Rosenbloom, J. & Granovsky, M. (1989) Calcif. amelogenin arose in different ways in several species. The Tissue Int. 45, 88–94. sequences may represent polymorphisms in the rat, sex-linked 18. Ausubel, F. M., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K., eds. (1988) Current Protocols in Molecular divergences in humans and cattle, and polyploidization in the Biology (Wiley, New York). toad. In species possessing the Y linked sequence (human and 19. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutler, cattle), the branch length joining it to the X linked sequence W. J. (1979) Biochemistry 18, 5294–5299. is long, indicating that more replacements have occurred in the 20. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Y linked lineage than in the X linked lineage. This observation Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, supports the conjecture that the Y linked genes are less Plainview, NY). functionally constrained. Similarly, the toad-2 sequence has a 21. Breathnach, R. & Chambon, P. (1981) Annu. Rev. Biochem. 50, longer terminal-branch length than the toad-1 sequence. 349–383. Again, this may indicate a difference in functional constraint, 22. Gilbert, D. G. (1995) SEQPUP, A Biosequence Editor and Analysis although the long divergences from other sequences and the Application, Version 0.4j. 23. Saitou, N. & Nei, M. (1987) Mol. Biol. Evol. 4, 406–425. presence of many indels in the variable region may obscure the 24. Li, R., Li, W. & DenBesten, P. K. (1995) J. Dent. Res. 74, relationships between the toad sequences. 1880–1885. The availability of amelogenin sequences in representatives 25. Kyte, J. & Doolittle, R. F. (1982) J. Mol. Biol. 157, 105–132. of reptiles and amphibians should facilitate the search for 26. Fincham, A. G. & Simmer, J. P. (1997) in Dental Enamel, Ciba homologous genes in fishes on the one hand, and birds on the Foundation Symposium 205, eds. Chadwick, D. J. & Cardew, G. other. The former were apparently the first vertebrates to (Wiley, New York), pp. 118–130. develop teeth (35), and the latter lost the ability to form teeth 27. Fincham, A. G., Hu, Y., Lau, E. C., Slavkin, H. C. & Snead, M. L. more than 120 Myr ago. [Although the family of neotropical (1991) Arch. Oral. Biol. 36, 305–317. wood-quails is referred to as Odontophorinae, i.e., ‘‘tooth- 28. Ito, M., Matsuo, Y. & Nishikawa, K. (1997) Comput. Appl. Biosci. 13, bearing,’’ these birds, too, are in fact toothless. The designation 415–423. 29. Yen, P. H., Marsh, B., Allen, E., Tsai, S. P., Ellison, J., Connolly, refers to the serrated or ‘‘toothed’’ appearance of the lower L., Neiswanger, K. & Shapiro, L. J. (1988) Cell 55, 1123–1135. jaw’s cutting edge, which, like the rest of their stout bill, has 30. Lagerstro¨m, M., Dahl, N., Iselius, L., Ba¨ckman,B. & Pettersson, ontogenetically nothing in common with true teeth (36). U. (1990) Am. J. Hum. Genet. 46, 120–125. Similarly, the ‘‘egg tooth,’’ a small sharp projection on the 31. Duellman, W. E. & Trueb, L. (1986) in Biology of Amphibians, upper jaw of embryos in many bird species used in opening the eds. Duellman, W. E. & Trueb, L. (McGraw–Hill, New York), pp. egg shell during hatching, is histologically and embryologically 450–452. unrelated to true teeth (37)]. Turtles, alone among the reptiles, 32. Li, W.-H., Wu, C.-I. & Luo, C.-C. (1985) Mol. Biol. Evol. 2, 150–174. have also been toothless for more than 100 Myr. It will be 33. Kumar, S. & Hedges, S. B. (1998) Nature (London) 392, 917–920. interesting to find out whether amelogenin and other genes 34. O’hUigin, C. & Li, W.-H. (1992) J. Mol. Evol. 35, 377–384. 35. Miles, A. E. W. & Poole, D. F. G. (1967) in Structural and involved in tooth formation have been retained by birds and Chemical Organization of Teeth, ed. Miles, A. E. W. (Academic, turtles and used in functions other than tooth formation. London), pp. 3–44. We thank Ms. Niamh Ni Bhleithin for editorial assistance. 36. Sibley, C. G. & Ahlquist, J. E. (1990) Phylogeny and Classification of Birds. A Study in Molecular Evolution (Yale University Press, 1. Ørvig, T. (1967) in Structural and Chemical Organization of Teeth, New Haven, CT). ed. Miles, A. E. W. (Academic, London), pp. 45–110. 37. Campbell, B. & Lack, E. (1985) A Dictionary of Birds (T.&A.D. 2. Deutsch, D. (1989) Anat. Rec. 224, 189–210. Poyser, Carlton, England). Downloaded by guest on October 2, 2021