bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
1 Title: Efficient Immune Cell Genome Engineering with Improved CRISPR Editing Tools
2
3 Authors:
4 Waipan Chan1,*, Rachel A. Gottschalk1,4, Yikun Yao2, Joel L. Pomerantz3 & Ronald N. Germain1,*
5
6 Affiliation:
7 1Lymphocyte Biology Section, Laboratory of Immune System Biology, National Institute of Allergy
8 and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
9 2Molecular Development of the Immune System Section, Laboratory of Immune System Biology,
10 National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD
11 20892
12 3Department of Biological Chemistry and Institute for Cell Engineering, The Johns Hopkins
13 University School of Medicine, Baltimore, MD 21205
14 4Current Address: Department of Immunology, University of Pittsburgh School of Medicine,
15 W1047 Biomedical Science Tower, 200 Lothrop Street, Pittsburgh, PA 15261
16
17 *Corresponding authors: [email protected]; [email protected]
18
19 This work was supported by the Intramural Research Program of NIAID, NIH.
20
21 All animal experiments were done in accordance with the guidelines of the NIAID/NIH
22 Institutional Animal Care and Use Committee.
1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
23 Abstract
24 CRISPR (clustered regularly interspaced short palindromic repeats)-based methods have
25 revolutionized genome engineering and the study of gene-phenotype relationships. However,
26 modifying cells of the innate immune system, especially macrophages, has been challenging
27 because of cell pathology and low targeting efficiency resulting from nucleic acid activation of
28 sensitive intracellular sensors. Likewise, lymphocytes of the adaptive immune system are largely
29 refractory to CRISPR-enhanced homology-directed repair (HDR) due to inefficient or toxic
30 delivery of donor templates via transient transfection methods. To overcome these challenges and
31 limitations, we developed three improved methods for CRISPR-based genome editing using a hit-
32 and-run transient expression strategy to minimize off-target effects and generate more precise
33 genome editing. Overall, our enhanced CRISPR tools and strategies designed to tackle both
34 murine and human immune cell genome engineering are expected to be widely applicable not only
35 in hematopoietic cells but also other mammalian cell types of interest.
36
37 Introduction
38 The bacterial innate defense system CRISPR was discovered more than 3 decades ago (1),
39 yet this game-changing genome engineering technology was not harnessed for human gene
40 editing applications until a series of landmark studies published in 2013 (2–4). Since then, there
41 has been an exponential increase of CRISPR-related publications, mainly focusing on the use of the
42 Cas9 nuclease that comes with unpredictable off-target effects (5–7), hindering its direct
43 application to the clinic. Many research groups have developed novel methods to minimize these
44 potential side-effects (8–14). The Cas9 nickase method is a promising approach due to its strict
45 pairing distance requirement, which makes off-target pairing very unlikely to occur and therefore
2 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
46 minimizes off-target effects. Another straight-forward strategy to reduce CRISPR-Cas9 off-target
47 effects is to limit the expression duration of Cas9 or guide-RNA (gRNA), the same rationale behind
48 the use of Cas9 inhibitors. While this can be achieved using transient transfection methods, the
49 on-target editing efficiency can be compromised (15) as compared to the stable lentiviral
50 transduction methods.
51 Despite many advances in CRISPR technology, to date there have been very few reports of
52 using the Cas9 nickase strategy for immune cell (myeloid cell or lymphocyte) genome engineering.
53 Macrophages are a major cell type involved in innate immune responses and have been especially
54 difficult to modify using available CRISPR methods. In particular, genome editing of macrophage
55 cell lines using all-in-one CRISPR-Cas9 techniques has been inefficient (16) and although newer
56 methods have yielded improved results (17–19), some of these approaches require antibiotic
57 selection and clonal isolation that dramatically delays the phenotyping timeline and risks the loss
58 of original cell properties. To enable high-throughput CRISPR-Cas9 genome-wide knockout (KO)
59 library screens, the murine RAW264.7 macrophage (RAW) cell line has been modified to
60 constitutively express Cas9 for efficient genome editing (20). While constitutive Cas9 and gRNA
61 expression can lead to the accumulation of off-target mutations in the long run, the doxycycline-
62 inducible system pCW-Cas9 (21) helps resolve both issues by controlling the genome editing time
63 window to minimize long-term off-target effects and allowing immediate phenotyping before the
64 onset of potential compensating mechanisms. However, the lack of a live cell marker makes it
65 difficult to identify and isolate the Cas9-expressing population for further analysis. Here we
66 describe a modified method to enable doxycycline-induced Cas9 expression to be tracked by EGFP
67 fluorescence in live single cells and utilize this system to effectively engineer the RAW cell line.
3 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
68 Macrophages are also problematic to engineer due to their innate immune sensors.
69 Lentiviral particles produced from packaging cells such as the HEK293T cell line are usually
70 filtered or spun to remove cell debris. However, this process does not remove many small
71 molecules and exosomes secreted from the exhausted and dying packaging cells. Lentiviral
72 supernatant containing these uncharacterized materials are often directly applied to cell culture
73 and the potential side effects of the treatment due to sensor signaling are often ignored. Here we
74 improve the purity of lentiviral particles to enhance macrophage cell viability post-transduction.
75 With an optimized protocol to transduce primary bone marrow derived macrophages (BMDM)
76 derived from the Cas9 mice (22), we validated our cell-line RAW cell CRISPR-KO phenotypes using
77 the same set of targeting gRNAs with primary macrophages.
78 In contrast to macrophages, lentiviral-mediated CRISPR-KO is highly efficient in human T
79 lymphocytes (20,21). However, this approach is not suitable for CRISPR-HDR applications due to
80 the random integration of the HDR donor template that can create undesired genomic instability.
81 Transient transfection delivery methods such as lipid-based reagents and electroporation systems
82 either yield low transfection efficiency or a high percentage of cell death. Furthermore, compared
83 to the high targeting efficiency (80~90%) of CRISPR-induced NHEJ (non-homologous end joining),
84 the targeting efficiency of CRISPR-induced HDR is generally inefficient (10~20% for large
85 fragment insertion) (23). Many reported HDR applications relevant to immune cell manipulation
86 involve targeting embryos (24) or newborn mice (25), not mature immune T cells. To achieve
87 efficient and precise genome modifications in human Jurkat T cells as a model for mature
88 lymphocyte engineering, we adopted the Cas9 nickase strategy and describe here an antibiotic
89 selection strategy that helps enrich specifically for rare HDR clones following plasmid co-
90 transfection. In addition, we further improved this method to minimize the genomic footprint
4 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
91 created by the antibiotic resistance marker and make it possible for future rounds of genome
92 editing in the same cells using the same strategy.
93 Another issue is enhancement of the efficiency of directed templated mutagenesis. While
94 the NHEJ inhibitor SCR7 (26) and the HDR stimulatory compound RS-1 (27) were reported to
95 enhance CRISPR-Cas9-induced HDR efficiency, the key to shifting the balance between the NHEJ
96 and the HDR DNA repair mechanisms in favor of the latter outcome seems to rely on a high molar
97 ratio of donor DNA to Cas9-gRNA ribonucleoprotein (RNP). This was demonstrated in human
98 primary T cell engineering using 1e6 MOI of AAV6 (adeno-associated virus type 6) transduction to
99 deliver a high copy number of HDR donor templates per target cell (28). AAV is a small single-
100 stranded DNA virus that infrequently integrates into the host genome, making it a safe delivery
101 platform for the HDR donor template. However, the production and purification process of AAV
102 particles is relatively labor-intensive and often requires industrial assistance, which significantly
103 increases the cost and reduces the flexibility of preliminary experiments in the laboratory setting.
104 In addition, the very limited payload of the AAV vector makes it impossible to fit Cas9, gRNA
105 expression and donor template in one AAV backbone. In comparison, lentiviral particles are easy
106 to produce and purify in most laboratories with relatively low cost. Furthermore, the payload of
107 lentiviral particles is large enough to carry Cas9, gRNA expression and donor template all-in-one.
108 Despite these advantages, random integration of lentiviral DNA into the host genome makes it
109 problematic as a platform to deliver the HDR donor template. Here we overcome this limitation
110 by the use of integrase-deficient lentiviral particles (29) and report two examples of this novel
111 approach in human Jurkat T cells.
112 Finally, all these methods involve either gene inactivation or modification. There are
113 numerous situations in which augmented expression of a given gene would be desirable in an
5 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
114 experimental setting. While global methods for gene activation using a so-called CRISPRa strategy
115 have been reported (30–32), efficient induction of selective gene expression is not yet a commonly
116 used method nor do simple tools exist for this purpose. Here we describe a lentiviral-based
117 system for individual gene activation control and show its utility as applied to the human Jurkat T
118 cell model. In combination with the previously noted improvements for macrophage genome
119 editing, these various new vectors and strategies constitute an effective suite of methods for the
120 manipulation of both innate (macrophage) and adaptive (lymphocyte) immune cells that offer
121 benefits when applied to a wide variety of cells types.
122
123 Materials and Methods
124 Gibson Assembly cloning of donor and lentiviral expression plasmids. The pCW-Cas9-2A-
125 EGFP plasmid was constructed by replacing the FseI-BamHI fragment in the pCW-Cas9 plasmid
126 (Addgene plasmid #50661) (21) with the T2A-EGFP fragment. The LCv2B plasmid was
127 constructed by replacing the BamHI-MluI fragment in the lentiCRISPRv2 plasmid (Addgene
128 plasmid #52961) (33) with the P2A-BSD fragment. The LGB and the LGR plasmids were
129 constructed by replacing the XbaI-Cas9-BamHI fragment in the LCv2B plasmid with the TagBFP
130 and the TagRFP-T fragment respectively. The STAT3 HDR donor plasmid was constructed by
131 replacing the NotI-XhoI fragment in the pcDNA3.1 plasmid with the indicated fragments. The
132 BCL10 HDR donor plasmid was assembled based on a minimal PciI-BglII pcDNA3 fragment that
133 contains only the ColE1 origin and the ampicillin resistance expression cassette. To construct the
134 LCv2B-HDR-mCherry-2A-hCD3E plasmid, LCv2B plasmid containing either the CD3E gRNA-1 or 2
135 was linearized at the KpnI site upstream of the U6 promoter before the assembly of the donor
136 template fragments. The LCv2S plasmid (Figure 5 - figure supplement 1A) was constructed by
6 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
137 replacing the BamHI-MluI PuroR fragment in the lentiCRISPRv2 plasmid with a 24-bp bridging
138 fragment via sticky-end ligation. To construct the LCv2S-HDR-tBFP-hRelA plasmid, LCv2S plasmid
139 containing the RelA gRNA was linearized at the same KpnI site to allow for the assembly of the
140 donor template fragments. The LCv2R plasmid was assembled by adding the P2A-mScarlet-I
141 fragment to the BamHI-linearized LCv2S backbone. The LCv2E plasmid was assembled using In-
142 Fusion cloning by adding the P2A-tEGFR fragment to the BamHI-linearized LCv2S backbone. The
143 LES2A-CRE plasmid was assembled by replacing the XbaI-EcoRI fragment in the lentiCas9-Blast
144 plasmid (Addgene plasmid #52962) (33) with the mScarlet-I-P2A-CRE fragment. The Lenti-CMV-
145 mCherry-P2A-CRE (aka pLM-CMV-R-Cre) plasmid was a gift from Michel Sadelain (Addgene
146 plasmid #27546) (34). The LentiSAMPHv2 plasmid was assembled by adding the P2A-MS2-p65-
147 HSF1 fragment amplified from the lentiMPH v2 plasmid (Addgene plasmid #89308) (32) to the
148 BsrGI-linearized lentiSAMv2 backbone (Addgene plasmid #75112) (32). All constructs described
149 in this paper will be deposited with Addgene and become available to qualified investigators.
150
151 CRISPR gRNA target design and cloning. All gRNAs were designed based on the analysis results
152 from the Zhang Lab online platform (crispr.mit.edu). For the DUSP gene knockout application, we
153 selected the gRNA with the best score that targets downstream of the start codon of each DUSP
154 gene. For the STAT3 HDR application, we selected a gRNA pair with the best score that targets
155 near the start codon. For the BCL10 HDR application, we selected top five scoring gRNA pairs that
156 target near the start codon. In addition, we selected a gRNA pair (D3) that confers a small offset
157 distance of 3 bp. Both the CD3E gRNA-1 and the RelA gRNA for the NIL delivery applications were
158 designed to overlap with the start codon in each case in order to avoid further editing following
159 the HDR event. With the same rationale in the case of CD3E gRNA-2, a PAM mutation was
7 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
160 introduced into the LCv2B-HDR-mCherry-2A-hCD3E plasmid. The RelA gRNA A1 was adopted
161 from the human GeCKOv2 library A (33). The PX461 and PX462 plasmids were gifts from Feng
162 Zhang (Addgene plasmid #48140 & #48141) (35). The pKLV-BFP plasmid was a gift from Kosuke
163 Yusa (Addgene plasmid #50946) (36). All lentiviral and other gRNA expression plasmids were
164 prepared by sticky-end ligation before any further modification described. The PX462-hBCL10-
165 gRNA-A1 plasmid was constructed by Gibson Assembly in the PciI-linearized PX461 backbone,
166 followed by sub-cloning of the double gRNA expression fragment into the PX462 backbone with
167 PvuI-XbaI sticky-end ligation. CRISPRa gRNAs were adopted from the Human CRISPR Activation
168 Library (SAM – 2 plasmid system) from Feng Zhang (32).
169
170 Production, purification and concentration of lentiviral particles. Lentiviral particles were
171 produced in HEK293T cells following transient transfection of the packaging plasmids pVSVg
172 (Addgene plasmid #8454) and psPAX2 (Addgene plasmid #12260), and the lentiviral expression
173 plasmid in a 1:10:10 ratio using Lipofectamine 3000. Lentiviral supernatant was harvested 44 to
174 52 h post-transfection and spun at 500 X g for 5 minutes to clear cell debris. NIL particles were
175 produced the same way except with the use of the psPAX2-D64V plasmid (Addgene plasmid
176 #63586) (29) instead of the psPAX2 plasmid. All lentiviral particles other than those used in the
177 RAW cell transductions and Figure 2B (top panel) were further purified and concentrated with the
178 Lenti-X Concentrator reagent (Takara) according to the manufacturer’s instructions.
179
180 Cell culture, transfection and antibiotic selection conditions. HEK293T, RAW264.7 and Jurkat
181 cell lines were purchased from ATCC. Cell culture was performed in a humidified environment
182 with 5% CO2 at 37°C. Both HEK293T and RAW264.7 cell lines were cultured in DMEM
8 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
183 supplemented with 10% FBS, glutamine and 18 mM HEPES buffer. Jurkat cell lines were cultured
184 in RPMI supplemented with 10% FBS, penicillin/streptomycin, glutamine and 50 M -
185 mercaptoethanol (complete RPMI). For plasmid transfections of HEK293T and Jurkat cells,
186 Lipofectamine 3000 (ThermoFisher) was used according to manufacturer’s protocol. Puromycin
187 (0.5 to 3 g/mL) or blasticidin (1 to 3 g/mL) was added to cell culture medium 1 to 2 days after
188 transduction of both RAW and Jurkat cell lines.
189
190 Genomic DNA extraction, T7EN assay and sequencing. Genomic DNA was extracted from RAW,
191 HEK293T or Jurkat cells using the QIAmp DNA Mini Kit (Qiagen) following the manufacturer’s
192 protocol. Genomic regions of interest were then amplified by PCR for follow-up analysis. For the
193 T7EN assay, equal amounts of genomic PCR products were used within each comparison group for
194 the hybridization reaction in a thermocycler programmed to 95°C for 10 minutes, -2°C per second
195 ramp to 85°C, -0.1°C per second ramp to 25°C, and then held at 4°C until a subsequent T7
196 Endonuclease I (NEB) treatment at 37°C for 30 to 90 minutes. 25 mM final concentration of EDTA
197 was added to each reaction before agarose gel electrophoresis analysis. Indel percentage was
198 determined as described previously (8). For the genomic DNA sequencing, each DUSP gene locus
199 surrounding the CRISPR gRNA target site (approximately -500 bp to +500 bp) was amplified and
200 cloned into a XhoI-NotI linearized pcDNA3.1 backbone by Gibson Assembly. Sequencing was
201 performed with the BGH-R (Table 1) primer on 20 clones per gene.
202
203 Bone marrow isolation and intracellular Ki67 staining. Mice were maintained in specific-
204 pathogen-free conditions and all procedures were approved by the NIAID Animal Care and Use
205 Committee (National Institutes of Health, Bethesda, MD, ASP LISB-4E). Bone marrow progenitors
9 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
206 isolated from C57BL/6 mice (Jackson Laboratories) and Rosa26-Cas9 B6J mice (Jackson
207 Laboratories #026179) were differentiated into BMDM during a 7-day culture in complete
208 Dulbecco’s modified Eagle’s medium (10% FBS, 100 U/mL penicillin, 100 U/mL streptomycin, 2
209 mM L-Glutamine, 20 mM HEPES) supplemented with 60 ng/mL recombinant mouse M-CSF (R&D
210 systems). For analysis of proliferation, cells were harvested at the indicated day of the BMDM
211 culture, were processed using BD Cytofix/Cytoperm reagents as directed, blocked and stained
212 with anti-Ki-67 (BD Pharmingen).
213
214 Macrophage TLR4 activation and intracellular phospho-p38 staining. BMDM or RAW cells
215 were stimulated with TLR4 ligand Kdo2-Lipid A (KLA, Avanti Polar Lipids). Ligand addition was
216 staggered so that for all time points, cells were fixed at the same time by addition of
217 paraformaldehyde to cell cultures at a final concentration of 1.6% (10 minutes). After one wash
218 with PBS 1% FBS, cells were gently harvested from plates by scraping, were permeabilized
219 overnight using ice cold MeOH at -20°C, blocked using 5% goat serum and Fc receptor specific
220 antibody, and stained for 1 h at room temperature with anti-p38 (phospho-Thr180/Try182, BD
221 36/p38) antibody.
222
223 Cell sorting, FACS analysis and live cell confocal imaging. Cell sorting was conducted by the
224 Flow Cytometry Section, Research Technologies Branch of NIAID. FACS analysis data were
225 collected using a BD LSRII or BD Fortessa Cell Analyzer and further processed with FlowJo.
226 Human PDCD1 or PDL1 cell surface protein staining was analyzed using anti-PD-1 (ThermoFisher
227 clone MIH4) or anti-PD-L1 (ThermoFisher clone MIH1) antibody respectively. Live cell confocal
228 time-lapse imaging data were collected using a Leica SP8 microscope with a 63x NA 1.4 oil
10 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
229 objective (Biological Imaging Section, Research Technologies Branch of NIAID). The imaging
230 chamber (ThermoFisher 155411) was coated with poly-D-lysine (Sigma P7280) for 1 h at 37°C
231 and washed twice with PBS. Cells were imaged in a heated 37°C environment with 5% CO2.
232 Imaging data were processed by Imaris (Bitplane).
233
234 Chemical reagents, lysis buffer and western blots. Doxycycline hydrochloride (Sigma D3447)
235 was reconstituted in DMSO at 50 mg/mL and stored at -20°C. Jurkat T cells were stimulated with
236 50 ng/mL PMA (Santa Cruz Biotechnology) and 1 M ionomycin (Sigma) (37). RAW cells were
237 lysed in a buffer containing 50 mM Tris pH7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol and 1%
238 Igepal. Western blots were analyzed using anti-DUSP3 antibody (Abcam clone EPR5492), anti-
239 DUSP1 antibody (Millipore 07-535), and anti-FLAG antibody (Santa Cruz Biotechnology sc-
240 166355).
241
242 Human PBMC isolation and transduction. Human whole blood from healthy anonymous
243 volunteer donors was purchased from a NIH blood bank. This was exempted from the need for
244 informed consent and Institutional Review Board review, as determined by the NIH Office of
245 Human Subjects Research Protection. Human peripheral blood mononuclear cells (hPBMC) were
246 isolated from whole blood by Ficoll density gradient separation, cultured in complete RPMI
247 medium mentioned above, and stimulated with 1 g/mL anti-CD3 (BioLegend 300334) and 1 g/mL
248 anti-CD28 (BioLegend 302944) soluble antibodies for 18 h. Purified and concentrated lentiviral
249 particles were then added to the hPBMC culture, with 8 g/mL Polybrene (Millipore Sigma TR-1003)
250 and 100 U/mL recombinant human IL-2 (TECIN (teceleukin)). These cells were then spun at 400 X g
251 for 90 minutes in a pre-warmed centrifuge at 34 °C.
11 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
252
253 Results
254 Dual-color Inducible CRISPR-Cas9 Editing System in RAW264.7 Macrophages.
255 To achieve a controllable balance between on-target and off-target mutations induced by
256 CRISPR, we adopted the doxycycline-inducible pCW-Cas9 system to enable precise manipulation
257 of the genome editing time period. In pCW-Cas9-transduced RAW macrophages, a range of Cas9
258 protein expression was induced by doxycycline dose titration (Figure 1 - figure supplement 1A).
259 We modified this existing system to enable single-cell flow cytometric analysis and developed the
260 pCW-Cas9-2A-EGFP (iCE) lentiviral expression plasmid (Figure 1A). Doxycycline titration in the
261 iCE-transduced and puromycin-selected RAW cells (RAWiCE) revealed saturating Cas9-2A-EGFP
262 protein expression at 1.0 µg/mL doxycycline (Figure 1B). Single clone isolation from the RAWiCE
263 line yielded cells that fully responded to doxycycline induction (Figure 1C), indicating the digital
264 nature of this inducible expression system. To track single cells that constitutively express a
265 targeting gRNA with a different set of antibiotic selection and live cell fluorescent markers, we
266 developed the LentiGuide-TagBFP-2A-BSD (LGB) plasmid (Figure 1D) based on the
267 LentiCRISPRv2 backbone, which had been optimized to produce high-titer lentiviral particles. For
268 applications that require simultaneous tracking of two targeting gRNAs, we also developed the
269 LentiGuide-TagRFP-2A-BSD (LGR) plasmid (Figure 1 - figure supplement 1B) to offer a different
270 color option and enhance the overall flexibility of this inducible CRISPR-Cas9 editing system.
271 To test this method, we targeted a family of dual-specificity phosphatases (DUSPs) in RAW
272 cells. The RAWiCE cells transduced with LGB targeting each DUSP genomic locus were first
273 selected by blasticidin to maximize the gRNA-expressing (tBFP+) population. Following
274 doxycycline induction at 1.0 µg/mL for 6 days, we analyzed DUSP3 expression by intracellular
12 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
275 staining and EGFP+ tBFP+ gating (Figure 1E). We observed substantial (>95%) reduction in total
276 DUSP3 protein expression (Figure 1F) within the CRISPR-targeted EGFP+ tBFP+ population,
277 indicating that the majority of targeted cell clones (Figure 1E) were indeed complete knockouts
278 (KO) of DUSP3 expression. Due to limited antibody availability, we performed T7 Endonuclease I
279 (T7EN) assays to confirm the presence of insertion/deletion (indel) mutations at the targeted
280 genomic loci (Figure 1G). Since the T7EN assay does not yield the actual DUSP3 KO percentage,
281 we performed genomic DNA sequencing to better estimate the CRISPR-editing outcomes of all five
282 DUSP genes. The sequencing results revealed that most if not all targeted DUSP alleles had been
283 mutated at the expected loci surrounding the PAM (protospacer adjacent motif) sites (Figure 1H &
284 Figure 1 - figure supplement 1C). Overall, these results strongly suggest that our dual-color
285 inducible CRISPR strategy confers high genome editing efficiency in an extremely sensitive, albeit
286 transformed, innate immune cell type.
287 Upon stimulating DUSP-KO RAW cells with TLR4 ligand, we did not observe sustained p38
288 phosphorylation in DUSP1-KO RAW cells (Figure 2 - figure supplement 1A), an expected
289 phenotype based on a previous study using primary BMDM derived from DUSP1-KO mice (38).
290 Thus, we examined the effects of such a KO in BMDM using the same gRNA used to target DUSP1 in
291 RAW cells. Although lentiviruses can transduce non-dividing cells, transduction efficiency is
292 optimized in cells undergoing active replication. Based on the Ki67 proliferative marker
293 expression profile of bone marrow cells cultured with M-CSF (Figure 2 - figure supplement 1B),
294 we developed a lentiviral gRNA transduction protocol (Figure 2A) to create target gene KO BMDM
295 for further analysis. Unlike RAW cells, BMDM are more sensitive to crude lentiviral supernatant
296 from HEK293T packaging cells seen as a dramatic post-transduction decline in the live BMDM
297 percentage (Figure 2B). To optimize BMDM survival, we further purified and concentrated
13 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
298 lentiviral particles to remove potentially toxic materials from the crude supernatant. This
299 approach improved the live BMDM percentage as the LGB titration reached a peak transduction
300 efficiency (Figure 2B). Using this improved transduction method for LGB expression in Cas9+
301 EGFP+ BMDM, we performed intracellular protein staining and validated the editing efficiency of
302 DUSP3 gRNA (Figure 2C). Consistent with previous report using BMDM from DUSP1-KO mice (38),
303 we observed sustained TLR4-induced p38 phosphorylation (p-p38) in BMDM transduced with the
304 LGB-DUSP1 gRNA expression, as compared to the EV (empty vector) and the DUSP4 controls
305 (Figure 2D). Increased p-p38 phenotype generally correlated with the LGB-DUSP1 gRNA
306 expression level, as indicated by tBFP fluorescence in Cas9+ EGFP+ BMDM (Figure 2E). Our
307 results suggest that TLR4-induced p38 is differentially regulated between primary BMDM and the
308 transformed RAW macrophages and illustrate the utility of our method for study of these
309 otherwise hard-to-modify cells.
310
311 An Efficient Selection Strategy for CRISPR-induced HDR Clones in Jurkat T Cells.
312 We next turned to new strategies for editing the genomes of lymphocytes. To minimize off-
313 target effects, we designed a pair of gRNAs for targeting with the Cas9-D10A nickase (Cas9n)
314 strategy, choosing the human STAT3 locus as an exemplar (Figure 3A). This pair of gRNAs
315 together with Cas9n expression in HEK293T cells was confirmed to create indel mutations at the
316 targeted STAT3 loci, as measured by the T7EN assay (Figure 3B) following co-transfection of the
317 PX461 and the pKLV-BFP plasmids. However, our goal was more ambitious than just achieving
318 gene expression loss in these cells. In addition to expression of Cas9n and a pair of gRNAs lying in
319 close proximity, a DNA donor template is required to induce precise knock-in modification via the
320 HDR repair mechanism. The STAT3 HDR donor plasmid (Figure 3C) was designed with 2000-bp
14 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
321 homology arms flanking the insert fragment containing the puromycin resistance (PuroR) gene,
322 followed by the T2A sequence and the mNeonGreen (mNG) fluorescent protein-coding gene.
323 Following co-transfection of PX461-STAT3-gRNA-A, pKLV-BFP-STAT3-gRNA-1 and STAT3 HDR
324 donor plasmids, approximately 6e5 total (<0.5% co-transfection efficiency) Jurkat T cells were
325 selected with puromycin and separated by dilution cloning before further validation (Figure 3D).
326 Based on the low HDR efficiency for large fragment insertion (<10%), it is technically challenging
327 to isolate this tiny (<0.05% or <300 cells) population of successful HDR cell clones without using
328 any selection method. After puromycin selection, flow cytometric analysis of 40 puromycin-
329 resistant Jurkat cell clones revealed that most of the selected population had acquired mNG
330 expression to various extents (Figure 3E). Further genomic PCR analysis of 7 clones that express
331 medium to high level of mNG showed that 6 out these 7 clones were indeed complete knock-in for
332 all STAT3 alleles (Figure 3F). Based on these results, we estimated the clonal distribution of the
333 parental mNG-STAT3 Jurkat cell line (Figure 3G). The high percentage (82.5%) of partial or
334 complete mNG-STAT3 knock-in clones suggests that this kind of antibiotic selection strategy
335 efficiently enriches the desired HDR cell clones.
336 We extended studies of this method by targeting the human BCL10 locus to express a
337 fluorescent protein-tagged fusion protein, using 6 nickase gRNA pairs (Figure 4A) and measuring
338 the targeting efficiency by T7EN assay (Figure 4B) as in Figure 3B. Despite the higher indel
339 frequency induced by the D3 gRNA combination (Figure 4A & 4B), we selected the highest-scoring
340 (crispr.mit.edu) A1 gRNA combination to minimize potential off-target effects. To enhance co-
341 transfection efficiency, we created a double gRNA expression plasmid (Figure 4C) based on the
342 PX462 backbone. Furthermore, we attempted to minimize the genome editing footprint by
343 incorporating loxP sites flanking the PuroR-T2A selection cassette in the BCL10 HDR donor
15 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
344 plasmid (Figure 4D). Upon CRE-mediated excision of the loxP-PuroR-T2A-loxP fragment, further
345 genome editing with the same strategy can be applied because puromycin sensitivity is restored
346 (Figure 4E). After plasmid co-transfection and puromycin selection, most Jurkat cells had
347 acquired mNG-BCL10 expression (Figure 4F) and showed dispersed protein localization, as
348 compared to the nuclear H2B-BFP marker (data not shown). After NIL-CRE (non-integrating
349 lentiviral particles; see Figure 5A for details) treatment, we observed enhanced mNG-BCL10
350 expression level (Figure 4G) and a substantially higher frequency of mNG-BCL10 aggregate
351 formation (39) upon antigen receptor stimulation (data not shown). Puromycin re-treatment
352 killed approximately 99.8% of the NIL-CRE-treated mNG-BCL10 Jurkat cells but did not affect the
353 survival of the original mNG-BCL10 line (data not shown). Finally, based on this NIL-CRE-treated
354 or Puro-T2A-excised mNG-BCL10 Jurkat parental cell line, we repeated STAT3 genome editing as
355 in Figure 3 but using a modified STAT3 HDR donor plasmid (Figure 4H) in which the mScarlet
356 element replaces the mNeonGreen element (Figure 3C). Following plasmid co-transfection and
357 puromycin selection, more than 75% of mNG-BCL10+ Jurkat cells had gained the targeted
358 mScarlet-STAT3 expression (Figure 4I). With minimal off-target editing concern, these results
359 demonstrated a highly efficient yet sustainable selection method to precisely enrich targeted
360 knock-in cell population from very few recombinant clones created by CRISPR-mediated HDR.
361
362 All-in-one Non-integrating Lentiviral Delivery of the CRISPR-HDR Blueprint.
363 As an alternative approach, we sought to deliver Cas9, gRNA, and the HDR donor template
364 to the entire T cell culture in a transient transfection manner. We therefore turned to the use of
365 integrase-deficient lentiviral particles. We packaged the Lenti-CMV-mCherry-P2A-CRE viral
366 vector either with the wild-type integrase in the psPAX2 plasmid to produce integrating lentiviral
16 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
367 (IL) particles, or with the integrase-deficient mutant in the psPAX2-D64V plasmid to produce non-
368 integrating lentiviral (NIL) particles. While the IL transduction created stable mCherry expression
369 in Jurkat T cells, the NIL delivery failed to integrate into the genomes and led to transient mCherry
370 expression (Figure 5A). To test whether NIL delivery of the entire CRISPR-HDR instruction can
371 generate targeted knock-in cells, we assembled the LentiCRISPRv2B-HDR-mCherry-2A-hCD3E
372 viral vector (Figure 5B) and examined two gRNAs targeting the human CD3E locus (Figure 5C). 7
373 days after the NIL-CRISPR-Cas9-HDR delivery, we indeed observed a distinct population of
374 mCherry+ Jurkat cells by flow cytometry (Figure 5D). Using primers that distinguish the
375 endogenous locus from randomly-integrated HDR template sequences, genomic PCR analysis
376 confirmed the presence of targeted knock-in alleles within the mCherry-sorted Jurkat population
377 (Figure 5E).
378 Using NIL delivery of the LentiCRISPRv2S-HDR-tBFP-hRelA viral vector (Figure 5F), we
379 attempted to generate a TagBFP-RelA fusion knock-in Jurkat cells, employing a gRNA targeting the
380 human RelA locus (Figure 5G). This HDR attempt yielded a distinct and stable tBFP+ Jurkat
381 population that was further purified by FACS (Figure 5H). We used live cell confocal time-lapse
382 imaging to visualize the RelA nuclear translocation response to PMA-ionomycin stimulation
383 (Figure 5I). As expected, in the steady-state tBFP-RelA was mostly excluded from the H2B-
384 sfCherry-defined nuclear region. Upon NF-B pathway activation, a rapid but transient increase in
385 the nuclear to cytoplasmic ratio of tBFP-RelA was observed in approximately 85% of the Jurkat
386 population (Figure 5I). To distinguish targeted genomic knock-in from random lentiviral
387 integration, we transduced the original tBFP-RelA knock-in Jurkat line with LentiCRISPRv2B
388 (Figure 5J) carrying RelA gRNA-A1 (Figure 5K) to inactivate endogenous RelA expression. After 5
389 days of blasticidin selection, approximately 70% of the gated population had lost tBFP expression
17 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
390 (Figure 5L), indicating that most of the tBFP+ cells were indeed created by the HDR mechanism at
391 the human RelA locus. Taken together, these results provide proof-of-concept data to support the
392 NIL delivery approach as a powerful alternative to the existing CRISPR-HDR methods in human T
393 cells.
394
395 Selective Gene Expression Induction with All-in-one Lentiviral CRISPRa System.
396 The vectors and methods described above are useful for either eliminating expression of a
397 particular gene or modifying an already-expressed gene in a given cell type, but there are
398 numerous situations in which it would be useful to induce expression of an otherwise silent locus
399 in a specific cell type. To achieve this end, we created an all-in-one lentiviral CRISPRa system
400 based on an existing two-plasmid system (32) and we refer it as LentiSAMPHv2 (Supplementary
401 Figure A). With this system, we tested 6 gRNAs from an existing CRISPRa library (32) targeting
402 the promoter region of the human PDCD1 or PDL1 genomic locus. These gRNAs induced various
403 levels of target gene expression (Supplementary Figure B), as compared to the corresponding no
404 gRNA control condition. For the gRNA that induces the highest level of PD1 expression, we also
405 tested the specificity of this induction by measuring the cell surface expression level of PDL1
406 (Supplementary Figure C).
407
408 Discussion
409 Many research groups have encountered failures in their unpublished CRISPR-KO attempts
410 to engineer the widely-studied RAW macrophage cell line (personal communications). Using the
411 lentiCRISPR system, we consistently observed massive cell death following lentiviral transduction
412 and puromycin selection, likely due to a combinatorial effect of low viral titer and cytotoxic
18 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
413 materials from the crude lentiviral supernatant. In contrast, the high transduction efficiency of
414 our LGB gRNA expression system ensures that a majority of the transduced RAW cells survive
415 under blasticidin selection, conferring a good representation of the original cell line. Inducible
416 Cas9 expression allows more precise control of the genome editing time window and therefore
417 minimizes long-term off-target effects that cannot be avoided by constitutive Cas9 expression in
418 many lentiviral-based CRISPR expression systems. For gRNAs that efficiently knockout essential
419 cell survival genes or oncogenes, percentage changes in EGFP+ tBFP+ cells over doxycycline
420 treatment time help quantify the impacts of these gRNAs.
421 The high genome editing efficiency and the rapid single-cell phenotyping option of our
422 dual-color inducible CRISPR system in RAW cells makes this platform suitable for high-throughput
423 genome-wide gRNA library screening. Our inducible CRISPR system allows for stable uninduced
424 cell lines to be frozen for long-term storage and future analysis. Furthermore, we have optimized
425 these methods for use in primary immune cells. Lentiviral or retroviral supernatant produced
426 from HEK293T packaging cells often influences target cell growth rate and morphology, especially
427 when a high volume-ratio of viral supernatant to cell culture medium is applied to the target cell
428 line. Our data illustrate that further purification of lentiviral particles helps minimize BMDM cell
429 death. Thus, our methods achieve high transduction efficiency without sacrificing cell health in
430 culture. With these approaches, we were able to identify Cas9 and gRNA double positive
431 macrophages, using both the RAW murine cell line and primary BMDM. Interestingly, these
432 studies revealed distinct MAPK regulation between these cells. CRISPR deletion of the
433 phosphatase DUSP1 in BMDM resulted in sustained p38 phosphorylation, consistent with
434 published studies in BMDM generated from DUSP1 deficient mice (38). In contrast, DUSP1
435 deletion in RAW cells, using the same gRNA, did not yield detectable changes in p38 activation.
19 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
436 This adds to our previous reports of dysregulated TLR4-induced MAPK activity in RAW cells
437 compared to BMDM (40).
438 The Cas9 nickase strategy requires two gRNA targets to be in close proximity to efficiently
439 induce DNA double-strand break repair mechanisms (8,9). Therefore, it is extremely unlikely to
440 find another off-target pairing site in the genome. Our data support previous reports that the pair
441 of Cas9 nickases are optimized with minimized offset of the gRNA pairs (8,9). Without including
442 an upstream promoter in the donor template design, our PuroR selection strategy reduces the
443 probability of selecting randomly integrated clones. Obviously, this strategy relies on genomic loci
444 that are well expressed to generate sufficient expression of the drug resistance gene. Among the
445 target genes that we have tested, we observed that this strategy worked best with the N-terminal
446 PuroR-2A but not the C-terminal 2A-PuroR fusion expression. Combined with a CRE-lox or FLP-
447 FRT recombination design, our PuroR selection strategy is further optimized to sustain more
448 rounds of genome editing, enabling sequential engineering of multiplex reporters, significantly
449 reducing the genomic footprint to a short single recombination site. Following the NIL-mediated
450 mCherry-P2A-CRE or mScarlet-P2A-CRE (Figure 5 - figure supplement 1D), or commercially
451 available Cre Gesicles (Takara) delivery, target cells that transiently express CRE recombinase can
452 be isolated from the untreated population via fluorescence-activated cell sorting (FACS). For
453 relatively small proteins such as BCL10, the protein expression level can be dramatically reduced
454 by the genomic insertion of the PuroR selection cassette together with a fluorescent protein. Our
455 data suggest that reduced BCL10 protein expression can lead to the loss of BCL10 oligomerization
456 upon antigen receptor signaling, which justifies the need to remove the PuroR selection cassette to
457 achieve a more functional BCL10 reporter Jurkat T cell line.
20 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
458 Lentiviruses such as HIV have evolved to efficiently infect human T cells, making them
459 perfect delivery vehicles for human T cell genome engineering. In Jurkat cells, lentiviral delivery is
460 much more efficient than any existing transfection method including electroporation, which often
461 leads to substantial cell death upon electric shock and reduces cell growth and overall protein
462 production for the surviving population. In addition, lentiviral particles are easy to prepare by
463 most laboratories, carry double to triple the payload as compared to the AAV system, and
464 therefore enable all-in-one design and delivery of a Cas9, gRNA expression and HDR donor
465 template. Although there is now an existing report (41) that demonstrates the feasibility of NIL
466 delivery of the CRISPR-HDR blueprint, we now demonstrate the utility of this method in an
467 especially difficult to engineer type of cell, T lymphocytes. Our experiments using human primary
468 T cells showed that the NIL-LCv2R (Figure 5 - figure supplement 1B) particles efficiently
469 transduced more than 80% of the total population (Figure 5 - figure supplement 1E).
470 As one of the first studies to report the use of NIL as delivery vehicle for CRISPR-HDR
471 applications, we suggest many exciting optimization possibilities for this method. First of all,
472 sensitive marker expression such as mScarlet in the LCv2R backbone (Figure 5 - figure
473 supplement 1B) or tEGFR in the LCv2E backbone (Figure 5 - figure supplement 1C) could be
474 included to eliminate residual random integration events from NIL particles. In addition, various
475 HDR-stimulating chemicals such as RS-1 (27) could be tested to enhance knock-in efficiency.
476 Furthermore, eSpCas9 or more specific Cas9 variant could be used instead of Cas9 nuclease to
477 minimize off-target effects. Finally, the use of both NIL and AAV systems could be combined to
478 deliver few copies of NIL-CRISPR-Cas9-gRNA but high copy number of AAV-HDR donor template
479 (28) per target cell to maximize HDR efficiency and donor template accuracy.
21 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
480 We also introduce here a new all-in-one vector system for activation of selected gene loci in
481 immune cells. Using a single lentivirus containing gRNA that targets the human PDCD1 or PDL1
482 genomic locus, we demonstrate high level expression of a previously silent locus in Jurkat cells
483 and the value of this induced expression in assays of immune function. This strategy builds on
484 pre-existing methods for large scale gene induction by providing experimentalists with a simple
485 method for selective, one-molecule-at-a-time alteration of cell phenotype in a positive rather than
486 negative manner.
487 Among the published reports using various CRISPR technologies in immune cells, there has
488 been a lack of focus on using more accurate genome editing tools. As more precise CRISPR-based
489 genome editing tools are being developed and characterized, future immune cell genome
490 engineering studies should pay more attention to minimizing off-target editing effects. This is
491 particularly important for immune cells that are modified for therapeutic applications that require
492 the highest safety level of genome engineering.
493
494 Acknowledgements
495 We thank Clinton Bradfield, Iain Fraser, and Wanjing Shang for critical reading of the manuscript.
496 We thank Cindi Pfannkoch, Bin Lin, Caleb Ng, Sebastian Montalvo, Iain Fraser, and Michael
497 Lenardo for helpful discussions and advice. This research was supported by the Intramural
498 Research Program of the NIH, NIAID.
499
500 Competing interests
501 All authors declare no competing interests.
502
22 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
503 References
504 1. Ishino Y, Shinagawa H, Makino K, Amemura M, Nakata A. Nucleotide sequence of the iap
505 gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and
506 identification of the gene product. Journal of Bacteriology. 1987 Dec;169(12):5429–33.
507 2. Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J. RNA-programmed genome editing in human
508 cells. eLife. 2013 Jan 29;2(2):1–9.
509 3. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex Genome Engineering Using
510 CRISPR/Cas Systems. Science. 2013 Feb 15;339(6121):819–23.
511 4. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, et al. RNA-Guided Human Genome
512 Engineering via Cas9. Science. 2013 Feb 15;339(6121):823–6.
513 5. Kuscu C, Arslan S, Singh R, Thorpe J, Adli M. Genome-wide analysis reveals characteristics of
514 off-target sites bound by the Cas9 endonuclease. Nature Biotechnology. 2014 Jul
515 18;32(7):677–83.
516 6. Tsai SQ, Zheng Z, Nguyen NT, Liebers M, Topkar V V., Thapar V, et al. GUIDE-seq enables
517 genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nature
518 Biotechnology. 2015 Feb 16;33(2):187–97.
519 7. Wang X, Wang Y, Wu X, Wang J, Wang Y, Qiu Z, et al. Unbiased detection of off-target
520 cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors. Nature
521 Biotechnology. 2015 Feb 19;33(2):175–8.
522 8. Ran FA, Hsu PD, Lin C, Gootenberg JS, Konermann S, Trevino AE, et al. Double Nicking by
523 RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Cell. 2013
524 Sep;154(6):1380–9.
23 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
525 9. Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, et al. Efficient genome modification by
526 CRISPR-Cas9 nickase with minimal off-target effects. Nature Methods. 2014 Apr
527 2;11(4):399–402.
528 10. Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK. Improving CRISPR-Cas nuclease specificity
529 using truncated guide RNAs. Nature Biotechnology. 2014 Mar 26;32(3):279–84.
530 11. Guilinger JP, Thompson DB, Liu DR. Fusion of catalytically inactive Cas9 to FokI nuclease
531 improves the specificity of genome modification. Nature Biotechnology. 2014 Jun
532 25;32(6):577–82.
533 12. Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Programmable editing of a target base in
534 genomic DNA without double-stranded DNA cleavage. Nature. 2016 May
535 20;533(7603):420–4.
536 13. Pawluk A, Amrani N, Zhang Y, Garcia B, Hidalgo-Reyes Y, Lee J, et al. Naturally Occurring Off-
537 Switches for CRISPR-Cas9. Cell. 2016 Dec;167(7):1829-1838.e9.
538 14. Chen JS, Dagdas YS, Kleinstiver BP, Welch MM, Sousa AA, Harrington LB, et al. Enhanced
539 proofreading governs CRISPR–Cas9 targeting accuracy. Nature. 2017 Oct
540 20;550(7676):407–10.
541 15. Ren J, Liu X, Fang C, Jiang S, June CH, Zhao Y. Multiplex Genome Editing to Generate
542 Universal CAR T Cells Resistant to PD1 Inhibition. Clinical Cancer Research. 2017 May
543 1;23(9):2255–66.
544 16. Ferri F, Parcelier A, Petit V, Gallouet A-S, Lewandowski D, Dalloz M, et al. TRIM33 switches
545 off Ifnb1 gene transcription during the late phase of macrophage activation. Nature
546 Communications. 2015 Dec 23;6(1):8900.
24 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
547 17. Tang S, Chen T, Yu Z, Zhu X, Yang M, Xie B, et al. RasGRP3 limits Toll-like receptor-triggered
548 inflammatory response in macrophages by activating Rap1 small GTPase. Nature
549 Communications. 2014 Dec 14;5(1):4657.
550 18. Jing W, Zhang X, Sun W, Hou X, Yao Z, Zhu Y. CRISPR/CAS9-Mediated Genome Editing of
551 miRNA-155 Inhibits Proinflammatory Cytokine Production by RAW264.7 Cells. BioMed
552 Research International. 2015;2015:1–7.
553 19. Li X, Yang M, Yu Z, Tang S, Wang L, Cao X, et al. The tyrosine kinase Src promotes
554 phosphorylation of the kinase TBK1 to facilitate type I interferon production after viral
555 infection. Science Signaling. 2017 Jan 3;10(460):eaae0435.
556 20. Napier BA, Brubaker SW, Sweeney TE, Monette P, Rothmeier GH, Gertsvolf NA, et al.
557 Complement pathway amplifies caspase-11–dependent cell death and endotoxin-induced
558 sepsis severity. The Journal of Experimental Medicine. 2016 Oct 17;213(11):2365–82.
559 21. Wang T, Wei JJ, Sabatini DM, Lander ES. Genetic Screens in Human Cells Using the CRISPR-
560 Cas9 System. Science. 2014 Jan 3;343(6166):80–4.
561 22. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, et al. CRISPR-Cas9 Knockin Mice for
562 Genome Editing and Cancer Modeling. Cell. 2014 Oct;159(2):440–55.
563 23. Yang H, Wang H, Jaenisch R. Generating genetically modified mice using CRISPR/Cas-
564 mediated genome engineering. Nature Protocols. 2014 Aug 24;9(8):1956–68.
565 24. Ma H, Marti-Gutierrez N, Park S-W, Wu J, Lee Y, Suzuki K, et al. Correction of a pathogenic
566 gene mutation in human embryos. Nature. 2017 Aug 2;548(7668):413–9.
567 25. Yang Y, Wang L, Bell P, McMenamin D, He Z, White J, et al. A dual AAV system enables the
25 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
568 Cas9-mediated correction of a metabolic liver disease in newborn mice. Nature
569 Biotechnology. 2016 Mar 1;34(3):334–8.
570 26. Maruyama T, Dougan SK, Truttmann MC, Bilate AM, Ingram JR, Ploegh HL. Increasing the
571 efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end
572 joining. Nature Biotechnology. 2015 May 23;33(5):538–42.
573 27. Song J, Yang D, Xu J, Zhu T, Chen YE, Zhang J. RS-1 enhances CRISPR/Cas9- and TALEN-
574 mediated knock-in efficiency. Nature Communications. 2016 Apr 28;7(1):10548.
575 28. Eyquem J, Mansilla-Soto J, Giavridis T, van der Stegen SJC, Hamieh M, Cunanan KM, et al.
576 Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature.
577 2017 Mar 22;543(7643):113–7.
578 29. Certo MT, Ryu BY, Annis JE, Garibov M, Jarjour J, Rawlings DJ, et al. Tracking genome
579 engineering outcome at individual DNA breakpoints. Nature Methods. 2011 Aug
580 10;8(8):671–6.
581 30. Maeder ML, Linder SJ, Cascio VM, Fu Y, Ho QH, Joung JK. CRISPR RNA–guided activation of
582 endogenous human genes. Nature Methods. 2013 Oct 25;10(10):977–9.
583 31. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, et al. Genome-
584 scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 2015 Jan
585 10;517(7536):583–8.
586 32. Joung J, Konermann S, Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, et al. Genome-
587 scale CRISPR-Cas9 knockout and transcriptional activation screening. Nature Protocols.
588 2017 Apr 23;12(4):828–63.
26 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
589 33. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR
590 screening. Nature Methods. 2014 Aug 30;11(8):783–4.
591 34. Papapetrou EP, Lee G, Malani N, Setty M, Riviere I, Tirunagari LMS, et al. Genomic safe
592 harbors permit high β-globin transgene expression in thalassemia induced pluripotent stem
593 cells. Nature Biotechnology. 2011 Jan 12;29(1):73–8.
594 35. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the
595 CRISPR-Cas9 system. Nat Protocols. 2013;8(11):2281–308.
596 36. Koike-Yusa H, Li Y, Tan E-P, Velasco-Herrera MDC, Yusa K. Genome-wide recessive genetic
597 screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature
598 Biotechnology. 2014 Mar 23;32(3):267–73.
599 37. Chan W, Schaffer TB, Pomerantz JL. A Quantitative Signaling Screen Identifies CARD11
600 Mutations in the CARD and LATCH Domains That Induce Bcl10 Ubiquitination and Human
601 Lymphoma Cell Survival. Molecular and Cellular Biology. 2013 Jan 15;33(2):429–43.
602 38. Zhao Q, Wang X, Nelin LD, Yao Y, Matta R, Manson ME, et al. MAP kinase phosphatase 1
603 controls innate immune responses and suppresses endotoxic shock. The Journal of
604 Experimental Medicine. 2006 Jan 23;203(1):131–40.
605 39. Paul S, Kashyap AK, Jia W, He YW, Schaefer BC. Selective Autophagy of the Adaptor Protein
606 Bcl10 Modulates T Cell Receptor Activation of NF-κB. Immunity. 2012 Jun;36(6):947–58.
607 40. Gottschalk RA, Martins AJ, Angermann BR, Dutta B, Ng CE, Uderhardt S, et al. Distinct NF-κB
608 and MAPK Activation Thresholds Uncouple Steady-State Microbe Sensing from Anti-
609 pathogen Inflammatory Responses. Cell Systems. 2016 Jun;2(6):378–90.
27 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
610 41. Wang Y, Wang Y, Chang T, Huang H, Yee J-K. Integration-defective lentiviral vector mediates
611 efficient gene editing through homology-directed repair in human embryonic stem cells.
612 Nucleic Acids Research. 2017 Mar 17;45(5):e29.
613
614 Figure Legends
615 Figure 1. Dual-color inducible CRISPR strategy efficiently modifies DUSP genes in
616 RAW264.7 macrophages. (A) Lentiviral vector encoding inducible Cas9-T2A-EGFP under the
617 control of the tTRE promoter. (B) EGFP expression by RAWiCE cells treated with doxycycline. (C)
618 EGFP expression by RAWiCE clones treated with doxycycline. (D) Lentiviral vector for gRNA
619 expression with TagBFP fluorescent marker and blasticidin resistance gene BSD. (E) Analysis of
620 DUSP3, EGFP and tBFP by RAWiCE cells transduced with the indicated LGB lentiviral particles and
621 selected with blasticidin after doxycycline treatment. Results are representative of three
622 independent experiments. (F) DUSP protein expression by RAWiCE cells transduced with the
623 indicated LGB targeting DUSP2 or DUSP3. Data are representative of three independent
624 experiments. (G) Indel analysis of genomic DNA from RAWiCE lines. (H) Sequence analysis of the
625 genomic DNA from the RAWiCE lines.
626
627 Figure 2. LGB-mediated CRISPR in BMDM recapitulates reported role for DUSP1 in control
628 of TLR4-p38 signaling. (A) Workflow diagram for generating CRISPR-KO BMDMs for TLR4
629 signaling pathway analysis. (B) Lentiviral titration in BMDMs for cell toxicity. (C) DUSP3 protein
630 expression following LGB-DUSP3-transduction of Cas9+ BMDMs. (D) Phospho-p38 induced by
631 TLR4 engagement of DUSP1-KO BMDMs as compared to the EV and the DUSP4-KO controls. Data
28 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
632 are representative of two independent experiments. (E) Examination of TLR4-induced phospho-
633 p38 signaling together with LGB-DUSP1 gRNA expression as indicated by tBFP fluorescence.
634
635 Figure 3. In-frame PuroR HDR donor design allows highly specific selection of mNG-STAT3
636 knock-in Jurkat T cells. (A) Cas9 nickase gRNA pair design targeting human STAT3 locus to
637 induce HDR events near the start codon. (B) T7EN assay for locus-specific editing in HEK293T
638 cells. (C) STAT3 HDR donor plasmid. Start codon and the original second codon are labeled as
639 shown in A. (D) Strategy for puromycin selection of clonal Jurkat cells with the STAT3 locus-
640 targeted Jurkat T cells. (E) mNeonGreen expression by clones of puromycin-resistant mNG-STAT3
641 Jurkat cells. (F) PCR analysis of the hSTAT3 locus in targeted mNG-STAT3 Jurkat cells. (G)
642 Targeting efficiency in the mNG-STAT3 line.
643
644 Figure 4. CRE-loxP excision strategy minimizes genomic footprint of the PuroR selection
645 cassette and allows for multiple rounds of genome editing. (A) Cas9 nickase gRNA pair design
646 targeting the human BCL10 locus. (B) T7EN assay for locus-specific editing in HEK293T cells. (C)
647 Double gRNAs and Cas9-D10A nickase expression plasmid derived from the PX462 backbone. (D)
648 BCL10 HDR donor plasmid design. (E) Strategy for creating puromycin-selected Jurkat T cells
649 with post-selection excision of the Puro-T2A cassette. (F)(G) mNeonGreen expression by
650 puromycin-selected mNG-BCL10 knock-in Jurkat line with or without NIL-CRE treatment. (H)
651 Modified STAT3 HDR donor plasmid. (I) mNeonGreen and mScarlet co-expression by puromycin-
652 selected mScarlet-STAT3/mNG-BCL10 double knock-in Jurkat line.
653
29 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
654 Figure 5. All-in-one NIL-CRISPR-Cas9-HDR delivery enables targeted genome modifications
655 in human Jurkat T cells. (A) Time course of mCherry-P2A-CRE expression after NIL vs. IL
656 transduction of Jurkat T cells. (B) All-in-one lentiviral design for mCherry-P2A-CD3E knock-in via
657 CRISPR-Cas9-HDR. PAM site for CD3E gRNA-2 was modified from AGG to ACG in the left homology
658 arm. (C) Human CD3E locus showing targeting sites of both gRNAs tested. (D) mCherry
659 expression by Jurkat cells transduced with NIL-LCv2B-HDR-mCherry-2A-hCD3E. Results are
660 representative of two independent experiments. (E) PCR analysis of homology arm regions of
661 mCherry+ Jurkat cells. (F) All-in-one lentiviral design for tBFP-RelA knock-in via CRISPR-Cas9-
662 HDR. Start codon and the original second codon are labeled as highlighted in G. (G) Human RelA
663 locus showing the target site of gRNA used in F. (H) tBFP expression of Jurkat cells untreated or
664 treated with LCv2S-HDR-tBFP-hRelA, before or after tBFP+ cell sorting. Results are representative
665 of two independent experiments. (I) Live cell confocal time-lapse imaging of tBFP-RelA knock-in
666 Jurkat cells stimulated with PMA-ionomycin. Pre-existing H2B-sfCherry expression created by
667 lentiviral transduction was used as nuclear marker. (J) Modified lentiCRISPRv2 plasmid
668 LentiCRISPRv2B replacing puromycin resistance with blasticidin resistance gene BSD. (K) Human
669 RelA locus showing the target site of gRNA A1 near exon 3. (L) tBFP expression by the Jurkat
670 tBFP-RelA knock-in line either untreated or transduced with LCv2B carrying RelA gRNA-A1 to
671 knockout endogenous RelA expression.
672
673 Figure 1 - figure supplement 1. Inducible genome editing system in RAW264.7
674 macrophages. (A) RAW cells transduced with pCW-Cas9 were treated with titrating doses of
675 doxycycline. Cell lysates were analyzed by western blot with anti-FLAG antibody. (B) Lentiviral
30 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
676 vector for gRNA expression with TagRFP-T fluorescent marker and blasticidin resistance gene
677 BSD. (C) Sequence analysis of the genomic DNA from the RAWiCE lines.
678
679 Figure 2 - figure supplement 1. DUSP1-KO RAW cell phenotype and Ki67 profile of B6 bone
680 marrow. (A) After blasticidin selection and doxycycline induction, RAWiCE cells transduced with
681 the indicated LGB variant were stimulated with TLR4 ligand and mean phospho-p38 was
682 quantified over time. Data are representative of two independent experiments. (B) Ki67 staining
683 profile of C57BL/6 mouse bone marrow cells after 30 ng/mL M-CSF treatment.
684
685 Figure 5 - figure supplement 1. LES2A-CRE, LentiCRISPRv2 variants LCv2S, LCv2R and
686 LCv2E, and lentiviral transduction efficiency in human PBMC. (A) The LentiCRISPRv2S
687 plasmid offers reduced lentiviral vector size and flexible cloning of the marker of interest. (B) The
688 LentiCRISPRv2R plasmid contains mScarlet-I for sensitive detection of Cas9 expression. (C) The
689 LentiCRISPRv2E plasmid contains the tEGFR cell surface marker to report Cas9 expression. (D)
690 The Lenti-EF1a-mScarlet-2A-CRE plasmid allows sensitive reporting of CRE recombinase
691 expression via the mScarlet-I fluorescent marker. (E) mScarlet expression by human PBMC
692 transduced with LCv2R or NIL-LCv2R.
693
694 Supplementary Figure. Lentiviral-mediated CRISPRa with the LentiSAMPHv2 System. (A)
695 The all-in-one LentiSAMPHv2 (LSv2) plasmid for CRISPR-based gene activation applications. (B)
696 Flow cytometric analysis of human PDCD1 (top panel) or PDL1 (bottom panel) cell surface protein
697 expression after LSv2 transduction with empty vector control or the indicated CRISPRa targeting
698 gRNA. (C) Flow cytometric analysis of human PDCD1 (left panel) or PDL1 (right panel) cell
31 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
699 surface protein expression in untransduced control cells versus cells transduced with LSv2
700 targeting the human PDCD1 promoter region.
701
702 Table 1. Summary of oligonucleotide sequences.
Oligonucleotide 5' to 3' Sequence Related to Figure # mDUSP1-E1F CGTCTTTGCTTTTGGCTTTGGCGGCGCCAAGCTCGGTAGG 1G mDUSP1-E1R GGTGGACTGTTTGCTGCACAGCTCAGGGCAGGAAGCCGAA 1G mDUSP2-E1F CCTGGGAGAAAATGGGAAAAGTGAGGAAGCTGAAGACCTG 1G mDUSP2-E1R GACAAGAAAGGGTATGATTAGCCAAGAGGTCGGGAACGGG 1G mDUSP3-E1F GTGTTTGGGGTGAATGAATGGATGCCCACTCTGCTGGTGT 1-fs1C mDUSP3-E1R GGGTATTTGGATTTCCTGACACGGACAGGAAAAGCTCCAC 1-fs1C mDUSP4-E1F CTTGCGTTGGGGGCGGGGCCTGGCGAGGTAGTAATGACTC 1-fs1C mDUSP4-E1R CCGCCAAGTCCCTTACACTACCTACCCTCCCACCTCGCTC 1-fs1C mDUSP5-E1F GTTCCTGACACTCCACCGGTAGTCCGGGGTGATGCGTGAG 1-fs1C mDUSP5-E1R GACGTGTTGCAAGGACCTCCCAAGCGCACGTCAAACCCCG 1-fs1C BGH-R TAGAAGGCACAGTCGAGG 1H hSTAT3-Exon1-F GGAGCTGTGATTATCCCAAGGTGGGGATTGTGAATGTGTT 3B & 3F hSTAT3-Exon1-R CCACATCACTGGATTATCAGAATATATAGAGGATCTGCCC 3B & 3F hBcl10-E1F TGGCGTCGATAGGCTGCC 4B hBcl10-E1R TGGTACAGCCTTCGCTCTAGGCTG 4B GAGGATTAAATAAGATATATCAGAAAAGCTCTTAGAACGGTG hCD3E-F 5E CTTGGATATAGTAAGCATTTGATTAATGCATGC hCD3E-R CCATTTTGCCTCATGTGGTGCAGCCATTTAGAGTAC 5E 703
704
705
706
707
708
709
710
32 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
711 Table 2. Summary of gRNA targeting sequences.
Target Gene 5' to 3' gRNA Targeting Sequence Related to Figure # mDUSP1 ATCGTGCGGCGCCGCGCCAA 1, 2 & 2-fs1 mDUSP2 TTGCGATGCCGATCGCCATG 1 & 2-fs1 mDUSP3 CCTCGGGACGACCTCGTTGC 1, 1-fs1, 2 & 2-fs1 mDUSP4 CGGCGACATGGTGACGATGG 1, 1-fs1, 2 & 2-fs1 mDUSP5 ATGAAGGTCACGTCGCTCGA 1, 1-fs1 & 2-fs1 hSTAT3 (gRNA-A) TGGGCCATCCTGCTAAAATC 3 hSTAT3 (gRNA-1) GCAGCTTGACACACGGTACC 3 hBCL10 (gRNA-A) GATGGCGCTTCTTCCGGGTC 4 hBCL10 (gRNA-B) ATGGCGCTTCTTCCGGGTCC 4 hBCL10 (gRNA-C) GCGGGAGATGGCGCTTCTTC 4 hBCL10 (gRNA-D) TCGGTGAGGGACGGTGCGGT 4 hBCL10 (gRNA-1) CGCACCGTCCCTCACCGAGG 4 hBCL10 (gRNA-2) CACCGCACCGTCCCTCACCG 4 hBCL10 (gRNA-3) GGACCTCACTGAAGTGAAGA 4 hCD3E (gRNA-1) AGATGCAGTCGGGCACTCAC 5 hCD3E (gRNA-2) TTACTTTACTAAGATGGCGG 5 hRelA GACCCCGGCCATGGACGGTG 5 hRelA (gRNA-A1) AGCGCCCCTCGCACTTGTAG 5 hPDCD1 (gRNA-1) GACAGAGGCAGTGCTGGGGG Supplementary Figure hPDCD1 (gRNA-2) GGGAGACAGAGGAGATGGGG Supplementary Figure hPDCD1 (gRNA-3) GGGTGAGGAGGGGGTAGGAC Supplementary Figure hPDL1 (gRNA-1) CTATACACAGCTTTATTCCT Supplementary Figure hPDL1 (gRNA-2) CTGACCTTCGGTGAAATCGG Supplementary Figure hPDL1 (gRNA-3) TCAGTTTAGGTATCTAGTGT Supplementary Figure 712
713
714 Video 1. Live cell confocal time-lapse imaging data of tBFP-RelA translocations following
715 PMA-ionomycin stimulation in human Jurkat T cells.
33 Figure 1
A bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder,cPPT who has granted bioRxiv a license toT2A display the preprint in perpetuity. ItT2A is made pCW-Cas9-2A-EGFP availableΨ RRE undertTRE aCC-BY 4.0S. International pyogenes license Cas9. EGFP hPGK PuroR rtTA-A
B 25h Induction Untreated Control C Clone 1 Clone 5 Clone 7 Clone 9 0.5 μg/mL Doxycycline 1.0 μg/mL Doxycycline 1.5 μg/mL Doxycycline
Untreated Control 1.0 μg/mL Doxycycline (22h)
D cPPT P2A Ψ RRE U6 sgRNA EF1α TagBFP BSD WPRE LentiGuide-TagBFP-2A-BSD (LGB)
F LGB gRNA Target: DUSP2 DUSP3 E LGB-EV EGFP+ tBFP+ Gate WB: αDUSP3
WB: αDUSP1 EGFP+ tBFP+ RAW264.7 Cell Lysate
LGB-DUSP3 G DUSP1 Exon 1 DUSP2 Exon 1 DUSP3 Exon 1 DUSP4 Exon 1 DUSP5 Exon 1 LGB gRNA Target: EV DUSP1 EV DUSP2 EV DUSP3 EV DUSP4 EV DUSP5
LGB-DUSP3 LGB-EV Indel (%) 9.3 10.6 24.0 19.9 11.5
H mouse DUSP1 locus mouse DUSP2 locus DUSP1 gRNA PAM DUSP2 gRNA PAM 5’...CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGCCAAGGGCGCCATGGGCCTGGAGCATATC...3’ 5’...AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGCCATGGGGCTGGAGACGGCGTGCGAGCTAG...3’
...CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGC ATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGC ATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGCC GGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCG AGCATATC...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCG GGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGC ...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGCC TGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCC ATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATC ATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGCC GGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGC ATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATC ATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGC CATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGC ATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGCCCATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... AGAGGACATCCGGAAGCAGGAGGCTTTGCGATGCCGATCGC ATGGGGCTGGAGACGGCGTGCGAGCTAG...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AAGGGCGCCATGGGCCTGGAGCATATC...... CTCAGTGAACGTGCGCTTCAGCACCATCGTGCGGCGCCGCGC AGGGCGCCATGGGCCTGGAGCATATC...... CTCAGTGAACGTGCGCTTCAGCACCATC CATGGGCCTGGAGCATATC... Figure 2
A bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002Cas9 (EGFP+) LGB-gRNA; this version posted(EGFP+ February tBFP+) 14, 2020. The copyright holder for this preprint Cas9 (EGFP+) Mouse (which was not certified by peer review)Bone Marrow is the author/funder,Transduction who has granted bioRxiv BMDMsa license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. LPS Stimulation Fixation and Staining M-CSF M-CSF (2 days) (5 days)
B % Live Cell Gate C % tBFP+ Gate BMDM - 5 days post-transduction LGB-DUSP3 LGB-EV
D E LGB-EV LGB-DUSP1 4500 LGB-EV 30 min 80 min LGB-DUSP1 3500 LGB-DUSP4
4 2500 10 p-p38 MF I 1500 103
500 Fluorescence (a.u.) tBFP 102 0 20 40 60 80 100 120 102 103 104 102 103 104 minutes of stimulation p-p38 Figure 3 A B bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002CRISPR-Cas9 Nickase (D10A) gRNA; Pairthis versionDesign posted February 14, 2020. The copyright holder for this preprintSTAT3 Exon 2 (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprintPX461 in perpetuity.gRNA Target: ItSTAT3-A is made EV human STAT3 locus available under aCC-BY 4.0 International license. pKLV-BFP gRNA Target: STAT3-1 EV Start Codon STAT3 gRNA-1 PAM
5’...GACCCCTGATTTTAGCAGGATGGCCCAATGGAATCAGCTACAGCAGCTTGACACACGGTACCTGGAGCA...3’ ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: 3’...CTGGGGACTAAAATCGTCCTACCGGGTTACCTTAGTCGATGTCGTCGAACTGTGTGCCATGGACCTCGT...5’
PAM STAT3 gRNA-A Indel (%) 10.7
C ATG T2A GCC STAT3 HDR Donor Plasmid Design 2kbp Homology Arm PuroR mNeonG 2kbp Homology Arm
D
A Lipofectamine 3000 Puromycin Selection Dilution Cloning Flow Cytometric & Genomic PCR Analysis 1 Jurkat T Cells mNG-STAT3 D Jurkat
E F Genomic PCR - human STAT3 locus Clone # mNG MFI Clone # mNG MFI mNeonGreen-STAT3 Knock-in Jurkat Clones WT 14 21 22 24 26 27 40 20 143 40 287 19 201 39 69.5 (bp)
5000 - 18 181 38 188 4000 - 17 174 37 227 3000 -
16 266 36 365 2000 - - 2181 bp (Knock-in)
15 190 35 171 1650 - 14 335 34 205 13 168 33 159 1000 - 12 95.0 32 191 850 - 11 222 31 129 - 810 bp (WT)
10 97.5 30 70.6 650 - 9 263 29 64.8 8 203 28 132 7 218 27 286 6 73.5 26 261 5 271 25 197 G Clonal Distribution in mNG-STAT3 Jurkat Line 4 173 24 292 3 216 23 194 10.00% No Knock-in Total=40 2 117 22 302 7.50% Minimal Editing 1 242 21 356 82.50% Partial or Complete Knock-in WT 71.3 WT 71.3 Figure 4
AbioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002CRISPR-Cas9; this Nickase version (D10A) posted gRNA February Pairs 14, Design 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made human BCL10 locus available under aCC-BY 4.0 International license. gRNA-3 gRNA-2 Start Codon gRNA-1 5’...GCCCGAGCTCCCGGACCCGGAAGAAGCGCCATCTCCCGCCTCCACCATGGAGCCCACCGCACCGTCCCTCACCGAGGAGGACCTCACTGAAGTGAAGAAGGACGTGAGTAAC...3’ :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: 3’...CGGGCTCGAGGGCCTGGGCCTTCTTCGCGGTAGAGGGCGGAGGTGGTACCTCGGGTGGCGTGGCAGGGAGTGGCTCCTCCTGGAGTGACTTCACTTCTTCCTGCACTCATTG...5’ gRNA-A gRNA-D gRNA-B gRNA-C
B BCL10 Exon 1 C PX461 gRNA Target: A B A C C D A+D - Cas9 Nickase (D10A) Double gRNA Expression pKLV-BFP gRNA Target: 1 1 2 1 2 3 - - T2A U6 gRNA-1 U6 gRNA-A Cbh spCas9n PuroR
PX462-hBCL10-gRNA-A1 Indel (%) 15.4 16.2 14.0 15.3 13.3 25.5 1.7
D ATG T2A GAG BCL10 HDR Donor Plasmid Design 2kbp Homology Arm PuroR mNeonG 2kbp Homology Arm loxP loxP
E
A1 Lipofectamine 3000 Puromycin Selection CRE Expression PuroR-T2A-excised mNG-BCL10 Jurkat Jurkat T Cells mNG-BCL10 D PuroR+ Jurkat ( Puromycin-sensitive cells )
F G loxP-PuroR-loxP-mNG-BCL10 Line I PuroR-T2A-excised mNG-BCL10 Line WT mNG-BCL10 No CRE +NIL-CRE 2nd HDR: Puro-T2A-mScarlet-STAT3 mNG-BCL10+ mS-STAT3+ 78.4%
H ATG T2A GCC STAT3 HDR Donor Plasmid Design 2kbp Homology Arm PuroR mScarlet 2kbp Homology Arm Figure 5
A B LentiCRISPRv2B-HDR-mCherry-2A-hCD3E bioRxivLenti-CMV-mCherry-P2A-CRE preprint doi: https://doi.org/10.1101/2020.02.13.947002 Viral Packaging ; this versionPAM posted Mutation February (G to C) 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who hascPPT granted bioRxivATG a licenseP2A to display the preprint in perpetuity. ItP2A is made available underΨ aRRECC-BYHomology 4.0 InternationalmCherry licenseHomology. U6 sgRNA EF1α Cas9 BSD WPRE 800bp 850bp
C human CD3E locus CD3E gRNA-1 PAM Start Codon 5’...CTGGCCTCCGCCATCTTAGTAAAGTAACAGTCCCATGAAACAAAGATGCAGTCGGGCACTCACTGGAGAG...3’ :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: 3’...GACCGGAGGCGGTAGAATCATTTCATTGTCAGGGTACTTTGTTTCTACGTCAGCCCGTGAGTGACCTCTC...5’
PAM CD3E gRNA-2 D E Jurkat T Cells - 7 days post NIL-CRISPR-Cas9-HDR Delivery Genomic PCR - human CD3E locus Untreated Control CD3E gRNA-1 CD3E gRNA-2 CD3E gRNA (mCherry+ Jurkat) Control 1 2 (bp) 4000 - 3000 - - 2543 bp (Knock-in) 2000 - - 1769 bp (WT) 1650 -
1000 -
F G LentiCRISPRv2S-HDR-tBFP-hRelA human RelA locus cPPT ATG GAC RelA gRNA PAM Start Codon Ψ RRE Homology TagBFP Homology U6 sgRNA EF1α Cas9 WPRE 5’...CCCCCGGGACCCCGGCCATGGACGGTGAGGTCGC...3’ :::::::::::::::::::::::::::::::::: 1000bp 1000bp 3’...GGGGGCCCTGGGGCCGGTACCTGCCACTCCAGCG...5’
H 16 days post NIL-CRISPR-Cas9-HDR Delivery RelA gRNA J LentiCRISPRv2B (LCv2B) Untreated Control RelA gRNA tBFP+ Sorted cPPT P2A Ψ RRE U6 sgRNA EF1α Cas9 BSD WPRE
K human RelA locus (Exon 3)
5’...CGCTTCCGCTACAAGTGCGAGGGGCGCTCCGCGGGC...3’ :::::::::::::::::::::::::::::::::::: 3’...GCGAAGGCGATGTTCACGCTCCCCGCGAGGCGCCCG...5’
PAM RelA gRNA A1
I tBFP-hRelA Knock-in Jurkat +PMA-ionomycin Stimulation L tBFP-hRelA Knock-in Jurkat Line 6 days post LCv2B Transduction 5 days post Blasticidin Selection Untreated Control RelA gRNA A1 tBFP-RelA H2B-sfCherry
Scale Bar = 10 µm 0 min 20 min 40 min 60 min Figure 1 - �igure supplement 1
AbioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which Doxycyclinewas not certified by(ng/mL): peer review) is0 the author/funder,20 50 who 100has granted200 bioRxiv400 a license600 to display800 the1000 preprint in perpetuity. It is made 24h available under aCC-BY 4.0 International license.
- FLAG-tagged Cas9
pCW-Cas9+ RAW264.7 Cell Lysate WB: αFLAG B cPPT P2A Ψ RRE U6 sgRNA EF1α TagRFP BSD WPRE LentiGuide-TagRFP-2A-BSD (LGR) C mouse DUSP3 locus PAM DUSP3 gRNA 5’...GCAAGATCTCAACGACCTGCTCTCGGATGGCAGCGGCTGCTACAGCCTGCCGAGCCAGCCCTGCAACGAGGTCGTCCCGAGGGTCTACGTGGGCAACGCGTGAGTCTCTGGGAGGGCCAAACCCGTAGCCGCTCCCAGCG...3’
...GCAAGATCTCAACGACCTGCTCTCGGATGGCAGCGGCTGCTACAGCCTGCCGAGC GTCCCGAGGGTCTACGTGGGCAACGCGTGAGTCTCTGGGAGGGCCAAACCCGTAGCCGCTCCCAGCG...... GCAAGATCTCAACGACCTGCTCCT ...... GCAAGATCTCAACGACCTGCTCTCGGATGG TCTACGTGGGCAACGCGTGAGTCTCTGGGAGGGCCAAACCCGTAGCCGCTCCCAGCG...... GCAAGATCTC TGGGAGGGCCAAACCCGTAGCCGCTCCCAGCG...... GCAAGATCTCAACGACCTGCTCTCGGATGGCAGCGGCTG ...... GCAAGATCTCAACGACCTGCTCTCGGATGGCAGCGGCTGCTACAGCCTGCCGAGCCAGCCCTGCA GGTCGTCCCGAGGGTCTACGTGGGCAACGCGTGAGTCTCTGGGAGGGCCAAACCCGTAGCCGCTCCCAGCG...... GCAAGATCTCAACGACCTGCTCTCGGATGGCAGCGGCTGCTACAGCCTGCCGAGCCAGCCCTGCAA GGTCGTCCCGAGGGTCTACGTGGGCAACGCGTGAGTCTCTGGGAGGGCCAAACCCGTAGCCGCTCCCAGCG...
mouse DUSP4 locus DUSP4 gRNA PAM 5’...CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGATGGAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...3’
...CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGA TGGAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGA AGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGAATGGAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGA GGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGA AGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGA TGGAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGA GCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACG GAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGA GGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGA AGGAACTGCGGGAGATGGACTGCAT ...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATG AGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACGAATGGAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGC AGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGG AGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...... CTAGCTGGCTCCGGTGCCCTTGGCCTTCTCCAGCTAGCTCCCCAGCTTACTGCGTTTTGCCGGCGACATGGTGACG GAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGGGATGAGAACG...
mouse DUSP5 locus DUSP5 gRNA PAM 5’...GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCGCTCGACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...3’
...GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCG ACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAG CGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGC TGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCGCTTCGACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCG ACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCGC GACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCGCTTCGACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCGGAGGTGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCGCTTCGACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCGCTTCGACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGGTGGCAGCGGCATGAAGGTCACGTCG ACGGGCGCCAGCTGCGCAAGATGCTCCGCAAGGAGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GCCCGCCCGTCCTCTGGCAGCTGTGGGGCGCGCAGCGTCGGGCCGCTGGG AGGCGGAGGCGCGCTGCGTGGTGCTCGA...... GC ...... Figure 2 - �igure supplement 1
AbioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not1600 certified by peer review) is the author/funder,RAWiCE who Cells has granted bioRxiv a license to display the preprint in perpetuity. It is made availableEGFP+ under tBFP+ aCC-BY Gate 4.0 International license. LGB-EV 1200 LGB-DUSP1 LGB-DUSP2 800 LGB-DUSP3
p-p38 MF I LGB-DUSP4 LGB-DUSP5 400
0 20 40 60 80 100 120 minutes of stimulation B Bone marrow with 30 ng/ml M-CSF Day 2 Day 3 Day 4 Day 5 Day 6
72.6 85.3 62.4 19.1
67.7
Ki67 Figure 5 - �igure supplement 1 A bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version postedLentiCRISPRv2S February 14, 2020. (LCv2S) The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made cPPT available under aCC-BY 4.0 International license. Ψ RRE U6 sgRNA EF1α S. pyogenes Cas9 WPRE
B LentiCRISPRv2R (LCv2R) cPPT P2A Ψ RRE U6 sgRNA EF1α S. pyogenes Cas9 mScarlet-I WPRE
C LentiCRISPRv2E (LCv2E) cPPT P2A Ψ RRE U6 sgRNA EF1α S. pyogenes Cas9 tEGFR WPRE
D Lenti-EF1a-mScarlet-2A-CRE (LES2A-CRE) cPPT P2A Ψ RRE EF1α mScarlet-I CRE recombinase WPRE
E hPBMC - 1 day post-transduction Untransduced LCv2R NIL-LCv2R Supplementary Figure A bioRxiv preprint doi: https://doi.org/10.1101/2020.02.13.947002; this version posted February 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint LentiSAMPHv2in perpetuity. It is made (LSv2) cPPT available under aCC-BY 4.0 International license. P2A T2A Ψ RRE U6 MS2-sgRNA EF1α dSpCas9 VP64 MS2 p65 HSF1 BSD WPRE
B Jurkat T Cells - 24 days post LSv2 Transduction - 23 days post Blasticidin Selection No gRNA Control hPDCD1 gRNA-1 hPDCD1 gRNA-2 hPDCD1 gRNA-3
No gRNA Control hPDL1 gRNA-1 hPDL1 gRNA-2 hPDL1 gRNA-3
C Jurkat T Cells - 16 days post LSv2 Transduction - 15 days post Blasticidin Selection Untransduced Control LSv2-hPDCD1-gRNA-2