Volume 1 - Number 1 May - September 1997
Volume 20 - Number 6 June 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Scope
The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It is made for and by: clinicians and researchers in cytogenetics, molecular biology, oncology, haematology, and pathology. One main scope of the Atlas is to conjugate the scientific information provided by cytogenetics/molecular genetics to the clinical setting (diagnostics, prognostics and therapeutic design), another is to provide an encyclopedic knowledge in cancer genetics. The Atlas deals with cancer research and genomics. It is at the crossroads of research, virtual medical university (university and post-university e-learning), and telemedicine. It contributes to "meta-medicine", this mediation, using information technology, between the increasing amount of knowledge and the individual, having to use the information. Towards a personalized medicine of cancer.
It presents structured review articles ("cards") on: 1- Genes, 2- Leukemias, 3- Solid tumors, 4- Cancer-prone diseases, and also 5- "Deep insights": more traditional review articles on the above subjects and on surrounding topics. It also present 6- Case reports in hematology and 7- Educational items in the various related topics for students in Medicine and in Sciences. The Atlas of Genetics and Cytogenetics in Oncology and Haematology does not publish research articles.
See also: http://documents.irevues.inist.fr/bitstream/handle/2042/56067/Scope.pdf
Editorial correspondance
Jean-Loup Huret, MD, PhD, Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France phone +33 5 49 44 45 46 [email protected] or [email protected] .
Editor, Editorial Board and Publisher See:http://documents.irevues.inist.fr/bitstream/handle/2042/48485/Editor-editorial-board-and-publisher.pdf
The Atlas of Genetics and Cytogenetics in Oncology and Haematology is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008. The Atlas is hosted by INIST-CNRS (http://www.inist.fr) Staff: Vanessa Le Berre Philippe Dessen is the Database Directorof the on-line version (Gustave Roussy Institute – Villejuif – France).
Publisher Contact: INIST-CNRS Mailing Address: Catherine Morel, 2,Allée du Parc de Brabois, CS 10130, 54519 Vandoeuvre-lès-Nancy France. Email Address:[email protected] Articles of the ATLAS are free in PDF format, and metadata are available on the web in Dublin Core XML format and freely harvestable.A Digital object identifier (DOI®), recorded at the International Agency CrossRefhttp://www.crossref.org/ is assigned to each article. http://AtlasGeneticsOncology.org
© ATLAS - ISSN 1768-3262
The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Editor-in-Chief Jean-Loup Huret (Poitiers, France) Lymphomas Section Editor Antonino Carbone (Aviano, Italy) Myeloid Malignancies Section Editor Robert S. Ohgami (Stanford, California) Bone Tumors Section Editor Judith Bovee (Leiden, Netherlands) Head and Neck Tumors Section Editors Cécile Badoual and Hélène Blons (Paris, France) Urinary Tumors Section Editor Paola Dal Cin (Boston, Massachusetts) Pediatric Tumors Section Editor Frederic G. Barr (Bethesda, Maryland) Cancer Prone Diseases Section Editor Gaia Roversi (Milano, Italy) AKT signalings Section Editor Robin C.Muise-Helmericks (Charleston, South Carolina) Cell Cycle Section Editor João Agostinho Machado-Neto (São Paulo, Brazil) DNA Repair Section Editor Godefridus Peters (Amsterdam, Netherlands) Hormones and Growth factors Section Editor Gajanan V. Sherbet (Newcastle upon Tyne, UK) Mitosis Section Editor Patrizia Lavia (Rome, Italy) WNT pathway Section Editor Alessandro Beghini (Milano, Italy)
Board Members Sreeparna Department of Biological Sciences, Middle East Technical University, Ankara, Turkey; [email protected] Banerjee Alessandro Department of Health Sciences, University of Milan, Italy; [email protected] Beghini Judith Bovée 2300 RC Leiden, The Netherlands; [email protected] Dipartimento di ScienzeMediche, Sezione di Ematologia e Reumatologia Via Aldo Moro 8, 44124 - Ferrara, Italy; Antonio Cuneo [email protected] Paola Dal Cin Department of Pathology, Brigham, Women's Hospital, 75 Francis Street, Boston, MA 02115, USA; [email protected] François IRBA, Departement Effets Biologiques des Rayonnements, Laboratoire de Dosimetrie Biologique des Irradiations, Dewoitine C212, Desangles 91223 Bretigny-sur-Orge, France; [email protected] Molecular and Population Genetics Laboratory, Wellcome Trust Centre for Human Genetics, Roosevelt Dr. Oxford, OX37BN, UK Enric Domingo [email protected] Ayse Elif Erson- Department of Biological Sciences, Middle East Technical University, Ankara, Turkey; [email protected] Bensan Ad Geurts van Department of Human Genetics, Radboud University Medical Center, Radboud Institute for Molecular Life Sciences, 6500 HB Kessel Nijmegen, The Netherlands; [email protected] Department of Pediatrics and Adolescent Medicine, St. Anna Children's Hospital, Medical University Vienna, Children's Cancer Oskar A. Haas Research Institute Vienna, Vienna, Austria. [email protected] Anne Hagemeijer Center for Human Genetics, University Hospital Leuven and KU Leuven, Leuven, Belgium; [email protected] Department of Pathology, The Ohio State University, 129 Hamilton Hall, 1645 Neil Ave, Columbus, OH 43210, USA; Nyla Heerema [email protected] Sakari Knuutila Hartmann Institute and HUSLab, University of Helsinki, Department of Pathology, Helsinki, Finland; [email protected] Lidia Larizza Lab Centro di Ricerche e TecnologieBiomedicheIRCCS-IstitutoAuxologico Italiano Milano, Italy; l.larizza@auxologico Department of Human, Animal Cell Lines, Leibniz-Institute DSMZ-German Collection of Microorganisms, Cell Cultures, Roderick Mc Leod Braunschweig, Germany; [email protected] Cristina Mecucci Hematology University of Perugia, University Hospital S.Mariadella Misericordia, Perugia, Italy; [email protected] Department of Clinical Genetics, University and Regional Laboratories, Lund University, SE-221 85 Lund, Sweden; Fredrik Mertens [email protected] Konstantin Miller Institute of Human Genetics, Hannover Medical School, 30623 Hannover, Germany; [email protected] Department of Clinical Genetics, University and Regional Laboratories, Lund University, SE-221 85 Lund, Sweden; Felix Mitelman [email protected] Hossain Mossafa Laboratoire CERBA, 95066 Cergy-Pontoise cedex 9, France; [email protected] Department of Human, Animal Cell Lines, Leibniz-Institute DSMZ-German Collection of Microorganisms, Cell Cultures, Stefan Nagel Braunschweig, Germany; [email protected] Florence Laboratory of Solid Tumors Genetics, Nice University Hospital, CNRSUMR 7284/INSERMU1081, France; Pedeutour [email protected] Department of Pathology, St. Jude Children's Research Hospital, 262 Danny Thomas Place, Mail Stop 250, Memphis, Tennessee Susana Raimondi 38105-3678, USA; [email protected] Clelia Tiziana Department of Biology, University of Bari, Bari, Italy; [email protected] Storlazzi Sabine Strehl CCRI, Children's Cancer Research Institute, St. Anna Kinderkrebsforschunge.V., Vienna, Austria; [email protected] Nancy Uhrhammer Laboratoire Diagnostic Génétique et Moléculaire, Centre Jean Perrin, Clermont-Ferrand, France; [email protected] Dan L. Van Dyke Mayo Clinic Cytogenetics Laboratory, 200 First St SW, Rochester MN 55905, USA; [email protected] Universita di Cagliari, Dipartimento di ScienzeBiomediche(DiSB), CittadellaUniversitaria, 09042 Monserrato (CA) - Italy; Roberta Vanni [email protected] Service d'Histologie-Embryologie-Cytogénétique, Unité de Cytogénétique Onco-Hématologique, Hôpital Universitaire Necker-Enfants Franck Viguié Malades, 75015 Paris, France; [email protected]
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Volume 20, Number 6, June 2016 Table of contents
Gene Section
CDC25A (Cell division cycle 25A) 316 Christine Dozier, Stéphane Manenti MIR200A (microRNA 200a) 322 Yaguang Xi, Hong Chang MIR429 (microRNA 429) 324 Yaguang Xi, Hong Chang SH3PXD2A (SH3 and PX domains 2A) 326 Carman Man-Chung Li, Tyler Jacks SLPI (secretory leukocyte peptidase inhibitor) 331 Nella Ambrosi, Diego Guerrieri, Fiorella Caro, Micaela Barbieri Kennedy, Francisco Sánchez, Mercedes L. Sánchez, Eduardo Chuluyan SOCS2 (suppressor of cytokine signaling 2) 341 Indranil Paul, Leandro Fernández-Pérez, Amilcar Flores-Morales
Leukaemia Section der(18)t(1;18)(q10-25;q11-23) 347 Adriana Zamecnikova, Soad Al Bahar
Cancer Prone Disease Section
Oculocutaneous Albinism 352 Kunal Ray, Mainak Sengupta, Kausik Ganguly
Deep Insight Section
General resources in Genetics and/or Oncology 359 Etienne De Braekeleer, Jean Loup Huret, Hossain Mossafa, Katriina Hautaviita, Philippe Dessen Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Gene Section Review
CDC25A (Cell division cycle 25A) Christine Dozier, Stéphane Manenti Cancer Research Center of Toulouse (CRCT), UMR1037 INSERM, ERL5294 CNRS, Université Toulouse III Paul Sabatier, Toulouse, France. [email protected]
Published in Atlas Database: August 2015 Online updated version : http://AtlasGeneticsOncology.org/Genes/CDC25AID40004ch3p21.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62938/08-2015-CDC25AID40004ch3p21.pdf DOI: 10.4267/2042/62938 This article is an update of : Ray D, Kiyokawa H. CDC25A (Cell division cycle 25A). Atlas Genet Cytogenet Oncol Haematol 2008;12(6)
This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Other names: CDC25A2 Abstract Local order CDC25A phosphatase is essential for cell cycle The gene is located telomeric to CAMP (cathelicidin progression by activating the cyclin-associated antimicrobial peptide) and centromeric to kinases CDK4/6, CDK2 and CDK1. Its invalidation LOC729349 (a pseudogene similar to 60S ribosomal in mice is embryonic lethal. Its expression is tigthtly protein L17 (L23)). The gene starts at 48,173,672 bp regulated at many levels and its overexpression is from pter and ends at 48,204,805 bp from pter with observed in various cancers, often associated with a total size of 31,133 bases. high grade tumors and poor prognosis. Keywords DNA/RNA CDC25, cell cycle, CDK/cyclin, apoptosis Description Identity CDC25A is about 31.13 Kb located on the short (p) arm of chromosome 3, in the centromere-to-telomere HGNC (Hugo): CDC25A orientation. The gene has 15 exons and the start Location: 3p21.31 codon is located at the end of exon 1 and stop codon in the beginning of exon 15.
Genomic organization of human CDC25A gene on chromosome 3 p-ter.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 316 CDC25A (Cell division cycle 25A) Dozier C, Manenti S
Domains of different isoforms of CDC25A (A1 and A2). The splice variant A2 lacks an in-frame exon (exon 6) encoding 40 amino acids (amino acid 160-201), however, has the same N- and C-termini compared to isoform A1. The approx. molecular weight of each isoform is mentioned in parenthesis.
Transcription lung, thyroid, head and neck cancers and also in high grade lymphomas. The CDC25A transcript is 3704 bp in length. So far two major transcript variant have been reported, Localisation CDC25A1 and A2. CDC25A initially believed to be a nuclear protein. The transcript variant CDC25A2, has a deletion of But using fluorescence loss in photobleaching 120 nucleotides (exon 6) resulting in a protein (FLIP) a more dynamic nuclear-cytosolic shuttling having truncation of 40 amino acids (between amino of CDC25A localization has been reported. acid 160-201). At the very N-terminus end between amino acid 38- However, both the N-terminal and C-terminal end of 59, the nuclear export sequence (NES) is located, the protein is the same in both splice variant. whereas between amino acid 272-294, a bipartite nuclear localization signal (NLS) was proved to be Protein important for its nuclear localization (Källström et Description al., 2005). Depending of the cell line, CDC25A is nuclear or The full length CDC25A protein consists of 524 nuclear and cytoplasmic. amino acids with an estimated molecular weight of 59 kDa. Function The other reported isoform CDC25A2, consists of 484 amino acids with a molecular weight of 54.4 - CDC25A is essential for early embryonic kDa (Wegener et al., 2000).. Both the isoforms have development as Cdc25A-null mice die in utero by the same N- and C-terminal end, thus expected to embryonic day 7(Ray et al., 2007). have similar catalytic activity. - It is a member of the M-phase inducer (MPI) The N-terminal regulatory domain contains several phosphatase family protein, which not only regulates phosphorylation sites and shows low sequence mitotic progression by activating mitotic CDKs in a homology between CDC25 family members, dosage-dependent manner, it is also equally whereas C-terminal end has conserved Rhodanese important in G1 and for G1 to S-phase transition. homology domain containing the active site - During G1, CDC25A dephosphorylates cysteine. CDK4/CDK6 on tyrosine 17 and 24, respectively, The catalytic site contain the CX5R motif (C= allowing their association with D-type cyclins and cysteine; X= any amino acid; R= arginine) common thus their activation (Bertero et al., 2013). During G1 to all protein tyrosine phosphatases (Boutros et al., to S transition, it activates CDK2 by removing two 2006). inhibitory phosphates on residues threonine 14 and Upon apoptosis induction, CDC25A is cleaved at tyrosine 15. During G2/M transition CDC25A D223 (D=Aspartic acid) by caspase to generate a similarly regulates the activity of CDK1 (CDC2). catalytically active CDC25A C-terminal 37Kda - It is an inhibitor of apoptosis by inhibiting protein (Mazars et al., 2009; Chou et al., 2010). apoptosis signal-regulating kinase 1 (ASK1). in a phosphatase-independent manner, by activating the Expression AKT-survival pathway in the cytoplasm and also by CDC25A is expressed early during embryonic stages stimulating NF-kB activity through NFKBIA (IκB- and in adults it is expressed in a variety of normal α) destabilization (review Fernandez-Vidal et al., cells and tissues. 2008; review Shen and Huang, 2012; Hong et al., CDC25A is a highly expressed gene in a variety of 2012). But overexpressed nuclear CDC25A also human cancers including breast, esophageal, gastric, exhibits pro apoptotic activity by activating the pro-
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 317
CDC25A (Cell division cycle 25A) Dozier C, Manenti S
apoptotic factor FKHLR1 (review Fernandez-Vidal ubiquitination by the E3 ubiquitine ligase APC/C et al., 2008; review Shen and Huang, 2012). (cyclosome) (review Fernandez-Vidal et al., 2008; - CDC25A plays an important role in review Shen and Huang, 2012). spermatogenesis as decreased transcript level of - CDC25A protein level is important for oncogene- Cdc25A is correlated with spermatogenic failure and induced transformation and mouse mammary tumor failed sperm retrieval in infertile men. (Cheng et al., virus (MMTV)-neu/ras induced mammary 2009). tumorigenesis (Ray et al., 2007). -CDC25A also plays a role in meiotic maturation of - During early cell cycle progression glycogen oocytes, its activity is required for the metaphase II synthase kinase 3-beta (GSK-3β) can phosphorylate arrest in mouse oocytes (Oh et al., 2013). allowing its proteasomal degradation. Interestingly, - CDC25A was shown to function as a androgen the same report showed that overproduction of receptor corepressor in prostate cancer cells (Chiu et CDC25A in some human cancers is correlated to the al., 2009). inactivation of GSK-3β (Kang et al., 2008). Regulation - Overexpression of CDC25A in some human - CDC25A is transcriptionally regulated by E2F, a sarcomas has also been shown to be the result of transcription factor implicated at the G1/S transition, transcriptional upregulation involving the c-myc, STAT3, the p53-pathway via the transcription factor TCF/β-catenin upregulated upon transcription factor ATF3, TCF/beta-catenin, activation of the wnt canonical signaling FOXM1, NANOG in embryonic stem cell and (Vijayakumar et al.,2011). HOMOLOGY CDC25A PROX1 in neural precursor (review Fernandez- gene is highly conserved among mammals (99% Vidal et al., 2008; review Shen and Huang, 2012). homology with Chimpanzee; 90% with dog; about - CDC25A is also regulated at the translational level 86% with rat and about 85% with mouse). In by the translation initiation factors EIF2S1 mammals, CDC25A has two orthologs, CDC25B (eIF2alpha), EIF3M, the RNA-binding proteins and CDC25C. Among them, the N-terminal BOLL in spermatogenesis, and various miRNAs regulatory region show low sequence homology (20- such as let7b, 15a, 21, 449a, 449b, 483-3p, 424/503 25% identity), however, the C-terminal catalytic cluster and 141-3p. Some of these miRNAs being region is quite conserved with about 64% homology deregulated in cancers can contribute to the with CDC25B and about 58% homology to overexpression of CDC25A in cancers. CDC25C. - CDC25A activity can be regulated by phosphorylation events (review Fernandez-Vidal et Mutations al., 2008; review Shen and Huang, 2012). The kinases PIM-1, RAF1, CDK2, RSK, ROCK1 Gene mutation or amplification is not commonly (p160Rock) and the phosphatase CDC14B have reported for CDC25A. A naturally occurring point been shown to regulate CDC25A activity. The mutation (C to A) of mouse Cdc25A gene has been kinase CHK1 has been shown to phosphorylate reported where Histidine 128 (CAC) has been CDC25A on serine 178 and threonine 507 converted to Glutamine (CAA). This change caused preventing its interaction with its CDK/cyclin an increase in CDC25A phosphatase activity and substrates. thereby affected erythropoiesis in mice only under - CDC25A is an unstable protein in interphase, or certain genetic background (Melkun et al., 2002). A under several different stress conditions (DNA human polymorphism variant in which Serine 88 is damage induced by ionizing radiation, ultraviolet converted to Phenylalanine has been described. This light, replicative stress) being degraded by the variant fails to interact with ASK1 and therefore proteasome after ubiquitination by SCFβTrCP E3 does not suppress ASK1-mediated apoptosis, which ubiquitin ligase. This ubiquitination is dependent on leads to early embryonic lethality in mice and several phosphorylation events in the N-terminal predisposes to cancer in human (Bahassi et al. part of the protein carried out by many kinases such 2011).. as CHK1 (on serine 76, 124, 178, 279 and 293), CHK2 (on serine 124, 178 and 293), p38MAPK (on Implicated in serine 76), GSK3-β (on serine 76), Plk3 (on threonine 80), NEK11 (on serine 82 and 88) and Note CK1alpha and epsilon (on serine 82) (review - CDC25A is overexpressed in a variety of human Fernandez-Vidal et al., 2008; review Shen and cancers including breast, hepatocellular, ovarian, Huang, 2012). colorectal, gastric, lung, thyroid, esophageal, - CDC25A protein is stabilized during mitosis due to laryngeal, head and neck cancers, retinoblastoma, phosphorylation on serine 18 and 116 by glioma, and also in non-Hodgkin lymphoma. often CDK1/cyclinB occuring at the G2/M transition associated with high grade tumours and bad (Mailand et al., 2002). At the mitotic exit and in early prognosis (Boutros et al., 2007). G1, CDC25A is degraded by the proteasome after
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 318
CDC25A (Cell division cycle 25A) Dozier C, Manenti S
- Upregulation of CDC25A is also observed down- regions (e.g., telomeric region of chromosome 4, stream of the NPM1 / ALK oncogene in anaplastic which is homologous to human chromosome 1p31- large cell lymphoma and participates to their 36, a hotspot for several human cancers including enhanced proliferation (Fernandez-Vidal et al., breast cancer). 2009). - CDC25A is overexpressed in erythroleukemia cell Hepatocellular carcinoma lines expressing the JAK2V617F oncogene, present Note in the majority of patients with polycythemia vera Overexpression of CDC25A mRNAs was found in and one-half of those with essential 69% of hepatocellular carcinomas (HCCs) and this thrombocythemia and primary myelofibrosis. This overexpression was also confirmed by upregulation occurs at the translational level through Immunohistochemistry (56% HCCs exhibit the transcription factor STAT5 and the translational overexpression of CDC25A) and western blot initiation factor eIF2alpha (Gautier et al., 2012). analysis (Xu et al., 2003). Different CDC25 inhibitor - An upregulation of CDC25A activity due to its (such as vitamin K analog Cpd 5; phenyl maleimide phosphorylation by deregulated CDK5 has been compound PM-20; 2-Methoxyestadiol, a observed in Alzheimer's disease (Chang et al., 2012). physiological metabolite of estrogen) are capable of inhibiting the hepatocellular carcinoma growth both Breast cancer in vitro and in vivo (Wang et al., 2001; Kar et al, Note 2006). - In about 47% of early (T1) stage breast cancer Disease patients CDC25A is reported to be overexpressed. High expression of CDC25A was associated with - In some breast cancer cell lines it was reported that dedifferentiated phenotype and portal vein invasion. CDC25A overexpression is mainly due to increased Prognosis protein stability as oppose to gene amplification or transcriptional upregulation. (Löffler et al., 2003). In CDC25A overexpression is associated with poor a subset of human breast cancers overexpression of prognosis of hepatocellular carcinoma. the ubiquitin hydrolase DUB3, which Retinoblastoma deubiquitinates CDC25A preventing its degradation, is shown to be responsible for overexpression of Note CDC25A (Pereg et al., 2010). Overexpression of CDC25A mRNAs was found in - In mice, overexpression of CDC25A alone in 48,33 % retinoblastomas, confirmed by mammary gland using mouse mammary tumor virus immunohistochemistry (52,29 %) and western (MMTV) promoter, is not sufficient to induce blotting (Shingh et al., 2014). mammary tumorigenesis. However, such mammary Prognosis specific overexpression of CDC25A does cooperate Expression of CDC25A showed significant with HER2/neu-ras signaling to form more correlation with poor tumour differentiation and aggressive tumors with enhanced genomic tumour invasion. instability. (Ray et al., 2007). - In contrast, hemizygous loss of Cdc25A in mice Non-Hodgkin's lymphoma protected them significantly from MMTV-neu/ras- Prognosis induced mammary tumorigenesis, possibly by High level of CDC25A mRNAs was found in 35 % restricting precancerous cell proliferation and also of the tumors and were more frequently observed in by enhancing G2-checkpoint response. Thus the aggressive than in indolent lymphomas. This was protein level of CDC25A is crucial for the initiation also confirmed at the protein level. and/or progression of breast tumorigenesis in mice (Ray and Kiyokawa, 2007). Gastric cancer Prognosis Note Overexpression of CDC25A is correlated with more By immunohistochemistry CDC25A was found aggressive breast cancer with poor prognosis. expressed in 87.1 % of gastric carcinomas, Cytogenetics correlated with c-myc overexpression (Xing et al., CDC25A overexpression in MMTV-CDC25A; 2008). MMTV-neu double transgenic mice caused faster Disease tumor growth as compared to MMTV-neu single Overexpression of CDC25A was independent of transgenic mice. Importantly, such CDC25A intestinal or diffuse type of gastric cancer. overexpressing tumor cells displayed miscoordination of S phase and mitosis, and had Prognosis severe genomic instability as evidenced by aneuploidy and deletion of fragile chromosomal
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 319
CDC25A (Cell division cycle 25A) Dozier C, Manenti S
Association between CDC25A expression and Källström H, Lindqvist A, Pospisil V, Lundgren A, Rosenthal higher histological grade of differentiation. CK. Cdc25A localisation and shuttling: characterisation of sequences mediating nuclear export and import. Exp Cell References Res. 2005 Feb 1;303(1):89-100 Kang T, Wei Y, Honaker Y, Yamaguchi H, Appella E, Hung Bahassi el M, Yin M, Robbins SB, Li YQ, Conrady DG, Yuan MC, Piwnica-Worms H. GSK-3 beta targets Cdc25A for Z, Kovall RA, Herr AB, Stambrook PJ. A human cancer- ubiquitin-mediated proteolysis, and GSK-3 beta inactivation predisposing polymorphism in Cdc25A is embryonic lethal correlates with Cdc25A overproduction in human cancers. in the mouse and promotes ASK-1 mediated apoptosis. Cell Cancer Cell. 2008 Jan;13(1):36-47 Div. 2011 Feb 10;6(1):4 Kar S, Wang M, Carr BI. 2-Methoxyestradiol inhibits Bartek J, Lukas J. Mammalian G1- and S-phase hepatocellular carcinoma cell growth by inhibiting Cdc25 checkpoints in response to DNA damage. Curr Opin Cell and inducing cell cycle arrest and apoptosis. Cancer Biol. 2001 Dec;13(6):738-47 Chemother Pharmacol. 2008 Oct;62(5):831-40 Bertero T, Gastaldi C, Bourget-Ponzio I, Mari B, Meneguzzi Löffler H, Syljuåsen RG, Bartkova J, Worm J, Lukas J, G, Barbry P, Ponzio G, Rezzonico R. CDC25A targeting by Bartek J. Distinct modes of deregulation of the proto- miR-483-3p decreases CCND-CDK4/6 assembly and oncogenic Cdc25A phosphatase in human breast cancer contributes to cell cycle arrest. Cell Death Differ. 2013 cell lines. Oncogene. 2003 Nov 6;22(50):8063-71 Jun;20(6):800-11 Mailand N, Falck J, Lukas C, Syljuâsen RG, Welcker M, Boutros R, Dozier C, Ducommun B. The when and wheres Bartek J, Lukas J. Rapid destruction of human Cdc25A in of CDC25 phosphatases. Curr Opin Cell Biol. 2006 response to DNA damage. Science. 2000 May Apr;18(2):185-91 26;288(5470):1425-9 Boutros R, Lobjois V, Ducommun B. CDC25 phosphatases Mailand N, Podtelejnikov AV, Groth A, Mann M, Bartek J, in cancer cells: key players? Good targets? Nat Rev Lukas J. Regulation of G(2)/M events by Cdc25A through Cancer. 2007 Jul;7(7):495-507 phosphorylation-dependent modulation of its stability. EMBO J. 2002 Nov 1;21(21):5911-20 Chang KH, Vincent F, Shah K. Deregulated Cdk5 triggers aberrant activation of cell cycle kinases and phosphatases Mazars A, Fernandez-Vidal A, Mondesert O, Lorenzo C, inducing neuronal death. J Cell Sci. 2012 Nov 1;125(Pt Prévost G, Ducommun B, Payrastre B, Racaud-Sultan C, 21):5124-37 Manenti S. A caspase-dependent cleavage of CDC25A generates an active fragment activating cyclin-dependent Cheng YS, Kuo PL, Teng YN, Kuo TY, Chung CL, Lin YH, kinase 2 during apoptosis. Cell Death Differ. 2009 Feb;16(2):208-18
Melkun E, Pilione M, Paulson RF. A naturally occurring point Liao RW, Lin JS, Lin YM. Association of spermatogenic substitution in Cdc25A, and not Fv2/Stk, is associated with failure with decreased CDC25A expression in infertile men. altered cell-cycle status of early erythroid progenitor cells. Hum Reprod. 2006 Sep;21(9):2346-52 Blood. 2002 Nov 15;100(10):3804-11 Chiu YT, Han HY, Leung SC, Yuen HF, Chau CW, Guo Z, Oh JS, Susor A, Schindler K, Schultz RM, Conti M. Cdc25A Qiu Y, Chan KW, Wang X, Wong YC, Ling MT. CDC25A activity is required for the metaphase II arrest in mouse functions as a novel Ar corepressor in prostate cancer cells. oocytes. J Cell Sci. 2013 Mar 1;126(Pt 5):1081-5 J Mol Biol. 2009 Jan 16;385(2):446-56 Pereg Y, Liu BY, O'Rourke KM, Sagolla M, Dey A, Komuves Chou ST, Yen YC, Lee CM, Chen MS. Pro-apoptotic role of L, French DM, Dixit VM. Ubiquitin hydrolase Dub3 promotes Cdc25A: activation of cyclin B1/Cdc2 by the Cdc25A C- oncogenic transformation by stabilizing Cdc25A. Nat Cell terminal domain. J Biol Chem. 2010 Jun 4;285(23):17833- Biol. 2010 Apr;12(4):400-6 45 Ray D, Kiyokawa H. CDC25A levels determine the balance Demetrick DJ, Beach DH. Chromosome mapping of human of proliferation and checkpoint response. Cell Cycle. 2007 CDC25A and CDC25B phosphatases. Genomics. 1993 Dec 15;6(24):3039-42 Oct;18(1):144-7 Ray D, Terao Y, Nimbalkar D, Hirai H, Osmundson EC, Zou Fernandez-Vidal A, Mazars A, Gautier EF, Prévost G, X, Franks R, Christov K, Kiyokawa H. Hemizygous Payrastre B, Manenti S. Upregulation of the CDC25A disruption of Cdc25A inhibits cellular transformation and phosphatase down-stream of the NPM/ALK oncogene mammary tumorigenesis in mice. Cancer Res. 2007 Jul participates to anaplastic large cell lymphoma enhanced 15;67(14):6605-11 proliferation. Cell Cycle. 2009 May 1;8(9):1373-9 Shen T, Huang S. The role of Cdc25A in the regulation of Galaktionov K, Beach D. Specific activation of cdc25 cell proliferation and apoptosis. Anticancer Agents Med tyrosine phosphatases by B-type cyclins: evidence for Chem. 2012 Jul;12(6):631-9 multiple roles of mitotic cyclins. Cell. 1991 Dec 20;67(6):1181-94 Singh L, Pushker N, Sen S, Singh MK, Bakhshi S, Chawla B, Kashyap S. Expression of CDC25A and CDC25B Gautier EF, Picard M, Laurent C, Marty C, Villeval JL, phosphatase proteins in human retinoblastoma and its Demur C, Delhommeau F, Hexner E, Giraudier S, correlation with clinicopathological parameters. Br J Bonnevialle N, Ducommun B, Récher C, Laurent G, Manenti Ophthalmol. 2015 Apr;99(4):457-63 S, Mansat-De Mas V. The cell cycle regulator CDC25A is a target for JAK2V617F oncogene. Blood. 2012 Feb Vijayakumar S, Liu G, Rus IA, Yao S, Chen Y, Akiri G, 2;119(5):1190-9 Grumolato L, Aaronson SA. High-frequency canonical Wnt activation in multiple sarcoma subtypes drives proliferation Hong HY, Choi J, Cho YW, Kim BC. Cdc25A promotes cell through a TCF/β-catenin target gene, CDC25A. Cancer survival by stimulating NF-κB activity through IκB-α Cell. 2011 May 17;19(5):601-12 phosphorylation and destabilization. Biochem Biophys Res Commun. 2012 Apr 6;420(2):293-6
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 320
CDC25A (Cell division cycle 25A) Dozier C, Manenti S
Wang Z, Southwick EC, Wang M, Kar S, Rosi KS, Wilcox Xu X, Yamamoto H, Sakon M, Yasui M, Ngan CY, CS, Lazo JS, Carr BI. Involvement of Cdc25A phosphatase Fukunaga H, Morita T, Ogawa M, Nagano H, Nakamori S, in Hep3B hepatoma cell growth inhibition induced by novel Sekimoto M, Matsuura N, Monden M. Overexpression of K vitamin analogs. Cancer Res. 2001 Oct 1;61(19):7211-6 CDC25A phosphatase is associated with hypergrowth activity and poor prognosis of human hepatocellular Wegener S, Hampe W, Herrmann D, Schaller HC. carcinomas Clin Cancer Res 2003 May;9(5):1764-72 Alternative splicing in the regulatory region of the human phosphatases CDC25A and CDC25C. Eur J Cell Biol. 2000 Zou X, Tsutsui T, Ray D, Blomquist JF, Ichijo H, Ucker DS, Nov;79(11):810-5 Kiyokawa H. The cell cycle-regulatory CDC25A phosphatase inhibits apoptosis signal-regulating kinase 1 Xiao Z, Chen Z, Gunasekera AH, Sowin TJ, Rosenberg SH, Mol Cell Biol 2001 Jul;21(14):4818-28 Fesik S, Zhang H. Chk1 mediates S and G2 arrests through Cdc25A degradation in response to DNA-damaging agents This article should be referenced as such: J Biol Chem 2003 Jun 13;278(24):21767-73 Dozier C, Manenti S. CDC25A (Cell division cycle 25A). Xing X, Chen J, Chen M. Expression of CDC25 Atlas Genet Cytogenet Oncol Haematol. 2016; phosphatases in human gastric cancer Dig Dis Sci 2008 20(6):316-321. Apr;53(4):949-53
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 321 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Gene Section Short Communication
MIR200A (microRNA 200a) Yaguang Xi, Hong Chang Mitchell Cancer Institute, University of South Alabama, USA. [email protected]; [email protected]
Published in Atlas Database: August 2015 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR200AID53347ch1p36.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62939/08-2015-MIR200AID53347ch1p36.pdf DOI: 10.4267/2042/62939 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Abstract DNA/RNA Review on MIR200A, with data on RNA, and where Description it is implicated. microRNA 200a located in chromosome 1 and Keywords: MIR200A microRNA 200a was transcribed with microRNA 200b and microRNA 429 as a ploycistronic Identity transcript. The putative transcription start site locates about 4987 bp upstream of the precursor of HGNC (Hugo): MIR200A microRNA 200a. Location: 1p36.33 Transcription Note MicroRNA 200a belongs to microRNA 200 family. MiR-200a precursor: 5'- MicroRNA 200 family consists of five microRNAs, CCGGGCCCCUGUGAGCAUCUUACCGGACA microRNA 200b, microRNA 200a, microRNA 429, GUGCUGGAUUUCCCAGCUUGACUCUAACA microRNA 200c and microRNA 141. MicroRNA CUGUCUGGUAACGAUGUUCAAAGGUGACC 200b, microRNA 200a and microRNA 429 were CGC-3' transcribed as a single ploycistronic transcript from Mature miR-200a: 5'- chromosome 1. And microRNA 200 family were UAACACUGUCUGGUAACGAUGU-3' demonstrated important roles in EMT (epithelial- Pseudogene mesenchymal transition) progress. No pseudogene was found.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 322 MIR200A (microRNA 200a) Xi Y, Chang H
that miR-200a could regulate EMT by targeting Protein SIRT1 and mammary epithelial cells (Eades, Yao et Note al. 2011). In hepatic oval cells, downregulation of microRNAs are not translated into proteins. miR-200a induces EMT phenotypes and CSC-like signatures by directly targeting beta-catenin (Liu, Implicated in Ruan et al. 2013). Tumor cell proliferation References MiR-200a showed its roles in regulation of tumor Eades G, Yao Y, Yang M, Zhang Y, Chumsri S, Zhou Q. cell proliferation. miR-200a regulates SIRT1 expression and epithelial to In human endometrial adenocarcinoma cell line mesenchymal transition (EMT)-like transformation in mammary epithelial cells. J Biol Chem. 2011 Jul HEC-1B, repression of miR-200a could increase the 22;286(29):25992-6002 tumor suppressor gene PTEN and thus inhibit cell proliferation and promote cell apoptosis, which Li R, He JL, Chen XM, Long CL, Yang DH, Ding YB, Qi showed the oncogenic role of miR-200a (Li, He et HB, Liu XQ. MiR-200a is involved in proliferation and al. 2014). However, studies in breast cancer also apoptosis in the human endometrial adenocarcinoma cell demonstrated that miR-200a could attenuate cell line HEC-1B by targeting the tumor suppressor PTEN. Mol Biol Rep. 2014;41(4):1977-84 proliferation by targeting Mitochondrial Transcription Factor A (Yao, Zhou et al. 2014). As Liu J, Ruan B, You N, Huang Q, Liu W, Dang Z, Xu W, Zhou T, Ji R, Cao Y, Li X, Wang D, Tao K, Dou K. Downregulation well, miR-200a was also proved to impair glioma of miR-200a induces EMT phenotypes and CSC-like cell growth by targeting SIM2-s (Su, He et al. 2014). signatures through targeting the β-catenin pathway in Tumor cells invasion and cancer hepatic oval cells. PLoS One. 2013;8(11):e79409 metastasis Su Y, He Q, Deng L, Wang J, Liu Q, Wang D, Huang Q, Li G. MiR-200a impairs glioma cell growth, migration, and As a member of miR-200 family, miR-200a showed invasion by targeting SIM2-s. Neuroreport. 2014 Jan its regulation roles in cancer cells invasion and 8;25(1):12-7 migration. Wu Q, Guo R, Lin M, Zhou B, Wang Y. MicroRNA-200a By targeting SIM-2, miR-200a could inhibit glioma inhibits CD133/1+ ovarian cancer stem cells migration and cell migration and invasion (Su, He et al. 2014). In invasion by targeting E-cadherin repressor ZEB2. Gynecol Oncol. 2011 Jul;122(1):149-54 CD133/1+ ovarian cancer stem cells, miR-200a could inhibit cell migration and invasion by Yao J, Zhou E, Wang Y, Xu F, Zhang D, Zhong D. repressing expression of Zeb2 (which is a repressor microRNA-200a inhibits cell proliferation by targeting mitochondrial transcription factor A in breast cancer. DNA of E-cadherin) (Wu, Guo et al. 2011). However, in Cell Biol. 2014 May;33(5):291-300 human breast cancer cells, it was found that miR- Yu SJ, Hu JY, Kuang XY, Luo JM, Hou YF, Di GH, Wu J, 200a could target YAP1 thus induce anoikis Shen ZZ, Song HY, Shao ZM. MicroRNA-200a promotes resistance and metastasis (Yu, Hu et al. 2013). anoikis resistance and metastasis by targeting YAP1 in human breast cancer. Clin Cancer Res. 2013 Mar Repression of epithelial- 15;19(6):1389-99 mesenchymal transition (EMT) This article should be referenced as such: Roles of miR-200 family in EMT regulation were intensively studied. As miR-200a, it was reported Xi Y, Chang H. MIR200A (microRNA 200a). Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6):322-323.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 323
Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Gene Section Short Communication
MIR429 (microRNA 429) Yaguang Xi, Hong Chang Mitchell Cancer Institute, University of South Alabama, USA. [email protected]; [email protected]
Published in Atlas Database: August 2015 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR429ID51154ch1p36.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62940/08-2015-MIR429ID51154ch1p36.pdf DOI: 10.4267/2042/62940 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Abstract DNA/RNA Review on MIR429, with data on RNA, and where it Description is implicated. microRNA 429 located in chromosome 1 and Keywords: MIR429 microRNA 429 was transcribed with microRNA 200b and microRNA 200a as a ploycistronic Identity transcript. The putative transcription start site locates about 6129 bp upstream of the precursor of HGNC (Hugo): MIR429 microRNA 429. Location: 1p36.33 Note Transcription MicroRNA 429 belongs to microRNA 200 family. MiR-429 precursor: 5'- MicroRNA 200 family consists of five microRNAs, CGCCGGCCGAUGGGCGUCUUACCAGACAU microRNA 200b, microRNA 200a, microRNA 429, GGUUAGACCUGGCCCUCUGUCUAAUACUG microRNA 200c and microRNA 141. MicroRNA UCUGGUAAAACCGUCCAUCCGCUGC-3' 200b, microRNA 200a and microRNA 429 were Mature miR-429: 5'- transcribed as a single ploycistronic transcript from UAAUACUGUCUGGUAAAACCGU-3' chromosome 1. And microRNA 200 family were demonstrated important roles in EMT (epithelial- Pseudogene mesenchymal transition) progress. No pseudogene was found.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 324 MIR429 (microRNA 429) Xi Y, Chang H
Protein targeting ONECUT2 (Sun, Shen et al. 2014). Chemoresistance Note Cancer stem cells showed highly resistance to microRNAs are not translated into proteins. chemotherapy which make relapse of tumor. It was found that over-expression of miR-429 could Implicated in increase drug sensitivity in metastasizing ovarian Tumor cell proliferation (Wang, Mezencev et al. 2014). However, it was reported that miR-429 was highly Abnormal expression of miR-200a was reported in expressed in hepatocellular carcinoma tissues and various tumors, including human breast cancer, enrichment of miR-429 in liver tumour-initiating gastric carcinoma, endometrial adenocarcinoma, cells with EPCAM expression would contributed to gliomas, and colorectal carcinoma. MiR-429 could hepatocyte self-renewal, malignant proliferation, inhibit cell growth and induce apoptosis by directly chemoresistance and tumorigenicity (Li, Tang et al. targeting ONECUT2 in colorectal carcinoma and 2014). targeting BCL2 in esophageal carcinoma (Sun, Shen et al. 2014). References Also, MiR-429 could induce apoptosis and suppress invasion by targeting BCL2 and SP1 in esophageal Chen J, Wang L, Matyunina LV, Hill CG, McDonald JF. carcinoma (Wang, Li et al. 2013). However, miR- Overexpression of miR-429 induces mesenchymal-to- epithelial transition (MET) in metastatic ovarian cancer cells. 429 was also showed its anti-apoptosis function in Gynecol Oncol. 2011 Apr;121(1):200-5 colorectal cancer by targeting SOX2 (Li, Du et al. 2013). Li J, Du L, Yang Y, Wang C, Liu H, Wang L, Zhang X, Li W, Zheng G, Dong Z. MiR-429 is an independent prognostic Tumor cells invasion and cancer factor in colorectal cancer and exerts its anti-apoptotic function by targeting SOX2. Cancer Lett. 2013 Feb metastasis 1;329(1):84-90 Members of miR-200 family showed vital roles in Li L, Tang J, Zhang B, Yang W, LiuGao M, Wang R, Tan Y, tumor cells invasion and cancer metastasis. As to Fan J, Chang Y, Fu J, Jiang F, Chen C, Yang Y, Gu J, Wu miR-429, studies demonstrated it could repress D, Guo L, Cao D, Li H, Cao G, Wu M, Zhang MQ, Chen L, tumor cell invasion and cancer metastasis by Wang H. Epigenetic modification of MiR-429 promotes liver tumour-initiating cell properties by targeting Rb binding targeting ONECUT2 and SP1 in different tumors protein 4. Gut. 2015 Jan;64(1):156-67 (Sun, Shen et al. 2014; Wang, Li et al. 2013). Sun Y, Shen S, Liu X, Tang H, Wang Z, Yu Z, Li X, Wu M. Repression of epithelial- MiR-429 inhibits cells growth and invasion and regulates EMT-related marker genes by targeting Onecut2 in mesenchymal transition (EMT) colorectal carcinoma. Mol Cell Biochem. 2014 May;390(1- EMT is an important feature of tumor cells. 2):19-30 Tumor cells underwent EMT showed more invasion Wang L, Mezencev R, Švajdler M, Benigno BB, McDonald and metastatic properties. JF. Ectopic over-expression of miR-429 induces Studies demonstrated members of miR-200 family mesenchymal-to-epithelial transition (MET) and increased drug sensitivity in metastasizing ovarian cancer cells. could directly target ZEB1 and ZEB2 and could be Gynecol Oncol. 2014 Jul;134(1):96-103 regulated as a feedback loop during EMT. Ectopic over-expression of miR-429 induces Wang Y, Li M, Zang W, Ma Y, Wang N, Li P, Wang T, Zhao G. MiR-429 up-regulation induces apoptosis and mesenchymal-to-epithelial transition (MET) in suppresses invasion by targeting Bcl-2 and SP-1 in metastasizing ovarian cancer cells (Chen, Wang et esophageal carcinoma. Cell Oncol (Dordr). 2013 al. 2011). Oct;36(5):385-94 In colorectal carcinoma cells, miR-429 could This article should be referenced as such: regulate EMT-related markers such as ZEB2, Vimentin, SNAI2 (SLUG) and SNAI1 (SNAIL) by Xi Y, Chang H. MIR429 (microRNA 429). Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6):324-325.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 325 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Gene Section Review
SH3PXD2A (SH3 and PX domains 2A) Carman Man-Chung Li, Tyler Jacks David H. Koch Institute for Integrative Cancer Research, Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA. [email protected]
Published in Atlas Database: August 2015 Online updated version : http://AtlasGeneticsOncology.org/Genes/SH3PXD2AID45995ch10q24.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62940/08-2015-SH3PXD2AID45995ch10q24.pdf DOI: 10.4267/2042/62940 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Abstract Transcription The full-length SH3PXD2A transcript is 11264 nt in The TKS5 protein, encoded by the gene length. Multiple TKS5 isoforms arise as a result of SH3PXD2A, is a scaffolding protein essential for the alternative mRNA splicing involving exons 7 and formation of podosomes and invadopodia in 10, and alternative use of transcription start sites. untransformed cells and cancer cells, respectively. Podosomes and invadopodia (which collectively are Protein termed invadosomes) are actin-rich cellular protrusions capable of secreting proteolytic enzymes Description that can degrade the extracellular matrix. These The full-length SH3PXD2A transcript (TKS5- structures are thought to regulate cellular migration LONG or TKS5-ALPHA) is transcribed from a and invasion, as well as adhesion and the release of promoter upstream of exon 1 and is translated into a growth factors. In the context of cancer, TKS5- 150 kDa protein that contains a Phox-homology dependent invadopodia activity has been shown to (PX) domain in the N-terminus and five Src play important roles in tumor growth and metastasis homology 3 (SH3) domains in the C-terminus. The in various cancer types. Multiple isoforms of TKS5 shorter isoforms that arise from downstream exist due to alternative mRNA splicing and promoter transcription start sites lack the PX domain but retain usage. the five SH3 domains. Because the PX domain is Keywords required for binding to the cell membrane, full- SH3PXD2A; TKS5; podosomes; invadopodia; length TKS5 is able to localize to invadosome foci metastasis. but the short isoforms cannot. Identity Expression Other names: TKS5, FISH, SH3MD1, KIAA0418 TKS5 expression is detected in many tissue types, including brain, lung, liver, heart, skeletal muscles, HGNC (Hugo): SH3PXD2A and, kidneys, but was low in spleen and absent in Location: 10q24.33 testis (Lock et al, 1998). Tks5 has also been detected in many cell types, including macrophages, DNA/RNA myoblasts, neural crest cells, osteoblasts, and neurons (Burger et al., 2011; Thompson et al., 2008; Description Murphy et al., 2011; Oikawa et al., 2012; Santiago- The SH3PXD2A gene is located on chromosome 10 Medina et al. 2015). (10q24.33). It contains 15 exons.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 326 SH3PXD2A (SH3 and PX domains 2A) Li CMC, Jacks T
The SH3PXD2A locus encodes multiple TKS5 isoforms as a result of alternative splicing at exons 7 and 10 as well as alternative promoter usage. Genomic information was obtained from the UCSC genome browser (http://genome.ucsc.edu/). Short-form Tks5 (Tks5-short and Tks5-beta) have been reported by Li et al. (2013) and Cejudo-Martin et al. (2014).
Localisation 2008). At the cell membrane, TKS5 is thought to interact with multiple components of invadosomes Cytoplasmic and at invadosome foci. either directly or indirectly, and thereby mediates Function invadosome formation and maturation (Sharma et TKS5 was initially identified as a substrate for SRC al., 2013). These interacting partners includes (Lock et al., 1998), and was subsequently shown to adaptor proteins and actin regulatory proteins, such play a critical role in invadosome formation in as NCK1, NCK2, GRB2, CTTN (Cortactin), WASL multiple cell types (Courtneidge, 2011; Murphy and (N-WASP), ACTR2/ACTR3 (Arp2/3) complex, and Courtneidge, 2011; Paz et al., 2013). ARHGAP35 (p190RhoGAP) (Crimaldi et al., 2009; Full-length TKS5 functions as an adaptor for Oikawa et al., 2008; Stylli et al., 2009). TKS5 also recruiting other proteins to the cell membrane for interacts with NOXA1 and CYBA (p22phox), which invadosome formation. are components of the NADPH oxidase complex, The recruitment of TKS5 to the cell membrane and thereby promotes reactive oxygen species (ROS) depends on its PX domain and phosphorylation by production by NOX enzymes at invadosomes (Diaz Src (Abram et al., 2003). It has been proposed that et al., 2009; Gianni et al., 2010; 2009). ROS have phosphorylation of TKS5 releases its PX domain been shown to facilitate invadosome formation by from intramolecular interaction and allows TKS5 to maintaining or amplifying the phosphorylation of bind to cell membrane phosphatidylinositol lipids, TKS5. As such, TKS5 is thought to promote such as phosphatidylinositol-3,4-bisphosphate invadosome formation via ROS in a positive (PI(3,4)P2) (Abram et al., 2003; Oikawa et al., feedback loop.
The full-length TKS5 mRNA encodes a protein that contains a PX domain and five SH3 domains, as well as proline-rich regions (PxxP) and Src phosphorylation sites (Y). The various short isoforms lack the PX domain.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 327
SH3PXD2A (SH3 and PX domains 2A) Li CMC, Jacks T
Finally, TKS5 has also been shown to interact with Homology members of the ADAM family metalloproteases, specifically ADAM12, ADAM15, ADAM19 TKS5 is homologous to SH3PXD2B (TKS4), (Abram et al., 2003). It is believed that Tks5 recruits another adaptor protein that functions as a Src theses proteases to the invadosome foci for substrate and promotes invadosome function processing growth factors and regulating cell (Buschman et al, 2009). TKS4 contains a PX domain motility. For example, ADAM12 has been shown to at the N-terminus and four SH3 domains in the C- promote ectodomain shedding of HBEGF (heparin- terminus. binding EGF-like growth factor) and enhance invadopodia formation in cancer cells (Diaz et al., Implicated in 2013). In the context of cancer, TKS5-dependent formation Breast cancer of invadopodia is thought to promote metastasis by TKS5 expression is increased in human primary mediating local tumor invasion and intravasation at breast tumors compared to normal tissues, and is the primary site, as well as extravasation and further increased in metastases (Stylli et al., 2014). colonization at the distant site (Murphy and TKS5 is required for invadopodia formation in Courtneidge, 2011; Paz et al., 2014). breast cancer cells (Seals et al, 2005). In the context of normal development, TKS5- TKS5-dependent invadopodia have been shown to depedent podosomes are important for mediating promote tumor growth in a transplantation setting, cell migration during embryogenesis. Knockdown of cancer cell intravasation and extravasation, and Tks5 in zebrafish led to impaired dorsal-ventral metastasis formation (Eckert et al., 2011; migration of neural crest cells and defective Gligorijevic et al., 2012; Leong et al., 2014; Blouw craniofacial structures and pigmentation (Murphy et et al., 2015). al., 2011). Similarly, genetic deletion of Tks5 in Expression of full-length TKS5 in human breast mice led to complete cleft of the secondary palate tumors correlated with poor prognosis (Blouw et al., and neonatal death (Cejudo-Martin et al., 2014). In 2015). addition, study in Xenopus showed that Tks5- Lung cancer dependent podosomes are also required for the TKS5 expression is increased in human lung tumors migration of neuronal growth cones (Santiago- compared to normal tissues (Stylli et al., 2014). Full- Medina et al., 2015). length Tks5 is required for metastasis in a mouse While most studies have focused on full-length model of lung cancer (Li et al., 2013). Furthermore, TKS5, shorter isoforms of TKS5 that lack the PX higher expression of full-length TKKS5 relative to domain have been reported (Lock et al, 1998; Li et short-form TKS5 correlated with poor survival of al., 2013; Cejudo-Martin et al., 2014). early-stage lung adenocarcinoma patients (Li et al., There are few reports on the functions of these short 2013). isoforms. Experiments in mouse lung cancer cell lines showed Melanoma that overexpression of a short isoform (Tks5-short) TKS5 is required for invadopodia formation in suppressed invadopodia function by disrupting the melanoma cells (Seals et al, 2005). stability of invadopodia (Li et al., 2013). In addition, overexpression of a short-form equivalent protein, Prostate cancer ΔPX-Tks5, in Xenopus neural crest cells inhibited TKS5 expression is increased in human prostate invadosome functions and impaired motoneuron tumors compared to normal tissues, and is required axon extension into the peripheral myotomal tissue for invadopodia function in prostate cancer cells in Xenopus embryos (Santiago-Medina et al., 2015). (Stylli et al., 2014; Burger et al., 2014). These data suggest that the short forms of TKS5 can Gliomas function as negative regulators of invadosomes. At the mRNA level, the transcription of full-length TKS5 expression correlates with poor survival of Tks5 has been shown to be synergistically inhibited glioma patients (Stylli et al., 2011). by the developmental regulators NKX2-1, FOXA2, Colon Cancer and CDX2 in lung adenocarcinoma (Li et al., 2015). Furthermore, TKS5 has been shown to be a target of TKS5 expression is increased in human colon the microRNA mir200-c (Sundararajan et al., 2015). tumors compared to normal tissues (Stylli et al., In terms of protein stability and abundance, the full- 2014). length isoform of TKS5 is positively Alzeimer disease regulated by Src, while the short isoform (TKS5- KS5 and ADAM12 have been proposed to mediate beta) is negatively regulated by Src (Cejudo-Martin the toxicity of amyloid-β peptide (Aβ), which is a et al. 2014). potential cause of Alzheimer's disease as it has been
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 328
SH3PXD2A (SH3 and PX domains 2A) Li CMC, Jacks T
shown to mediate neurodegenerative alterations that formation is involved in intravasation and lung metastasis of are associated with amyloid plaques (Malinin et al., mammary tumors J Cell Sci 2012 Feb 1;125(Pt 3):724-34 2005; Harold et al., 2007). Harold D, Jehu L, Turic D, Hollingworth P, Moore P, Summerhayes P, Moskvina V, Foy C, Archer N, Hamilton BA, Lovestone S, Powell J, Brayne C, Rubinsztein DC, References Jones L, O'Donovan MC, Owen MJ, Williams J. Interaction Abram CL, Seals DF, Pass I, Salinsky D, Maurer L, Roth between the ADAM12 and SH3MD1 genes may confer TM, Courtneidge SA. The adaptor protein fish associates susceptibility to late-onset Alzheimer's disease Am J Med with members of the ADAMs family and localizes to Genet B Neuropsychiatr Genet 2007 Jun 5;144B(4):448-52 podosomes of Src-transformed cells. J Biol Chem. 2003 Leong HS, Robertson AE, Stoletov K, Leith SJ, Chin CA, May 9;278(19):16844-51 Chien AE, Hague MN, Ablack A, Carmine-Simmen K, Blouw B, Patel M, Iizuka S, Abdullah C, You WK, Huang X, McPherson VA, Postenka CO, Turley EA, Courtneidge SA, Li JL, Diaz B, Stallcup WB, Courtneidge SA. The Chambers AF, Lewis JD. Invadopodia are required for invadopodia scaffold protein Tks5 is required for the growth cancer cell extravasation and are a therapeutic target for of human breast cancer cells in vitro and in vivo. PLoS One. metastasis Cell Rep 2014 Sep 11;8(5):1558-70 2015;10(3):e0121003 Li CM, Chen G, Dayton TL, Kim-Kiselak C, Hoersch S, Burger KL, Davis AL, Isom S, Mishra N, Seals DF. The Whittaker CA, Bronson RT, Beer DG, Winslow MM, Jacks podosome marker protein Tks5 regulates macrophage T. Differential Tks5 isoform expression contributes to invasive behavior. Cytoskeleton (Hoboken). 2011 metastatic invasion of lung adenocarcinoma Genes Dev Dec;68(12):694-711 2013 Jul 15;27(14):1557-67 Burger KL, Learman BS, Boucherle AK, Sirintrapun SJ, Li CM, Gocheva V, Oudin MJ, Bhutkar A, Wang SY, Date Isom S, Díaz B, Courtneidge SA, Seals DF. Src-dependent SR, Ng SR, Whittaker CA, Bronson RT, Snyder EL, Gertler Tks5 phosphorylation regulates invadopodia-associated FB, Jacks T. Foxa2 and Cdx2 cooperate with Nkx2-1 to invasion in prostate cancer cells. Prostate. 2014 inhibit lung adenocarcinoma metastasis Genes Dev 2015 Feb;74(2):134-48 Sep 1;29(17):1850-62 Buschman MD, Bromann PA, Cejudo-Martin P, Wen F, Lock P, Abram CL, Gibson T, Courtneidge SA. A new Pass I, Courtneidge SA. The novel adaptor protein Tks4 method for isolating tyrosine kinase substrates used to (SH3PXD2B) is required for functional podosome formation. identify fish, an SH3 and PX domain-containing protein, and Mol Biol Cell. 2009 Mar;20(5):1302-11 Src substrate EMBO J 1998 Aug 3;17(15):4346-57 Cejudo-Martin P, Yuen A, Vlahovich N, Lock P, Courtneidge Malinin NL, Wright S, Seubert P, Schenk D, Griswold- SA, Díaz B. Genetic disruption of the sh3pxd2a gene Prenner I. Amyloid-beta neurotoxicity is mediated by FISH reveals an essential role in mouse development and the adapter protein and ADAM12 metalloprotease activity Proc existence of a novel isoform of tks5. PLoS One. Natl Acad Sci U S A 2005 Feb 22;102(8):3058-63 2014;9(9):e107674 Murphy DA, Courtneidge SA. The 'ins' and 'outs' of Courtneidge SA. Cell migration and invasion in human podosomes and invadopodia: characteristics, formation disease: the Tks adaptor proteins. Biochem Soc Trans. and function Nat Rev Mol Cell Biol 2011 Jun 23;12(7):413- 2012 Feb;40(1):129-32 26 Crimaldi L, Courtneidge SA, Gimona M. Tks5 recruits Murphy DA, Diaz B, Bromann PA, Tsai JH, Kawakami Y, AFAP-110, p190RhoGAP, and cortactin for podosome Maurer J, Stewart RA, Izpisúa-Belmonte JC, Courtneidge formation. Exp Cell Res. 2009 Sep 10;315(15):2581-92 SA. A Src-Tks5 pathway is required for neural crest cell Díaz B, Yuen A, Iizuka S, Higashiyama S, Courtneidge SA. migration during embryonic development PLoS One Notch increases the shedding of HB-EGF by ADAM12 to 2011;6(7):e22499 potentiate invadopodia formation in hypoxia. J Cell Biol. Oikawa T, Itoh T, Takenawa T. Sequential signals toward 2013 Apr 15;201(2):279-92 podosome formation in NIH-src cells J Cell Biol 2008 Jul Diaz B, Shani G, Pass I, Anderson D, Quintavalle M, 14;182(1):157-69 Courtneidge SA. Tks5-dependent, nox-mediated Oikawa T, Oyama M, Kozuka-Hata H, Uehara S, Udagawa generation of reactive oxygen species is necessary for N, Saya H, Matsuo K. Tks5-dependent formation of invadopodia formation. Sci Signal. 2009 Sep 15;2(88):ra53 circumferential podosomes/invadopodia mediates cell-cell Eckert MA, Lwin TM, Chang AT, Kim J, Danis E, Ohno- fusion J Cell Biol 2012 May 14;197(4):553-68 Machado L, Yang J. Twist1-induced invadopodia formation Paz H, Pathak N, Yang J. Invading one step at a time: the promotes tumor metastasis. Cancer Cell. 2011 Mar role of invadopodia in tumor metastasis Oncogene 2014 8;19(3):372-86 Aug 14;33(33):4193-202 Gianni D, Diaz B, Taulet N, Fowler B, Courtneidge SA, Santiago-Medina M, Gregus KA, Nichol RH, O'Toole SM, Bokoch GM. Novel p47(phox)-related organizers regulate Gomez TM. Regulation of ECM degradation and axon localized NADPH oxidase 1 (Nox1) activity Sci Signal 2009 guidance by growth cone invadosomes Development 2015 Sep 15;2(88):ra54 Feb 1;142(3):486-96 Gianni D, Taulet N, DerMardirossian C, Bokoch GM. c-Src- Seals DF, Azucena EF Jr, Pass I, Tesfay L, Gordon R, mediated phosphorylation of NoxA1 and Tks4 induces the Woodrow M, Resau JH, Courtneidge SA. The adaptor reactive oxygen species (ROS)-dependent formation of protein Tks5/Fish is required for podosome formation and functional invadopodia in human colon cancer cells Mol Biol function, and for the protease-driven invasion of cancer cells Cell 2010 Dec;21(23):4287-98 Cancer Cell 2005 Feb;7(2):155-65 Gligorijevic B, Wyckoff J, Yamaguchi H, Wang Y, Roussos Sharma VP, Eddy R, Entenberg D, Kai M, Gertler FB, ET, Condeelis J. N-WASP-mediated invadopodium Condeelis J. Tks5 and SHIP2 regulate invadopodium
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 329
SH3PXD2A (SH3 and PX domains 2A) Li CMC, Jacks T
maturation, but not initiation, in breast carcinoma cells Curr Sundararajan V, Gengenbacher N, Stemmler MP, Biol 2013 Nov 4;23(21):2079-89 Kleemann JA, Brabletz T, Brabletz S. The ZEB1/miR-200c feedback loop regulates invasion via actin interacting Stylli SS, I ST, Kaye AH, Lock P. Prognostic significance of proteins MYLK and TKS5 Oncotarget 2015 Sep Tks5 expression in gliomas J Clin Neurosci 2012 29;6(29):27083-96 Mar;19(3):436-42 Thompson O, Kleino I, Crimaldi L, Gimona M, Saksela K, Stylli SS, Luwor RB, Kaye AH, I ST, Hovens CM, Lock P. Winder SJ. Dystroglycan, Tks5 and Src mediated assembly Expression of the adaptor protein Tks5 in human cancer: of podosomes in myoblasts PLoS One 2008;3(11):e3638 prognostic potential Oncol Rep 2014 Sep;32(3):989-1002 Stylli SS, Stacey TT, Verhagen AM, Xu SS, Pass I, This article should be referenced as such: Courtneidge SA, Lock P. Nck adaptor proteins link Tks5 to Li CMC, Jacks T. SH3PXD2A (SH3 and PX domains 2A). invadopodia actin regulation and ECM degradation J Cell Atlas Genet Cytogenet Oncol Haematol. 2016; Sci 2009 Aug 1;122(Pt 15):2727-40 20(6):326-330.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 330 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Gene Section Review
SLPI (secretory leukocyte peptidase inhibitor) Nella Ambrosi, Diego Guerrieri, Fiorella Caro, Micaela Barbieri Kennedy, Francisco Sánchez, Mercedes L. Sánchez, Eduardo Chuluyan CEFYBO-CONICET, Facultad de Medicina, Universidad de Buenos Aires, Buenos Aires, Argentina / [email protected] Published in Atlas Database: August 2015 Online updated version : http://AtlasGeneticsOncology.org/Genes/SLPIID46048ch20q13.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62942/08-2015-SLPIID46048ch20q13.pdf DOI: 10.4267/2042/62942 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
SLPI, antimicrobial activity, anti-inflammatory Abstract activity, anti-tumoral activity. Secretory Leukocyte Peptidase Inhibitor (SLPI) functionality in health and disease: Secretory Identity Leukocyte Peptidase Inhibitor (SLPI) is a serine protease inhibitor of cathepsin G, trypsin and Other names: ALK1, ALP, HUSI, HUSI-I, BLPI, chymotrypsin, but primarily against neutrophil MPI, WAP4, WFDC4 elastase. Its major function is to inhibit inflammation HGNC (Hugo): SLPI by blocking the proteolytic activity of these Location: 20q13.12 chr20:43,881,055- 43,883,184 proteinases released by leukocytes and also through (reverse strand) down-modulation of several cytokines. The anti- inflammatory activity is also mediated by inhibition of the activation of the transcription nuclear factor DNA/RNA NF-kB. Some studies localized the molecule within Description the cytosol and in secondary granules of neutrophils. Because of this, it is believed that neutrophil-derived SLPI belongs to the whey acidic protein four- SLPI may regulate the protease/antiprotease balance disulfide core family of proteins. The human SLPI at sites of tissue inflammation. In relation with the gene is localized on chromosome 20q12-13.2 adaptive immune system, it was suggested that SLPI (Kikuchi et al. 1998). The SLPI gene consists of four modulates the cellular and humoral immune exons and three introns, it spans approximately 2.6 response, by decreasing the T cell proliferation and kb (Kikuchi et al. 1998; Stetler et al. 1986). The SLPI reducing the class switching. Also, it is known that gene is stable and seems to be nonpolymorphic (Abe this polycationic non-glycosylated peptide, displays et al. 1991). Though, it has the potential to be anti-microbial properties against bacteria, viruses (in modulated at both the transcriptional and post- particular HIV) and fungus. In summary, the SLPI is transcriptional levels (Abe et al. 1991). Up to date, it a pleitropic molecule, implicated in physiological has not been detected a state of SLPI deficiency. and pathological events, such as wound healing, However, patients with severe congenital pregnancy, chronic obstructive pulmonary disease, neutropenia (a primary immunodeficiency syndrome cancer, ischemia reperfusion injury and stroke, characterized by mutations in at least 6 different among others. Their detection in serum and genes) were found to have strongly reduced SLPI biological fluids may be useful as a biomarker to levels, being SLPI a key factor for the neutrophil diagnosis and prognosis for certain diseases. differentiation in the bone marrow (Klimenkova et al. 2014). Keywords
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 331 SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
Transcription 2001). However, concentrations of the molecule vary depending on age and gender of the individual The SLPI gene is actively transcribed in mucosal tested. In vivo, it is produced in the lung by tracheal cells, being the half-life of the transcripts of serous glands and by clear bronchial cells. In male approximately 12 h. Close to the exon 1, SLPI gene (Ohlsson et al. 1995) and female (Moriyama et al. has four potential binding sites for transcription 1999) genital tracts, SLPI is located in seminal factor AP-1, three for AP-2 and one for plasma and cervical mucosa, respectively. C/EPB(Klimenkova et al. 2014). Also, Kikuchi et Furthermore, it is produced by the parotid glands, al., describes that SLPI has a promoter region which intestinal epithelial cells (Si-Tahar et al. 2000), renal has a recognition sequence for two transcription tubule cells (Ohlsson et al. 2001), keratinocytes factor, one of which is highly expressed in lung cell (Wiedow et al. 1998), beta cells of the pancreas lines, and the other in nonlung cell lines (Kikuchi et (Nystrom et al. 1999) and immune cells like al. 1997). neutrophils and alveolar macropaghes (Sallenave et al. 1997; Mihaila et al. 2001; Guerrieri et al. 2011). Protein The SLPI expression is modulated by different Description molecules. It has been shown that SLPI is up- regulated by LPS, IL-1beta, TNF-alpha, neutrophil SLPI is an 11,7 kDa molecular weight non- elastasa, alpha-defensins, surfactant protein A, glycosylated protein composed by 132 amino acids corticosteroid and progesterone (Sallenave et al. (Stolk et al. 1999). The amino acid sequence of SLPI 1994; Reid et al. 1999; Maruyama et al. 1994; generates a highly polycationic peptide with two Abbinante-Nissen et al. 1995; King et al. 2003; highly homologous domains. These two domains Velarde et al. 2005; van Wetering et al. 2000; (COOH and NH2 terminal domains) share around a Ramadas et al. 2009). Finally, apoptotic cells can 35% homology (Vogelmeier et al. 1996). Each upregulate SLPI production by macrophages (Odaka domain contains eight cysteine residues that form et al. 2003). four disulfide bonds, which helps to stabilize the In contrast, few factors can downmodulate the structure of the molecule (Grutter et al. 1988). These expression of SLPI. Among them, the most cysteine rich domains are also called WAP domains significant are IFNgamma and TGF-beta (Jaumann (Whey Acid Protein). Domain 2 was initially et al. 2000; Jin et al. 1997). described to bind and inhibit the serine proteases Although, the structure of SLPI seems to be stable, it such as trypsin and elastase, while the domain 1 was could be cleaved and inactive-ated by probably not inhibitory (Eisenberg et al. 1990; chymase(Belkowski et al. 2008), cathepsins B, L, S Meckelein et al. 1990). It has been proposed that this (Taggart et al. 2001), lipid peroxidation products last domain helps in the stabilization of the (Tomova et al. 1994) and Host dust mite 1 allergen complexes "SLPI:elastase". Also, it is believed that (Brown et al. 2003), among others(Weldon et al. the domain 1 mediates binding to heparin, and thus 2009). increases its antiprotease activity, probably as a result of a conformational change of the molecule Function (Faller et al. 1992). Antiprotease activity: The inhibition of protease Expression activity was described for C-terminus domain SLPI was first isolated from bronchial secretions against elastasa, cathepsin G, trypsin, chymotrypsin, (Hochstrasser et al. 1972; Ohlsson et al. 1976). Then tryptase and chymase (Williams et al. 2006). Thus, the SLPI was characterized by two groups of SLPI major function is inhibit inflammation by researchers, whom purified the molecule from the blocking the proteolytic activity of serine proteinases urine and (Seemuller et al. 1986) and the parotid released by leukocytes and also through blocking the gland secretions (Thompson et al. 1986). SLPI is LPS effects, such as the upregulation of several located in both, the extracellular matrix and the cytokines like TNFalpha, MCP-1 and IL-6 (Yang et intracellular compartments, suggesting that it could al. 2005; Jin et al. 1998; Taggart et al. 2005; Ashcroft exert autocrine and paracrine effects (Taggart et al. et al. 2000). SLPI acts locally to maintain a 2005). protease/antiprotease balance thereby preventing The expression of SLPI is constitutive as well as protease mediated tissue destruction (Vogelmeier et modulated by different factors. Constitutively SLPI al. 1990). In the lungs, the disturbance of this balance can be found in serum and in extravascular mucosal is responsible for various lung diseases, many of fluids. Thus, it is found around of 40 (26.1-65.0) which are initiated and maintained by the ng/ml in serum, 72 (0.4-250) ng/ml in bronchial recruitment and activation of neutrophils (Birrer et lavage fluid (Hollander et al. 2007), in exhaled al. 1994; Suter 1989). breath condensate (2.82 - 0.58 pg/ml) (Tateosian et Anti-inflammatory activity: SLPI has anti- al. 2012) and saliva (0.3-3.2 ug/ml) (Shugars et al. inflammatory activities not necessarily related to its
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 332
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
ability to inhibit extracellular proteases. The anti- is well-established that human saliva inhibits HIV inflammatory activity is also mediated by inhibition infectivity in vitro (McNeely et al. 1995; of proteolytic degradation of IkB, an inhibitor of the Nagashunmugam et al. 1997; Shugars et al. 2001; nuclear factor NF-kB (Ashcroft et al. 2000; Samsom Malamud et al. 1992; Fultz 1986). The infection of et al. 2007). adherent primary monocytes with HIV-1 was It has been shown that over-expression of SLPI significantly suppressed in the presence of human inhibits NF-kB, which is a transcription factor of saliva [76-80]. Four in vitro studies have several pro-inflammatory mediators in pulmonary demonstrated that SLPI has anti-HIV-1 activity in inflammation (Henriksen et al. 2004). Currently, cells that included peripheral blood mononuclear there are some evidence that SLPI is rapidly taken up cells, purified primary T cells, and SupT1 cells, a by cells and is localized in the nucleus and cytoplasm lymphocyte-derived tumor cell line (Fultz 1986; (Taggart et al. 2002). In the cytoplasm, SLPI Hocini et al. 2000; Shugars et al. 1997; Skott et al. prevents degradation of several key proteins in the 2002). regulated activation of NF-kB, as IkBalpha, IkBbeta Evidence suggests that SLPI blocks HIV-1 and IRAK (IL-1-receptor-associated kinase) through internalization in a dose-dependent manner the ubiquitin-proteasome mechanism (Greene et al. (McNeely et al. 1997). McNeely et al. found that 2004; Taggart et al. 2002), that follows the activation SLPI inhibits a step of viral infection that occurs of NF-kB by LPS or LTA (lipoteichoic acids). Also after virus binding but before reverse transcription. it has been proposed that SLPI acting in the nucleus In a co-precipitation experiment, it was described a can bind to NF-kB consensus region of target genes 55-kDa cell surface protein from monocytes by (Taggart et al. 2005). The entering into the nucleus using anti-SLPI antibodies. For some authors, the occurs through a mechanism in which SLPI may interaction between HIV and CCR5 could be the traverse membranes, due to its cationic nature main target of SLPI (Naif et al. 1998). Other authors (favored by the high content of arginine and lysine) showed that SLPI interferes with HIV fusion with by interaction with the negatively charged the T-cell plasma membrane through binding to membrane. Independently of the mode of action, in scramblase 1, a membrane protein that interacts with vivo experiments have demonstrated anti- CD4 and controls the movement of the phospholipid inflammatory / pro-apoptotic activities in the lung, bilayer of the plasma membrane (Shugars et al. and in a variety of other organs. 1999). It was also demonstrated that in myeloid cell, Microbicidal activity: SLPI blocks viral entry/fusion as a result of binding - Against Bacteria: to annexin II (Ohlsson et al. 2001; Ma et al. 2004; SLPI displays anti-microbial properties in vivo and Drannik et al. 2011). This molecule is a macrophage in vitro (Sallenave 2002; Gomez et al. 2009). It has receptor that binds to phosphatidylserine moiety that been recently reported that mouse and even human HIV carries on its outer layer on exiting from an SLPI shows anti-bacterial activity against infected cell (Ohlsson et al. 2001; Drannik et al. mycobacteria and it constitutes a pattern recognition 2011; Ma et al. 2004). Furthermore, the elastase receptor (PRR), that not only kills the inhibiting activity of SLPI was not be essential for microorganism, but also facilitates their their anti-HIV-1 activity (McNeely et al. 1997). phagocytosis by murine and human macrophages - Against Fungi: (Nishimura et al. 2008; Gomez et al. 2009). Either C. albicans and Aspergillus fumigatus were sensitive the antimicrobial activity or PRR ability depends on to the antimicrobial activity of recombinant SLPI. the COOH terminal domain where the inhibitory This activity was localized to N-terminal domain of activity of serine proteases resides. The WAPs the molecule (Tomee et al. 1997). domains of the molecule are involved, and this is due Wound healing activity: The role of SLPI in tissue to cationic residues that allow the disruption of the repair was suggested by the observation that in membranes of target organisms (Verma et al. 2007; human, epithelial expression of SLPI is increased in Gomez et al. 2009; Nishimura et al. 2008). The damaged skin (Wingens et al. 1998). Studies in SLPI antimicrobial activity of human SLPI has been deficient mice demonstrated that SLPI has an described for various bacteria such as Pseudomonas essential role in wound healing (Ashcroft et al. aeruginosa, Staphylococcus aureus, Staphylococcus 2000). In the absence of SLPI, the animals presents epidermis (Wiedow et al. 1998; Wingens et al. a delay in cutaneous wound healing, which is 1998), Mycobacterium tuberculosis (Gomez et al. attributed to an increased and prolonged 2009), and Escherichia coli (Williams et al. 2006). inflammatory response during the repair process, Therefore this activity is against Gram negative and and a delay in the accumulation of the matrix. The Gram positive bacteria and is part of the defense altered inflammatory profile involves enhanced system of the mucosa. activation of local TGF-beta (Ashcroft et al. 2000). - Against Viruses: Immunomodulatory activity in adaptive immune SLPI has been suggested as the main soluble factor response: The effect of SLPI seems not to be limited responsible for the HIV inhibitory effect of saliva. It to innate immune response but also to the cellular
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 333
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
and humoral adaptive immune response. In fact, the al. 2001; Clauss et al. 2005; Devoogdt et al. 2009) high SLPI expression was found in dendritic cells of independent of its antiprotease activity (Simpkins et mucosal lymph node and it was suggested that these al. 2008). However, in Lewis lung cancer cells, the dendritic cells regulate cellular activation to pro-tumoral activity was shown to be dependent on microbial products and maintain the tolerance its protease inhibitor activity (Devoogdt et al. 2003). threshold (Samsom et al. 2007). Also, it was described that SLPI plasma levels were Also, we have observed that SLPI decreases elevated in lung cancer patients (Zelvyte et al. 2004). lymphocyte proliferation, a phenomenon which More recently, low level of SLPI was detected in oral depends on the presence of monocytes (Guerrieri et squamous cell carcinoma compared with normal oral al. 2011). However, it is not possible to rule out a epithelium (Wen et al. 2011). Moreover, an inverse direct effect of SLPI on lymphocytes since it is able correlation was also reported between SLPI and to bind the receptors phospholipid scramblases 1 and histological parameters associated with tumor 4 on CD4 T cells (Py et al. 2009). On tonsillar cells, progression (Wen et al. 2011). Interestingly, SLPI SLPI inhibits B cells expressing activation-induced reduced the hepatic lung carcinoma metastasis cytidine deaminase, an enzyme involved in class (Wang et al. 2006). In breast tumors, the mRNA switching. expression of SLPI either increases or decreases Thus, the overall idea is that SLPI is a tolerigenic depending on the case (Kluger et al. 2004; Stoff- factor, that it is able to down modulate the innate and Khalili et al. 2005). Also in a breast tumor cell line, adaptive immune response. Moreover, recently it has the SLPI overexpressing cells did not develop been shown that the hyporesponsiveness of human tumors in mice (Amiano et al. 2013). This effect was buccal epithelium to microbial stimulation is a specific for this type of cell line, since colon tumor phenomenon that depends on SLPI expression. cells overexpressing SLPI, developed faster tumors (Menckeberg et al. 2015). than control cells. Moreover, the breast cancer cell Recently, it has been also described that SLPI, in line that overexpresses SLPI showed a decrease in E- conjunction of neutrophil DNA or cathepsin G and cadherin expression, pro-apoptotic effects and cell human neutrophil elastase, induced a marked cycle arrests. (Rosso et al. 2014). Interestingly, the production of type I interferon by plasmacytoid administration of these SLPI transfected cells, which dendritic cells (Skrzeczynska-Moncznik et al. 2012; do not develop tumor in immunocompetent mice, Skrzeczynska-Moncznik et al. 2013). inhibited the tumor growth and increased the On the other hand, it was found that SLPI inhibits the survival of mice that were inoculated with mock formation of neutrophil extracellular traps; transfected control cells. (Amiano et al. 2011). structures that are involved in the elimination of In ovarian cancer SLPI inhibits cell growth through microorganisms, and also in the presentation of an apoptotic pathway (Nakamura et al. 2008), while, autoantigens (Zabieglo et al. 2015). These findings it has been also described that over-expression of suggest a role of SLPI in autoimmune diseases. SLPI is capable of producing a more aggressive ovarian cancer in vitro and in vivo models Implicated in (Devoogdt et al. 2009). In fact, it was suggested that SLPI could be a useful diagnostic and prognostic Cancer tool in ovarian cancer (Carlson et al. 2013). The invasiveness of tumors occurs through The SLPI gene and the protein expression are infiltration of tumor cells into healthy tissue and by significantly lower in metastatic "head and neck angiogenesis, which is modulated by proteases and squamous cell carcinoma" compared with non- antiproteases released from tumor cells that carry out metastatic ones. Also, an inverse significant tissue remodeling. correlation with HPV status was found for this kind Many studies have shown that SLPI expression is of tumor (Hoffmann et al. 2013). Therefore, overall modulated in cancer. However, there has been these data suggests us that it is not possible to reported an increased or decreased expression profile generalize the findings related to SLPI expression of the protein depending on the type of tumor. and function in only a unique type of tumor, since its For example, SLPI expression is increased in expression and modulation seems to be tumor pancreatic (Iacobuzio-Donahue et al. 2003), thyroid specific. (Jarzab et al. 2005), cervix (Rein et al. 2004), Pregnancy endometrial (Zhang et al. 2002), ovarian (Israeli et al. 2005) and gastric cancer (Cheng et al. 2008). SLPI among others antimicrobial peptides seems to In contrast, it is weakly expressed in nasopharyngeal play a role in pregnancy. SLPI is produced by carcinoma (Sriuranpong et al. 2004; Huang et al. amnion epithelium and deciduas (King et al. 2007). 2012), bladder tumors (Liang et al. 2002) and some High levels of SLPI were found in the cervical breast carcinomas (Hu et al. 2004). As we mentioned mucus plug during human pregnancy. The SLPI above, in ovarian cancer, SLPI is over-expressed and mRNA expression was higher in the second and the is thought to have a carcinogenic function (Hough et third trimester when compared with the first one
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 334
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
(Itaoka et al. 2015). Thus, in amniotic fluid, its Chronic obstructive pulmonary concentration increases according to the period of disease (COPD) pregnancy and the highest levels is reached on the onset of labor (Denison et al. 1999). As SLPI is a Emphysema may be due to an imbalance in protease- natural antimicrobial molecule, it may be involved in antiprotease activity. Patients with COPD show high the prevention of uterine infection during pregnancy levels of SLPI compared with healthy subjects and labor, and be a modulator of inflammation in this (Hollander et al. 2007). Conversely, SLPI levels are stage. decreased during COPD exacerbations produced by bacterial infection or rhinovirus (Mallia et al. 2012). Autoimmunity High levels of SLPI have been observed in several Ischemia reperfusion injury autoimmune diseases. For example, it was observed It has been described a protective effect of SLPI in in: i) inflamed joint tissues in a rat model of arthritis different ischemia/reperfusion injury models, such (Song et al. 1999); ii) patients with primary Sjögren's as heart and liver (Amberger et al. 2002; Lentsch et syndrome (Maruyama et al. 1998); iii) immune cells al. 1999). We have also observed a beneficial effect infiltrating the corpus in autoimmune gastritis (Hritz of SLPI in kidney ischemia reperfusion injury et al. 2006); iv) macrophages, activated microglia, (unpublished result). Interestingly, in cardiac neuronal cells and astrocytes during experimental transplantation, null mice for SLPI had an impaired autoimmune encephalomyelitis (Mueller et al. function after cold ischemia unlike the wild type 2008). (Schneeberger et al. 2008). Moreover, when SLPI In contrast, the administration of systemic SLPI or was added to the preservation solution, myocardial microencapsulated SLPI has proven to reduce the contraction was restored to normal. injury found in tissues of different autoimmune models (Guazzone et al. 2011; Song et al. 1999). Central Nervous System Ischemia Overall, these results highlight the in vivo In two rat models, one of focal cerebral ischemia immunosuppressive effect of SLPI. However, it has (Wang et al. 2003) and the other of spinal injury, it been also implicated in the pathogenesis of other was observed high levels of SLPI. The same was autoimmune diseases such as psoriasis. As we seen in ischemic stroke in humans (Ilzecka et al. mentioned above, Nestle et al. have demonstrated 2002). Interestingly, the administration of SLPI has that the IFNalpha, produced by plasmacytoid been shown to be neuroprotective in both models of dendritic cells in response to DNA structures, injury in rats (Wang et al. 2003; Hannila et al. 2013). containing the neutrophil serine protease cathepsin G Taking into account that the SLPI can promote (CatG) and SLPI was important in the development axonal regeneration, plus the evidence of their of psoriatic skin lesions (Skrzeczynska-Moncznik et neuroprotective effects, we could consider this al. 2013). In fact, the neutralization of SLPI reduces molecule as potential therapeutic tool for different the severity of experimental autoimmune nervous system diseases (Hannila 2014). encephalitis (Muller et al. 2012). Biomarker Tuberculosis It has been found that the determination of serum Exposure of murine peritoneal macrophages to SLPI levels could be useful as a marker of several Mycobacterium tuberculosis led to an increase in diseases, such as disease activity in systemic SLPI protein secretion (Ding et al. 2005) which sclerosis with interstitial lung disease (Aozasa et al. seems to be a pattern recognition receptor for 2012). Also, it has been suggested that a form of micobacterias and inhibits the growth of cleaved SLPI can reflect the disease activity of them(Nishimura et al. 2008; Gomez et al. 2009). In patients with allergic rhinitis and asthma (Belkowski plasma of tuberculosis patients, the SLPI and IFN- et al. 2009). It was also been proposed as a biomarker gamma levels were significantly higher compared in ovarian and gastric cancer (Devoogdt et al. 2009; with the levels found in healthy subjects. Moreover, Cheng et al. 2008), or to identify subjects at risk of a direct association between SLPI levels and the infections and malignant transformation due to HIV severity of tuberculosis was detected. The main infection (Nittayananta et al. 2013). Recently, it was protective cytokine in tuberculosis, IFN-gamma, proposed as a biomarker for acute kidney injury after decreased the expression of SLPI in healthy subjects transplantation (Wilflingseder et al. 2014). However, but not in tuberculosis patients, probably because of until now none of these assays have been introduced the low expression of IFN- gammaR detected in in the clinical settings. these patients (Tateosian et al. 2014). References Abbinante-Nissen JM, Simpson LG, Leikauf GD. Corticosteroids increase secretory leukocyte protease
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 335
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
inhibitor transcript levels in airway epithelial cells. Am J Devoogdt N, Rasool N, Hoskins E, Simpkins F, Tchabo N, Physiol. 1995 Apr;268(4 Pt 1):L601-6 Kohn EC. Overexpression of protease inhibitor-dead secretory leukocyte protease inhibitor causes more Abe T, Kobayashi N, Yoshimura K, Trapnell BC, Kim H, aggressive ovarian cancer in vitro and in vivo Cancer Sci Hubbard RC, Brewer MT, Thompson RC, Crystal RG. 2009 Mar;100(3):434-40 Expression of the secretory leukoprotease inhibitor gene in epithelial cells. J Clin Invest. 1991 Jun;87(6):2207-15 Ding A, Yu H, Yang J, Shi S, Ehrt S. Induction of macrophage-derived SLPI by Mycobacterium tuberculosis Amberger A, Schneeberger S, Hernegger G, Brandacher G, depends on TLR2 but not MyD88 Immunology 2005 Obrist P, Lackner P, Margreiter R, Mark W. Gene Nov;116(3):381-9 expression profiling of prolonged cold ischemia and reperfusion in murine heart transplants. Transplantation. Drannik AG, Henrick BM, Rosenthal KL. War and peace 2002 Nov 27;74(10):1441-9 between WAP and HIV: role of SLPI, trappin-2, elafin and ps20 in susceptibility to HIV infection Biochem Soc Trans Amiano N, Reiteri RM, Costa MJ, Tateosian N, Chuluyan 2011 Oct;39(5):1427-32 HE. Immunotherapy with SLPI over-expressing mammary tumor cells decreases tumor growth. Cancer Immunol Eisenberg SP, Hale KK, Heimdal P, Thompson RC. Immunother. 2011 Jun;60(6):895-900 Location of the protease-inhibitory region of secretory leukocyte protease inhibitor J Biol Chem 1990 May Amiano NO, Costa MJ, Reiteri RM, Payés C, Guerrieri D, 15;265(14):7976-81 Tateosian NL, Sánchez ML, Maffia PC, Diament M, Karas R, Orqueda A, Rizzo M, Alaniz L, Mazzolini G, Klein S, Faller B, Frommherz K, Bieth JG. Heparin interferes with the Sallenave JM, Chuluyan HE. Anti-tumor effect of SLPI on inhibition of neutrophil elastase by its physiological mammary but not colon tumor growth. J Cell Physiol. 2013 inhibitors Biol Chem Hoppe Seyler 1992 Jul;373(7):503-8 Feb;228(2):469-75 Fultz PN. Components of saliva inactivate human Aozasa N, Asano Y, Akamata K, Noda S, Masui Y, Tamaki immunodeficiency virus Lancet 1986 Nov 22;2(8517):1215 Z, Tada Y, Sugaya M, Kadono T, Sato S. Clinical significance of serum levels of secretory leukocyte protease Gomez SA, Argüelles CL, Guerrieri D, Tateosian NL, inhibitor in patients with systemic sclerosis Mod Rheumatol Amiano NO, Slimovich R, Maffia PC, Abbate E, Musella RM, 2012 Aug;22(4):576-83 Garcia VE, Chuluyan HE. Secretory leukocyte protease inhibitor: a secreted pattern recognition receptor for Ashcroft GS, Lei K, Jin W, Longenecker G, Kulkarni AB, mycobacteria Am J Respir Crit Care Med 2009 Feb Greenwell-Wild T, Hale-Donze H, McGrady G, Song XY, 1;179(3):247-53 Wahl SM. Secretory leukocyte protease inhibitor mediates non-redundant functions necessary for normal wound Grütter MG, Fendrich G, Huber R, Bode W. The 2 5 A X-ray healing Nat Med 2000 Oct;6(10):1147-53 crystal structure of the acid-stable proteinase inhibitor from human mucous secretions analysed in its complex with Belkowski SM, Boot JD, Mascelli MA, Diamant Z, de bovine alpha-chymotrypsin EMBO J Garavilla L, Hertzog B, Polkovitch D, Towers M, Batheja A, D'Andrea MR. Cleaved secretory leucocyte protease Greene CM, McElvaney NG, O'Neill SJ, Taggart CC. inhibitor as a biomarker of chymase activity in allergic Secretory leucoprotease inhibitor impairs Toll-like receptor airway disease Clin Exp Allergy 2009 Aug;39(8):1179-86 2- and 4-mediated responses in monocytic cells Infect Immun 2004 Jun;72(6):3684-7 Birrer P, McElvaney NG, Rüdeberg A, Sommer CW, Liechti- Gallati S, Kraemer R, Hubbard R, Crystal RG. Protease- Guazzone VA, Guerrieri D, Jacobo P, Glisoni RJ, antiprotease imbalance in the lungs of children with cystic Chiappetta D, Lustig L, Chuluyan HE. Micro-encapsulated fibrosis Am J Respir Crit Care Med 1994 Jul;150(1):207-13 secretory leukocyte protease inhibitor decreases cell- mediated immune response in autoimmune orchitis Life Sci Brown A, Farmer K, MacDonald L, Kalsheker N, Pritchard 2011 Jul 18;89(3-4):100-6 D, Haslett C, Lamb J, Sallenave JM. House dust mite Der p 1 downregulates defenses of the lung by inactivating Guerrieri D, Tateosian NL, Maffía PC, Reiteri RM, Amiano elastase inhibitors Am J Respir Cell Mol Biol 2003 Sep;29(3 NO, Costa MJ, Villalonga X, Sanchez ML, Estein SM, Pt 1):381-9 Garcia VE, Sallenave JM, Chuluyan HE. Serine leucocyte proteinase inhibitor-treated monocyte inhibits human Carlson AM, Maurer MJ, Goergen KM, Kalli KR, Erskine CL, CD4(+) lymphocyte proliferation Immunology 2011 Behrens MD, Knutson KL, Block MS. Utility of progranulin Aug;133(4):434-41 and serum leukocyte protease inhibitor as diagnostic and prognostic biomarkers in ovarian cancer Cancer Epidemiol Hannila SS. Secretory Leukocyte Protease Inhibitor (SLPI): Biomarkers Prev 2013 Oct;22(10):1730-5 Emerging Roles in CNS Trauma and Repair Neuroscientist 2014 Aug 12 Cheng WL, Wang CS, Huang YH, Liang Y, Lin PY, Hsueh C, Wu YC, Chen WJ, Yu CJ, Lin SR, Lin KH. Hannila SS, Siddiq MM, Carmel JB, Hou J, Chaudhry N, Overexpression of a secretory leukocyte protease inhibitor Bradley PM, Hilaire M, Richman EL, Hart RP, Filbin MT. in human gastric cancer Int J Cancer 2008 Oct Secretory leukocyte protease inhibitor reverses inhibition by 15;123(8):1787-96 CNS myelin, promotes regeneration in the optic nerve, and suppresses expression of the transforming growth factor- Clauss A, Lilja H, Lundwall A. The evolution of a genetic signaling protein Smad2 J Neurosci 2013 Mar locus encoding small serine proteinase inhibitors Biochem 20;33(12):5138-51 Biophys Res Commun 2005 Jul 29;333(2):383-9 Henriksen PA, Hitt M, Xing Z, Wang J, Haslett C, Denison FC, Kelly RW, Calder AA, Riley SC. Secretory Riemersma RA, Webb DJ, Kotelevtsev YV, Sallenave JM. leukocyte protease inhibitor concentration increases in Adenoviral gene delivery of elafin and secretory leukocyte amniotic fluid with the onset of labour in women: protease inhibitor attenuates NF-kappa B-dependent characterization of sites of release within the uterus J inflammatory responses of human endothelial cells and Endocrinol 1999 May;161(2):299-306 macrophages to atherogenic stimuli J Immunol 2004 Apr 1;172(7):4535-44
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 336
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
Hochstrasser K, Reichert R, Schwarz S, Werle E. [Isolation of variability and diagnostic implications Cancer Res 2005 and characterisation of a protease inhibitor from human Feb 15;65(4):1587-97 bronchial secretion] Hoppe Seylers Z Physiol Chem 1972 Feb;353(2):221-6 Jaumann F, Elssner A, Mazur G, Dobmann S, Vogelmeier C. Transforming growth factor-beta1 is a potent inhibitor of Hocini H, Becquart P, Bouhlal H, Adle-Biassette H, secretory leukoprotease inhibitor expression in a bronchial Kazatchkine MD, Bélec L. Secretory leukocyte protease epithelial cell line Munich Lung Transplant Group Eur inhibitor inhibits infection of monocytes and lymphocytes Respir J with human immunodeficiency virus type 1 but does not interfere with transcytosis of cell-associated virus across Jin F, Nathan CF, Radzioch D, Ding A. Lipopolysaccharide- tight epithelial barriers Clin Diagn Lab Immunol 2000 related stimuli induce expression of the secretory leukocyte May;7(3):515-8 protease inhibitor, a macrophage-derived lipopolysaccharide inhibitor Infect Immun 1998 Hoffmann M, Quabius ES, Tribius S, Hebebrand L, Görögh Jun;66(6):2447-52 T, Halec G, Kahn T, Hedderich J, Röcken C, Haag J, Waterboer T, Schmitt M, Giuliano AR, Kast WM. Human Jin FY, Nathan C, Radzioch D, Ding A. Secretory leukocyte papillomavirus infection in head and neck cancer: the role protease inhibitor: a macrophage product induced by and of the secretory leukocyte protease inhibitor Oncol Rep antagonistic to bacterial lipopolysaccharide Cell 1997 Feb 2013 May;29(5):1962-8 7;88(3):417-26 Hollander C, Westin U, Wallmark A, Piitulainen E, Sveger Kikuchi T, Abe T, Hoshi S, Matsubara N, Tominaga Y, Satoh T, Janciauskiene SM. Plasma levels of alpha1- K, Nukiwa T. Structure of the murine secretory antichymotrypsin and secretory leukocyte proteinase leukoprotease inhibitor (Slpi) gene and chromosomal inhibitor in healthy and chronic obstructive pulmonary localization of the human and murine SLPI genes Am J disease (COPD) subjects with and without severe alpha1- Respir Cell Mol Biol 1998 Dec;19(6):875-80 antitrypsin deficiency BMC Pulm Med 2007 Jan 29;7:1 King AE, Kelly RW, Sallenave JM, Bocking AD, Challis JR. Hough CD, Cho KR, Zonderman AB, Schwartz DR, Morin Innate immune defences in the human uterus during PJ. Coordinately up-regulated genes in ovarian cancer pregnancy Placenta 2007 Nov-Dec;28(11-12):1099-106 Cancer Res 2001 May 15;61(10):3869-76 King AE, Morgan K, Sallenave JM, Kelly RW. Differential Hritz I, Kuester D, Vieth M, Herszenyi L, Stolte M, Roessner regulation of secretory leukocyte protease inhibitor and A, Tulassay Z, Wex T, Malfertheiner P. Secretory leukocyte elafin by progesterone Biochem Biophys Res Commun protease inhibitor expression in various types of gastritis: a 2003 Oct 17;310(2):594-9 specific role of Helicobacter pylori infection Eur J Klimenkova O, Ellerbeck W, Klimiankou M, Ünalan M, Gastroenterol Hepatol 2006 Mar;18(3):277-82 Kandabarau S, Gigina A, Hussein K, Zeidler C, Welte K, Hu Y, Sun H, Drake J, Kittrell F, Abba MC, Deng L, Gaddis Skokowa J. A lack of secretory leukocyte protease inhibitor S, Sahin A, Baggerly K, Medina D, Aldaz CM. From mice to (SLPI) causes defects in granulocytic differentiation Blood humans: identification of commonly deregulated genes in 2014 Feb 20;123(8):1239-49 mammary cancer via comparative SAGE studies Cancer Kluger HM, Kluger Y, Gilmore-Hebert M, DiVito K, Chang Res 2004 Nov 1;64(21):7748-55 JT, Rodov S, Mironenko O, Kacinski BM, Perkins AS, Sapi Huang C, Tang H, Zhang W, She X, Liao Q, Li X, Wu M, Li E. cDNA microarray analysis of invasive and tumorigenic G. Integrated analysis of multiple gene expression profiling phenotypes in a breast cancer model Lab Invest 2004 datasets revealed novel gene signatures and molecular Mar;84(3):320-31 markers in nasopharyngeal carcinoma Cancer Epidemiol Lentsch AB, Yoshidome H, Warner RL, Ward PA, Edwards Biomarkers Prev 2012 Jan;21(1):166-75 MJ. Secretory leukocyte protease inhibitor in mice regulates Ińzecka J, Stelmasiak Z. Increased serum levels of local and remote organ inflammatory injury induced by endogenous protectant secretory leukocyte protease hepatic ischemia/reperfusion Gastroenterology 1999 inhibitor in acute ischemic stroke patients Cerebrovasc Dis Oct;117(4):953-61 2002;13(1):38-42 Liang G, Gonzales FA, Jones PA, Orntoft TF, Thykjaer T. Iacobuzio-Donahue CA, Ashfaq R, Maitra A, Adsay NV, Analysis of gene induction in human fibroblasts and bladder Shen-Ong GL, Berg K, Hollingsworth MA, Cameron JL, Yeo cancer cells exposed to the methylation inhibitor 5-aza-2'- CJ, Kern SE, Goggins M, Hruban RH. Highly expressed deoxycytidine Cancer Res 2002 Feb 15;62(4):961-6 genes in pancreatic ductal adenocarcinomas: a Müller AM, Jun E, Conlon H, Sadiq SA. Inhibition of SLPI comprehensive characterization and comparison of the ameliorates disease activity in experimental autoimmune transcription profiles obtained from three major encephalomyelitis BMC Neurosci 2012 Mar 21;13:30 technologies Cancer Res 2003 Dec 15;63(24):8614-22 Ma G, Greenwell-Wild T, Lei K, Jin W, Swisher J, Hardegen Israeli O, Goldring-Aviram A, Rienstein S, Ben-Baruch G, N, Wild CT, Wahl SM. Secretory leukocyte protease Korach J, Goldman B, Friedman E. In silico chromosomal inhibitor binds to annexin II, a cofactor for macrophage HIV- clustering of genes displaying altered expression patterns in 1 infection J Exp Med 2004 Nov 15;200(10):1337-46 ovarian cancer Cancer Genet Cytogenet 2005 Jul 1;160(1):35-42 Malamud D, Friedman HM. HIV in the oral cavity: virus, viral inhibitory activity, and antiviral antibodies: a review Crit Rev Itaoka N, Nagamatsu T, Schust DJ, Ichikawa M, Sayama S, Oral Biol Med 1993;4(3-4):461-6 Iwasawa-Kawai Y, Kawana K, Yamashita T, Osuga Y, Fujii T. Cervical Expression of Elafin and SLPI in Pregnancy and Mallia P, Footitt J, Sotero R, Jepson A, Contoli M, Trujillo- Their Association With Preterm Labor Am J Reprod Torralbo MB, Kebadze T, Aniscenko J, Oleszkiewicz G, Immunol 2015 Jun;73(6):536-44 Gray K, Message SD, Ito K, Barnes PJ, Adcock IM, Papi A, Stanciu LA, Elkin SL, Kon OM, Johnson M, Johnston SL. Jarzab B, Wiench M, Fujarewicz K, Simek K, Jarzab M, Rhinovirus infection induces degradation of antimicrobial Oczko-Wojciechowska M, Wloch J, Czarniecka A, Chmielik peptides and secondary bacterial infection in chronic E, Lange D, Pawlaczek A, Szpak S, Gubala E, Swierniak A. Gene expression profile of papillary thyroid cancer: sources
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 337
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
obstructive pulmonary disease Am J Respir Crit Care Med inhibitor (SLPI) in human pancreatic beta-cells Mediators 2012 Dec 1;186(11):1117-24 Inflamm 1999;8(3):147-51 Maruyama M, Sugiyama E, Hori T, Murayama R, Nakazaki Odaka C, Mizuochi T, Yang J, Ding A. Murine macrophages S, Yamashita N, Kobayashi M. Increased serum produce secretory leukocyte protease inhibitor during concentrations of secretory leukoprotease inhibitor in clearance of apoptotic cells: implications for resolution of the patients with primary Sjögren's syndrome In Vivo 1998 Sep- inflammatory response J Immunol 2003 Aug Oct;12(5):535-8 1;171(3):1507-14 McNeely TB, Shugars DC, Rosendahl M, Tucker C, Ohlsson K, Bjartell A, Lilja H. Secretory leucocyte protease Eisenberg SP, Wahl SM. Inhibition of human inhibitor in the male genital tract: PSA-induced proteolytic immunodeficiency virus type 1 infectivity by secretory processing in human semen and tissue localization J leukocyte protease inhibitor occurs prior to viral reverse Androl 1995 Jan-Feb;16(1):64-74 transcription Blood 1997 Aug 1;90(3):1141-9 Ohlsson K, Tegner H. Inhibition of elastase from Meckelein B, Nikiforov T, Clemen A, Appelhans H. The granulocytes by the low molecular weight bronchial location of inhibitory specificities in human mucus protease inhibitor Scand J Clin Lab Invest 1976 proteinase inhibitor (MPI): separate expression of the Sep;36(5):437-45 COOH-terminal domain yields an active inhibitor of three different proteinases Protein Eng 1990 Jan;3(3):215-20 Ohlsson S, Ljungkrantz I, Ohlsson K, Segelmark M, Wieslander J. Novel distribution of the secretory leucocyte Menckeberg CL, Hol J, Simons-Oosterhuis Y, Raatgeep proteinase inhibitor in kidney Mediators Inflamm 2001 HR, de Ruiter LF, Lindenbergh-Kortleve DJ, Korteland-van Dec;10(6):347-50 Male AM, El Aidy S, van Lierop PP, Kleerebezem M, Groeneweg M, Kraal G, Elink-Schuurman BE, de Jongste Py B, Basmaciogullari S, Bouchet J, Zarka M, Moura IC, JC, Nieuwenhuis EE, Samsom JN. Human buccal Benhamou M, Monteiro RC, Hocini H, Madrid R, Benichou epithelium acquires microbial hyporesponsiveness at birth, S. The phospholipid scramblases 1 and 4 are cellular a role for secretory leukocyte protease inhibitor Gut 2015 receptors for the secretory leukocyte protease inhibitor and Jun;64(6):884-93 interact with CD4 at the plasma membrane PLoS One 2009;4(3):e5006 Mihaila A, Tremblay GM. Human alveolar macrophages express elafin and secretory leukocyte protease inhibitor Z Ramadas RA, Wu L, LeVine AM. Surfactant protein A Naturforsch C 2001 Mar-Apr;56(3-4):291-7 enhances production of secretory leukoprotease inhibitor and protects it from cleavage by matrix metalloproteinases Moriyama A, Shimoya K, Ogata I, Kimura T, Nakamura T, J Immunol 2009 Feb 1;182(3):1560-7 Wada H, Ohashi K, Azuma C, Saji F, Murata Y. Secretory leukocyte protease inhibitor (SLPI) concentrations in Reid PT, Marsden ME, Cunningham GA, Haslett C, cervical mucus of women with normal menstrual cycle Mol Sallenave JM. Human neutrophil elastase regulates the Hum Reprod 1999 Jul;5(7):656-61 expression and secretion of elafin (elastase-specific inhibitor) in type II alveolar epithelial cells FEBS Lett 1999 Mueller AM, Pedré X, Stempfl T, Kleiter I, Couillard-Despres Aug 20;457(1):33-7 S, Aigner L, Giegerich G, Steinbrecher A. Novel role for SLPI in MOG-induced EAE revealed by spinal cord Rein DT, Breidenbach M, Nettelbeck DM, Kawakami Y, expression analysis J Neuroinflammation 2008 May Siegal GP, Huh WK, Wang M, Hemminki A, Bauerschmitz 26;5:20 GJ, Yamamoto M, Adachi Y, Takayama K, Dall P, Curiel DT. Evaluation of tissue-specific promoters in carcinomas of the Nagashunmugam T, Malamud D, Davis C, Abrams WR, cervix uteri J Gene Med 2004 Nov;6(11):1281-9 Friedman HM. Human submandibular saliva inhibits human immunodeficiency virus type 1 infection by displacing Rosso M, Lapyckyj L, Amiano N, Besso MJ, Sánchez M, envelope glycoprotein gp120 from the virus J Infect Dis Chuluyan E, Vazquez-Levin MH. Secretory Leukocyte 1998 Dec;178(6):1635-41 Protease Inhibitor (SLPI) expression downregulates E- cadherin, induces -catenin re-localisation and triggers Naif HM, Li S, Alali M, Sloane A, Wu L, Kelly M, Lynch G, apoptosis-related events in breast cancer cells Biol Cell Lloyd A, Cunningham AL. CCR5 expression correlates with 2014 Sep;106(9):308-22 susceptibility of maturing monocytes to human immunodeficiency virus type 1 infection J Virol 1998 Sallenave JM. Antimicrobial activity of antiproteinases Jan;72(1):830-6 Biochem Soc Trans 2002 Apr;30(2):111-5 Nakamura K, Takamoto N, Hongo A, Kodama J, Abrzua F, Samsom JN, van der Marel AP, van Berkel LA, van Helvoort Nasu Y, Kumon H, Hiramatsu Y. Secretory leukoprotease JM, Simons-Oosterhuis Y, Jansen W, Greuter M, Nelissen inhibitor inhibits cell growth through apoptotic pathway on RL, Meeuwisse CM, Nieuwenhuis EE, Mebius RE, Kraal G. ovarian cancer Oncol Rep 2008 May;19(5):1085-91 Secretory leukoprotease inhibitor in mucosal lymph node dendritic cells regulates the threshold for mucosal tolerance Nishimura J, Saiga H, Sato S, Okuyama M, Kayama H, J Immunol 2007 Nov 15;179(10):6588-95 Kuwata H, Matsumoto S, Nishida T, Sawa Y, Akira S, Yoshikai Y, Yamamoto M, Takeda K. Potent Schneeberger S, Hautz T, Wahl SM, Brandacher G, Sucher antimycobacterial activity of mouse secretory leukocyte R, Steinmassl O, Steinmassl P, Wright CD, Obrist P, protease inhibitor J Immunol 2008 Mar 15;180(6):4032-9 Werner ER, Mark W, Troppmair J, Margreiter R, Amberger A. The effect of secretory leukocyte protease inhibitor Nittayananta W, Kemapunmanus M, Yangngam S, (SLPI) on ischemia/reperfusion injury in cardiac Talungchit S, Sriplung H. Expression of oral secretory transplantation Am J Transplant 2008 Apr;8(4):773-82 leukocyte protease inhibitor in HIV-infected subjects with long-term use of antiretroviral therapy J Oral Pathol Med Seemüller U, Arnhold M, Fritz H, Wiedenmann K, Machleidt 2013 Mar;42(3):208-15 W, Heinzel R, Appelhans H, Gassen HG, Lottspeich F. The acid-stable proteinase inhibitor of human mucous Nyström M, Bergenfeldt M, Ljungcrantz I, Lindeheim A, secretions (HUSI-I, antileukoprotease) Complete amino Ohlsson K. Production of secretory leucocyte protease acid sequence as revealed by protein and cDNA
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 338
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
sequencing and structural homology to whey proteins and leukocyte protease inhibitor, a potent inhibitor of leukocyte Red Sea turtle proteinase inhibitor FEBS Lett elastase Proc Natl Acad Sci U S A 1986 Sep;83(18):6692- 6 Shugars DC, Watkins CA, Cowen HJ. Salivary concentration of secretory leukocyte protease inhibitor, an Tomee JF, Hiemstra PS, Heinzel-Wieland R, Kauffman HF. antimicrobial protein, is decreased with advanced age Antileukoprotease: an endogenous protein in the innate Gerontology 2001 Sep-Oct;47(5):246-53 mucosal defense against fungi J Infect Dis 1997 Sep;176(3):740-7 Si-Tahar M, Merlin D, Sitaraman S, Madara JL. Constitutive and regulated secretion of secretory leukocyte proteinase Tomova S, Cutruzzolà F, Barra D, Amiconi G, Ascenzi P, inhibitor by human intestinal epithelial cells Djinović Carugo K, Menegatti E, Sarti P, Schnebli Gastroenterology 2000 Jun;118(6):1061-71 HP, Bolognesi M. Selective oxidation of methionyl residues in the human recombinant secretory leukocyte proteinase Simpkins FA, Devoogdt NM, Rasool N, Tchabo NE, inhibitor Effect on the inhibitor binding properties J Mol Alejandro EU, Kamrava MM, Kohn EC. The alarm anti- Recognit protease, secretory leukocyte protease inhibitor, is a proliferation and survival factor for ovarian cancer cells Velarde MC, Parisek SI, Eason RR, Simmen FA, Simmen Carcinogenesis 2008 Mar;29(3):466-72 RC. The secretory leukocyte protease inhibitor gene is a target of epidermal growth factor receptor action in Skott P, Lucht E, Ehnlund M, Björling E. Inhibitory function endometrial epithelial cells J Endocrinol 2005 of secretory leukocyte proteinase inhibitor (SLPI) in human Jan;184(1):141-51 saliva is HIV-1 specific and varies with virus tropism Oral Dis 2002 May;8(3):160-7 Verma C, Seebah S, Low SM, Zhou L, Liu SP, Li J, Beuerman RW. Defensins: antimicrobial peptides for Skrzeczynska-Moncznik J, Wlodarczyk A, Banas M, therapeutic development Biotechnol J 2007 Kwitniewski M, Zabieglo K, Kapinska-Mrowiecka M, Dubin Nov;2(11):1353-9 A, Cichy J. DNA structures decorated with cathepsin G/secretory leukocyte proteinase inhibitor stimulate IFNI Vogelmeier C, Gillissen A, Buhl R. Use of secretory production by plasmacytoid dendritic cells Am J Clin Exp leukoprotease inhibitor to augment lung antineutrophil Immunol 2013 Jun 15;2(2):186-94 elastase activity Chest 1996 Dec;110(6 Suppl):261S-266S Song Xy, Zeng L, Jin W, Thompson J, Mizel DE, Lei K, Wang N, Thuraisingam T, Fallavollita L, Ding A, Radzioch Billinghurst RC, Poole AR, Wahl SM. Secretory leukocyte D, Brodt P. The secretory leukocyte protease inhibitor is a protease inhibitor suppresses the inflammation and joint type 1 insulin-like growth factor receptor-regulated protein damage of bacterial cell wall-induced arthritis J Exp Med that protects against liver metastasis by attenuating the 1999 Aug 16;190(4):535-42 host proinflammatory response Cancer Res 2006 Mar 15;66(6):3062-70 Sriuranpong V, Mutirangura A, Gillespie JW, Patel V, Amornphimoltham P, Molinolo AA, Kerekhanjanarong V, Wang X, Li X, Xu L, Zhan Y, Yaish-Ohad S, Erhardt JA, Supanakorn S, Supiyaphun P, Rangdaeng S, Voravud N, Barone FC, Feuerstein GZ. Up-regulation of secretory Gutkind JS. Global gene expression profile of leukocyte protease inhibitor (SLPI) in the brain after nasopharyngeal carcinoma by laser capture ischemic stroke: adenoviral expression of SLPI protects microdissection and complementary DNA microarrays Clin brain from ischemic injury Mol Pharmacol 2003 Cancer Res 2004 Aug 1;10(15):4944-58 Oct;64(4):833-40 Stetler G, Brewer MT, Thompson RC. Isolation and Weldon S, McNally P, McElvaney NG, Elborn JS, McAuley sequence of a human gene encoding a potent inhibitor of DF, Wartelle J, Belaaouaj A, Levine RL, Taggart CC. leukocyte proteases Nucleic Acids Res 1986 Oct Decreased levels of secretory leucoprotease inhibitor in the 24;14(20):7883-96 Pseudomonas-infected cystic fibrosis lung are due to neutrophil elastase degradation J Immunol 2009 Dec Stoff-Khalili MA, Stoff A, Rivera AA, Banerjee NS, Everts M, 15;183(12):8148-56 Young S, Siegal GP, Richter DF, Wang M, Dall P, Mathis JM, Zhu ZB, Curiel DT. Preclinical evaluation of Wen J, Nikitakis NG, Chaisuparat R, Greenwell-Wild T, transcriptional targeting strategies for carcinoma of the Gliozzi M, Jin W, Adli A, Moutsopoulos N, Wu T, Warburton breast in a tissue slice model system Breast Cancer Res G, Wahl SM. Secretory leukocyte protease inhibitor (SLPI) 2005;7(6):R1141-52 expression and tumor invasion in oral squamous cell carcinoma Am J Pathol 2011 Jun;178(6):2866-78 Suter S. The imbalance between granulocyte neutral proteases and antiproteases in bronchial secretions from Wiedow O, Harder J, Bartels J, Streit V, Christophers E. patients with cystic fibrosis Antibiot Chemother (1971) 1989;42:158-68 Antileukoprotease in human skin: an antibiotic peptide constitutively produced by keratinocytes Biochem Biophys Taggart CC, Cryan SA, Weldon S, Gibbons A, Greene CM, Res Commun 1998 Jul 30;248(3):904-9 Kelly E, Low TB, O'neill SJ, McElvaney NG. Secretory leucoprotease inhibitor binds to NF-kappaB binding sites in Wilflingseder J, Sunzenauer J, Toronyi E, Heinzel A, Kainz monocytes and inhibits p65 binding J Exp Med 2005 Dec A, Mayer B, Perco P, Telkes G, Langer RM, Oberbauer R. 19;202(12):1659-68 Molecular pathogenesis of post-transplant acute kidney injury: assessment of whole-genome mRNA and miRNA Tateosian NL, Pasquinelli V, Hernández Del Pino RE, profiles PLoS One 2014 Aug 5;9(8):e104164 Ambrosi N, Guerrieri D, Pedraza-Sánchez S, Santucci N, D'Attilio L, Pellegrini J, Araujo-Solis MA, Musella RM, Williams SE, Brown TI, Roghanian A, Sallenave JM. SLPI Palmero DJ, Hernandez-Pando R, Garcia VE, Chuluyan and elafin: one glove, many fingers Clin Sci (Lond) 2006 HE. The impact of IFN- receptor on SLPI expression in Jan;110(1):21-35 active tuberculosis: association with disease severity Am J Wingens M, van Bergen BH, Hiemstra PS, Meis JF, van Pathol 2014 May;184(5):1268-73 Vlijmen-Willems IM, Zeeuwen PL, Mulder J, Kramps HA, Thompson RC, Ohlsson K. Isolation, properties, and van Ruissen F, Schalkwijk J. Induction of SLPI (ALP/HUSI- complete amino acid sequence of human secretory
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 339
SLPI (secretory leukocyte peptidase inhibitor) Ambrosi N, et al.
I) in epidermal keratinocytes J Invest Dermatol 1998 Zhang D, Simmen RC, Michel FJ, Zhao G, Vale-Cruz D, Dec;111(6):996-1002 Simmen FA. Secretory leukocyte protease inhibitor mediates proliferation of human endometrial epithelial cells Yang J, Zhu J, Sun D, Ding A. Suppression of macrophage by positive and negative regulation of growth-associated responses to bacterial lipopolysaccharide (LPS) by genes J Biol Chem 2002 Aug 16;277(33):29999-30009 secretory leukocyte protease inhibitor (SLPI) is independent of its anti-protease function Biochim Biophys Acta 2005 van Wetering S, van der Linden AC, van Sterkenburg MA, Sep 30;1745(3):310-7 de Boer WI, Kuijpers AL, Schalkwijk J, Hiemstra PS. Regulation of SLPI and elafin release from bronchial Zabieglo K, Majewski P, Majchrzak-Gorecka M, Wlodarczyk epithelial cells by neutrophil defensins Am J Physiol Lung A, Grygier B, Zegar A, Kapinska-Mrowiecka Cell Mol Physiol 2000 Jan;278(1):L51-8 M, Naskalska A, Pyrc K, Dubin A, Wahl SM, Cichy J. The inhibitory effect of secretory leukocyte protease inhibitor This article should be referenced as such: (SLPI) on formation of neutrophil extracellular traps J Ambrosi N, Guerrieri D, Caro F, Barbieri Kennedy M, Leukoc Biol 2015 Jul;98(1):99-106 Sánchez F, Sánchez ML, Chuluyan E. SLPI (secretory Zelvyte I, Wallmark A, Piitulainen E, Westin U, leukocyte peptidase inhibitor). Atlas Genet Cytogenet Janciauskiene S. Increased plasma levels of serine Oncol Haematol. 2016; 20(6):331-340. proteinase inhibitors in lung cancer patients Anticancer Res 2004 Jan-Feb;24(1):241-7
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 340 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Gene Section Review
SOCS2 (suppressor of cytokine signaling 2) Indranil Paul, Leandro Fernández-Pérez, Amilcar Flores-Morales Institut for Veteriaer Sygdomsbiologi, Danish Cancer Society Research Center, University of Copenhagen, Denmark (IP, AFM); University of Las Palmas de GC, Faculty of Health Sciences, Molecular and Translational Endocrinology Group, c/ Dr. Pasteur s/n - Campus San Cristobal, 35016 - Las Palmas, Spain, (LFP)
Published in Atlas Database: August 2015 Online updated version : http://AtlasGeneticsOncology.org/Genes/SOCS2ID44123ch12q21.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62943/08-2015-SOCS2ID44123ch12q21.pdf DOI: 10.4267/2042/62943 This article is an update of : Fernández-Pérez L, Flores-Morales A. SOCS2 (suppressor of cytokine signaling 2). Atlas Genet Cytogenet Oncol Haematol 2008;12(3)
This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Abstract Protein Review on SOCS2, with data on DNA, on the protein encoded, and where the gene is implicated. Description Keywords: SOCS2; proteasome; immune cell Reference sequence for SOCS2 protein: differentiation; neuronal development; NP_001257399.1. SOCS2 contains 198 amino acid inflammation; cancer; diabetes residues with a molecular weight of 22172 Da. SOCS2 belongs to the SOCS box family. SOCS2 Identity contains a C terminal SOCS box (residue 151-197) for ElonginB,C/Cullin5/Rbx2 interaction. The Other names: CIS-2, CIS2, Cish2, SOCS-2, SSI-2, unstructured N-terminal region (residue 1-47) and SSI2, STATI2 the SH2 domain (residue 48-156) is implicated in HGNC (Hugo): SOCS2 substrate interaction. The SH2 domain is known to Location: 12q21.3-q23 (Yandava et al., 1999). Plus interact with conserved phosphotyrosine residues on strand. target proteins imparting substrate specificity to SOCS box proteins. DNA/RNA Expression Description SOCS mRNA and protein levels are constitutively NCBI Reference Sequence: NC_000012.12; Coding low in unstimulated cells, but their expression is positions from 93,966,674 to 93,968,952 (length: rapidly induced upon cytokine stimulation, thereby 2,279 bp). Mouse SOCS2 gene is composed of 3 creating a negative feedback loop. Although exons and 2 introns (Metcalf et al., 2000). Human constitutively expressed SOCS2 mRNA has been SOCS-2 comprises 3 exons spanning approximately detected in several tissues and cell types, its 6,38 kb of genomic DNA. expression is, in general, induced by stimulation with different cytokines and hormones (Rico- Transcription Bautista et al., 2006). SOCS2 promoter analysis 2888 bp mRNA. There are 6 transcript variants. indicates the presence of AhR and STAT5 binding Transcript variant 5 is the largest and is cited here. sites that confer responsiveness to dioxin (Boverhof The variants differ in their 5' UTR. All variants et al., 2004) and GH (Vidal et al., 2006), encode the same protein. respectively.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 341 SOCS2 (suppressor of cytokine signaling 2) Paul I, et al.
Diagram representing the structure of SOCS proteins. At least eight proteins belonging to the SOCS family of proteins are shown (upper panel). They are characterized by the presence of an SH2 central domain and the SOCS box domain at the C-terminus. A small domain called kinase inhibitory region (KIR), only found in SOCS1 and SOCS3, is shown as a small box at the N- terminal region. SOCS proteins can interact with phosphotyrosine phosphorylated proteins through their SH2 domain and with Elongin BC through their SOCS box domain. Other proteins containing a SOCS box domain but lacking a SH2 domain are also shown (lower panel). Adapted from Elliot and Johnston (Elliott and Johnston, 2004) with modifications.
Localisation being implicated in the progression of multiple human cancers (Schultheis et al., 2002; Harris et al., Intracellular, cytoplasm. SOCS2 can be located in 2006; Newton et al., 2010; Iglesias-Gato et al., the nuclear compartment when overexpressed in cell 2014). cultures. Function Homology The function of SOCS proteins rely, on one hand, in HomoloGene (NCBI) Genes identified as putative their ability to bind tyrosine phosphorylated proteins homologs: NP_003868.1 SOCS2, H.sapiens; through their SH2 domains and, on the other hand, XP_001139989.1 SOCS2, P.troglodytes; to bind Elongins B/C through their SOCS box XP_002798772.1 SOCS2, M.mulatta; domains which in turn engages with the XP_005629280.1 SOCS2, C.lupus; NP_803489.1 Cullin5/Rbx2 complex to assemble an E3 ubiquitin SOCS2, B.taurus; NP_001162126.1 Socs2, ligase. M.musculus; NP_478115.1 Socs2, R.norvegicus; SOCS family proteins form part of a classical NP_989871.1 SOCS2, G.gallus; NP_001120898.1 negative feedback system that regulates cytokine socs2, X.tropicalis; NP_001108022.1 socs2, D.rerio signal transduction (Rico-Bautista et al., 2006). Being a substrate recognition module for Mutations Cullin5/Rbx2 E3 ligase complex, SOCS2 is involved in regulating protein turnover by targeting proteins Note for proteasome-mediated degradation. SOCS2 binds There are 8 SNPs in coding regions of human and promote the ubiquitination of the Growth SOCS2 which result in missense protein residues Hormone receptor (GHR) controlling GHR content (NCBI dbSNP). in different tissues (Metcalf et al., 2000; Vesterlund Homozygous null mice display gigantism (Metcalf et al., 2011). et al., 2000), impaired innate immune cell Through the negative regulation of GHR signaling, differentiation and hypersensitivity to infections SOCS2 exerts multiple actions in growth and (Baetz et al., 2004; Yoshimura et al., 2005; metabolisms (Greenhalgh et al., 2005; Zadjali et al., Yoshimura et al., 2007). Homozygous null mice also 2012). display altered metabolic and inflammatory response SOCS2 is also a critical regulator of inflammatory to high fat feeding (Zadjali et al., 2012;). SNP: responses and immune cell differentiation (Machado increasing the risk of type 2 diabetes (Kato et al., et al., 2006; Hu et al., 2009a). Recently, SOCS2 is 2006)
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 342
SOCS2 (suppressor of cytokine signaling 2) Paul I, et al.
Implicated in Breast cancer Note Neural development SOCS2 expression inversely correlates with Note histological grades and is a positive prognostic factor SOCS2 plays a critical role in neuronal development, (Farabegoli et al., 2005; Haffner et al., 2007). growth, and stem cell differentiation (Turnley et al., SOCS2 expression is induced by estrogen receptor 2002). (ER) activity. Estrogen treatment activates ER which in turn upregulates miR-191 which through Inflammation downregulation of SATB1, a global chromatic Note remodeller, enhances SOCS2 transcription (Nagpal SOCS2 deficient dendritic cells and macrophages et al., 2013). Upregulation of SOCS2 upon estrogen are hyper-responsive to microbial stimulation. administration antagonizes growth hormone action SOCS2 deficient animals have uncontrolled mediated through JAK2/STAT3 and STAT5 (Leung production of inflammatory cytokines (IL-12, et al., 2003). IFNγand TNFα ) and succumb to endotoxic shock, Colon cancer polymicrobial sepsis and other microbial infections (Esper et al., 2012). Note SOCS2 plays a central role in differentiation and Both heterozygous and homozygous deletions of maturation of innate immune cells. Specifically, SOCS2 promoted spontaneous tumorigenesis in SOCS2 promotes generation of regulatory dendritic ApcMin/+ mice model of colorectal cancer. This is cells and macrophages (Novak et al., 1999; Jackson accompanied with a dramatic increase in AP-1 DNA et al., 2004; Hu et al., 2012) and Treg population binding (Newton et al., 2010). Acromegalic patients (Knosp et al., 2013). are prone to colonic polyp formation. These patients Conversely, SOCS2 inhibits Th2 differentiation with hyperplastic polyps have increased SOCS2 (Knosp et al., 2011). transcripts (Bogazzi et al., 2009). Upon induced inflammatory challenge, absence of Myeloproliferative disorder SOCS2 has been shown to render multiple immune cell types incapable of mounting anti-inflammatory Note responses. SOCS2 gene is also hypermethylated in Under resting conditions, SOCS2 null animals also myeloproliferative disorders (Zhou et al., 2009; display a population-bias towards a pro- Zhang et al., 2013). SOCS2 is an important negative inflammatory phenotype (Machado et al., 2006; Lee regulator of a constitutive active mutant of JAK2 et al., 2010; Knosp et al., 2011; Posselt et al., 2011; (JAK2 V617F) (Etienne et al., 2007). Hu et al., 2012). Prostate cancer SOCS2 is known to inhibit TGFβ, IL-4, IL-5, IL-10, Note IL-13 and IFNγ signaling (Knosp et al., 2011, Knosp SOCS2 is upregulated at both mRNA and protein et al., 2013). levels in primary prostate cancer tissues relative to In general, SOCS2 inhibits expression/secretion of normal prostate. This upregulation is correlated to pro-inflammatory cytokines and promotes lower Gleason score, absence of metastasis and low generation of regulatory phenotype (anti- PSA failure (Zhu et al., 2013). In contrast, SOCS2 inflammatory) of immune cells. SOCS2 is thought to expression is downregulated in castration resistant function in both MyD88 dependent and independent prostate cancer. This is partly explained by the fact TLR4 signaling pathways because its that SOCS2 is transcriptionally upregulated by downregulation negatively affects SAPK/JNK, p38 androgen receptor and inhibits GH signaling in MAPK, ERK and NFkB signaling (Hu et al., 2009b). prostate (Iglesias-Gato et al., 2014). Being an E3 ligase, SOCS2 regulates a number of proteins highly implicated in regulation of immune Other cancers responses such as FoxP3 (Knosp et al., 2013) and Note TRAF6 (McBerry et al., 2012). SOCS2 also SOCS2 gene is hypermethylated in melanoma and accelerates degradation of other members of the ovarian carcinoma (Marini et al., 2006; Liu et al., SOCS family such as SOCS1 and SOCS3 thus 2008). Lower SOCS2 expressions are also correlated further impinging on downstream STAT signaling to higher grades of hepatocellular carcinoma (Qiu et (Piessevaux et al., 2006; Tannahill et al., 2005). In al., 2013). turn, SOCS2 gene itself is under regulation of various inflammatory signals (e.g., LPS, dioxins, Gigantism LipoxinA4) (Machado et al., 2006; Hu et al., 2009b, Note 2012) and cytokines (e.g.,IL-4, IL-10, IFNβ, IFNγ) SOCS2 null mice are giants but not obese (Metcalf (Knosp et al., 2011; Posselt et al., 2011). et al., 2000). SOCS2 deficient mice have growth and
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 343
SOCS2 (suppressor of cytokine signaling 2) Paul I, et al.
metabolic characteristics that can be related to the suppressor of cytokine signalling (SOCS) 2 in the colonic enhanced GH actions (Rico-Bautista et al., 2005). mucosa of acromegalic patients are associated with hyperplastic polyps. Clin Endocrinol (Oxf). 2009 On the other hand, the gigantic phenotype displayed Jun;70(6):898-906 by SOCS2 null mice is mechanistically different Boverhof DR, Tam E, Harney AS, Crawford RB, Kaminski from that of human acromegalic patients as they do NE, Zacharewski TR. 2,3,7,8-Tetrachlorodibenzo-p-dioxin not exhibit increased circulating IGF-1 levels and induces suppressor of cytokine signaling 2 in murine B cells. seems to express reduced levels of GH (Greenhalgh Mol Pharmacol. 2004 Dec;66(6):1662-70 2005 and Zadjali 2012). Elliott J, Johnston JA. SOCS: role in inflammation, allergy Disease and homeostasis. Trends Immunol. 2004 Aug;25(8):434-40 Gigantism is a condition characterized by excessive Esper L, Roman-Campos D, Lara A, Brant F, Castro LL, growth, significantly above average. This is caused Barroso A, Araujo RR, Vieira LQ, Mukherjee S, Gomes ER, due to an overactivation of growth hormone Rocha NN, Ramos IP, Lisanti MP, Campos CF, Arantes RM, Guatimosim S, Weiss LM, Cruz JS, Tanowitz HB, signaling. Teixeira MM, Machado FS. Role of SOCS2 in modulating Diabetes heart damage and function in a murine model of acute Chagas disease. Am J Pathol. 2012 Jul;181(1):130-40 Note Etienne A, Carbuccia N, Adélaïde J, Bekhouche I, Rémy V, Genomic linkage analysis identified SOCS2 as a Sohn C, Sainty D, Gastaut JA, Olschwang S, Birnbaum D, susceptibility gene for type 2 diabetes in a cohort of Mozziconacci MJ, Chaffanet M. Rearrangements involving Japanese individuals. In the same study, adenovirus- 12q in myeloproliferative disorders: possible role of HMGA2 and SOCS2 genes. Cancer Genet Cytogenet. 2007 Jul mediated expression of the SOCS2 gene in MIN6 1;176(1):80-8 cells or isolated rat islets significantly suppressed glucose-stimulated insulin secretion (Kato et al., Farabegoli F, Ceccarelli C, Santini D, Taffurelli M. Suppressor of cytokine signalling 2 (SOCS-2) expression in 2006). Constitutive SOCS2 expression in mice breast carcinoma. J Clin Pathol. 2005 Oct;58(10):1046-50 pancreatic beta cells interferes with proinsulin processing and leads to decreased insulin secretion Greenhalgh CJ, Rico-Bautista E, Lorentzon M, Thaus AL, Morgan PO, Willson TA, Zervoudakis P, Metcalf D, Street I, (Lebrun et al., 2010). In contrast, SOCS2 null mice Nicola NA, Nash AD, Fabri LJ, Norstedt G, Ohlsson C, does not exhibit obvious defects in pancreatic beta Flores-Morales A, Alexander WS, Hilton DJ. SOCS2 cell function. When challenged with high fat diet negatively regulates growth hormone action in vitro and in SOCS2 null mice are protected from hepatic vivo. J Clin Invest. 2005 Feb;115(2):397-406 steatosis but exhibit an exacerbated inflammatory Haffner MC, Petridou B, Peyrat JP, Révillion F, Müller- response and a worsening of insulin sensitivity as Holzner E, Daxenbichler G, Marth C, Doppler W. Favorable prognostic value of SOCS2 and IGF-I in breast cancer. BMC compared to wild-type mice on a similar diet. Cancer. 2007 Jul 25;7:136 Disease Harris J, Stanford PM, Sutherland K, Oakes SR, Naylor MJ, Diabetes is a condition characterized by high blood Robertson FG, Blazek KD, Kazlauskas M, Hilton HN, Wittlin sugar levels. This is caused due to inadequate insulin S, Alexander WS, Lindeman GJ, Visvader JE, Ormandy CJ. production or insulin resistance. Socs2 and elf5 mediate prolactin-induced mammary gland development. Mol Endocrinol. 2006 May;20(5):1177-87 Osteoarthritis Hu J, Lou D, Carow B, Winerdal ME, Rottenberg M, Note Wikström AC, Norstedt G, Winqvist O. LPS regulates Analysis of SOCS2 null mice has revealed that the SOCS2 transcription in a type I interferon dependent autocrine-paracrine loop. PLoS One. 2012;7(1):e30166 absence of SOCS2 induces a reduction in the trabecular and cortical volumetric bone mineral Hu J, Winqvist O, Flores-Morales A, Wikström AC, Norstedt G. SOCS2 influences LPS induced human monocyte- density (Lorentzon et al., 2005). SOCS2 induces the derived dendritic cell maturation. PLoS One. 2009 Sep differentiation of C2C12 mesenchymal cells into 25;4(9):e7178 myoblasts or osteoblasts (Ouyang et al., 2006). Iglesias-Gato D, Chuan YC, Wikström P, Augsten S, Jiang Disease N, Niu Y, Seipel A, Danneman D, Vermeij M, Fernandez- Osteoarthritis is a condition characterized by Perez L, Jenster G, Egevad L, Norstedt G, Flores-Morales A. SOCS2 mediates the cross talk between androgen and mechanical degeneration of joints resulting in pain growth hormone signaling in prostate cancer. and restricted movement. This is caused due to Carcinogenesis. 2014 Jan;35(1):24-33 hereditary and metabolic reasons. Jackson SH, Yu CR, Mahdi RM, Ebong S, Egwuagu CE. Dendritic cell maturation requires STAT1 and is under References feedback regulation by suppressors of cytokine signaling. J Baetz A, Frey M, Heeg K, Dalpke AH. Suppressor of cytokine signaling (SOCS) proteins indirectly regulate toll- Immunol. 2004 Feb 15;172(4):2307-15 like receptor signaling in innate immune cells. J Biol Chem. 2004 Dec 24;279(52):54708-15 Kato H, Nomura K, Osabe D, Shinohara S, Mizumori O, Katashima R, Iwasaki S, Nishimura K, Yoshino M, Kobori Bogazzi F, Ultimieri F, Raggi F, Russo D, Costa A, Marciano M, Ichiishi E, Nakamura N, Yoshikawa T, Tanahashi T, E, Bartalena L, Martino E. Changes in the expression of Keshavarz P, Kunika K, Moritani M, Kudo E, Tsugawa K,
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 344
SOCS2 (suppressor of cytokine signaling 2) Paul I, et al.
Takata Y, Hamada D, Yasui N, Miyamoto T, Shiota H, Inoue 2 gene disruption promotes Apc(Min/+) tumorigenesis and H, Itakura M. Association of single-nucleotide activator protein-1 activation. Am J Pathol. 2010 polymorphisms in the suppressor of cytokine signaling 2 May;176(5):2320-32 (SOCS2) gene with type 2 diabetes in the Japanese. Genomics. 2006 Apr;87(4):446-58 Novak U, Marks D, Nicholson SE, Hilton D, Paradiso L. Differential ability of SOCS proteins to regulate IL-6 and Knosp CA, Carroll HP, Elliott J, Saunders SP, Nel HJ, Amu CSF-1 induced macrophage differentiation. Growth Factors. S, Pratt JC, Spence S, Doran E, Cooke N, Jackson R, Swift 1999;16(4):305-14 J, Fitzgerald DC, Heaney LG, Fallon PG, Kissenpfennig A, Johnston JA. SOCS2 regulates T helper type 2 Ouyang X, Fujimoto M, Nakagawa R, Serada S, Tanaka T, differentiation and the generation of type 2 allergic Nomura S, Kawase I, Kishimoto T, Naka T. SOCS-2 responses. J Exp Med. 2011 Jul 4;208(7):1523-31 interferes with myotube formation and potentiates osteoblast differentiation through upregulation of JunB in Knosp CA, Schiering C, Spence S, Carroll HP, Nel HJ, C2C12 cells. J Cell Physiol. 2006 May;207(2):428-36 Osbourn M, Jackson R, Lyubomska O, Malissen B, Ingram R, Fitzgerald DC, Powrie F, Fallon PG, Johnston JA, Piessevaux J, Lavens D, Montoye T, Wauman J, Catteeuw Kissenpfennig A. Regulation of Foxp3+ inducible regulatory D, Vandekerckhove J, Belsham D, Peelman F, Tavernier J. T cell stability by SOCS2. J Immunol. 2013 Apr Functional cross-modulation between SOCS proteins can 1;190(7):3235-45 stimulate cytokine signaling. J Biol Chem. 2006 Nov 3;281(44):32953-66 Lebrun P, Cognard E, Gontard P, Bellon-Paul R, Filloux C, Berthault MF, Magnan C, Ruberte J, Luppo M, Pujol A, Posselt G, Schwarz H, Duschl A, Horejs-Hoeck J. Pachera N, Herchuelz A, Bosch F, Van Obberghen E. The Suppressor of cytokine signaling 2 is a feedback inhibitor of suppressor of cytokine signalling 2 (SOCS2) is a key TLR-induced activation in human monocyte-derived repressor of insulin secretion. Diabetologia. 2010 dendritic cells. J Immunol. 2011 Sep 15;187(6):2875-84 Sep;53(9):1935-46 Qiu X, Zheng J, Guo X, Gao X, Liu H, Tu Y, Zhang Y. Lee SH, Yun S, Piao ZH, Jeong M, Kim DO, Jung H, Lee J, Reduced expression of SOCS2 and SOCS6 in Kim MJ, Kim MS, Chung JW, Kim TD, Yoon SR, Greenberg hepatocellular carcinoma correlates with aggressive tumor PD, Choi I. Suppressor of cytokine signaling 2 regulates IL- progression and poor prognosis. Mol Cell Biochem. 2013 15-primed human NK cell function via control of Jun;378(1-2):99-106 phosphorylated Pyk2. J Immunol. 2010 Jul 15;185(2):917- Rico-Bautista E, Flores-Morales A, Fernández-Pérez L. 28 Suppressor of cytokine signaling (SOCS) 2, a protein with Leung KC, Doyle N, Ballesteros M, Sjogren K, Watts CK, multiple functions. Cytokine Growth Factor Rev. 2006 Low TH, Leong GM, Ross RJ, Ho KK. Estrogen inhibits GH Dec;17(6):431-9 signaling by suppressing GH-induced JAK2 Schultheis B, Carapeti-Marootian M, Hochhaus A, Weisser phosphorylation, an effect mediated by SOCS-2. Proc Natl A, Goldman JM, Melo JV. Overexpression of SOCS-2 in Acad Sci U S A. 2003 Feb 4;100(3):1016-21 advanced stages of chronic myeloid leukemia: possible Liu S, Ren S, Howell P, Fodstad O, Riker AI. Identification inadequacy of a negative feedback mechanism. Blood. of novel epigenetically modified genes in human melanoma 2002 Mar 1;99(5):1766-75 via promoter methylation gene profiling. Pigment Cell Tannahill GM, Elliott J, Barry AC, Hibbert L, Cacalano NA, Melanoma Res. 2008 Oct;21(5):545-58 Johnston JA. SOCS2 can enhance interleukin-2 (IL-2) and Lorentzon M, Greenhalgh CJ, Mohan S, Alexander WS, IL-3 signaling by accelerating SOCS3 degradation. Mol Cell Ohlsson C. Reduced bone mineral density in SOCS-2- Biol. 2005 Oct;25(20):9115-26 deficient mice. Pediatr Res. 2005 Feb;57(2):223-6 Turnley AM, Faux CH, Rietze RL, Coonan JR, Bartlett PF. Machado FS, Johndrow JE, Esper L, Dias A, Bafica A, Suppressor of cytokine signaling 2 regulates neuronal Serhan CN, Aliberti J. Anti-inflammatory actions of lipoxin differentiation by inhibiting growth hormone signaling. Nat A4 and aspirin-triggered lipoxin are SOCS-2 dependent. Neurosci. 2002 Nov;5(11):1155-62 Nat Med. 2006 Mar;12(3):330-4 Vesterlund M, Zadjali F, Persson T, Nielsen ML, Kessler Marini A, Mirmohammadsadegh A, Nambiar S, Gustrau A, BM, Norstedt G, Flores-Morales A. The SOCS2 ubiquitin Ruzicka T, Hengge UR. Epigenetic inactivation of tumor ligase complex regulates growth hormone receptor levels. suppressor genes in serum of patients with cutaneous PLoS One. 2011;6(9):e25358 melanoma. J Invest Dermatol. 2006 Feb;126(2):422-31 Vidal OM, Merino R, Rico-Bautista E, Fernandez-Perez L, McBerry C, Gonzalez RM, Shryock N, Dias A, Aliberti J. Chia DJ, Woelfle J, Ono M, Lenhard B, Norstedt G, Rotwein SOCS2-induced proteasome-dependent TRAF6 P, Flores-Morales A. In vivo transcript profiling and degradation: a common anti-inflammatory pathway for phylogenetic analysis identifies suppressor of cytokine control of innate immune responses. PLoS One. signaling 2 as a direct signal transducer and activator of 2012;7(6):e38384 transcription 5b target in liver. Mol Endocrinol. 2007 Jan;21(1):293-311 Metcalf D, Greenhalgh CJ, Viney E, Willson TA, Starr R, Nicola NA, Hilton DJ, Alexander WS. Gigantism in mice Yandava CN, Pillari A, Drazen JM. Radiation hybrid and lacking suppressor of cytokine signalling-2. Nature. 2000 cytogenetic mapping of SOCS1 and SOCS2 to Jun 29;405(6790):1069-73 chromosomes 16p13 and 12q, respectively. Genomics. 1999 Oct 1;61(1):108-11 Nagpal N, Ahmad HM, Molparia B, Kulshreshtha R. Yoshimura A, Naka T, Kubo M. SOCS proteins, cytokine MicroRNA-191, an estrogen-responsive microRNA, signalling and immune regulation. Nat Rev Immunol. 2007 functions as an oncogenic regulator in human breast Jun;7(6):454-65 cancer. Carcinogenesis. 2013 Aug;34(8):1889-99 Zadjali F, Santana-Farre R, Vesterlund M, Carow B, Newton VA, Ramocki NM, Scull BP, Simmons JG, Mirecki-Garrido M, Hernandez-Hernandez I, Flodström- McNaughton K, Lund PK. Suppressor of cytokine signaling- Tullberg M, Parini P, Rottenberg M, Norstedt G, Fernandez-
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 345
SOCS2 (suppressor of cytokine signaling 2) Paul I, et al.
Perez L, Flores-Morales A. SOCS2 deletion protects Zhu JG, Dai QS, Han ZD, He HC, Mo RJ, Chen G, Chen against hepatic steatosis but worsens insulin resistance in YF, Wu YD, Yang SB, Jiang FN, Chen WH, Sun ZL, Zhong high-fat-diet-fed mice. FASEB J. 2012 Aug;26(8):3282-91 WD. Expression of SOCSs in human prostate cancer and their association in prognosis. Mol Cell Biochem. 2013 Zhang MY, Fung TK, Chen FY, Chim CS. Methylation Sep;381(1-2):51-9 profiling of SOCS1, SOCS2, SOCS3, CISH and SHP1 in Philadelphia-negative myeloproliferative neoplasm. J Cell This article should be referenced as such: Mol Med. 2013 Oct;17(10):1282-90 Paul I, Fernández-Pérez L, Flores-Morales A. SOCS2 Zhou J, Bi C, Janakakumara JV, Liu SC, Chng WJ, Tay (suppressor of cytokine signaling 2). Atlas Genet KG, Poon LF, Xie Z, Palaniyandi S, Yu H, Glaser KB, Albert Cytogenet Oncol Haematol. 2016; 20(6):341-346. DH, Davidsen SK, Chen CS. Enhanced activation of STAT pathways and overexpression of survivin confer resistance to FLT3 inhibitors and could be therapeutic targets in AML. Blood. 2009 Apr 23;113(17):4052-62
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 346
Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Leukaemia Section Short Communication der(18)t(1;18)(q10-25;q11-23) Adriana Zamecnikova, Soad Al Bahar Kuwait Cancer Control Center, Laboratory of Cancer Genetics, Department of Hematology, Shuwaikh, 70653, Kuwait
Published in Atlas Database: June 2015 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t118q10q11ID1655.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62944/06-2015-t118q10q11ID1655.pdf DOI: 10.4267/2042/62944 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Abstract Etiology Myeloid neoplasms: a 64 year old female with Review on der(18)t(1;18)(q10-25;q11-23) refractory anemia and 4 patients with AML (1 translocation, with data on clinics and cytogenetics. female infant with Down syndrome and 3 adults (2 males, 1 female; aged 21 to 66 years). Acute Clinics and pathology lymphoblastic leukemia: a 2 years old female infant with Down syndrome and 3 adults (2 males and 1 Disease female; aged 43 to 70 years). Multiple myeloma: Acute myeloid leukemia (AML), acute lymphocycic female prevalence (1 male, 10 females) and 12 leukemia (ALL), multiple myeloma (MM) and patients with various lymphoid malignancies: (6 lymphoid neoplasms males, 6 females; aged 34 to 70 years) Phenotype/cell stem origin Epidemiology Pluripotent. 32 cases to date; 11 male and 21 female patients aged 1-70 yrs (Table 1)
Partial karyotypes with der(18)t(1;18)(q10;q11)
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 347 der(18)t(1;18)(q10-25;q11-23) Zamecnikova A, Al Bahar S
Table 1: Part 1 - Abbreviations: M, male; F, female; MDS, myelodysplastic syndrome; AML, acute myeloid leukemia; MM, multiple myeloma; DLBCL, diffuse large B-cell lymphoma; FL, follicular lymphoma; MCL, mantle cell lymphoma; PT LPD, post- transplant lymphoproliferative disorder; BL, Burkitt lymphoma/leukemia; ALCL, anaplastic large cell lymphoma; ATLL, adult T- cell lymphoma/leukemia. References: 1. GFCH (Groupe Francais de Cytogénétique Hématologique), 1988; 2. Misawa et al., 1988; 3. Geddes et al.,1990; 4. Zamecnikova et al., 2002; 5. Farag et al., 2006; 6. Heerema et al., 1998; 7. Brozek et al., 1999; 8. Lee et al., 2002; 9. Manola et al., 2008; 10. Brigaudeau et al., 1997; 11. Sawyer et al., 1998; 12. Le Baccon et al., 2001; 13. Mohammed et al., 2007; 14-20. Sawyer et al., 2014; 21. Koduru et al., 1987; 22. Slavutsky et al., 1987; 23. Ott et al., 1998; 24. Rosenwald et al., 1999; 25. Le Baccon et al., 2001; 26. Katzenberger et al., 2004; 27. Djokic et al., 2006; 28-29. Johnson et al., 2008; 30. Salaverria et al., 2008; 31. Havelange et al., 2013; 32. Narayan et al., 2013. CLINICS
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 348
der(18)t(1;18)(q10-25;q11-23) Zamecnikova A, Al Bahar S
Table 1: Part 2 - Abbreviations: M, male; F, female; MDS, myelodysplastic syndrome; AML, acute myeloid leukemia; MM, multiple myeloma; DLBCL, diffuse large B-cell lymphoma; FL, follicular lymphoma; MCL, mantle cell lymphoma; PT LPD, post- transplant lymphoproliferative disorder; BL, Burkitt lymphoma/leukemia; ALCL, anaplastic large cell lymphoma; ATLL, adult T- cell lymphoma/leukemia. References: 1. GFCH (Groupe Francais de Cytogénétique Hématologique), 1988; 2. Misawa et al., 1988; 3. Geddes et al.,1990; 4. Zamecnikova et al., 2002; 5. Farag et al., 2006; 6. Heerema et al., 1998; 7. Brozek et al., 1999; 8. Lee et al., 2002; 9. Manola et al., 2008; 10. Brigaudeau et al., 1997; 11. Sawyer et al., 1998; 12. Le Baccon et al., 2001; 13. Mohammed et al., 2007; 14-20. Sawyer et al., 2014; 21. Koduru et al., 1987; 22. Slavutsky et al., 1987; 23. Ott et al., 1998; 24. Rosenwald et al., 1999; 25. Le Baccon et al., 2001; 26. Katzenberger et al., 2004; 27. Djokic et al., 2006; 28-29. Johnson et al., 2008; 30. Salaverria et al., 2008; 31. Havelange et al., 2013; 32. Narayan et al., 2013. CLINICS
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 349
der(18)t(1;18)(q10-25;q11-23) Zamecnikova A, Al Bahar S
Heerema NA, Sather HN, Sensel MG, Kraft P, Nachman JB, Prognosis Steinherz PG, Lange BJ, Hutchinson RS, Reaman GH, Unknown; likely unfavorable in cases with complex Trigg ME, Arthur DC, Gaynon PS, Uckun FM. Frequency and clinical significance of cytogenetic abnormalities in karyotypes. pediatric T-lineage acute lymphoblastic leukemia: a report from the Children's Cancer Group. J Clin Oncol. 1998 Cytogenetics Apr;16(4):1270-8 Johnson NA, Al-Tourah A, Brown CJ, Connors JM, Cytogenetics morphological Gascoyne RD, Horsman DE. Prognostic significance of Found as -18, + der(18)t(1;18)(q10-25;q11-23) with secondary cytogenetic alterations in follicular lymphomas. 2 normal chromosomes 1, a normal chromosome 18 Genes Chromosomes Cancer. 2008 Dec;47(12):1038-48 and a der(18) chromosome. Breakpoints in 1q were Katzenberger T, Ott G, Klein T, Kalla J, Müller-Hermelink clustering to 1q21-23; the 18q breaks occurred HK, Ott MM. Cytogenetic alterations affecting BCL6 are predominantly found in follicular lymphomas grade 3B with mostly in 18q21-23 region. a diffuse large B-cell component. Am J Pathol. 2004 Additional anomalies Aug;165(2):481-90 May be associated with known anomalies such as Koduru PR, Filippa DA, Richardson ME, Jhanwar SC, Chaganti SR, Koziner B, Clarkson BD, Lieberman PH, t(8;21)(q22;q22) or +8 in AML and t(9;22)(q34;q11) Chaganti RS. Cytogenetic and histologic correlations in in ALL; part of complex karyotypes in MM. malignant lymphoma. Blood. 1987 Jan;69(1):97-102 Associated with 14q32 rearrangements, (8 cases); +7 Le Baccon P, Leroux D, Dascalescu C, Duley S, Marais D, (4 cases), -X/+X (5 cases) and chromosome X Esmenjaud E, Sotto JJ, Callanan M. Novel evidence of a anomalies (3 cases) in lymphoid malignancies. role for chromosome 1 pericentric heterochromatin in the pathogenesis of B-cell lymphoma and multiple myeloma. To be noted Genes Chromosomes Cancer. 2001 Nov;32(3):250-64 Lee S, Kim DW, Kim YJ, Park YH, Min CK, Lee JW, Min The unbalanced der(18)t(1;18)(q10-25;q11-23) WS, Kim CC. Influence of karyotype on outcome of results in partial trisomy for the 1q segment and loss allogeneic bone marrow transplantation for adults with of genes from 18q leading to gene dosage precursor B-lineage acute lymphoblastic leukaemia in first or second remission. Br J Haematol. 2002 Apr;117(1):109- abnormalities. May be detected in both hematologic 18 neoplasms and lymphoid malignancies. Found in association with known primary anomalies in acute Manola KN, Georgakakos VN, Stavropoulou C, Spyridonidis A, Angelopoulou MK, Vlachadami I, leukemias, indicating that this aberration is mostly a Katsigiannis A, Roussou P, Pantelias GE, Sambani C. secondary event representing clonal evolution. Jumping translocations in hematological malignancies: a Frequent chromosomal change in multiple myeloma cytogenetic study of five cases. Cancer Genet Cytogenet. and lymphoid neoplasms, where it is part of complex 2008 Dec;187(2):85-94 karyotypes associated with tumor progression Misawa S, Yashige H, Horiike S, Taniwaki M, Nishigaki H, advanced disease. Okuda T, Yokota S, Tsuda S, Edagawa J, Imanishi H. Detection of karyotypic abnormalities in most patients with acute nonlymphocytic leukemia by adding ethidium bromide References to short-term cultures. Leuk Res. 1988;12(9):719-29 Brigaudeau C, Trimoreau F, Gachard N, Rouzier E, Jaccard Mohamed AN, Bentley G, Bonnett ML, Zonder J, Al-Katib A. A, Bordessoule D, Praloran V. Cytogenetic study of 30 Chromosome aberrations in a series of 120 multiple patients with multiple myeloma: comparison of 3 and 6 day myeloma cases with abnormal karyotypes. Am J Hematol. bone marrow cultures stimulated or not with cytokines by 2007 Dec;82(12):1080-7 using a miniaturized karyotypic method. Br J Haematol. 1997 Mar;96(3):594-600 Narayan G, Xie D, Freddy AJ, Ishdorj G, Do C, Satwani P, Liyanage H, Clark L, Kisselev S, Nandula SV, Scotto L, Brozek I, Babińska M, Limon J, Zaborowska-Sołtys M, Alobeid B, Savage D, Tycko B, O'Connor OA, Bhagat G, Płoszyńska A, Balcerska A. A second known case of Down Murty VV. PCDH10 promoter hypermethylation is frequent syndrome with t(1;18)(q25;q23) in leukemic cells. Cancer in most histologic subtypes of mature lymphoid Genet Cytogenet. 1999 Apr 15;110(2):136-7 malignancies and occurs early in lymphomagenesis. Genes Chromosomes Cancer. 2013 Nov;52(11):1030-41 . Cytogenetic findings in leukemic cells of 56 patients with constitutional chromosome abnormalities. A cooperative Ott G, Katzenberger T, Siebert R, DeCoteau JF, Fletcher study. Groupe Français de Cytogénétique Hématologique. JA, Knoll JH, Kalla J, Rosenwald A, Ott MM, Weber- Cancer Genet Cytogenet. 1988 Oct 15;35(2):243-52 Matthiesen K, Kadin ME, Müller-Hermelink HK. Chromosomal abnormalities in nodal and extranodal CD30+ Djokic M, Le Beau MM, Swinnen LJ, Smith SM, Rubin CM, anaplastic large cell lymphomas: infrequent detection of the Anastasi J, Carlson KM. Post-transplant lymphoproliferative t(2;5) in extranodal lymphomas. Genes Chromosomes disorder subtypes correlate with different recurring Cancer. 1998 Jun;22(2):114-21 chromosomal abnormalities. Genes Chromosomes Cancer. 2006 Mar;45(3):313-8 Rosenwald A, Ott G, Katzenberger T, Siebert R, Kalla J, Kuse R, Ott MM, Müller-Hermelink HK, Schlegelberger B. Geddes AA, Bowen DT, Jacobs A. Clonal karyotype Jumping translocation of 1q as the sole aberration in a case abnormalities and clinical progress in the myelodysplastic of follicular lymphoma. Cancer Genet Cytogenet. 1999 Jan syndrome. Br J Haematol. 1990 Oct;76(2):194-202 1;108(1):53-6
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 350
der(18)t(1;18)(q10-25;q11-23) Zamecnikova A, Al Bahar S
Salaverria I, Espinet B, Carrió A, Costa D, Astier L, Slotta- multiple myeloma: a novel mechanism for deletion of 17p in Huspenina J, Quintanilla-Martinez L, Fend F, Solé F, cytogenetically defined high-risk disease. Blood. 2014 Apr Colomer D, Serrano S, Miró R, Beà S, Campo E. Multiple 17;123(16):2504-12 recurrent chromosomal breakpoints in mantle cell lymphoma revealed by a combination of molecular Slavutsky I, Labal de Vinuesa M, Estévez ME, Sen L, cytogenetic techniques. Genes Chromosomes Cancer. Dupont J, Larripa I. Chromosome studies in human 2008 Dec;47(12):1086-97 hematologic diseases: non-Hodgkin's lymphomas. Haematologica. 1987 Jan-Feb;72(1):29-37 Sawyer JR, Lukacs JL, Munshi N, Desikan KR, Singhal S, Mehta J, Siegel D, Shaughnessy J, Barlogie B. Identification Zámecníkova A, Vranovský A, Gyarfás J. Acute of new nonrandom translocations in multiple myeloma with myelomonocytic leukemia with t(1;18) in an adult patient. multicolor spectral karyotyping. Blood. 1998 Dec Cancer Genet Cytogenet. 2002 Mar;133(2):185-6 1;92(11):4269-78 This article should be referenced as such: Sawyer JR, Tian E, Heuck CJ, Epstein J, Johann DJ, Swanson CM, Lukacs JL, Johnson M, Binz R, Boast A, Zamecnikova A, Al Bahar S. der(18)t(1;18)(q10-25;q11- Sammartino G, Usmani S, Zangari M, Waheed S, van Rhee 23). Atlas Genet Cytogenet Oncol Haematol. 2016; F, Barlogie B. Jumping translocations of 1q12 in 20(6):347-351.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 351 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Cancer Prone Disease Section Review
Oculocutaneous Albinism Kunal Ray, Mainak Sengupta, Kausik Ganguly Academy of Scientific and Innovative Research (AcSIR), New Delhi # (KR); Department of Genetics, University of Calcutta, Kolkata (MS, KG), India. [email protected]; [email protected]; [email protected]
Published in Atlas Database: April 2015 Online updated version : http://AtlasGeneticsOncology.org/Kprones/OculocutaneousAlbinismID10022 Essai.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62945/04-2015-OculocutaneousAlbinismID10022.pdf DOI: 10.4267/2042/62945 This article is an update of : Ray K, Sengupta M. Oculocutaneous Albinism. Atlas Genet Cytogenet Oncol Haematol 2013;17(1)
This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2016 Atlas of Genetics and Cytogenetics in Oncology and Haematology
(King et al., 2001) but is very uncommon among Abstract African-Americans. Review on oculocutaneous albinism, with data on The overall prevalence of OCA2 is estimated to be clinics, and the genes involved. 1:36000 in USA, but it is a lot more common among the African Americans with a prevalence of 1:10000 Identity (Okoro, 1975). In fact, OCA2 affects 1 in 3900 of the population in the southern parts of Africa. Other names OCA3 or Rufous oculocutaneous albinism has been Albinism, Oculocutaneous Albinism type 1 (OCA1) estimated to affect 1:8500 individuals in Africa; Oculocutaneous Albinism type 2 (OCA2) however, it is very rare in any other populations as Oculocutaneous Albinism type 3 (OCA3) per published literature. OCA4 has been found to be Oculocutaneous Albinism type 4 (OCA4) the second largest rare form of albinism after OCA1 Oculocutaneous Albinism type 5 (OCA5) in Japan. The 3 other forms of OCA are very rare. Oculocutaneous Albinism type 6 (OCA6) There is a single report till date for OCA5 in a Oculocutaneous Albinism type 7 (OCA7) consanguineous Pakistani family [Kausar et al., Tyrosinase-Negative Albinism 2013]. A few distinct cases of SLC24A5 mediated Tyrosinase-Positive Albinism OCA6 - one from India, one from China, two Note patients from France, three from Portugal, one from Oculocutaneous Albinism (OCA) is a group of Belgium and one from Syria, have been reported till congenital developmental disorder characterized by date [Mondal et al., 2012; Wei et al., 2013; Fanny et complete or partial loss of melanin in skin, hair and al., 2014]. Nine Faroese patients and one Danish eye. OCA is caused due to defects in genes patient of Lithuanian origin harbored mutations in associated with melanin biosynthetic pathway. C10ORF11 gene representing OCA7 [ Gronskov et Depending on the gene mutated, OCA can be al., 2014]. classified into Oculocutaneous Albinism type 1 It is worth mentioning that in countries like India (OCA1), Oculocutaneous Albinism type 2 (OCA2), where endogamy prevails, the incidence of OCA Oculocutaneous Albinism type 3 (OCA3) and would be higher than the world average. In fact, in Oculocutaneous Albinism type 4 (OCA4), India, a preponderance of homozygous mutations is Oculocutaneous Albinism type 5 (OCA5), found and OCA1 is caused majorly because of Oculocutaneous Albinism type 6 (OCA6) and founder mutations (Chaki et al., 2005; Chaki et al. Oculocutaneous Albinism type 7 (OCA7). OCA1 2006). affects 1 per 40000 individuals in most populations Inheritance
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 352 Oculocutaneous Albinism Ray K, et al.
OCA is inherited in an autosomal recessive mode. OCA1 can be sub-classified into two categories - (a) However, recently, it has been hypothesized that the OCA1A: when the tyrosinase enzyme activity is clinical spectrum of OCA depends on the completely lacking, and (b) OCA1B: when some pigmentation threshold of the patient. In residual activity is retained. The visual acuity of the genotypically darker complexion individuals such as OCA1A patients is greatly reduced; the degree of in Africans, two mutations are needed to completely nystagmus, strabismus, photophobia are usually shut off the high pigmentation background; whereas severe and the translucent iris that appear pink early in individuals with lighter complexion such as in life, often become gray-blue with age. In case of Caucasians, OCA can be manifested by the presence OCA1A there is an absence of pigmentation of one mutation and one hypomorphic allele (Chiang throughout the patient's life. In contrast, in OCA1B, et al., 2008). although there is little or no apparent melanin at birth, progressive melanization might occur with Clinics time. The range of pigmentation in OCA1B varies from little cutaneous pigment to nearly normal skin OCA is characterized by partial or total absence of color and the phenotype is often influenced by melanin in the skin, hair and eyes at birth. The ethnicity. OCA1B is called 'yellow OCA' due to the absence of optimum content of melanin during color of the hair, produced by pheomelanin embryogenesis acts as a cue to trigger defects in eye synthesis. development that cannot be corrected. A portion of the retinal ganglion cell (RGC) axons, originally Neoplastic risk destined to the ipsilateral hemisphere of the dorsal The loss of pigment often leads to non-melanotic lateral geniculate nuclei (dLGN) of the midbrain, skin cancers in form of Squamous Cell Carcinoma misproject to the contralateral side, thereby resulting (SCC) and Basal Cell Carcinoma (BCC) (Mabula et in the disruption of binocular vision (Lund, 1965; al., 2012). Melanoma is rare in albino patients Guillery, 1971; Cooper and Pettigrew, 1979; Drager (Pehamberger et al., 1984). and Olsen, 1980; Lavado and Montoliu, 2006). The developmental defect concerned with abnormal Treatment nerve fibre projection has been discussed in details No specific treatment is available for OCA. in a review by Ray et al., 2007 (Ray et al., 2007). Attention must be paid to avoidance of direct sun Phenotype and clinics exposure. The reduction of melanin in peripheral retina results Evolution in a stereoscopic set of developmental defects in OCA1B patients although are born with almost no neuronal migration in the visual pathways leading to pigmentation, show a progressive melanization with foveal hypoplasia, abnormal routing of the nerve age. fibers from the eye to brain with consequent low Prognosis vision (reduced visual acuity usually in the range 20/60 to 20/400 and refractive errors), photophobia, With proper protection from direct exposure from iris transillumination, nystagmus and strabismus. An sun and visual aids like dome magnifiers, reading OCA affected person is considered legally blind if glasses, hand-held and stand magnifiers, patients he/she has a visual acuity of 20/200 (6/60) or less. should be able to lead a normal life. The degree of severity of the eye features as well as skin pigmentation varies with the different subtypes Genes involved and of albinism. Due to loss of pigmentation, the iris proteins looks hazel or light blue or in extreme cases as in OCA1, it is translucent to such an extent that it Note appears pink or red in ambient light. The skin OCA can be classified into seven major types viz. remains white or only become slightly pigmented Oculocutaneous Albinism type 1 (OCA1), with time in case of OCA1 whereas the patients Oculocutaneous Albinism type 2 (OCA2), suffering from the other 3 types of albinism have Oculocutaneous Albinism type 3 (OCA3) and residual pigmentation and look pinkish or yellowish. Oculocutaneous Albinism type 4 (OCA4), If unprotected from sun rays, hypopigmented skin in Oculocutaneous Albinism type 5 (OCA5), the albinistic individuals may develop erythema. Oculocutaneous Albinism type 6 (OCA6) and Moreover, the reduction in melanin pigment in the Oculocutaneous Albinism type 7 (OCA7). Each of skin results in an increased sensitivity to UV induced the classical subtypes is caused due to defects in 7 skin damage and subsequently non-melanotic skin different genes independently. Table 1 shows the cancers. genes involved in OCA: It must be stated here that based on the severity of pigment loss, the most severe form of OCA viz.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 353
Oculocutaneous Albinism Ray K, et al.
Table 1: Causal genes and specific symptoms for 7 classical OCA syndromes.
NP_000363.1) composed of 529 amino acids. TYR TYR is a melanosomal membrane bound glycoenzyme Alias with a type-3 copper active site. Monophenol monooxygenase, SHEP3, Tumor The mature TYR polypeptide includes an 18-amino rejection antigen AB, LB24-AB, SK29-AB. acid long N-terminal signal peptide, six N- glycosylation sites, two copper binding sites (CuA Location and CuB) and one transmembrane (TM) domain 11q14.3 followed by a relatively short carboxyl tail. Note Expression TYR codes for Tyrosinase protein, the rate limiting TYR is mainly expressed in two cell types: (a) enzyme of melanin biosynthetic pathway. Melanocytes that are derived from neural crest cells DNA/RNA colonizing within iris, cochlea, skin and choroids, Description and (b) Retinal pigment epithelial (RPE) cells that The human tyrosinase gene consists of 5 exons and are derived from the optic cup. During mouse spans about 65 kb of the genome. embryogenesis, the expression of TYR could be first detected from +16.5 days post coitum onwards in the Transcription skin melanocytes and from +10.5 days postcoitum It encodes a 2082 bp transcript (Accession No: onwards in the RPE cells (Beermann et al., 1992). NM_000372.4). Localisation Pseudogene TYR is a melanosomal membrane protein and the TYR-like segment (TYRL, 11p11.2, MIM 191270) TM region anchors the bulk of the protein inside the is a pseudogene of TYR, which contains sequences melanosomal lumen. very similar to exons IV and V of TYR gene. It is hypothesized that duplication of TYR exons IV Function and V regions followed by 11q:11p translocation has TYR catalyzes the rate limiting steps of melanin given rise to the TYRL segment. biosynthesis viz. hydroxylation of L-tyrosine to L- DOPA and oxidation of L-DOPA to DOPAquinone. Protein It also catalyzes the conversion of 5,6 Description dihydroxyindole to Indole 5,6 Quinone and TYR (monophenol monoxygenase EC 1.14.18.1) 5,6,dihydroxyindole carboxylic acid to Indole 5,6 encodes a ~80 kDa glycoprotein (Accession No: quinone carboxylic acid.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 354
Oculocutaneous Albinism Ray K, et al.
Homology include: a) normal biogenesis of melanosomes TYR, Tyrosinase Related Protein 1 (TYRP1) and (Rosemblat et al., 1998; Orlow and Brilliant et al., Tyrosinase Related Protein 2 (TYRP2/DCT) 1999); b) for normal processing and transport of represent a family of closely related gene products tyrosinase and other melanosomal proteins (Puri et (with almost 40% amino acid identity) that share a al., 2000; Manga et al., 2001; Toyofuku et al., 2002; common tertiary structure (Jimenez-Cervantes et al., Chen et al., 2002); and c) maintenance of an acidic 1998; Kobayashi et al., 1998). These have been pH in melanosomes (Ni-Komatsu and Orlow, 2006). grouped together to form the TYRP family of genes. Homology Mutations Its sequence predicts that OCA2 has a homology to a superfamily of permeases (Rinchik et al., 1993; Germinal Lee et al., 1995). TYR mutations are responsible for OCA1. A few Mutations OCA2 mutations have been associated with Germinal autosomal recessive ocular albinism (AROA). OCA2 mutations are responsible for OCA2. A few OCA1 is an endoplasmic reticulum retention (ER) OCA2 mutations have been associated with disorder and all the missense mutations that have autosomal recessive ocular albinism (AROA) too. been functionally characterized have yielded ER - retained proteins. TYRP1 (tyrosinase-related protein 1) OCA2 (OCA2 melanosomal Alias transmembrane protein) RP11-3L8.1, CAS2, CATB, GP75, SHEP11, TRP, TYRP, b-PROTEIN Alias Location P, Pink-eyed dilution protein homolog, D15S12, 9p23 Melanocyte-specific transporter protein, EYCL, Note EYCL2, EYCL3, BOCA, BEY, BEY1, BEY2, TYRP1 codes for TYRP1 protein, hypothesized to HCL3, PED, SHEP1, oculocutaneous albinism II be involved in melanin synthesis, stabilization of (pink-eye dilution (murine) homolog)1 tyrosinase and modulating its catalytic activity, Location maintenance of melanosome structure and affects 15q12 melanocyte proliferation and melanocyte cell death. Note Defects in this gene are the cause of rufous OCA2 codes for OCA2 protein, hypothesized to be oculocutaneous albinism and oculocutaneous involved in the transport of tyrosine, the precursor to albinism type III. melanin synthesis, within the melanocyte. DNA/RNA DNA/RNA Description Description The human TYRP1 gene consists of 8 exons and The human OCA2 gene consists of 24 exons and spans ~24.8 kb of the genome. spans ~344.5 kb of the genome. Transcription Transcription It encodes a 2876 bp transcript (Accession No: It encodes a 3154 bp transcript (Accession No: NM_000550.2). NM_000275.2). Protein Protein Description Description TYRP1 encodes a 60.7 kDa protein (Accession No: OCA2 encodes a ~110 kDa protein (Accession No: NP_000541.1) composed of 537 amino acids. The NP_000266.2) composed of 838 amino acids. The TYRP1 protein is thought to be a melanosomal OCA2 protein is thought to be a melanosomal membrane single-pass type I membrane protein. multipass integral membrane protein (with 12 Expression predicted transmembrane domains) involved in TYRP1, similar to TYR, is mainly expressed in two small molecule transport, specifically tyrosine - a cell types: (a) Melanocytes that are derived from precursor of melanin. neural crest cells colonizing within iris, cochlea, skin Expression and choroids, and (b) Retinal pigment epithelial Due to its localization in the melanosomal (RPE) cells that are derived from the optic cup. membrane, OCA2 is thought to be expressed in the Localisation melanocytes. TYRP1 is hypothesized to be localized in Localisation melanosome membrane. OCA2 is hypothesized to be present in the Function melanosomal membrane of the melanocytes. Oxidation of 5,6-dihydroxyindole-2-carboxylic acid Function (DHICA) into indole-5,6-quinone-2-carboxylic acid. The precise function of OCA2 has not been May regulate or influence the type of melanin elucidated till date. However, the potential functions synthesized.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 355
Oculocutaneous Albinism Ray K, et al.
Homology This chromosomal locus harbors 14 genes, none of Belongs to the tyrosinase family. Homologous to which are directly responsible for melanin murine brown locus. biosynthesis Mutations DNA/RNA Germinal Description TYRP1 mutations are responsible for OCA3. 4q24 harbors 14 genes (CENPE, TACR3, CXXC4, SLC45A2 (solute carrier family 45 TET2, PPA2, INTS12, GSTCD, NPNT, AIMP1, DKK2, PAPSS1, SGMS2, CYP2U1, HADH) with member 2) linkage interval of 3.84Mb. Alias Transcription Membrane associated transporter protein, MATP, The underlying gene causing OCA5 has not yet been MELANOMA ANTIGEN AIM1, AIM1 identified. Location Protein 5p13.2 Function Note 4q24 is a chromosomal locus harbouring about 14 SLC45A2 codes for SLC45A2 protein, hypothesized genes in it with a linkage interval of 3.84 Mb. to be involved in the transport of substances required Though none of those 14 genes are known to have for melanin biosynthesis within the melanocyte. any role in melanin synthesis, but studies are being DNA/RNA done to ascertain the role of this locus and to identify Description the underlying gene. The human SLC45A2 gene consists of 7 exons and Mutations spans 40.1 kb of the genome. Germinal Transcription Though inheritance indicates germinal origin of the It encodes a 1734 bp transcript (Accession No: mutations, the causal gene is yet to be recognized. NM_016180.3). SLC24A5 (solute carrier family 24 Protein Description (sodium/potassium/calcium SLC45A2 encodes a ~58 kDa protein (Accession exchanger), member 5) No: NP_057264.3) and composed of 530 amino Alias acids. The protein is thought to be a melanosomal Solute Carrier Family 24 multipass membrane protein (contains 12 putative (Sodium/Potassium/Calcium Exchanger), Member transmembrane domains) involved in small 5, JSX, OCA6 molecule transport. Location Expression 15q21.1 Expressed in most melanoma cell lines and Note melanocytes. SLC24A5 codes for a cation exchanger which is Localisation probably involved in ion transport in melanosomes. SLC45A2 is hypothesized to be present in the DNA/RNA melanosomal membrane of the melanocytes. Description Function The human SLC24A5 gene consists of 5 exons and The precise function of SLC45A2 has not been spans 21.701 kb of the genome elucidated till date. Studies on Medaka fish show Transcription that the SLC45A2/MATP plays an important role in This gene has 4 transcripts (splice variants), three of pigmentation and probably functions as a membrane which either skips an exon or are truncated versions. transporter in melanosomes (Fukamachi et al., The actual protein coding transcript is 1617 bp long 2001). (NM_205850.2). Homology Protein Belongs to the glycoside-pentoside-hexuronide Description (GPH) cation symporter transporter (TC 2.A.2) SLC24A5 codes for a cation exchanger which is 500 family. amino acid long (NP_995322). This protein is an Mutations intracellular potassium-dependent sodium/calcium Germinal exchanger with 2 large hydrophilic loops and 2 sets SLC45A2 mutations are responsible for OCA4. of multiple trans-membrane-spanning segments. Oculocutaneous Albinism 5 Expression (Autosomal Recessive) Due to its localization in the melanosomal membrane, OCA2 is thought to be expressed in the Location melanocytes. 4q24 Localisation Note
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 356
Oculocutaneous Albinism Ray K, et al.
SLC24A5 is hypothesized to be present in the trans- C10ORF11 mutations are responsible for OCA7. Golgi network of melanocytes. Function References The precise function of SLC24A5 has not been Beermann F, Schmid E, Schütz G. Expression of the mouse elucidated till date. However, the potential functions tyrosinase gene during embryonic development: include: (a) transporting 1 Ca2+ and 1 K+ to the recapitulation of the temporal regulation in transgenic mice. melanosome in exchange for 4 cytoplasmic Na+ Proc Natl Acad Sci U S A. 1992 Apr 1;89(7):2809-13 [Lamason RL et al., 2005]; (b) Influencing natural Chaki M, Mukhopadhyay A, Chatterjee S, Das M, Samanta variation in skin pigmentation via a novel, unknown S, Ray K. Higher prevalence of OCA1 in an ethnic group of mechanism affecting cellular sterol levels [Wilson S eastern India is due to a founder mutation in the tyrosinase et al., 2013]. gene. Mol Vis. 2005 Jul 19;11:531-4 Homology Chaki M, Sengupta M, Mukhopadhyay A, Subba Rao I, It belongs to Solute Carrier Family 24 Majumder PP, Das M, Samanta S, Ray K. OCA1 in different ethnic groups of india is primarily due to founder mutations (http://www.guidetopharmacology.org/GRAC/Fami in the tyrosinase gene. Ann Hum Genet. 2006 Sep;70(Pt lyDisplayForward?familyId=202). 5):623-30 Mutations Chen K, Manga P, Orlow SJ. Pink-eyed dilution protein Germinal controls the processing of tyrosinase. Mol Biol Cell. 2002 SLC24A5 mutations are responsible for OCA6. Jun;13(6):1953-64 LRMDA (leucine rich melanocyte Chiang PW, Spector E, Tsai AC. Oculocutaneous albinism differentiation associated) spectrum. Am J Med Genet A. 2009 Jul;149A(7):1590-1 Cooper ML, Pettigrew JD. The retinothalamic pathways in Alias Siamese cats. J Comp Neurol. 1979 Sep 15;187(2):313-48 Chromosome 10 Open Reading Frame, OCA7 Location Dräger UC, Olsen JF. Origins of crossed and uncrossed retinal projections in pigmented and albino mice. J Comp 10q22.3 Neurol. 1980 Jun;191(3):383-412 Note C10Orf11 codes for a leucine rich repeat containing Fukamachi S, Shimada A, Shima A. Mutations in the gene encoding B, a novel transporter protein, reduce melanin protein. content in medaka. Nat Genet. 2001 Aug;28(4):381-5 DNA/RNA Grønskov K, Dooley CM, Østergaard E, Kelsh RN, Hansen Description L, Levesque MP, Vilhelmsen K, Møllgård K, Stemple DL, The human C10ORF11 gene consists of 6 exons and Rosenberg T. Mutations in c10orf11, a melanocyte- spans 959 kb of the genome. differentiation gene, cause autosomal-recessive albinism. Transcription Am J Hum Genet. 2013 Mar 7;92(3):415-21 C10ORF11 encodes 16 splice variants of which 4 are Guillery RW. An abnormal retinogeniculate projection in the protein coding and rest are processed transcripts. Of albino ferret (Mustela furo). Brain Res. 1971 Oct those 16, transcript variant 2 (Accession No: 29;33(2):482-5 NM_032024.4) is 909 bp long and codes for a 198 Jiménez-Cervantes C, Martínez-Esparza M, Solano F, amino acids long peptide. Lozano JA, García-Borrón JC. Molecular interactions within the melanogenic complex: formation of heterodimers of Protein tyrosinase and TRP1 from B16 mouse melanoma. Biochem Description Biophys Res Commun. 1998 Dec 30;253(3):761-7 C10ORF11 encodes a 22.5 kDa protein (Accession Kausar T, Bhatti MA, Ali M, Shaikh RS, Ahmed ZM. OCA5, No: NP_114413.1) composed of 198 amino acids. a novel locus for non-syndromic oculocutaneous albinism, The sub-cellular localization of leucine rich repeat maps to chromosome 4q24. Clin Genet. 2013 Jul;84(1):91- containing protein C10ORF11 is not clear. 3 Expression King RA, Hearing VJ, Creel DJ and Oetting WS.. Albinism. This protein was found in melanoblast of embryo In: The metabolic and molecular bases of inherited disease. and melanocytes of fetus, but not in retinal pigment Scriver CR, Beaudet AL, Sly WS & Valle D (Eds.) 2001; epithelial cells. 5587-627. New York: McGraw-Hill. Localisation Kobayashi T, Imokawa G, Bennett DC, Hearing VJ.. C10ORF11 is hypothesized to be present in the Tyrosinase stabilization by Tyrp1 (the brown locus protein). melanosome, but not in retinal pigment epithelial J Biol Chem. 1998 Nov 27;273(48):31801-5. cells. Lamason RL, Mohideen MA, Mest JR, Wong AC, Norton Function HL, Aros MC, Jurynec MJ, Mao X, Humphreville VR, Humbert JE, Sinha S, Moore JL, Jagadeeswaran P, Zhao The precise function of C10ORF11 has not been W, Ning G, Makalowska I, McKeigue PM, O'donnell D, elucidated till date. However, there is some evidence Kittles R, Parra EJ, Mangini NJ, Grunwald DJ, Shriver MD, that it may play some role in melanocyte Canfield VA, Cheng KC. SLC24A5, a putative cation differentiation (Grønskov K et al., 2013). exchanger, affects pigmentation in zebrafish and humans Science 2005 Dec 16;310(5755):1782-6 Mutations Germinal
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 357
Oculocutaneous Albinism Ray K, et al.
Lavado A, Montoliu L.. New animal models to study the role melanosomal proteins in the eye. Exp Eye Res. 1999 of tyrosinase in normal retinal development. Front Biosci. Feb;68(2):147-54. 2006 Jan 1;11:743-52. (REVIEW) Pehamberger H, Honigsmann H, Wolff K.. Dysplastic nevus Lee ST, Nicholls RD, Jong MT, Fukai K, Spritz RA.. syndrome with multiple primary amelanotic melanomas in Organization and sequence of the human P gene and oculocutaneous albinism. J Am Acad Dermatol. 1984 identification of a new family of transport proteins. Oct;11(4 Pt 2):731-5. Genomics. 1995 Mar 20;26(2):354-63. Puri N, Gardner JM, Brilliant MH.. Aberrant pH of Lund RD.. Uncrossed Visual Pathways of Hooded and melanosomes in pink-eyed dilution (p) mutant melanocytes. Albino Rats. Science. 1965 Sep 24;149(3691):1506-7. J Invest Dermatol. 2000 Oct;115(4):607-13. Mabula JB, Chalya PL, McHembe MD, Jaka H, Giiti G, Ray K, Chaki M, Sengupta M.. Tyrosinase and ocular Rambau P, Masalu N, Kamugisha E, Robert S, Gilyoma diseases: some novel thoughts on the molecular basis of JM.. Skin cancers among Albinos at a University teaching oculocutaneous albinism type 1. Prog Retin Eye Res. 2007 hospital in Northwestern Tanzania: a retrospective review of Jul;26(4):323-58. Epub 2007 Jan 17. (REVIEW) 64 cases. BMC Dermatol. 2012 Jun 8;12:5. doi: 10.1186/1471-5945-12-5. Rinchik EM, Bultman SJ, Horsthemke B, Lee ST, Strunk KM, Spritz RA, Avidano KM, Jong MT, Nicholls RD.. A gene Manga P, Orlow SJ.. Inverse correlation between pink-eyed for the mouse pink-eyed dilution locus and for human type dilution protein expression and induction of melanogenesis II oculocutaneous albinism. Nature. 1993 Jan by bafilomycin A1. Pigment Cell Res. 2001 Oct;14(5):362- 7;361(6407):72-6. 7. Rosemblat S, Sviderskaya EV, Easty DJ, Wilson A, Kwon Mondal M, Sengupta M, Samanta S, Sil A, Ray K. Molecular BS, Bennett DC, Orlow SJ.. Melanosomal defects in basis of albinism in India: evaluation of seven potential melanocytes from mice lacking expression of the pink-eyed candidate genes and some new findings Gene 2012 Dec dilution gene: correction by culture in the presence of 15;511(2):470-4 excess tyrosine. Exp Cell Res. 1998 Mar 15;239(2):344-52. Montoliu L, Grønskov K, Wei AH, Martínez-García M, Toyofuku K, Valencia JC, Kushimoto T, Costin GE, Virador Fernández A, Arveiler B, Morice-Picard F, Riazuddin S, VM, Vieira WD, Ferrans VJ, Hearing VJ.. The etiology of Suzuki T, Ahmed ZM, Rosenberg T, Li W. Increasing the oculocutaneous albinism (OCA) type II: the pink protein complexity: new genes and new types of albinism Pigment modulates the processing and transport of tyrosinase. Cell Melanoma Res 2014 Jan;27(1):11-8 Pigment Cell Res. 2002 Jun;15(3):217-24. Morice-Picard F, Lasseaux E, François S, Simon D, Wei AH, Zang DJ, Zhang Z, Liu XZ, He X, Yang L, Wang Y, Rooryck C, Bieth E, Colin E, Bonneau D, Journel H, Zhou ZY, Zhang MR, Dai LL, Yang XM, Li W. Exome Walraedt S, Leroy BP, Meire F, Lacombe D, Arveiler B. sequencing identifies SLC24A5 as a candidate gene for SLC24A5 mutations are associated with non-syndromic nonsyndromic oculocutaneous albinism J Invest Dermatol oculocutaneous albinism J Invest Dermatol 2014 2013 Jul;133(7):1834-40 Feb;134(2):568-71 Wilson S, Ginger RS, Dadd T, Gunn D, Lim FL, Sawicka M, Ni-Komatsu L, Orlow SJ.. Heterologous expression of Sandel M, Schnetkamp PP, Green MR. NCKX5, a natural tyrosinase recapitulates the misprocessing and regulator of human skin colour variation, regulates the mistrafficking in oculocutaneous albinism type 2: effects of expression of key pigment genes MC1R and alpha-MSH altering intracellular pH and pink-eyed dilution gene and alters cholesterol homeostasis in normal human expression. Exp Eye Res. 2006 Mar;82(3):519-28. Epub melanocytes Adv Exp Med Biol 2013;961:95-107 2005 Sep 30. This article should be referenced as such: Okoro AN.. Albinism in Nigeria. A clinical and social study. Ray K, Sengupta M, Ganguly K. Oculocutaneous Br J Dermatol. 1975 May;92(5):485-92. Albinism. Atlas Genet Cytogenet Oncol Haematol. 2016; Orlow SJ, Brilliant MH.. The pink-eyed dilution locus 20(6):352-358. controls the biogenesis of melanosomes and levels of
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 358 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Deep Insight Section
Cancer Cytogenomics resources Etienne De Braekeleer, Jean Loup Huret, Hossain Mossafa, Katriina Hautaviita, Philippe Dessen Haematological Cancer Genetics & Stem Cell Genetics, Wellcome Trust Sanger Institute, Hinxton, Cambridge, CB10 1SA, United Kingdom; Medical Genetics, Dept Medical Information, University Hospital, F-86021 Poitiers, France; Laboratoire CERBA, 95310 Saint Ouen l'Aumone, France; (Mouse genomics, Wellcome Trust Sanger Institute); UMR 1170 INSERM, Gustave Roussy, 114 rue Edouard Vaillant, F-94805 Villejuif, France.
Published in Atlas Database: April 2016 Online updated version : http://AtlasGeneticsOncology.org/Deep/Cancer_CytogenomicsID20145 Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62946/04-2015-Cancer_CytogenomicsID20145.pdf DOI: 10.4267/2042/62946 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2017 Atlas of Genetics and Cytogenetics in Oncology and Haematology
Abstract This "Deep Insight" is a detailed subchapter of a general review article and summary on Internet databases for cytogeneticists: Internet databases and resources for cytogenetics and cytogenomics.
("HSR"), monosomies and trisomies, with massive Introduction gene copy number changes, marker chromosomes, Most gene fusions alter the expression and/or the with high levels of any possible abnormality, and function of normal genes, and they are generally rings ("r"), so instable that their significance, in term strong driver mutations in neoplasia. They can of carcinogenesis, at the cell level, remains provide important information for the classification anecdotic/unpredictable/unknown (see of tumors (e.g. the well-known problem of "small http://atlasgeneticsoncology.org/Educ/PolyMecaEn round blue cell tumors") and may become the target g.html). for therapy (e.g. tyrosine kinase inhibitors). Since the Various types of databases have been developed. discovery of the "Philadephia chromosome" Majority of this data is integrated in the COSMIC (BCR/ABL1 fusion), hundreds and thousands of database (as studies presented in gene fusions have been highlighted. http://atlasgeneticsoncology.org/cosmicstudies.html Several sets of hybrid genes (or "fusion genes") have ) or in the Mitelman database resulting in redundant been published during the last few years. information in various databases. The main resources in cytogenetics deal "every The Atlas of Genetics and Cytogenetics in Oncology minute-every day" with all the structural and and Haematology (http://atlasgeneticsoncology.org) numerical chromosome rearrangements: provides peer reviewed articles/cards on translocations ("t"), inversions ("inv"), insertions chromosome abnormalities, clinical entities and ("ins"), dicentrics ("dic", accompanied with "ace" genes. when the dic occurs) (generating many hybrid Primer sequences for the verification for hybrid genes/fusion proteins at the origin and/or in the genes can be provided in the literature (Lovf M et al., process of cancer development), and also deletions 2011; Skotheim RI et al., 2009; Urakami K et al., ("del"), duplications ("dup") (generating hybrid 2016). genes at the breakpoints, and/or gene copy number Hybrid genes can be present in tumors but as well in changes), isochromosomes ("i"), double minus normal tissues (Babiceanu M et al., 2016). ("dm") and homogeneously staining regions
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 359 General resources in Genetics and/or Oncology De Braekeleer E, et al.
Figure 1: Mitelman database: "Cases Quick Searcher", "Molecular Biology Associations Searcher", and "Clinical Associations Searcher" (http://cgap.nci.nih.gov/Chromosomes/AllAboutMitelman)
The International System for Human Cytogenetic Nomenclature (ISCN) is the nomenclature used to I- Chromosome describe normal and abnormal karyotypes. rearrangements/Hybrid genes Languages with specific grammars have been I-1 Mitelman Database invented in logic and in mathematics with specific The Catalog of Chromosome Aberrations in Cancer, grammars (see containing 3,844 cases, was first published in 1983. https://en.wikipedia.org/wiki/Portal:Logic). The Successive printings were published by Karger, ISCN follows this model. It uses operands and, to act Allen R Liss, and Wiley-Liss (Sixth Edition, 1998). on them, unary and binary operators (e.g. "r" (ring) In 2000, the support of the National Cancer Institute is an unary operator because it acts on one operand (NCI) pushed the Catalog to be an open online (one chromosome), and "t" (translocation) is a binary database (Figure 1). The last update in Februrary operator, because it acts on two operands, (the 2 2016, included a total number of cases amounting to chromosomes involved in the translocation). ISCN 66,479, implicating 10,277 gene fusions (Heim S originates at the Denver conference, in 1960 and Mitelman F, 2015). The information is manually (Proposed standard, 1960). Revisions and updates of collected from literature and subsequently organized the ISCN made the interpretation more difficult into distinct sub-databases: The "Cases Quick (ISCN 2013). A new version is being released by the Searcher" and the "Cases Full Searcher" contain the end of 2016 (McGowan-Jordan J et al. (2016) but information related to chromosomal aberrations in will not be freely available on the web. individual cases, with the specific tumor characteristics.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 360
General resources in Genetics and/or Oncology De Braekeleer E, et al.
The "Molecular Biology Associations Searcher" way to search recurrent chromosome abnormalities, compile events according to the gene and the "Reference Searcher", which enquires the rearrangements, with a mention to tumor histologies bibliographic references. (Figure 2). It is accessed by a Gene List" (from A2M, Each sub-database specifies pertinent references A2M/ALK, A2M/ARFGEF2, to ZZZ3/NCK1). The with PMID numbers hyperlinked to PubMed. "Clinical Associations Searcher" has established its This free access database shows raw data; it is database on tumor type, related to chromosomal (almost) finished, showing approximately 99.9% of aberrations and/or gene rearrangements. The starting the different published chromosomal point is the "Topography List" presenting the rearrangements, and very reliable (each case is location of the tumor (from Adrenal, Anus, Bladder, manually collected by prominent experts: Felix Blood vessel, Bone to Vagina), paired with a Mitelman, Bertil Johansson, and Fredrik Mertens). "Morphology List", according to histology subtypes The Mitelman catalog and database is still an of the tumor (from Acinic cell carcinoma, Acute indispensable assistant to every cancer basophilic leukemia, Acute eosinophilic leukemia, cytogeneticist. to Wilms tumour. It is possible to find other sub- Taking in consideration all the progress made in databases: "Recurrent Chromosome Aberrations cancer cytogenetics, it would have been much slower Searcher", providing a without the Mitelman database.
Figure 2: PAX5/JAK2 in the Mitelman database (http://cgap.nci.nih.gov/Chromosomes/MSearchForm, click on: "Expand Gene List", quote: PAX5/JAK2)
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 361
General resources in Genetics and/or Oncology De Braekeleer E, et al.
I-2 Atlas of Genetics and The Atlas is mainly constituted of structured review articles or "cards" (original monographs written by Cytogenetics in Oncology and invited authors), but also contains traditional Haematology overviews, a portal directed to websites and The Atlas of Genetics and Cytogenetics in Oncology databases dedicated to cancer and/or genetics, case and Haematology (Dorkeld et al., 1999; Huret al al., reports in haematology, and various languages 2013) (http://atlasgeneticsoncology.org) is a peer teaching items. reviewed all in one freely available online journal The Atlas constitutes a fountain of knowledge (ISSN: 1768-3262), encyclopaedia and database. It regarding the biology of normal and cancerous cells. is an integrated structure and includes the following There are 1,460 genes annotated cards (e.g. TP53 topics: genes, cytogenetics and clinical entities in http://atlasgeneticsoncology.org/Genes/P53ID88.ht cancer, and cancer-prone diseases. The Atlas ml), and 27,800 non-annotated cards on genes, 600 combines various types of information: genes, gene leukemias (e.g.Classification of myelodysplastic rearrangements, cytogenetics, protein domains, syndromes function, cell biology, pathways. It also encloses: http://atlasgeneticsoncology.org/Anomalies/Classif clinical genetics, cancer prone hereditary diseases MDSID1058.html ; see also Figure 3), 210 solid and diseases, focused on cancers and other medical tumors (e.g. Head and Neck Paraganglioma, an conditions. The collection of all these different data overview helps to unify cancer genetics, while data found http://atlasgeneticsoncology.org/Tumors/HeadNeck elsewhere is dispersed between several sites. The ParagangliomaID6202.html ), 115 cancer prone Atlas is the only cancer genetics database quoting diseases (e.g. Oculocutaneous Albinism prognosis. The iconography in the Atlas (32,554 http://atlasgeneticsoncology.org/Kprones/Oculocuta images) is diverse (medical imaging, pathology, neousAlbinismID10022.html), and 110 Deep insight chromosomes, 3-D structure of proteins, genetic (e.g. The nuclear pore complex: structure and maps...). function The objectives of the project is to transfer scientific http://atlasgeneticsoncology.org/Deep/NuclearPore innovation towards research itself, and more FunctionID20139.html). The Atlas items are usually precisely towards patient care (translational health looked up by chromosome or using the search box research), medical treatment assistance in rare forms for genes or chromosomal abnormalities, in of cancer, making the fight against cancer more dedicated pages for solid tumors or for cancer-prone efficient, decrease the costs in fundamental, applied diseases. However, a "Search by Chromosome band" research and medical, toward a personalised cancer has recently been developed: it is a synthesis of all medicine. It is also an appliance for researchers in hybrid gene resources for each chromosome band, genomics. representing 435 pages presenting the chromosomal Content: The Atlas contains 45,500 pages (30,519 abnormalities, genes implicated, associated with documents) written from 3,216 authors from roughly collected data from databases, the literature and links 50 countries (in decreasing order: France, USA, to the original web sites. (e.g. Italy, United Kingdom, Germany, Japan, Spain, http://atlasgeneticsoncology.org/Bands/1p36.html) Canada, China, The Netherlands...).
Figure 3 t(9;9)(p13;q24) PAX5/JAK2 in the Atlas (http://atlasgeneticsoncology.org/Anomalies/t0909p13p24ID1559.html)
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 362
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Annotations/Meta-analyses: The Atlas is the only external links to up to date databases filing database that gives annotated data with meta- complementary aspects. analyses (e.g. survival curves in the t(3;21)(q26;q22) Educational tools: The Atlas has also worked in RUNX1/MECOM developing educational tools in genetics in English, (http://atlasgeneticsoncology.org/Anomalies/t0321I Spanish, and French (e.g. D1009.html) or in the t(1;11)(p32;q23) http://atlasgeneticsoncology.org/GeneticFr.html). KMT2A/EPS15 Altogether with the information described above, (http://atlasgeneticsoncology.org/Anomalies/t0111p this constitutes a step in the continuing medical 32q23ID1046.html), which are calculated from the education. available cases in the literature. Also, the uniquely Electronic journal: An Open access electronic detailed description of the gene SQSTM1 domains journal/pdf version of the Atlas has been developed (http://atlasgeneticsoncology.org/Genes/GCSQST by Institute for Scientific and Technical Information M1.html) is the result of a careful annotation of (INIST) of the French National Centre for Scientific collected data from various research papers. Since Research (CNRS). Available are the archives of a 2000 the Atlas has started to use radiating circle as a quarterly journal since 1997, which became a way to illustrate partner genes in a translocation (see bimonthly journal in 2008 and a monthly journal in http://atlasgeneticsoncology.org/Partners.htm), and 2009, comprising 2,500 articles in more than 120 since then the use has largely expanded. volumes, which constitutes a 10,000 pages Diagnosis and treatment: The Atlas may contribute collection, available at: to the cytogenetic diagnosis and may guide treatment http://irevues.inist.fr/atlasgeneticsoncology. On the decision making, particularly regarding rare diseases other hand, the Atlas is an encyclopedia with 45,000 (numerous, rare diseases are frequently pages of reference work, unfortunately stays encountered). From the section "Genes", one can incomplete and partially dated. As a product of obtained 600 genes implicated in , 732 in breast collaborative work, the accuracy and the renewal of cancer, and 480 genes in prostate cancer (e.g. see the Atlas is dependent on colleague participation. paragraph "Other genes implicated" at: I-3 COSMIC http://atlasgeneticsoncology.org/Tumors/breastID5 (http://cancer.sanger.ac.uk/cosmic) 018.html). The improving development of technics COSMIC is a catalog of somatic mutations in cancer, in genetics, it now appears that many subtypes of developed by the Sanger Institute with the support of solid tumors may exist (there are potentially the Wellcome Trust. It approximately includes all hundreds of breast cancer subtypes defined by abnormalities, from single nucleotide variations to distinct genetic profile yet to be uncovered), chromosome rearrangements / hybrid genes. following the leukemia model. COSMIC includes and displays somatic mutation Recently, new information on lung adenocarcinoma information, related details and contains information might give the possibility to consider personalized related to human cancers. For hybrid genes, medicine (see COSMIC describes in v76 (Feb 2016) 17,245 http://atlasgeneticsoncology.org/Tumors/TranslocL fusions, with 283 fusion genes which are cured, and ungAdenocarcID6751.html ). Together with cell 1,271 different pairs when taking inferred biology developments, proves that the encyclopaedic breakpoints into account (Figure 4). These fusions content of the Atlas and other similar data sources are part of a global database that is mainly are probably a basis for developing personalized regrouping somatic mutations in cancer. All the medicine for cancer. fusions are identified with a code (ex: COSF699) and ICD-O3 nomenclature: Nosology and phylum of defined on the genome with the standardization of solid tumors and hematological cancers can be found HGVS (http://www.hgvs.org/mutnomen/recs- in the Atlas at DNA.html) (ex: http://atlasgeneticsoncology.org/Tumors/SolidNoso PLXND1{ENST00000324093}:r.13016TMCC1{E logy.html and NST00000393238}:r.9185992) (Forbes SA et al., http://atlasgeneticsoncology.org/Anomalies/ICD- 2015). OHematology.html. (http://cancer.sanger.ac.uk/cosmic/fusion/summary? Cell biology and physio-pathology: Information on id=1071) A synthesis of all these resources is cell biology and physio-pathology, can be found in integrated in chromosomal band pages of the Atlas specific pages of the Atlas (e.g.: Angiogenesis: (http://atlasgeneticsoncology.org/Bands/1p36.html# http://atlasgeneticsoncology.org/Categories/Angiog GENES) with links to the original websites. enesis.html). Links: More than 17,000 internal hyperlinks in the Atlas can be found. Gene cards are broadened by
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 363
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Figure 4: PAX5/JAK2 gene fusion at COSMIC
I-4 ChimerDB 2.0 I-8 Fusion cancer (http://biome.ewha.ac.kr:8080/FusionGene/) (http://donglab.ecnu.edu.cn/databases/FusionCance ChimerDB 2.0 is a database for hybrid genes r/) (Wang Y, 2015). updated in 2010, with PubMed references and This database of hybrid genes in human cancers various information about the structure of chimeric originated from the analysis of RNA-seq data in the genes. (Kim N et al., 2006a ; Kim P et al., 2006b). Sequence Read Archive (SRA) on NCBI in 15 I-5 TICdb cancer types and contains 11,839 fusions, with (http://www.unav.es/genetica/TICdb/) structured information on cancer types, breakpoint TICdb (v 3.3 August 2013) is a database of accession numbers of SRA and chimeric sequences. Translocation breakpoints In Cancer (Novo FJ et al., I-9 OMIM 2007). This update contains 1,313 sequences of (http://www.omim.org/ see General resources in hybrid genes found in human tumors, involving 420 Genetics and/or Oncology) different genes (Figure 5). For every fusion, TICdb The "Online Mendelian Inheritance in Man" will return the HGNC names of both partner genes (OMIM) catalog encloses 1,523 entries with "fusion and the original reference (either a GenBank or a gene" (Amberger JS et al., 2015). Pubmed ID), as well as the fusion sequence at the I-10 Other resources nucleotide level. A complete list of genes and the Books: "Cancer Cytogenetics: Chromosomal and fusion sequences can be obtained at Molecular Genetic Abberations of Tumor Cells", by http://www.unav.es/genetica/allseqsTICdb.txt. Sverre Heim and Felix Mitelman, is published by I-6 ChiTARS Wiley-Blackwell Ref. This major textbook is the (http://chitars.bioinfo.cnio.es/) fourth edition (2015) and contains 648 pages. Some ChiTARS is a database of chimeric transcripts useful iconography of chromosome rearrangements obtained by the analysis of EST or RNA sequencing from the UWCS laboratory, University of with part of experimental validation. This database Wisconsin, can be found at including 20,750 chimeric human transcripts, has http://www.slh.wisc.edu/clinical/cytogenetics/cance been developed within the ENCODE project r/. An analysis of hybrid genes in 675 tumor cell lines (Frenkel-Morgenstern M et al., 2013 ; Frenkel- has been performed by GenenTech (Klijn C et al., Morgenstern M et al., 2015). 2015). Of the 2,200 gene fusions catalogued, 1,435 I-7 TCGA Fusion gene Data Portal consist of genes not previously found in fusions. A (http://54.84.12.177/PanCanFusV2/) synthesis of cell lines analyses can be found in the TCGA Fusion gene Data Portal presents the analysis Atlas at from 20 tumor types of the TCGA program, as of http://atlasgeneticsoncology.org/celllines.html. December 2014, with 10,431 fusions in 2,961 tumors Finally, the Mitelman and the Atlas being with fusions (a mean of 3.5 fusions per sample) complementary, the recommendation is that both of (Yoshihara K et al., 2015). This is the result of a these indispensable databases should be used. specific pipleline for RNA Seq data analysis (PRADA) developed at the MDAndersson Cancer Center.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 364
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Figure 5: PAX5 hybrid genes at TicDB (http://www.unav.es/genetica/TICdb/results.php?hgnc=PAX5&x=23&y=8)
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 365
General resources in Genetics and/or Oncology De Braekeleer E, et al.
II- Data for SKY and FISH Concerning the SKY techniques, there are some Fluorescence in-situ hybridization (FISH) technique resources such as a SKY/M-FISH &CGH database facilitates the identification of chromosomal at the NCBI (which provides a public platform for structures to be identified using specific probes. This investigators to share and compare their molecular significantly improves the localisation of cytogenetic data http://www.ncbi.nlm.nih.gov/sky/), breakpoints on chromosomes by a direct view of with an ICD-O3 nomenclature (International hybridization of probes using one or several colors Classification of Diseases - Oncology). Elsewhere, associated with the probes. The big advantage of the there are some others resources as SKY Karyotypes FISH technique is that it can also be used on non- and FISH analysis of Epithelial Cancer Cell Lines at dividing cells (interphase nuclei). BAC clones are Cambridge (http://www.pawefish.path.cam.ac.uk/). used for mapping studies as they contain large inserts III- Comparative genomic of human DNA and can be fluorescently labeled to hybridization (CGH) resources determine the localization of genes and identify In 1992, Dan Pinckel (Kallioniemi A et al., 1992) regions implicated in cancer chromosomal developed the comparative genomic hybridization aberrations. The Cancer Chromosome Aberration (CGH) independently of the morphological analysis Project (CCAP) has created a set of BAC clones of chromosomes. In the first step of development, mapped cytogenetically by FISH and physically by CGH was used on metaphases. But at the end of 1990 STSs to the human genome. The BAC data is Solinas-Toldo (Solinas-Toldo S et al., 1997) and integrated into various CGAP and NCBI databases Pinkel et al. (Pinkel D et al., 1998) proposed a new to provide related clinical, histopathologic, genetic, technique of DNA hybridization on array (first and genomic information spotted with cDNA, but rapidly, after 2002, with (http://cgap.nci.nih.gov/Chromosomes/CCAPBAC synthetized (50-80 mers) oligonucleotides. The Clones) and more precisely for each chromosome genomic resolution was increased below 50-100 (e.g. nucleotides, as the density of probes is, in parallel, http://cgap.nci.nih.gov/Chromosomes/BACCloneM increased from 20K to up 2M. Because it is a method ap?CHR=6). of a ratio of copy numbers (often defined as log2 of The Human BAC Array the ratio) this technique only detects disequilibrium (http://mkweb.bcgsc.ca/bacarray/ is built using between a disease sample and a normal sample, and 32,855 clones from RPCI-11, RPCI-13, Caltech-D it has been applied to several aspects of genetic BAC libraries. The set achieves an average depth of imbalances. Numerous arrays have been designed coverage of 1.8X, average effective resolution of 76 (from pan-genomic to specific of some abnormalities kb. Genome-adjacent clones in the set overlap by an (custom design)). For example the GEO server average of 73 kb. The set provides coverage of 98% (Gene Expression Omnibus) has 432 CGH platforms of the human hg17 (May 2004) genome assembly (with 233 as human) and 71 SNP (with 46 for and 98% of the human May 2005 BAC fingerprint human). map. The clone set is publically available from The processing of CGH data is not obvious (with BACPAC Resources. An easy way to select them is normalization of the raw data, centralization, by the Cytogenetic Resource of FISH-mapped, segmentation in pieces of chromosomes with Sequence-tagged Clones at NCBI homogeneous copy number limited by breakpoints, (http://www.ncbi.nlm.nih.gov/genome/cyto/cytobac and finally annotation of implicated genes). An .cgi?CHR=6&VERBOSE=ctg). optimal profile of copy number associated with All BAC can be located on the UCSC genome accurate breakpoints requires normalization (with browser (http://genome.ucsc.edu) when BAC end correction of GC content) and centralization pairs track is selected. On the other hand, BAC from (especially when the profile has a great part of the fishClones file can be visualized on the abnormalities). This optimization also depends on chromosomal bands on the Atlas the nature of the sample (such as clonality or the (http://atlasgeneticsoncology.org/Bands/) that has a percentage of tumor cell). It is important to note the link to their GenBank sequences. impact in clinical routine to define, for example, More recently, several commercial companies have actionable genes (Commo F et al., 2015). Another developed more specific catalogs of FISH clones as extension of this approach are the SNP arrays that oligonucleotides probes (see also the chromosome combine probes designed for copy-number pages of the Atlas for links). With differently measurement and probes specific of a known labelled DNA probes (in general as a mixture), nucleotide variant ("single nucleotide combined green/red signals colocalize in yellow in polymorphism"). The great advantage is the normal cells. In a chromosome translocation the co- possibility to measure the ploidy (which cannot be localized signal will split, resulting in separate green measured by CGH alone, as the measure is a relative and red signals, the unaffected chromosome value, depending on the percentage of tumor cells). remaining with a yellow signal. Moreover, the segmentation of copy number can be
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 366
General resources in Genetics and/or Oncology De Braekeleer E, et al.
correlated with the segmentation of LOH (loss of almost anywhere in the genome. GISTIC identifies heterozygosity), which gives a better interpretation regions that are altered above the background rate of the origin of abnormalities. Several sites are and therefore may be subject to positive selection. repositories for these CGH/SNP profiles: For each of these regions, one or or more "peak III-1 GEO regions", most likely to contain the target genes, are (http://www.ncbi.nlm.nih.gov/geo/) identified. The evidence that a gene is targeted by GEO (Gene Expression Omnibus) is a public these copy number alterations includes: i) Presence functional genomics data repository supporting in a peak region: these peak regions are the regions MIAME-compliant data submissions. Array and deemed most likely by GISTIC to contain the gene sequence-based data are accepted. Tools are or genes being targeted by significant provided to help users query and download amplifications/deletions; ii) a significance (Q- experiments and curated gene expression profiles. value): this represents the likelihood that the gene This database includes curated gene expression only suffers amplifications/deletions at the DataSets, as well as original series and platform background rate across the entire genome. The data records in the GEO repository. Mainly used for gene can be visualized on the IGV (Integrated Genome expression, GEO has a limited part dedicated to Viewer). CGH datasets (1,358 experiments for human III-4 MetaCGH neoplasms). It is not easy to synthetize the variation (http://compbio.med.harvard.edu/metacgh/) of copy number results directly on the site. The best This website is designed to provide access to array way is to export (as GSExxxRAW.tar) and reanalyze CGH (comparative genomic hybridization) based on the data with a specific software (as Bioconductor copy number profiles of 8,227 human cancer packages or commercial companie's tools (Clough E genomes (Figure 6). See the description of the and Barrett T, 2016). database for more information about its composition III-2 Array Express (Kim TM et al., 2013). An interactive web-based (http://www.ebi.ac.uk/arrayexpress/) browser facilitates the exploration of the result set: - Array Express is a similar archive of functional Search for specific genes of interest. Support genomics data, stored data from high-throughput alternative gene nomenclatures. - Browse cytobands functional genomics experiments, and provides these by frequency of alteration. - Visualize alteration data for the reuse for the research community frequency over the full set of tumor types for a gene (Petryszak R et al., 2016). There are several other of interest. sites that present reanalyzed data (public or local) III-5 CaSNP with various analytic approaches and provide (http://cistrome.org/CaSNP/) facilities for exploring abnormalities in different CaSNP is a comprehensive collection of copy types of tumors. number alterations (CNA) from SNP arrays. It III-3 Tumorscape collects 11,485 Affymetrix SNP arrays of 34 (http://www.broadinstitute.org/tcga/home) different cancer types in 105 studies to profile the This portal (Broad Institute), created in 2010, is genome-wide CNA and SNP in each. This includes designed to facilitate the use and understanding of all the cancer SNP profiles using Affymetrix SNP high resolution copy number data amassed from arrays (10K to 6.0) with raw data from GEO, with multiple cancer types. The 3,131 datasets are partly additional arrays from the TCGA consortium and a originating from GEO and reanalyzed with the few individual publications. All CNA data stored in GISTIC algorithm to identify regions that have been CaSNP is generated from raw data analyzed by altered above the background rate and therefore may dCHIP-SNP software. Data can be visualized as be subject to positive selection. For each of these table or heatmap. (Cao Q et al., 2011). regions, one or more "peak regions", most likely to III-6 Cell line Project contain the target genes, are identified (Beroukhim (http://cancer.sanger.ac.uk/cell_lines) R et al., 2010). The following functionalities are For decades, human immortal cancer cell lines have supported: - Gene-level Analysis: One can query the constituted an accessible, easily usable set of level and significance of copy number alterations biological models. In order to improve their utility affecting any gene listed in Refseq (or miRNAs). the Cancer Genome Project has embarked on a Click "Analyses", then "by Gene". - Analysis by systematic characterization of the genetics and cancer type: One can query the most significant genomics of large numbers of cancer cell lines. Prior regions of amplification and deletion in individual knowledge of their genetic abnormalities may allow cancer types. Click "Analyses", then "by Cancer more informed choice of cancer cell lines in Type". In Analysis by Gene, these data represent a biological experiments and drug testing and more GISTIC analysis performed on this cancer type. informed interpretation of results. Among other Across a large number of cancers, copy number information (exome sequencing) the COSMIC Cell alterations (amplifications or deletions) can be found Lines Project includes genome wide copy number
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 367
General resources in Genetics and/or Oncology De Braekeleer E, et al.
analysis and genotyping information obtained by data reflects 65,042 genomic copy number arrays, in using the Affymetrix SNP6 array and analyzed by 986 experimental series and on 333 array platforms using the PICNIC algorithm. (Cai H et al., 2015). A main interest of these A complete list of cell lines can be found on resources (originating in great part from GEO http://cancer.sanger.ac.uk/cell_lines/cbrowse/all. datasets) is the fine classification with the ICD-O3 III-7 Cancer Cell Line nomenclature. This resource is an elaborate and complete site for Encyclopedia querying large amount of CGH data of cancer. (http://www.broadinstitute.org/ccle/home) For the majority of the samples, probe level For several years, the Broad Institute has developed visualization and customized data representation resources for cell lines data, especially copy number facilitate gene level and genome wide data review. analysis with Affymetrix SNP6.0 arrays. These last Results from multi-case selections can be connected two resources are complementary. Several other to downstream data analysis and visualization tools sites presenting global resources from TCGA or (as linear, circularized or karyotype like ICGC programs give access for each disease by copy presentations). Numerous tools permit visualization number analysis (e.g. Broad GDAC FireBrowse, of part of profiles (selection of chromosomes or cBioPortal (see below), OASIS portal ....) genes) and export of data in tabulated files. An API III-8 ArrayMap (with relatively easy syntaxes) facilitates an (http://www.arraymap.org) automation of analyses. Moreover a majority of ArrayMap is a curated reference database and cards (leukemia or solid tumors) in the Atlas are bioinformatics resource targeting copy number linked, via ICD-O3 codes, to ArrayMap (Figure 7). profiles that provides an entry point for meta- analysis and systems level data integration of high- resolution oncogenomic CNA data. The current
Figure 6: PAX3 gain and loss in tumors at MetaCGH (http://compbio.med.harvard.edu/metacghBrowser/).
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 368
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Figures 7: ArrayMap (http://www.arraymap.org/) Selection of 26 samples of T lymphoblastic leukaemia/lymphoma (ICD-O 9837/3) to obtain a "heatmap" of gain and loss for all the samples showing the variability of CGH profiles.
IV- Mutation databases the v76 (Feb 2016), there are 3,942,175 mutations on The difference between single nucleotide (SNP) as 1,192,776 samples collected in 22,844 papers. The the variability within a population and mutations interface has been fully redesigned and offers acquired in a neoplastic process is extremely crucial. multiple ways to view mutations, fusions, copy The determination of variants was previously numbers, etc. (Forbes SA et al., 2015). obtained by SNP arrays, but is nowadays performed IV-2 CENSUS by massive parallel sequencing. As a result, a huge (http://cancer.sanger.ac.uk/census/) quantity of polymorphisms and mutations in tumors, The Cancer Gene Census is an ongoing effort to are compared to controls. The landscape of the include cancer genes for which mutations have been majority of recurrent mutations is now known and causally implicated in cancer. The original census can be used for diagnosis. and analysis was published in Nature Reviews Even in haematological malignancies, where the Cancer and supplemental analysis information chromosome rearrangements have shown to bear a related to the paper is also available. The census is major role, nonetheless, it appears now that some regularly updated. In particular, Felix Mitelman and mutations at the nucleotide level can still be very his colleagues have been continuing to provide important in determining treatments in relation to information on more genes involved in uncommon patient outcome (e.g. ASXL1, ATM, BCL6, BRAF, translocations in leukaemias and lymphomas. KRAS and NRAS, CBL, CCND3, CDKN2A and Currently, there is more than 1% of all human genes CDKN2C, CEBPA, CRLF2, ETV6, FLT3, GATA2, that have been mutated in cancer. Out of these, ID3, IDH1, IDH2, IKZF1, JAK1, KIT, MYD88, roughtly 90% cancer mutations are somatic, 20% NOTCH1, NPM1, RUNX1, TP53). bear germline mutations that predispose to cancer IV-1 COSMIC and 10% show both somatic and germline mutations (http://cancer.sanger.ac.uk/cosmic) (Futreal PA et al., 2004). COSMIC is designed to store and display somatic IV-3 HGMD mutation information and related details and (http://www.hgmd.cf.ac.uk/ac/index.php) contains information relating to human cancers. In
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 369
General resources in Genetics and/or Oncology De Braekeleer E, et al.
The recognition that certain DNA sequences are common patterns of mutations in more than 2,800 hypermutable has yielded clues to the endogenous cancer whole genomes from the International Cancer mutational mechanisms involved and has provided Genome Consortium. It contains descriptions of insights into the intricacies of the processes of DNA 36,985,985 mutations in 57,773 genes and 17,867 replication and repair (Cooper and Krawczak 1993). donors within 66 projects in 21 primary sites (Zhang In practical terms, a fuller understanding of the J et al., 2011). mutational process may prove important in IV-7 OASIS Portal molecular diagnostic medicine by contributing to (see above) improvements in the design and efficacy of mutation presents data from 30 datasets (from Acute Myeloid search procedures and strategies for different genetic Leukemia to Uterine Corpus Endometrial disorders. The Human Gene Mutation Database Carcinosarcoma) with 6,817 mutations, 11,222 (HGMD) collects known (published) gene lesions CNVs and expression (8,178 RNA Seq and 4,889 responsible for human inherited disease. This microarrays). database, whilst originally established for the study of mutational mechanisms in human genes (Cooper IV-8 IntOGen DN and Krawczak M, 1996) has now acquired a (http://www.intogen.org) much broader utility in that it embodies an up-to-date IntOGen collects and analyses somatic mutations in and comprehensive reference source to the spectrum thousands of tumor genomes to identify cancer of inherited human genes. Thus, HGMD provides driver genes (Figure 9). At the end of 2014, IntOGen information of practical diagnostic importance to i) defines a list of 459 driver genes in 28 cancer types researchers and diagnosticians in human molecular (Gundem G et al., 2010). genetics, ii) physicians interested in a particular IV-9 BioMuta v2 inherited condition in a given patient or family, and (https://hive.biochemistry.gwu.edu/tools/biomuta/) iii) genetic counselors. Note: HGMD has two types BioMuta v2.0 is a curated single-nucleotide variation of access: a free public one with limited data and a (SNV) and disease association database where the professional one requiring a license. variations are mapped to the genome/protein/gene. IV-4 LOVD Oriented toward cancer, the database has 5,233,790 (http://www.lovd.nl/3.0/home) SNV for 41 cancer types and gives position of LOVD stands for Leiden Open (source) Variation mutation and frequency in each cancer type (Wu TJ Database. The LOVD's purpose is to provide a et al., 2014). flexible tool for gene-centered collection and display of DNA variations. LOVD 3.0 extends this idea to IV-10 DoCM also provide patient-centered data storage and NGS (http://docm.genome.wustl.edu/) data storage, even for variants outside of genes. The Database of Curated Mutations (DoCM) is a LOVD consist of both a database soltware and the curated database of known, disease-causing content from Locus Specific Mutations databases mutations that provides easily explorable variant lists (LSSB) (http://grenada.lumc.nl/LSDBlist/lsdbs) with direct links to source citations for easy which are curated by laboratories. A general access verification. Curation of the literature to produce a gives links to each gene (92,241 entries in all) high quality set of pathogenic somatic mutations is (Fokkema IF et al., 2011). not straitforward. This requires sifting through the ever growing body IV-5 TCGA cBIoPortal of cancer research literature (6% annual growth rate (http://www.cbioportal.org/) in the last 10 years), which for year 2015 means over The cBioPortal for Cancer Genomics provides 156,399 articles related to cancer as indexed by visualization, analysis and access of large-scale PubMed. cancer genomics data sets (126 in April 2016). For This volume of literature makes it difficult to identify each dataset the portal presents several diagrams for bona fide somatic mutations with characterized mutations, copy number variations, survival analysis functional or clinical significance in cancer. Once so on (Figure 8). It also provides help in analysing a identified, these mutations require significant list of predefined genes (Deng M et al., 2016). curation efforts to format and standardize the IV-6 ICGC Data Portal mutations in a consistent way that enables databasing. (https://dcc.icgc.org/) For example, publications often only specify the The ICGC Data Portal provides tools for visualizing, amino acid change and gene name to describe the querying and downloading the data released mutation. DoCM addresses these challenges by quarterly by the consortium's member projects. The acting as an accessible, open-source, and openly Pancancer Analysis of Whole Genomes (PCAWG) licensed somatic mutation repository that also study is an international collaboration to identify enables community contributions.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 370
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Figure 8: PAX5 alterations in cancer at cBioPortal (http://www.cbioportal.org/, Select Cancer Study, tick "all"; Enter Gene Set: "write; "PAX5")
Figure 9: PAX5 mutation frequency at intOGen (http://www.intogen.org/search?gene=PAX5)
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 371
General resources in Genetics and/or Oncology De Braekeleer E, et al.
de Klein A, van Kessel AG, Grosveld G, Bartram CR, IV-11 CIViC Hagemeijer A, Bootsma D, Spurr NK, Heisterkamp N, (https://civic.genome.wustl.edu/#/home) Groffen J, Stephenson JR A cellular oncogene is The CIViC (Clinical Interpretations of Variants in translocated to the Philadelphia chromosome in chronic Cancer) database is based on Evidence items which myelocytic leukaemia Nature 1982 Dec 23;300(5894):765- reference their parent variants, variant groups, and 7 genes. One can explore the various CIViC entities Rowley JD Letter: A new consistent chromosomal and their attributes using the menu. Precision abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining Nature 1973 medicine refers to the use of prevention and treatment Jun 1;243(5405):290-3 strategies that are tailored to the unique features of each individual and their disease. In the context of Zech L, Haglund U, Nilsson K, Klein G Characteristic chromosomal abnormalities in biopsies and lymphoid-cell cancer, this might involve the identification of lines from patients with Burkitt and non-Burkitt lymphomas specific mutations shown to predict response to a Int J Cancer 1976 Jan 15;17(1):47-56 targeted therapy. The biomedical literature describing Berger R, Bernheim A, Weh HJ, Flandrin G, Daniel MT, these associations is large and growing rapidly. Brouet JC, Colbert N A new translocation in Burkitt's tumor Currently these interpretations exist largely in private cells Hum Genet 1979;53(1):111-2 or encumbered databases resulting in extensive Miyoshi I, Hiraki S, Kimura I, Miyamoto K, Sato J 2/8 repetition of effort. Currently this database is just translocation in a Japanese Burkitt's lymphoma Experientia starting with 212 genes (474 variants) analysed from 1979 Jun 15;35(6):742-3 870 publications. Van Den Berghe H, Gosseye CP, Englebienne V, Cornu G, IV-12 ExAC Sokal G Variant translocation in Burkitt lymphoma Cancer Genetics and Cytogenetics 1960, 1; 9-14 (http://exac.broadinstitute.org) ExAC (Exome Aggregation Consortium) is a Oshimura M, Freeman AI, Sandberg AA Chromosomes and causation of human cancer and leukemia XXVI Binding coalition of investigators seeking to aggregate and studies in acute lymphoblastic leukemia (ALL) harmonize exome sequencing data from a variety of large-scale sequencing projects, and to make Rowley JD, Golomb HM, Dougherty C 15/17 translocation, a consistent chromosomal change in acute promyelocytic summary of the data available for the wider scientific leukaemia Lancet 1977 Mar 5;1(8010):549-50 community. The data set provided on this website spans across 60,706 unrelated individuals sequenced Fukuhara S, Rowley JD, Variakojis D, Golomb HM Chromosome abnormalities in poorly differentiated as part of various disease-specific and population lymphocytic lymphoma Cancer Res 1979 Aug;39(8):3119- genetic studies. All of the raw data from these 28 projects have been reprocessed through the same Ohno S, Babonits M, Wiener F, Spira J, Klein G, Potter M pipeline, and jointly variant-called to increase Nonrandom chromosome changes involving the Ig gene- consistency across projects. The data are available carrying chromosomes 12 and 6 in pristane-induced mouse under the ODC Open Database License (ODbL). One plasmacytomas Cell 1979 Dec;18(4):1001-7 is allowed to freely share and modify the ExAC data Seidal T, Mark J, Hagmar B, Angervall L Alveolar as long as it is of public use of the database, or work rhabdomyosarcoma: a cytogenetic and correlated produced from the database, with keeping the cytological and histological study Acta Pathol Microbiol Immunol Scand A 1982 Sep;90(5):345-54 resulting data-sets open and offering the shared or adapted version of the data under the same ODbL Aurias A, Rimbaut C, Buffe D, Dubousset J, Mazabraud A [Translocation of chromosome 22 in Ewing's sarcoma] C R license (Minikel EV et al., 2016). Seances Acad Sci III 1983;296(23):1105-7 References Turc-Carel C, Philip I, Berger MP, Philip T, Lenoir G [Chromosomal translocation (11; 22) in cell lines of Ewing's Stratton MR, Campbell PJ, Futreal PA The cancer genome sarcoma] C R Seances Acad Sci III 1983;296(23):1101-3 Nature 2009 Apr 9;458(7239):719-24 de Jong B, Molenaar IM, Leeuw JA, Idenberg VJ, Mertens F, Johansson B, Fioretos T, Mitelman F The Oosterhuis JW Cytogenetics of a renal adenocarcinoma in emerging complexity of gene fusions in cancer Nat Rev a 2-year-old child Cancer Genet Cytogenet 1986 Mar Cancer 2015 Jun;15(6):371-81 15;21(2):165-9 Boveri T. Zur Frage der Enstehung maligner Tumoren 1914 Stenman G, Sandros J, Dahlenfors R, Juberg-Ode M, Mark Gustav Fischer J 6q- and loss of the Y chromosome--two common deviations in malignant human salivary gland tumors Nowell PC, Hungerford DA A minute Chromosome in Cancer Genet Cytogenet 1986 Aug;22(4):283-93 Human Chronic Ganulocytic Leukemia Science 1960 132:1497 Mark J, Dahlenfors R, Ekedahl C, Stenman G The mixed salivary gland tumor Ñ A normally benign human neoplasm Caspersson T, Zech L, Modest EJ Fluorescent labeling of frequently showing specific chromosomal abnormalities. chromosomal DNA: superiority of quinacrine mustard to Cancer Genetics and Cytogenetics 1980 2, 231-24 quinacrine Science 1970 Nov 13;170(3959):762 Heim S, Mandahl N, Kristoffersson U, Mitelman F, Rser B, Rowley JD Identificaton of a translocation with quinacrine Rydholm A, Willén H Reciprocal translocation fluorescence in a patient with acute leukemia Ann Genet t(3;12)(q27;q13) in lipoma Cancer Genet Cytogenet 1986 1973 Jun;16(2):109-12 Dec;23(4):301-4
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 372
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Turc-Carel C, Dal Cin P, Rao U, Karakousis C, Sandberg FLNA, a new partner gene fused to MLL in a patient with AA Cytogenetic studies of adipose tissue tumors I A benign acute myelomonoblastic leukaemia Br J Haematol 2009 lipoma with reciprocal translocation t(3;12)(q28;q14) Sep;146(6):693-5 Bernard O, Lecointe N, Jonveaux P, Souyri M, Meyer C, Hofmann J, Burmeister T, Gröger D, Park Mauchauffé M, Berger R, Larsen CJ, Mathieu- TS, Emerenciano M, Pombo de Oliveira M, Renneville A, Mahul D Two site-specific deletions and t(1;14) Villarese P, Macintyre E, Cavé H, Clappier E, Mass- translocation restricted to human T-cell acute leukemias Malo K, Zuna J, Trka J, De Braekeleer E, De Braekeleer M, disrupt the 5' part of the tal-1 gene Oncogene 1991 Oh SH, Tsaur G, Fechina L, van der Velden VH, van Aug;6(8):1477-88 Dongen JJ, Delabesse E, Binato R, Silva ML, Kustanovich A, Aleinikova O, Harris MH, Lund-Aho T, Juvonen V, Barr FG, Nauta LE, Davis RJ, Schäfer BW, Nycum Heidenreich O, Vormoor J, Choi WW, Jarosova M, LM, Biegel JA In vivo amplification of the PAX3-FKHR and Kolenova A, Bueno C, Menendez P, Wehner S, Eckert C, PAX7-FKHR fusion genes in alveolar rhabdomyosarcoma Talmant P, Tondeur S, Lippert E, Launay E, Henry C, Hum Mol Genet 1996 Jan;5(1):15-21 Ballerini P, Lapillone H, Callanan MB, Cayuela JM, Herbaux Simon MP, Pedeutour F, Sirvent N, Grosgeorge J, Minoletti C, Cazzaniga G, Kakadiya PM, Bohlander S, Ahlmann M, F, Coindre JM, Terrier-Lacombe MJ, Mandahl N, Craver Choi JR, Gameiro P, Lee DS, Krauter J, Cornillet-Lefebvre RD, Blin N, Sozzi G, Turc-Carel C, O'Brien KP, Kedra D, P, Te Kronnie G, Schäfer BW, Kubetzko S, Alonso Fransson I, Guilbaud C, Dumanski JP Deregulation of the CN, zur Stadt U, Sutton R, Venn NC, Izraeli S, Trakhtenbrot platelet-derived growth factor B-chain gene via fusion with L, Madsen HO, Archer P, Hancock J, Cerveira N, Teixeira collagen gene COL1A1 in dermatofibrosarcoma MR, Lo Nigro L, Möricke A, Stanulla M, Schrappe M, protuberans and giant-cell fibroblastoma Nat Genet 1997 Sedék L, Szczepański T, Zwaan CM, Jan;15(1):95-8 Coenen EA, van den Heuvel-Eibrink MM, Strehl S, Dworzak M, Panzer-Grümayer R, Dingermann T, Klingebiel T, Sinclair PB, Nacheva EP, Leversha M, Telford N, Chang J, Marschalek R The MLL recombinome of acute leukemias in Reid A, Bench A, Champion K, Huntly B, Green AR Large 2013 Leukemia 2013 Nov;27(11):2165-76 deletions at the t(9;22) breakpoint are common and may identify a poor-prognosis subgroup of patients with chronic Speicher MR, Carter NP The new cytogenetics: blurring the myeloid leukemia Blood 2000 Feb 1;95(3):738-43 boundaries with molecular biology Nat Rev Genet 2005 Oct;6(10):782-92 Möller E, Hornick JL, Magnusson L, Veerla S, Domanski HA, Mertens F FUS-CREB3L2/L1-positive Pinkel D, Albertson DG Array comparative genomic sarcomas show a specific gene expression profile with hybridization and its applications in cancer Nat Genet 2005 upregulation of CD24 and FOXL1 Clin Cancer Res 2011 Jun;37 Suppl:S11-7 May 1;17(9):2646-56 De Braekeleer E, Douet-Guilbert N, De Braekeleer M Gelsi-Boyer V, Trouplin V, Adélaïde J, Aceto Genetic diagnosis in malignant hemopathies: from N, Remy V, Pinson S, Houdayer C, Arnoulet C, Sainty D, cytogenetics to next-generation sequencing Expert Rev Mol Bentires-Alj M, Olschwang S, Vey N, Mozziconacci MJ, Diagn 2014 Mar;14(2):127-9 Birnbaum D, Chaffanet M Genome profiling of chronic Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, myelomonocytic leukemia: frequent alterations of RAS and Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer RUNX1 genes BMC Cancer 2008 Oct 16;8:299 R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Van Vlierberghe P, van Grotel M, Tchinda J, Lee C, Chinnaiyan AM Recurrent fusion of TMPRSS2 and ETS Beverloo HB, van der Spek PJ, Stubbs A, Cools J, Nagata transcription factor genes in prostate cancer Science 2005 K, Fornerod M, Buijs-Gladdines J, Horstmann M, van Oct 28;310(5748):644-8 Wering ER, Soulier J, Pieters R, Meijerink JP The recurrent West RB, Rubin BP, Miller MA, Subramanian S, Kaygusuz SET-NUP214 fusion as a new HOXA activation mechanism G, Montgomery K, Zhu S, Marinelli RJ, De Luca A, Downs- in pediatric T-cell acute lymphoblastic leukemia Blood 2008 Kelly E, Goldblum JR, Corless CL, Brown PO, Gilks CB, May 1;111(9):4668-80 Nielsen TO, Huntsman D, van de Rijn M A landscape effect Mullighan CG, Collins-Underwood JR, Phillips LA, Loudin in tenosynovial giant-cell tumor from activation of CSF1 MG, Liu W, Zhang J, Ma J, Coustan-Smith E, Harvey RC, expression by a translocation in a minority of tumor cells Willman CL, Mikhail FM, Meyer J, Carroll AJ, Williams RT, Proc Natl Acad Sci U S A 2006 Jan 17;103(3):690-5 Cheng J, Heerema NA, Basso G, Pession A, Pui CH, Rikova K, Guo A, Zeng Q, Possemato A, Yu J, Haack H, Raimondi SC, Hunger SP, Downing JR, Carroll WL, Rabin Nardone J, Lee K, Reeves C, Li Y, Hu Y, Tan Z, Stokes M, KR Rearrangement of CRLF2 in B-progenitor- and Down Sullivan L, Mitchell J, Wetzel R, Macneill J, Ren JM, Yuan syndrome-associated acute lymphoblastic leukemia Nat J, Bakalarski CE, Villen J, Kornhauser JM, Smith B, Li D, Genet 2009 Nov;41(11):1243-6 Zhou X, Gygi SP, Gu TL, Polakiewicz RD, Rush J, Comb Santo EE, Ebus ME, Koster J, Schulte JH, Lakeman A, van MJ Global survey of phosphotyrosine signaling identifies Sluis P, Vermeulen J, Gisselsson D, Øra I, Lindner oncogenic kinases in lung cancer Cell 2007 Dec S, Buckley PG, Stallings RL, Vandesompele J, Eggert A, 14;131(6):1190-203 Caron HN, Versteeg R, Molenaar JJ Oncogenic activation Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, of FOXR1 by 11q23 intrachromosomal deletion-fusions in Ishikawa S, Fujiwara S, Watanabe H, Kurashina K, neuroblastoma Oncogene 2012 Mar 22;31(12):1571-81 Hatanaka H, Bando M, Ohno S, Ishikawa Y, Aburatani H, Pńaszczyca A, Nilsson J, Magnusson L, Niki T, Sohara Y, Sugiyama Y, Mano H Identification of the Brosjö O, Larsson O, Vult von Steyern F, Domanski transforming EML4-ALK fusion gene in non-small-cell lung HA, Lilljebjörn H, Fioretos T, Tayebwa J, Mandahl N, cancer Nature 2007 Aug 2;448(7153):561-6 Nord KH, Mertens F Fusions involving protein kinase C and membrane-associated proteins in benign fibrous Wang L, Motoi T, Khanin R, Olshen A, Mertens F, Bridge J, histiocytoma Int J Biochem Cell Biol 2014 Aug;53:475-81 Dal Cin P, Antonescu CR, Singer S, Hameed M, Bovee JV, Hogendoorn PC, Socci N, Ladanyi M Identification of a De Braekeleer E, Douet-Guilbert N, Morel F, Le Bris MJ, novel, recurrent HEY1-NCOA2 fusion in mesenchymal Meyer C, Marschalek R, Férec C, De Braekeleer M chondrosarcoma based on a genome-wide screen of exon-
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 373
General resources in Genetics and/or Oncology De Braekeleer E, et al.
level expression data Genes Chromosomes Cancer 2012 Wei L, Ma J, Kleppe M, Levine RL, Garcia-Manero G, Feb;51(2):127-39 Larsen E, Shah NP, Devidas M, Reaman G, Smith M, Paugh SW, Evans WE, Grupp SA, Jeha S, Pui CH, Gerhard Campbell PJ, Stephens PJ, Pleasance ED, O'Meara S, Li DS, Downing JR, Willman CL, Loh M, Hunger SP, Marra H, Santarius T, Stebbings LA, Leroy C, Edkins S, Hardy C, MA, Mullighan CG Genetic alterations activating kinase and Teague JW, Menzies A, Goodhead I, Turner DJ, Clee CM, cytokine receptor signaling in high-risk acute lymphoblastic Quail MA, Cox A, Brown C, Durbin R, Hurles ME, Edwards leukemia Cancer Cell 2012 Aug 14;22(2):153-66 PA, Bignell GR, Stratton MR, Futreal PA Identification of somatically acquired rearrangements in cancer using Yoshihara K, Wang Q, Torres-Garcia W, Zheng S, Vegesna genome-wide massively parallel paired-end sequencing Nat R, Kim H, Verhaak RG The landscape and therapeutic Genet 2008 Jun;40(6):722-9 relevance of cancer-associated transcript fusions Oncogene 2015 Sep 10;34(37):4845-54 Maher CA, Kumar-Sinha C, Cao X, Kalyana-Sundaram S, Han B, Jing X, Sam L, Barrette T, Palanisamy N, Mitelman F, Johansson B, Merten sF Mitelman database of Chinnaiyan AM Transcriptome sequencing to detect gene chromosome aberrations and genes fusions in Cancer fusions in cancer Nature 2009 Mar 5;458(7234):97-101 Mitelman F, Johansson B and Mertens F (Eds.) 2016, http://cgap.nci.nih.gov/Chromosomes/Mitelman Maher CA, Palanisamy N, Brenner JC, Cao X, Kalyana- Sundaram S, Luo S, Khrebtukova I, Barrette TR, Grasso C, Huret JL, Ahmad M, Arsaban M, Bernheim A, Cigna J, Yu J, Lonigro RJ, Schroth G, Kumar-Sinha C, Chinnaiyan Desangles F, Guignard JC, Jacquemot-Perbal MC, AM Chimeric transcript discovery by paired-end Labarussias M, Leberre V, Malo A, Morel-Pair C, Mossafa transcriptome sequencing Proc Natl Acad Sci U S A 2009 H, Potier JC, Texier G, Viguié F, Yau Chun Wan- Jul 28;106(30):12353-8 Senon S, Zasadzinski A, Dessen P Atlas of genetics and cytogenetics in oncology and haematology in 2013 Nucleic Stephens PJ, McBride DJ, Lin ML, Varela I, Pleasance ED, Acids Res 2013 Jan;41(Database issue):D920-4 Simpson JT, Stebbings LA, Leroy C, Edkins S, Mudie LJ, Greenman CD, Jia M, Latimer C, Teague JW, Lau KW, Mitelman F, Johansson B, Mertens F The impact of Burton J, Quail MA, Swerdlow H, Churcher C, Natrajan R, translocations and gene fusions on cancer causation Nat Sieuwerts AM, Martens JW, Silver DP, Langerød A, Rev Cancer 2007 Apr;7(4):233-45 Russnes HE, Foekens JA, Reis-Filho JS, van 't Veer L, Richardson AL, Børresen-Dale AL, Campbell PJ, Kalyana-Sundaram S, Shankar S, Deroo S, Iyer MK, Futreal PA, Stratton MR Complex landscapes of somatic Palanisamy N, Chinnaiyan AM, Kumar-Sinha C Gene rearrangement in human breast cancer genomes Nature fusions associated with recurrent amplicons represent a 2009 Dec 24;462(7276):1005-10 class of passenger aberrations in breast cancer Neoplasia 2012 Aug;14(8):702-8 Cancer Genome Atlas Research Network Comprehensive molecular characterization of clear cell renal cell carcinoma Gingeras TR Implications of chimaeric non-co-linear Nature 2013 Jul 4;499(7456):43-9 transcripts Nature 2009 Sep 10;461(7261):206-11 Cancer Genome Atlas Research Network Comprehensive Rickman DS, Pflueger D, Moss B, VanDoren VE, Chen CX, genomic characterization of squamous cell lung cancers de la Taille A, Kuefer R, Tewari AK, Setlur SR, Demichelis Nature 2012 Sep 27;489(7417):519-25 F, Rubin MA SLC45A3-ELK4 is a novel and frequent erythroblast transformation-specific fusion transcript in Cancer Genome Atlas Research Network Comprehensive prostate cancer Cancer Res 2009 Apr 1;69(7):2734-8 molecular characterization of urothelial bladder carcinoma Nature 2014 Mar 20;507(7492):315-22 Meyer C, Kowarz E, Hofmann J, Renneville A, Zuna J, Trka J, Ben Abdelali R, Macintyre E, De Braekeleer E, De Cancer Genome Atlas Research Network, Kandoth C, Braekeleer M, Delabesse E, de Oliveira MP, Cavé Schultz N, Cherniack AD, Akbani R, Liu Y, Shen H, H, Clappier E, van Dongen JJ, Balgobind BV, van den Robertson AG, Pashtan I, Shen R, Benz CC, Yau C, Laird Heuvel-Eibrink MM, Beverloo HB, Panzer-Grümayer PW, Ding L, Zhang W, Mills GB, Kucherlapati R, Mardis ER, R, Teigler-Schlegel A, Harbott J, Kjeldsen E, Schnittger S, Levine DA Integrated genomic characterization of Koehl U, Gruhn B, Heidenreich O, Chan LC, Yip SF, endometrial carcinoma Nature 2013 May 2;497(7447):67- Krzywinski M, Eckert C, Möricke A, Schrappe M, 73 Alonso CN, Schäfer BW, Krauter J, Lee DA, Zur Stadt U, Te Kronnie G, Sutton R, Izraeli S, Trakhtenbrot L, Lo Steidl C, Shah SP, Woolcock BW, Rui L, Kawahara M, Nigro L, Tsaur G, Fechina L, Szczepanski T, Strehl S, Farinha P, Johnson NA, Zhao Y, Telenius A, Neriah SB, Ilencikova D, Molkentin M, Burmeister T, Dingermann T, McPherson A, Meissner B, Okoye UC, Diepstra A, van den Klingebiel T, Marschalek R New insights to the MLL Berg A, Sun M, Leung G, Jones SJ, Connors JM, Huntsman recombinome of acute leukemias Leukemia 2009 DG, Savage KJ, Rimsza LM, Horsman DE, Staudt LM, Aug;23(8):1490-9 Steidl U, Marra MA, Gascoyne RD MHC class II transactivator CIITA is a recurrent gene fusion partner in Hedegaard J, Thorsen K, Lund MK, Hein AM, Hamilton- lymphoid cancers Nature 2011 Mar 17;471(7338):377-81 Dutoit SJ, Vang S, Nordentoft I, Birkenkamp- Demtröder K, Kruhøffer M, Hager H, Knudsen Welch JS, Westervelt P, Ding L, Larson DE, Klco JM, B, Andersen CL, Sørensen KD, Pedersen JS, Kulkarni S, Wallis J, Chen K, Payton JE, Fulton RS, Veizer Ørntoft TF, Dyrskjøt L Next-generation J, Schmidt H, Vickery TL, Heath S, Watson MA, Tomasson MH, Link DC, Graubert TA, DiPersio JF, Mardis ER, Ley TJ, sequencing of RNA and DNA isolated from paired fresh- Wilson RK Use of whole-genome sequencing to diagnose a frozen and formalin-fixed paraffin-embedded samples of cryptic fusion oncogene JAMA 2011 Apr 20;305(15):1577- human cancer and normal tissue PLoS One 2014 May 84 30;9(5):e98187 Roberts KG, Morin RD, Zhang J, Hirst M, Zhao Y, Su X, Fletcher CD The evolving classification of soft tissue Chen SC, Payne-Turner D, Churchman ML, Harvey RC, tumours - an update based on the new 2013 WHO Chen X, Kasap C, Yan C, Becksfort J, Finney RP, Teachey classification Histopathology 2014 Jan;64(1):2-11 DT, Maude SL, Tse K, Moore R, Jones S, Mungall K, Birol I, Edmonson MN, Hu Y, Buetow KE, Chen IM, Carroll WL, Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, Advani R, Ghielmini M, Salles GA, Zelenetz AD,
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 374
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Jaffe ES The 2016 revision of the World Health Kohno T, Tsuta K, Tsuchihara K, Nakaoku T, Yoh K, Goto Organization (WHO) classification of lymphoid neoplasms K RET fusion gene: translation to personalized lung cancer Blood 2016 Mar 15 therapy Cancer Sci 2013 Nov;104(11):1396-400 Hokland P, Ommen HB Towards individualized follow-up in Shaw AT, Hsu PP, Awad MM, Engelman JA Tyrosine adult acute myeloid leukemia in remission Blood 2011 Mar kinase gene rearrangements in epithelial malignancies Nat 3;117(9):2577-84 Rev Cancer 2013 Nov;13(11):772-87 Crowley E, Di Nicolantonio F, Loupakis F, Bardelli A Liquid Malik R, Khan AP, Asangani IA, Cielik M, Prensner JR, biopsy: monitoring cancer-genetics in the blood Nat Rev Wang X, Iyer MK, Jiang X, Borkin D, Escara-Wilke J, Clin Oncol 2013 Aug;10(8):472-84 Stender R, Wu YM, Niknafs YS, Jing X, Qiao Y, Palanisamy N, Kunju LP, Krishnamurthy PM, Yocum AK, Mellacheruvu Karabacak NM, Spuhler PS, Fachin F, Lim EJ, Pai V, D, Nesvizhskii AI, Cao X, Dhanasekaran SM, Feng FY, Ozkumur E, Martel JM, Kojic N, Smith K, Chen PI, Yang J, Grembecka J, Cierpicki T, Chinnaiyan AM Targeting the Hwang H, Morgan B, Trautwein J, Barber TA, Stott SL, MLL complex in castration-resistant prostate cancer Nat Maheswaran S, Kapur R, Haber DA, Toner M Microfluidic, Med 2015 Apr;21(4):344-52 marker-free isolation of circulating tumor cells from blood samples Nat Protoc 2014 Mar;9(3):694-710 Chen CW, Koche RP, Sinha AU, Deshpande AJ, Zhu N, Eng R, Doench JG, Xu H, Chu SH, Qi J, Wang X, Delaney Watanabe M, Serizawa M, Sawada T, Takeda K, Takahashi C, Bernt KM, Root DE, Hahn WC, Bradner JE, Armstrong T, Yamamoto N, Koizumi F, Koh Y A novel flow cytometry- SA DOT1L inhibits SIRT1-mediated epigenetic silencing to based cell capture platform for the detection, capture and maintain leukemic gene expression in MLL-rearranged molecular characterization of rare tumor cells in blood J leukemia Nat Med 2015 Apr;21(4):335-43 Transl Med 2014 May 23;12:143 Dawson MA, Prinjha RK, Dittmann A, Giotopoulos G, Yu KH, Ricigliano M, Hidalgo M, Abou-Alfa GK, Lowery MA, Bantscheff M, Chan WI, Robson SC, Chung CW, Hopf C, Saltz LB, Crotty JF, Gary K, Cooper B, Lapidus R, Savitski MM, Huthmacher C, Gudgin E, Lugo D, Beinke S, Sadowska M, O'Reilly EM Pharmacogenomic modeling of Chapman TD, Roberts EJ, Soden PE, Auger KR, Mirguet circulating tumor and invasive cells for prediction of O, Doehner K, Delwel R, Burnett AK, Jeffrey P, Drewes G, chemotherapy response and resistance in pancreatic Lee K, Huntly BJ, Kouzarides T Inhibition of BET cancer Clin Cancer Res 2014 Oct 15;20(20):5281-9 recruitment to chromatin as an effective treatment for MLL- Baccelli I, Schneeweiss A, Riethdorf S, Stenzinger A, fusion leukaemia Nature 2011 Oct 2;478(7370):529-33 Schillert A, Vogel V, Klein C, Saini M, Bäuerle T, McCabe MT, Ott HM, Ganji G, Korenchuk S, Thompson C, Wallwiener M, Holland-Letz T, Höfner T, Sprick M, Van Aller GS, Liu Y, Graves AP, Della Pietra A 3rd, Diaz E, Scharpff M, Marmé F, Sinn HP, Pantel K, Weichert LaFrance LV, Mellinger M, Duquenne C, Tian X, Kruger RG, W, Trumpp A Identification of a population of blood McHugh CF, Brandt M, Miller WH, Dhanak D, Verma SK, circulating tumor cells from breast cancer patients that Tummino PJ, Creasy CL EZH2 inhibition as a therapeutic initiates metastasis in a xenograft assay Nat Biotechnol strategy for lymphoma with EZH2-activating mutations 2013 Jun;31(6):539-44 Nature 2012 Dec 6;492(7427):108-12 Leary RJ, Kinde I, Diehl F, Schmidt K, Clouser C, Duncan Fillmore CM, Xu C, Desai PT, Berry JM, Rowbotham SP, C, Antipova A, Lee C, McKernan K, De La Vega FM, Kinzler Lin YJ, Zhang H, Marquez VE, Hammerman PS, Wong KK, KW, Vogelstein B, Diaz LA Jr, Velculescu VE Development Kim CF EZH2 inhibition sensitizes BRG1 and EGFR mutant of personalized tumor biomarkers using massively parallel lung tumours to TopoII inhibitors Nature 2015 Apr sequencing Sci Transl Med 2010 Feb 24;2(20):20ra14 9;520(7546):239-42 Druker BJ, Sawyers CL, Kantarjian H, Resta DJ, Reese SF, Bernheim A, Huret JL, Guillaud-Bataille M, Brison O, Ford JM, Capdeville R, Talpaz M Activity of a specific Couturiers J; Groupe Français de inhibitor of the BCR-ABL tyrosine kinase in the blast crisis Cytogéné Oncologique [Cytogenetics, of chronic myeloid leukemia and acute lymphoblastic cytogenomics and cancer: 2004 update] Bull Cancer 2004 leukemia with the Philadelphia chromosome N Engl J Med Jan;91(1):29-43 2001 Apr 5;344(14):1038-42 BEADLE GW Genetics and metabolism in Neurospora Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Physiol Rev 1945 Oct;25:643-63 Ford JM, Lydon NB, Kantarjian H, Capdeville R, Ohno- Jones S, Sawyers CL Efficacy and safety of a specific Burks C, Fickett JW, Goad WB, Kanehisa M, Lewitter FI, inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid Rindone WP, Swindell CD, Tung CS, Bilofsky HS The leukemia N Engl J Med 2001 Apr 5;344(14):1031-7 GenBank nucleic acid sequence database Comput Appl Biosci 1985 Dec;1(4):225-33 Rutkowski P, Van Glabbeke M, Rankin CJ, Ruka W, Rubin BP, Debiec-Rychter M, Lazar A, Gelderblom H, Sciot R, Burks C, Cassidy M, Cinkosky MJ, Cumella KE, Gilna P, Lopez-Terrada D, Hohenberger P, van Oosterom AT, Hayden JE, Keen GM, Kelley TA, Kelly M, Kristofferson D, Schuetze SM; European Organisation for Research and et al GenBank Nucleic Acids Res 1991 Apr 25;19 Treatment of Cancer Soft Tissue/Bone Sarcoma Group; Suppl:2221-5 Southwest Oncology Group Imatinib mesylate in advanced dermatofibrosarcoma protuberans: pooled analysis of two Benton D Recent changes in the GenBank On-line Service phase II clinical trials J Clin Oncol 2010 Apr 1;28(10):1772- Nucleic Acids Res 1990 Mar 25;18(6):1517-20 9 Benson DA, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell Joensuu H Adjuvant treatment of GIST: patient selection J, Sayers EW GenBank Nucleic Acids Res 2015 and treatment strategies Nat Rev Clin Oncol 2012 Apr Jan;43(Database issue):D30-5 24;9(6):351-8 Cook CE, Bergman MT, Finn RD, Cochrane G, Birney E, Lee HJ, Thompson JE, Wang ES, Wetzler M Philadelphia Apweiler R The European Bioinformatics Institute in 2016: chromosome-positive acute lymphoblastic leukemia: Data growth and integration Nucleic Acids Res 2016 Jan current treatment and future perspectives Cancer 2011 Apr 4;44(D1):D20-6 15;117(8):1583-94
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 375
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Pundir S, Magrane M, Martin MJ, O'Donovan C; UniProt Martincorena I, Campbell PJ Somatic mutation in cancer Consortium Searching and Navigating UniProt Databases and normal cells Science 2015 Sep 25;349(6255):1483-9 Curr Protoc Bioinformatics 2015 Jun 19;50:1 Sverre Heim and Felix Mitelman Cancer Cytogenetics: Gray KA, Yates B, Seal RL, Wright MW, Bruford EA Chromosomal and Molecular Genetic Abberations of Tumor Genenames org: the HGNC resources in 2015 Nucleic Cells 2015, Wiley-Blackwell , New-York Acids Res Dorkeld F, Bernheim A, Dessen P, Huret JL A database on NCBI Resource Coordinators Database resources of the cytogenetics in haematology and oncology Nucleic Acids National Center for Biotechnology Information Nucleic Acids Res 1999 Jan 1;27(1):353-4 Res 2016 Jan 4;44(D1):D7-19 A PROPOSED standard system of nomenclature of human Fishilevich S, Zimmerman S, Kohn A, Iny Stein T, Olender mitotic chromosomes Lancet 1960 May 14;1(7133):1063-5 T, Kolker E, Safran M, Lancet D Genic insights from PubMed PMID: 13857542 integrated human proteomics in GeneCards Database (Oxford) 2016 Apr 5;2016 Shaffer LG, McGowen-Jordan J, Schmid M, editors An International System for Human Cytogenetic Nomenclature Goldman M, Craft B, Swatloski T, Cline M, Morozova O, 2013, Basel: S. Karger Diekhans M, Haussler D, Zhu J The UCSC Cancer Genomics Browser: update 2015 Nucleic Acids Res 2015 Mitelman F, Johansson B, Mertens F Mitelman database of Jan;43(Database issue):D812-7 chromosome aberrations and genes fusions in Cancer
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 376
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Skotheim RI, Thomassen GO, Eken M, Lind GE, Micci F, Cai H, Gupta S, Rath P, Ai N, Baudis M arrayMap 2014: an Ribeiro FR, Cerveira N, Teixeira MR, Heim S, Rognes T, updated cancer genome resource Nucleic Acids Res 2015 Lothe RA A universal assay for detection of oncogenic Jan;43(Database issue):D825-30 fusion transcripts by oligo microarray analysis Mol Cancer 2009 Jan 19;8:5 Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y, Scherer SW, Lee C Detection of large-scale variation Urakami K, Shimoda Y, Ohshima K, Nagashima T, in the human genome Nat Genet 2004 Sep;36(9):949-51 Serizawa M, Tanabe T, Saito J, Usui T, Watanabe Y, Naruoka A, Ohnami S, Ohnami S, Mochizuki T, Kusuhara Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews M, Yamaguchi K Next generation sequencing approach for TD, Fiegler H, Shapero MH, Carson AR, Chen W, Cho EK, detecting 491 fusion genes from human cancer Biomed Res Dallaire S, Freeman JL, González JR, 2016;37(1):51-62 Gratacòs M, Huang J, Kalaitzopoulos D, Komura D, MacDonald JR, Marshall CR, Mei R, Montgomery L, Babiceanu M, Qin F, Xie Z, Jia Y, Lopez K, Janus N, Nishimura K, Okamura K, Shen F, Somerville MJ, Tchinda Facemire L, Kumar S, Pang Y, Qi Y, Lazar IM, Li H J, Valsesia A, Woodwark C, Yang F, Zhang J, Zerjal T, Recurrent chimeric fusion RNAs in non-cancer tissues and Zhang J, Armengol L, Conrad DF, Estivill X, Tyler-Smith C, cells Nucleic Acids Res 2016 Apr 7;44(6):2859-72 Carter NP, Aburatani H, Lee C, Jones KW, Scherer SW, Hurles ME Global variation in copy number in the human Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray genome Nature 2006 Nov 23;444(7118):444-54 JW, Waldman F, Pinkel D Comparative genomic hybridization for molecular cytogenetic analysis of solid MacDonald JR, Ziman R, Yuen RK, Feuk L, Scherer SW tumors Science 1992 Oct 30;258(5083):818-21 The Database of Genomic Variants: a curated collection of structural variation in the human genome Nucleic Acids Res Solinas-Toldo S, Lampel S, Stilgenbauer S, Nickolenko J, 2014 Jan;42(Database issue):D986-92 Benner A, Döhner H, Cremer T, Lichter P Matrix- based comparative genomic hybridization: biochips to Firth HV, Richards SM, Bevan AP, Clayton S, Corpas M, screen for genomic imbalances Genes Chromosomes Rajan D, Van Vooren S, Moreau Y, Pettett RM, Carter NP Cancer 1997 Dec;20(4):399-407 DECIPHER: Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources Am J Pinkel D, Segraves R, Sudar D, Clark S, Poole I, Kowbel D, Hum Genet 2009 Apr;84(4):524-33 Collins C, Kuo WL, Chen C, Zhai Y, Dairkee SH, Ljung BM, Gray JW, Albertson DG High resolution analysis of DNA 1000 Genomes Project Consortium, Auton A, Brooks LD, copy number variation using comparative genomic Durbin RM, Garrison EP, Kang HM, Korbel JO, Marchini JL, hybridization to microarrays Nat Genet 1998 McCarthy S, McVean GA, Abecasis GR A global reference Oct;20(2):207-11 for human genetic variation Nature 2015 Oct 1;526(7571):68-74 Commo F, Ferté C, Soria JC, Friend SH, André F, Guinney J Impact of centralization on International HapMap 3 Consortium, Altshuler DM, Gibbs aCGH-based genomic profiles for precision medicine in RA, Peltonen L, Altshuler DM, Gibbs RA, Peltonen L, oncology Ann Oncol 2015 Mar;26(3):582-8 Dermitzakis E, Schaffner SF, Yu F, Peltonen L, Dermitzakis E, Bonnen PE, Altshuler DM, Gibbs RA, de Bakker PI, Clough E, Barrett T The Gene Expression Omnibus Deloukas P, Gabriel SB, Gwilliam R, Hunt S, Inouye M, Jia Database Methods Mol Biol 2016;1418:93-110 X, Palotie A, Parkin M, Whittaker P, Yu F, Chang K, Hawes Petryszak R, Keays M, Tang YA, Fonseca NA, Barrera E, A, Lewis LR, Ren Y, Wheeler D, Gibbs RA, Muzny DM, Burdett T, Füllgrabe A, Fuentes AM, Jupp S, Barnes C, Darvishi K, Hurles M, Korn JM, Kristiansson K, Koskinen S, Mannion O, Huerta L, Megy K, Snow C, Lee C, McCarrol SA, Nemesh J, Dermitzakis E, Keinan A, Williams E, Barzine M, Hastings E, Weisser H, Wright J, Montgomery SB, Pollack S, Price AL, Soranzo N, Bonnen Jaiswal P, Huber W, Choudhary J, Parkinson HE, Brazma PE, Gibbs RA, Gonzaga-Jauregui C, Keinan A, Price AL, A Expression Atlas update--an integrated database of gene Yu F, Anttila V, Brodeur W, Daly MJ, Leslie S, McVean G, and protein expression in humans, animals and plants Moutsianas L, Nguyen H, Schaffner SF, Zhang Q, Ghori MJ, Nucleic Acids Res 2016 Jan 4;44(D1):D746-52 McGinnis R, McLaren W, Pollack S, Price AL, Schaffner SF, Takeuchi F, Grossman SR, Shlyakhter I, Hostetter EB, Beroukhim R, Mermel CH, Porter D, Wei G, Raychaudhuri Sabeti PC, Adebamowo CA, Foster MW, Gordon DR, S, Donovan J, Barretina J, Boehm JS, Dobson J, Urashima Licinio J, Manca MC, Marshall PA, Matsuda I, Ngare D, M, Mc Henry KT, Pinchback RM, Ligon AH, Cho YJ, Haery Wang VO, Reddy D, Rotimi CN, Royal CD, Sharp RR, Zeng L, Greulich H, Reich M, Winckler W, Lawrence MS, Weir C, Brooks LD, McEwen JE Integrating common and rare BA, Tanaka KE, Chiang DY, Bass AJ, Loo A, Hoffman C, genetic variation in diverse human populations Nature 2010 Prensner J, Liefeld T, Gao Q, Yecies D, Signoretti S, Maher Sep 2;467(7311):52-8 E, Kaye FJ, Sasaki H, Tepper JE, Fletcher JA, Tabernero J, Baselga J, Tsao MS, Demichelis F, Rubin MA, Janne PA, Tennessen JA, Bigham AW, O'Connor TD, Fu W, Kenny Daly MJ, Nucera C, Levine RL, Ebert BL, Gabriel S, Rustgi EE, Gravel S, McGee S, Do R, Liu X, Jun G, Kang HM, AK, Antonescu CR, Ladanyi M, Letai A, Garraway LA, Loda Jordan D, Leal SM, Gabriel S, Rieder MJ, Abecasis G, M, Beer DG, True LD, Okamoto A, Pomeroy SL, Singer S, Altshuler D, Nickerson DA, Boerwinkle E, Sunyaev S, Golub TR, Lander ES, Getz G, Sellers WR, Meyerson M Bustamante CD, Bamshad MJ, Akey JM; Broad GO; Seattle The landscape of somatic copy-number alteration across GO; NHLBI Exome Sequencing Project Evolution and human cancers Nature 2010 Feb 18;463(7283):899-905 functional impact of rare coding variation from deep Kim TM, Xi R, Luquette LJ, Park RW, Johnson MD, Park PJ sequencing of human exomes Science 2012 Jul Functional genomic analysis of chromosomal aberrations in 6;337(6090):64-9 a compendium of 8000 cancer genomes Genome Res Futreal PA, Coin L, Marshall M, Down T, Hubbard T, 2013 Feb;23(2):217-27 Wooster R, Rahman N, Stratton MR A census of human Cao Q, Zhou M, Wang X, Meyer CA, Zhang Y, Chen Z, Li cancer genes Nat Rev Cancer 2004 Mar;4(3):177-83 C, Liu XS CaSNP: a database for interrogating copy number Cooper DN, Krawczak M Human Gene Mutation Database alterations of cancer genome from SNP array data Nucleic Hum Genet 1996 Nov;98(5):629 Acids Res 2011 Jan;39(Database issue):D968-74
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 377
General resources in Genetics and/or Oncology De Braekeleer E, et al.
Fokkema IF, Taschner PE, Schaafsma GC, Celli J, Laros Rosenbloom KR, Armstrong J, Barber GP, Casper J, JF, den Dunnen JT LOVD v. 2.0: the next generation in Clawson H, Diekhans M, Dreszer TR, Fujita PA, Guruvadoo gene variant databases. Hum Mutat. May;32(5):557-63 L, Haeussler M, Harte RA, Heitner S, Hickey G, Hinrichs AS, Hubley R, Karolchik D, Learned K, Lee BT, Li CH, Miga KH, Deng M, Brägelmann J, Schultze JL, Perner S Web- Nguyen N, Paten B, Raney BJ, Smit AF, Speir ML, Zweig TCGA: an online platform for integrated analysis of AS, Haussler D, Kuhn RM, Kent WJ The UCSC Genome molecular cancer data sets BMC Bioinformatics 2016 Feb Browser database: 2015 update Nucleic Acids Res 2015 6;17:72 Jan;43(Database issue):D670-81 Gundem G, Perez-Llamas C, Jene-Sanz A, Kedzierska A, Wu C, Jin X, Tsueng G, Afrasiabi C, Su AI BioGPS: building Islam A, Deu-Pons J, Furney SJ, Lopez-Bigas N IntOGen: your own mash-up of gene annotations and expression integration and data mining of multidimensional profiles Nucleic Acids Res 2016 Jan 4;44(D1):D313-6 oncogenomic data Nat Methods 2010 Feb;7(2):92-3 UniProt Consortium UniProt: a hub for protein information Wu TJ, Shamsaddini A, Pan Y, Smith K, Crichton DJ, Nucleic Acids Res 2015 Jan;43(Database issue):D204-12 Simonyan V, Mazumder R A framework for organizing cancer-related variations from existing databases, Gaudet P, Michel PA, Zahn-Zabal M, Cusin I, Duek PD, publications and NGS data using a High-performance Evalet O, Gateau A, Gleizes A, Pereira M, Teixeira D, Integrated Virtual Environment (HIVE) Database (Oxford) Zhang Y, Lane L, Bairoch A The neXtProt knowledgebase 2014 Mar 25;2014:bau022 on human proteins: current status Nucleic Acids Res 2015 Jan;43(Database issue):D764-70 Minikel EV, Vallabh SM, Lek M, Estrada K, Samocha KE, Sathirapongsasuti JF, McLean CY, Tung JY, Yu LP, Hornbeck PV, Zhang B, Murray B, Kornhauser JM, Latham Gambetti P, Blevins J, Zhang S, Cohen Y, Chen W, Yamada V, Skrzypek E PhosphoSitePlus, 2014: mutations, PTMs M, Hamaguchi T, Sanjo N, Mizusawa H, Nakamura Y, and recalibrations Nucleic Acids Res 2015 Kitamoto T, Collins SJ, Boyd A, Will RG, Knight R, Ponto C, Jan;43(Database issue):D512-20 Zerr I, Kraus TF, Eigenbrod S, Giese A, Calero M, de Pedro- Cuesta J, Haïk S, Laplanche JL, Bouaziz-Amar E, Sigrist CJ, de Castro E, Cerutti L, Cuche BA, Hulo N, Bridge Brandel JP, Capellari S, Parchi P, Poleggi A, Ladogana A, A, Bougueleret L, Xenarios I New and continuing O'Donnell-Luria AH, Karczewski KJ, Marshall JL, Boehnke developments at PROSITE Nucleic Acids Res 2013 M, Laakso M, Mohlke KL, Kähler A, Chambert K, Jan;41(Database issue):D344-7 McCarroll S, Sullivan PF, Hultman CM, Purcell SM, Sklar P, Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, van der Lee SJ, Rozemuller A, Jansen C, Hofman A, Kraaij Mitchell AL, Potter SC, Punta M, Qureshi M, Sangrador- R, van Rooij JG, Ikram MA, Uitterlinden AG, van Duijn CM; Vegas A, Salazar GA, Tate J, Bateman A The Pfam protein Exome Aggregation Consortium (ExAC), Daly MJ, families database: towards a more sustainable future MacArthur DG Quantifying prion disease penetrance using Nucleic Acids Res 2016 Jan 4;44(D1):D279-85 large population control cohorts Sci Transl Med 2016 Jan 20;8(322):322ra9 Mitchell A, Chang HY, Daugherty L, Fraser M, Hunter S, Lopez R, McAnulla C, McMenamin C, Nuka G, Pesseat S, AUTHORS Birth Defects Cytogenet Cell Genet. Sangrador-Vegas A, Scheremetjew M, Rato C, Yong SY, 1974;13(3):1-216 Bateman A, Punta M, Attwood TK, Sigrist CJ, Redaschi N, Harrison SM, Riggs ER, Maglott DR, Lee JM, Azzariti DR, Rivoire C, Xenarios I, Kahn D, Guyot D, Bork P, Letunic I, Niehaus A, Ramos EM, Martin CL, Landrum MJ, Rehm HL Gough J, Oates M, Haft D, Huang H, Natale DA, Wu CH, Using ClinVar as a Resource to Support Variant Orengo C, Sillitoe I, Mi H, Thomas PD, Finn RD The InterPro Interpretation Curr Protoc Hum Genet 2016 Apr 1;89:8 protein families database: the classification resource after 15 years Nucleic Acids Res 2015 Jan;43(Database Yue P, Moult J Identification and analysis of deleterious issue):D213-21 human SNPs J Mol Biol 2006 Mar 10;356(5):1263-74 Pagon RA GeneTests: an online genetic information Rubinstein WS, Maglott DR, Lee JM, Kattman BL, Malheiro resource for health care providers J Med Libr Assoc 2006 AJ, Ovetsky M, Hem V, Gorelenkov V, Song G, Wallin C, Jul;94(3):343-8 Husain N, Chitipiralla S, Katz KS, Hoffman D, Jang W, Johnson M, Karmanov F, Ukrainchik A, Denisenko M, Rath A, Olry A, Dhombres F, Brandt MM, Urbero B, Ayme Fomous C, Hudson K, Ostell JM The NIH genetic testing S Representation of rare diseases in health information registry: a new, centralized database of genetic tests to systems: the Orphanet approach to serve a wide range of enable access to comprehensive information and improve end users Hum Mutat 2012 May;33(5):803-8 transparency Nucleic Acids Res 2013 Jan;41(Database Hnisz D, Weintraub AS, Day DS, Valton AL, Bak RO, Li CH, issue):D925-35 Goldmann J, Lajoie BR, Fan ZP, Sigova AA, Reddy J, O'Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, Borges-Rivera D, Lee TI, Jaenisch R, Porteus MH, Dekker McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako- J, Young RA Activation of proto-oncogenes by disruption of chromosome neighborhoods Science 2016 Mar Adjei D, Astashyn A, Badretdin A, Bao Y, Blinkova O, Brover 25;351(6280):1454-8 V, Chetvernin V, Choi J, Cox E, Ermolaeva O, Farrell CM, Goldfarb T, Gupta T, Haft D, Hatcher E, Hlavina W, Joardar Wildschutte JH, Williams ZH, Montesion M, Subramanian VS, Kodali VK, Li W, Maglott D, Masterson P, McGarvey RP, Kidd JM, Coffin JM Discovery of unfixed endogenous KM, Murphy MR, O'Neill K, Pujar S, Rangwala SH, Rausch retrovirus insertions in diverse human populations Proc Natl D, Riddick LD, Schoch C, Shkeda A, Storz SS, Sun H, Acad Sci U S A 2016 Apr 19;113(16):E2326-34 Thibaud-Nissen F, Tolstoy I, Tully RE, Vatsan AR, Wallin C, Lawler M, Siu LL, Rehm HL, Chanock SJ, Alterovitz G, Burn Webb D, Wu W, Landrum MJ, Kimchi A, Tatusova T, J, Calvo F, Lacombe D, Teh BT, North KN, Sawyers CL; DiCuccio M, Kitts P, Murphy TD, Pruitt KD Reference Clinical Working Group of the Global Alliance for sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation Nucleic Genomics and Health (GA4GH) All the World's a Stage: Acids Res 2016 Jan 4;44(D1):D733-45 Facilitating Discovery Science and Improved Cancer Care through the Global Alliance for Genomics and Health Cancer Discov 2015 Nov;5(11):1133-6
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 378
General resources in Genetics and/or Oncology De Braekeleer E, et al.
This article should be referenced as such: De Braekeleer E, Huret JL, Mossafa H, Hautaviita K, Dessen P. Cancer Cytogenomics resources. Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6):359-379.
Atlas Genet Cytogenet Oncol Haematol. 2016; 20(6) 379 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS
Policies- Instructions to Authors See http://documents.irevues.inist.fr/bitstream/handle/2042/48486/Instructions-to-authors.pdf Manuscripts submitted to the Atlas must be submitted solely to the Atlas. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. Case Reports in haematological malignancies are dedicated to recurrent –but rare- chromosomes abnormalities in leukaemias/lymphomas; see http://atlasgeneticsoncology.org//BackpageAuthors.html#CASE_REPORTS . It is mandatory to use the specific "Submissionformfor Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Research articlesThe Atlas of Genetics and Cytogenetics in Oncology and Haematology does not publish research articles. Authorship All authors should qualify for authorship according to the ICMJE criteria.
Editorial Ethics see http://documents.irevues.inist.fr/bitstream/handle/2042/56068/Policies-editorial-ethics.pdf for: Peer Review Process / Commissioned papers vs Unsolicited papers /Responsibility for the reviewers / Editorial responsibilities / Conflict of interest- Competing interests/ Privacy and Confidentiality - Iconography / Protection of Human Subjects and Animals in Research / Duplicate Publication/ Plagiarism / Retracting a publication
Subscription The Atlas is FREE! Costs/Page Charge There is NO page charge. PubMed Central Once the paper online, authors are encouraged to send their manuscript to PubMed Central http://www.ncbi.nlm.nih.gov/pmc/ with reference to the original paper in the Atlas in http://documents.irevues.inist.fr/handle/2042/15655
Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].
Rules, Copyright Notice and Disclaimer http://documents.irevues.inist.fr/bitstream/handle/2042/48487/Copyright-sponsorship.pdf Property As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org. http://AtlasGeneticsOncology.org © ATLAS - ISSN 1768-3262 Atlas of Genetics and Cytogenetics in Oncology and Haematology
OPEN ACCESS JOURNAL INIST-CNRS