INTROGRESSION of COTTON LEAF CURL VIRUS RESISTANCE GENES from Gossypium Arboreum

FINAL RESEARCH PROGRESS REPORT OF PARB’S CGS PROJECT NO. 127

NOVEL APPROACH TO GENERATE WIDE SPECTRUM RESISTANCE TO ALL COTTON BEGOMOVIRUSES INFECTING COTTON AND OTHER CULTIVATED CROPS

Transgen Contr

Submitted by: Professor Dr. Muhammad Saleem Haider, Director, Institute of Agricultural Sciences, University of the Punjab, Lahore.

Table of contents

S. No. Title Page No. Basic information of the Project 1

Executive Summary 4

1 Introduction 5

2 Project Objective 5

3 Outputs planned for the project 5 4 Detailed component wise methodology adopted, data 6 analyzed and results obtained 5 Description of the process in a manner of carrying it out in 30 practice

6 Component wise salient achievements 32

7 Overall progress of the problem searched 33 8 Varieties, breeds, vaccines or products developed and 33 patented

9 No. of national and international papers published 33

10 No. of Ph.D/M.Phil. produced 34

11 Papers presented in national and international institutes 34

12 Any other achievement 35

13 Current Status of Commercialization of Project 35 14 Impact of the project on strengthening of the institutional 35 infrastructure, machinery, equipment and human resources

15 Constraints in the Project 36

16 Suggestions for future research and development 36

17 References 37

Annexure 38

Basic Information of the Project

Name of the project Novel approach to generate wide spectrum resistance to all cotton begomoviruses infecting cotton and other cultivated crops Project period June 1st 2009 to May 31st 2016 Total project duration 48 Months Total Project cost Rs. 32.039 million Total Expenditures Rs. 32.035 millions Name of the Project Dr. M. Saleem Haider Manager with designation Professor and Director Phone and Email Telephone: 042-99231847 Email: [email protected] Host Institute Institute of Agricultural Sciences, University of the Punjab, Lahore Name and Designation of the COLABBORATING SCIENTIST Team Leader with Name of Name of the Team Leader: Dr. M.G. AbouHaidar the Collaborating institute Institute: University of Toronto, Canada Qualification and Experience): Telephone: 416 978 5615 Email: [email protected] Fax: 416 978 5878 Overseas cooperating a. Name of Organization: scientist and organization University of Toronto (Canada) b. Institute/Division/Section/ Department of Cell and Systems Biology c. Administrative Contacts: Tamar Mamourian d. Head of the Institution (Director/Chairman/Division Head etc.) Name: Dr. D. Goring Title: Professor and Chair Telephone: 416 978 2378 Email: [email protected] COLABBORATING SCIENTIST Name of the Team Leader: Dr. M.G. AbouHaidar Institute: University of Toronto, Canada Qualification and Experience): Telephone: 416 978 5615 Email: [email protected] Fax: 416 978 5878

Executive Summary The largest genus of the family Geminiviridae, Begomovirus, derives its name from Bean golden mosaic virus (Idris et al., 1999) which is now called Bean golden yellow mosaic virus (BGYMV). These are dicotyledonous-infecting, whitefly-transmitted geminiviruses. Cotton is a cash crop and begomoviruses cause serious yield losses in cotton and other crops in Pakistan particularly in the Punjab region, due to spread of a fatal viral disease CLCuD. RNAi technique can be used to enhance plants resistance against viruses (Nahid et al., 2011). Due to this technique the transgenic plants in the current research have shown resistance when infected with viral attack. Five districts of Punjab i.e. Vehari, Multan, Bahawalpur, Bahawalnagar and Rahim Yar Khan were surveyed for collection of virus infected plant samples. DNA from these samples were extracted by CTAB method and quantified by spectrophotometer. Confirmation through sequencing of the clones helped in preparing infectious clones. These infectious clones were used to test the resistance of transgenic and non-transgenic plants. Transgenic plants (T1 and T2 generation) have been analyzed and have shown promising results regarding their resistance to CLCuD and allied begomoviruses. In order to assess the resistance of transgenic plants, plants were inoculated with CLCuD infectious clones or through whitefly under natural conditions (T1 and T2 generations) and as control non-transgenic plants were also inoculated. Appearance of no or mild symptoms in transgenic tobacco, cotton and exhibition of typical symptoms of CLCuD in control plants proved that hp RNAi construct providing resistance to virus infection. First and second generation (T1 and T2) of transgenic cotton plants harboring pART27 IGS-IR construct were sown in CEMB/IAGS fields according to recommended biosafety guidelines. Verification of IGS-IR construct in T1 was done by PCR based testing. Southern blot analysis was performed to check the viral load in T1 plants. Nevertheless, patent has been filed in Higher Education Commission, Islamabad and for bio-safety clearance National biosafety commission, Islamabad has been intimated regarding certification of our product and response in this regard is awaited.

1. Introduction Begomoviruses are known to be a major problem in the cotton and other crops in Pakistan particularly in the Punjab region. Crops infected with these viruses show a notable decrease in the yield which results in major losses for farmers in particular and for the nation’s economy in general. Viruses of the genus Begomovirus (family Geminiviridae) are a major constraint to the agricultural output of many tropical and sub-tropical countries including Pakistan. The majority of the economically important geminiviruses fall into the genus Begomovirus. These viruses are transmitted exclusively by the whitefly Bemisia tabaci and affect almost all dicotyledonous crop species. The most prominent example is cotton leaf curl disease (CLCuD), which is caused by a complex of begomoviruses, and caused huge losses to Pakistan economy since its emergence in early 1990s. Occurrence of whitefly-transmitted diseases in plants, particularly in vegetables, ornamental plants, agricultural and economic crops presents a challenge for plant scientists concerned with the yield and quality in plant production. In recent years, the role of whitefly and begomoviruses both in yield and quality interest has been recognized. 2. Project Objective To develop transgenic cotton plants with RNAi-based resistance to cotton leaf curl disease (CLCuD) caused by begomoviruses. 3. Outputs planned for the project:(As per project document) Output-1: Generation of proper binary plasmid AEV construct Output-2: Survey of field for CLCuD/ whitefly sampling from cotton or other host plants (exhibiting CLCuD like symptoms). Five districts of Punjab i.e. Vehari, Multan, Bahawalpur, Bahawalnagar and Rahim Yar Khan and a neighbouring district of Sindh from the cotton belt will be surveyed. On an average twenty five samples will be collected from each district. Output-3: Analysis of samples collected in output 2 Output-4: Development of AEV Transgenic tobacco Output-5: Rearing of whiteflies and CLCuD transmission studies Output-6: Testing for resistance of transgenic tobacco plants Output-7: Generation of proper binary plasmid CLCuD construct Output-8: Production of CLCuD infectious clones Output-9: Development of CLCuD resistant transgenic tobacco and cotton Output-10: Testing of CLCuD infectious clones

Output-11: Testing of CLCuD resistant transgenic tobacco and cotton Output-12: Testing of CLCuD resistant transgenic tobacco and cotton T1 plants Output-13: Testing of CLCuD resistant transgenic tobacco and cotton T2 plants Output-14: Take care of IPR and Bio-safety rules Output-15: Evaluation of Advanced generation Output-16: Evaluation of Advanced generation and Biosafety Studies of Transgenic Cotton Plants. Output-17: Reconfirmation of CLCuD incidence, multiplication of transgenic lines seed at multi location and crossing with otherwise good material. 4. Detailed component wise methodology adopted, data analyzed and results obtained (Attach raw data as annexure) Output-1 (Institute of Agricultural Sciences, University of the Punjab, Lahore) Generation of proper binary plasmid AEV construct Activity-1: Designing of primer and amplification of RNAi product The following primers are designed with appropriate restriction enzyme sites to amplify sequence from AEV–A itergenic region (Annexure: 1; Fig. 1) by using PCR method For Sense region (actccaatggcataattgtaataacaaaactttaatttgaaatttaaaaaaaaggctaaagcggccatccgtataatattaccggatggccgcg atttttttaaagtggtcccccctgacaaagacatgtccaccaatctaaagcgtcgctcaaagcttaattgtttcgtggtccc) AEVKpnIFoR: 5′ CTGACAGGTACCACTCCAATGGCATAATTGTA 3′ AEVSalIRev: 5′ GACTGAGTCGACGGGACCACGAAACAATTAAG3′ For antisense region AEVForClaI: 5′ CTGACAATCGATACTCCAATGGCATAATTGTA3′ AEVNheIRev: 5′ GACTGAGCTAGCGGGACCACGAAACAATTAAG3′

Activity-2: Ligation and cloning of the RNAi fragment into Binary vector The PCR products having sense and antisense region were digested with appropriate enzymes and ligated into the plasmid (pHANNIBAL with ampicillin resistance gene as a bacterial selectable marker) also digested with the appropriate enzymes by using existing laboratory standard protocols. The plasmid was transformed into E. coli for plasmid DNA amplification by using heat-shock method. The hairpin cassette was then removed from pHANNIBAL vector using NotI sites and cloned into pART27 (binary vector with spectinomycin/streptomycin resistance gene as a bacterial selectable marker) in a single step

6 using the NotI restriction sites. The clone was confirmed by digestion with NotI restriction enzyme (Annexure: 1; Fig. 2).

Restriction analysis Plasmid DNA was digested using the recommended buffers and reaction conditions described by the restriction enzyme suppliers (i.e. NEB and Fermentas). Typically, DNA was digested in 50 µl reactions containing 5 µl 10X buffer and 5 units of enzyme overnight at 37 °C. The DNA was then deproteinated by phenol-chloroform extraction (Annexure: 1; Fig. 3).

Activity-3: Verification of proper binary construct The vector product was further confirmed by sequencing at The Centre for Applied Genomics. The sequencing facility provides high-quality capillary-based fluorescent sequencing on dual ABI 3730XL instruments. Samples were prepared for sequencing by using the standard protocols. Following primers were used for sequencing sense and antisense regions.

PDK3: 5′ TTCGTCTTACACATCACTTG 3′ (Reverse Primer) PDK5: 5′ TCGAACATGAATAAACAAGG3′ (Forward primer)

Following are the sequences of pHannibal clone with the intergenic region of AEV-A cloned in the forward and reverse direction. ACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGG

XhoI/SalI AGAGGACACGCTCGACGGGACCACGAAACAATTAAGCTTTGAGCGACGCTTTAGATTG GTGGACATGTCTTTGTCAGGGGGGACCACTTTAAAAAAATCGCGGCCATCCGGTAATA TTATACGGATGGCCGCTTTAGCCTTTTTTTTAAATTTCAAATTAAAGTTTTGTTATTACA

KpnI Plant intron pdk gene ATTATGCCATTGGAGTGGTACCCCAGCTTGGTAAGGAAATAATTATTTTCTTTTTTCCTTTT GTATAAAATAGTTAAGTGATGTTAATTAGTATGATTATAATAATATAGTTGTTA//AACATGAA TAAACAAGGTAACATGATAGATCATGTCATTGTGTTATCATTGATCTTACATTTGGATT

Plant intron pdk gene ClaI GATTACAGTTGGGAAGCTGGGTTCGAAATCGATACTCCAATGGCATAATTGTAATAACAA AACTTTAATTTGAAATTTAAAAAAAAGGCTAAAGCGGCCATCCGTATAATATTACCGGA TGGCCGCGATTTTTTTAAAGTGGTCCCCCCTGACAAAGACATGTCCACCAATCTAAAGC

XbaI/NheI GTCGCTCAAAGCTTAATTGTTTCGTGGTCCCGCTAGAGTCCTGCTTTAATGAGATATGCGA GACGCCTATGATCGCATGATATTTGCTTTCAATTCTGTTGTGCACGTTGTAAAAAACCTGAGCA TGTGTAGCTCAGATCCTTACCGCCGGTTTCGGTTCATTCTAATGAATATATCACCCGTTACTAT CGTATTTTTATGAATAATATTCTCCGTTCAATTTACTGATTGTACCCTACTACTTATATGTACAA TATTAAAATGA

Output-2 Survey of field for CLCuD/ whitefly sampling from cotton or other host plants (exhibiting CLCuD like symptoms). Five districts of Punjab i.e. Vehari, Multan, Bahawalpur, Bahawalnagar and Rahim Yar Khan and a neighbouring district of Sindh from the cotton belt will be surveyed. On an average twenty five samples will be collected from each district.

Activity-1: Collection of CLCuD samples and whitefly from all the above named districts during cotton season in 2009 and 2010: 2009: Bahawalpur 9, Multan 19, Bahawalnagar 5, Rahimyar Khan 4, Vehari 22, other districts 7. Total = 66 2010: Bahawalpur 23, Multan 25, Bahawalnagar 26, Rahimyar Khan 22, Vehari 27 Total = 123 Activity-2: Collection of CLCuD samples of other host plants from all the above named districts during the season when cotton crop is not in the field Bahawalpur 9, Multan 5, Bahawalnagar 6, Rahimyar Khan 5, Vehari 8, other districts 19 Total = 52 Output 3 Analysis of samples collected in output 2

Activity-1: Extraction of total DNA DNA from 66 samples were extracted by CTAB method and quantified by spectrophotometer (Annexure: 2; Table. 1). Activity-2: Detection of CLCuD through specific primers Following primers were used for the detection of CLCuD (Annexure: 2; Fig. 1,2,3 &4). CLCV1 CCGTGCTGCTGCCCCCATTGTCCGCGTACAC

CLCV2 CTGCCACAACCATGGATTCACGCACAGGG Begomo F ACGCGTGCCGTGCTGCTGCCCCCATTGTCC Begomo R ACGCGTATGGGCTGYCGAAGTTSAGAC

Summary of the Table 1: Total plant samples=117 66 processed Out of 66 Total samples positive for the virus or beta=30 Full length virus = 15 Positive with diagnostic primers = 12 Positive for beta = 15 Samples positive only for beta = 03 Total clones = 16 Total clones sequenced = 15 Virus Clones with seq = 07 (G9, G17, G18, G19, G20, G22, G01) Beta clones with seq = 05 (G23, G05, G24, G25, G30) Rubbish clones = 03 (G13, G14, G26) Repeated samples (with RCA) = 19, Eight samples which were previously negative are now positive. Activity-3: Primer designing and production of full length clones Following clones of begomoviruses were produced from plants (Annexure: 2; Fig. 5A &

5B). Following primers were used for amplification and cloning of begomoviruses from plants.

Begomo F ACGCGTGCCGTGCTGCTGCCCCCATTGTCC Begomo R ACGCGTATGGGCTGYCGAAGTTSAGAC

Table 1A. Full length Clones, produced from the putative samples. S/No. Clone name Sample code Size (in kb) Vector 1 MV12 G66 2.8 pBS 2 MV13 G65 2.8 pBS 3 MV14A G67 2.8 pBS 4 MV14B G67 2.8 pBS 5 MV14C G67 2.8 pBS 6 MV15 G104 2.8 pBS 7 MV16 G106 2.8 pBS 8 MV17A G66 1.4 pBS 9 MV17B G66 1.4 pBS 10 MV18A G182 2.8 pBS 11 MV18B G182 2.8 pBS 12 MV19A G173 1.4 pBS 13 MV19B G173 1.4 pBS 14 MV19C G173 1.4 pBS 15 MV20A G168 1.4 pBS 16 MV20B G168 2.8 pBS 17 MV22A G171 1.4 pBS 18 MV22B G171 1.4 pBS 19 MV23A G172 1.4 pBS 20 MV23B G172 1.4 pBS

Activity-4: Confirmation through sequencing of the clones Sequence analysis shows that Cotton leaf curl Burewala virus is present in most of the samples collected. Cotton leaf curl Multan virus is present in cotton sampled from Ghotki and Cotton leaf curl Burewala virus is responsible for leaf curl disease in cotton in Bahawalpur and Vehari. Cotton leaf curl Multan betasatellite is also associated in the pathogenicity of CLCuVs in Burewala and Bahawalpur. Pedilanthus leaf curl virus, Papaya leaf curl virus, Pepper leaf curl Bangladesh virus and Chili leaf curl betasatellite were also identified in crops other than cotton. Out of 20 clones 16 clones have been sequenced and following results were provided in Annexure 3.

Table 1C. Full length Clones that have been sequenced. S/No Clone Host Area Organism 1 MV12 cotton Bahawalnagar Cotton leaf curl Burewala virus

2 MV13 cotton Bahawalnagar Cotton leaf curl Burewala virus

3 MV14A cotton Bahawalnagar Cotton leaf curl Burewala virus

cotton Bahawalnagar Cotton leaf curl Burewala virus 4 MV14B

cotton Bahawalnagar Cotton leaf curl Burewala virus 5 MV14C

6 MV15 cotton Rahimyar Khan Cotton leaf curl Burewala virus

7 MV16 cotton Rahimyar Khan Cotton leaf curl Burewala virus

8 MV17A cotton Bahawalnagar Cotton leaf curl Multan betasatellite

9 MV17B cotton Bahawalnagar Cotton leaf curl Multan betasatellite

cotton Bahawalpur Cotton leaf curl Burewala virus 10 MV18A

cotton Bahawalpur Cotton leaf curl Burewala virus 11 MV18B

cotton Vehari Cotton leaf curl Burewala virus 12 MV19A

cotton Vehari Cotton leaf curl Burewala virus 13 MV19B

cotton Vehari Cotton leaf curl Burewala virus 14 MV19C

15 MV20A cotton Vehari Cotton leaf curl Burewala virus

16 MV20B cotton Vehari Cotton leaf curl Burewala virus

Output-4 (Laboratory of Virology, Department of Cell and Systems, University of

Toronto, Canada) Development of AEV Transgenic tobacco

Activity 1: Agro-transformation of the proper RNAi construct Bacterial strains were made competent and transformed using a calcium-chloride heat shock protocol. Although the following protocol describes the transformation of E. coli strain DH5 cells, Agrobacterium tumefaciens strain GV3103 were also transformed using this method, however, the cells were incubated at 28 °C rather than 37 °C, the incubation times were twice as long to accommodate for the difference in doubling time between the strains

(i.e. the doubling time for E. coli is 20 minutes compared to the 40 minutes required by A. tumefaciens), and the A. tumefaciens cells were cultured in the presence of 30 µg/ml Gentamycin and 100 µg/ml Spectinomycin.

Activity 2: Agrobacterium /biolistic inoculation of the RNAi construct into tobacco A glycerol stock of agrobacteria strain GV3103 harboring the desired AEV-IR construct in a binary vector pART27, was used to inoculate 3 ml of LB in the presence of 30 µg/ml Gentamycin and100 µg/ml Spectinomycin. The culture was incubated overnight in a 28 °C shaker. On the following day, 300 µl of this culture was used to subculture 30 ml of LB with 30 µg/ml Gentamycin and and100 µg/ml Spectinomycin; which was left to grow in a 28 °C shaker overnight once more. On the day of transformation, 10-15 medium-sized Nicotiana benthamiana and N. tabacum leaves were sterilized in 70% ethanol and rinsed with distilled water. The leaves were then placed in 1% bleach for 20 minutes. After the incubation period was over, the leaves were thoroughly rinsed with sterile ddH2O to remove any residual bleach. In the fume hood, small circles were cut from the leaves to create bacterial-entry sites. The leaf discs were then incubated in the 30 ml agrobacteria cultures for 5 minutes. Once infected, the leaf discs were blotted dry on sterile filter paper and transferred to Petri plates of MS modified medium(4.4 g/L MS salts, 3% sucrose, 2 g MES, 1 mg/L 6-benzyl-aminopurine (BAP), 0.1 mg/L naphthalene acetic acid (NAA), and 9 g/L agar, pH 5.8). The Petri plates were incubated for 3 days under constant light at 24 °C. The leaf circles were then transferred to Petri plates with selection medium (MS modified, 400 µg/ml Carbenicillin and 120 µg/ml kanamycin) to stimulate the formation of transgenic calli. Approximately 3-4 weeks after the appearance of transgenic calli, primary shoots began to develop on the calli. These shoots were then transferred to sterile magenta boxes containing MS rooting medium (2.2 g/L MS salts, 1.5% sucrose, 2 g MES, 0.9% agar, pH 5.8, 400 µg/ml Carbenicillin, and 400µg/ml Kanamycin (Annexure: 4; Fig. 1A & 1B).

Activity -3: Verification for transgenic tobacco plants The successful transformation of transgenic plant lines were confirmed using plant chromosomal DNA (Annexure: 4; Fig. 2). PCR analysis was done by using following primers

Pdk_F a a c a a a g c g c a a g a t c t a t c a Ocs_R t a g g c g t c t c g c a t a t c t c a

Output 5 Rearing of whiteflies and CLCuD transmission studies Activity-1: To grow and maintain insect and disease free cotton plants on regular basis Insect and disease free cotton plants were grown in glass house (Annexure: 5; Fig. 1A & 1B). Activity 2: Collection of whitefly populations from the field and rearing on healthy plants Whiteflies were reared in glass cages.

Activity 3: Maintenance of breeding populations and identification of biotype through squash silver leaf assay Silver leaf effect on squash plant will be produced, only if B-biotype is present in field (only nymphs of the B-biotype cause silver leaf effect), that also confirms the breeding of whitefly population. Silver leaf assay could not find any B biotype in whiteflies populations tested so far.

Activity 4: Exposure of A-viruleferous whiteflies for acquisition access period (diseased plants) and transmission access period (healthy plants) Aviruliferous whiteflies were exposed to N. tabacum plants infected with ToLCNDV (acquisition access period). Later on these whiteflies were allowed to feed on healthy N. tabacum to transmit the virus.

Activity 5: Shifting of whitefly inoculated plants from insectary to glasshouse and their fumigation over there N. tabacum plants exposed to viruliferous whiteflies were shifted to glasshouse after two days and then fumigated to kill virus vector. The biotyping analysis of whitefly samples collected from different areas of Punjab (Annexure: 5; Table 1) were also conducted for their identification using mitochondrial mtCO1 partial sequence. DNA of a single whitefly was extracted and used as a template for PCR for amplification of cytochrome oxidase gene with a set of primers given below.

C1-j-2195 5’ TTGATTTTTTGGTCATCCAGAAGT3’ L2-N-30104 5’ TCCAATGCACTAATCTGC CATATTA 3’

Approximately 0.9 kb fragment was produced (Annexure: 5; Fig. 2) after PCR which was cloned and sequenced. Sequencing results were submitted to EMBL databank with

13 accession no. given in Annexure: 5; Table 1. Results showed that all whitefly samples belong to Asia II group.

Output 6 Testing for resistance of transgenic tobacco plants Activity-1: Agrobacterium inoculation of AEV infectious clones onto transgenic tobacco Non transgenic and transgenic N. bethamiana plants were infected with infectious clones of AEV DNA A and betasatelite by Agroinfiltration method. Non transgenic plants developed symptoms, whereas transgenic plants remain symptomless. (Annexure 6: Fig. 1)

Activity 2: Testing of resistance through whitefly inoculation Transgenic and non-transgenic plants were challenged with ToLCNDV by whiteflies. Non transgenic plants produced viral symptoms after approx. 30 days whereas transgenic plants remain symptomless (Annexure 6; Fig.2).

Plants were tested for virus DNA by PCR method. Primers were designed against coat protein region. Product legnth of 283 bps was expected. Same quantity of total DNA from all plants was used for PCR reaction. Low intensity bands of transgenic lines indicate the resistance against virus .Actin gene was used as internal control (Annexure 6: Fig.3).

Output-7 Generation of proper binary plasmid CLCuD construct Activity 1: Alignment of IR sequences of all CLCuD species/strains to develop a conserved sequence RNAi insert/fragment The following intergenic region sequences of most of the CLCuD species (Cotton leaf curl Burewala virus, Shadadpur virus, Multan virus, Rajasthan virus, Kokhran virus- [Faisalabad1] etc) were aligned by consensus to generate an RNAi insert.

GTGTCTCCAAATGGCATATTCTGTAAATAACTAGAAGTTCGTTTGAAATTCAAAT TCCCCTTTGGGCTCCAAAAGCGGCCATCCGTATAATATTACCGGATGGCCGCGCG ATTTTTTTGTGGGCCCTACCATTAACTCTTGTCGGCCAATCATATGACGCGCTCAA AGCTTAAATAATTCTCCCGCC

Activity 2: Ligation and cloning of the RNAi fragment into Binary vector

The Synthesized DNA having sense and antisense regions were digested with appropriate enzymes and ligated into the plasmid (pHannibal with ampicillin resistance gene as a bacterial selectable marker) also digested with the appropriate enzymes by using existing laboratory standard protocols. The plasmid was transformed into E. coli for plasmid DNA amplification by using heat-shock method. The hairpin cassette was then removed from pHannibal vector using NotI sites and cloned into pART27 (binary vector with Spectinomycin/streptomycin resistance gene as a bacterial selectable marker) in a single step using the NotI restriction sites. The clone was confirmed by digestion with NotI restriction enzyme.

Restriction analysis Plasmid DNA was digested using the recommended buffers and reaction conditions described by the restriction enzyme supplier (Fermentas). Typically, DNA was digested in 50 µl reactions containing 5 µl 10X buffer and 5 units of enzyme overnight at 37 °C. The DNA was then deproteinated by phenol-chloroform extraction (Annexure 7; Fig.1).

Activity 3: Verification of proper pCambia construct The vector product was further confirmed by sequencing at the Centre for Applied Genomics. The sequencing facility provides high-quality capillary-based fluorescent sequencing on dual ABI 3730XL instruments. Samples were prepared for sequencing by using the standard protocols.

ACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTC

XhoI ATTTGGAGAGGACACGCTCGAGTGTCTCCAAATGGCATATTCTGTAAATAACTAGAAGTT CGTTTGAAATTCAAATTCCCCTTTGGGCTCCAAAAGCGGCCATCCGTATAATATTACCGG ATGGCCGCGCGATTTTTTTGTGGGCCCTACCATTAACTCTTGTCGGCCAAT

KpnI CATATGACGCGCTCAAAGCTTAAATAATTCTCCCGCCGGTACCCCAGCTTGGTAA GGAAATAATTATTTTCTTTTTTCCTTTTGTATAAAATAGTTAAGTGATGTTAATTA GTATGATTATAATAATATAGTTGTTA//AACATGAATAAACAAGGTAACATGATAG ATCATGTCATTGTGTTATCATTGATCTTACATTTGGATTGATTACAGTTGGGAAGC TGGGTTC

ClaI GAAATCGATGGCGGGAGAATTATTTAAGCTTTGAGCGCGTCATATGATTGGCCGA CAAGAGTTAATGGTAGGGCCCACAAAAAAATCGCGCGGCCATCCGGTAATATTA TACGGATGGCCGCTTTTGGAGCCCAAAGGGGAATTTGAATTTCAAACGAACTTCT AGTTA

XbaI TTTACAGAATATGCCATTTGGAGACACTCTAGAGTCCTGCTTTAATGAGATATGC GAGACGCCTATGATCGCATGATATTTGCTTTCAATTCTGTTGTGCACGTTGTAAA AAACCTGAGCATGTGTAGCTCAGATCCTTACCGCCGGTTTCGGTTCATTCTAATG AATATATCACCCGTTACTATCGTATTTTTATGAATAATATTCTCCGTTCAATTTAC TGATTGTACCCTACTACTTATATGTACAATATTAAAATGA Output 8 Production of CLCuD infectious clones Following infectious clones have been produced: • Tomato leaf curl New Delhi virus DNA A • Tomato leaf curl New Delhi virus DNA B • Pedilanthus leaf curl virus • Cotton leaf curl Burewala virus (PDMV12) • Cotton leaf curl Burewala virus (PDMV15) • Cotton leaf curl Multan betasatellite (PDMV17A) • Malvastrum yellow vein mosaic Changa Manga virus (PDMV10) • Mastrevirus (MV27B) • Tomato leaf curl Palampur virus DNA A (MV26D) • Tomato leaf curl Palampur virus DNA B (MV26B)

Activity 1: Restriction analysis for the infectious clones Clones MV10 and MV12 were selected to produce infectious clones. Both clones were digested with EcoRI and HindIII and following digestion pattern (Annexure 8; Fig.1) was produced. Partial dimers of clones MV27B, MV26D and MV26B were produced in this term. • Clone MV27B was digested with HindIII and Sma I and two fragments of 1976 bp and 610 bp were produced. • Clone MV26D was digested with HindIII and EcoR I and two fragments of 1215 bp and 1541 bp were produced. • Clone MV26B was digested with HindIII and BamHI and two fragments of 1100 bp and 1600 bp were produced.

Activity 2: Production and cloning of partial dimer Partial dimer of clone MV10 was produced by cloning approx. 1.1 kb fragment in binary vector pBin19 and later on full length DNA of the virus was cloned along with 1.1kb

16 fragment. Similarly partial dimer of clone MV12 was produced by cloning a partial fragment (approx. 1.1kb) in pBin19 and then full length DNA of the virus was also cloned in same construct.

Activity 3: Confirmation of partial dimer through restriction analysis Partial dimeric clones were confirmed by digestion with enzymes (cloning restriction sites) which should release a fragment of approx 2.8 kb from the construct (Annexure 8; Fig.2).

Activity 4: Agro-transformation of infectious clones Confirmed partial dimeric clones were transformed to an Agrobacterium strain GV3101 by electroporation and transformants were grown as colonies on Petri plates with LB medium.

Output 9 Development of CLCuD resistant Transgenic tobacco and Cotton (in addition to cotton cultivar cocker 312, two succeptible cotton cultivars such as S-12 and MNH-93 along with two other elite cotton cultivars will be used)

Activity 1: Agro-transformation of the RNAi construct A modified protocol of the freeze-thaw method for transformation of Agrobacterium tumefaciens strain GV3103. Binary vectors pART27 IGS-IR construct was used in transformation. An overnight culture of Agrobacterium tumefaciens was diluted in 50 ml LB medium. After 3-4 h the logarithmically growing cells were centrifuged at 3000 g for 20 minutes at room temperature. Bacterial strains were made competent and transformed using a calcium-chloride heat shock method. Competent cells were mixed with 0.5-1.0 µg plasmid DNA. The cells are incubated successively 5 minutes on ice, 5 minutes in liquid nitrogen and 5 minutes at 37°C. After dilution in 1 ml LB-medium the cells were shaken 2-4 h at 28°C. Aliquots of 200 µ1 were plated on LB-plates containing appropriate antibiotics (30 µg/ml Gentamycin and 100 µg/ml Spectinomycin) and incubated for 2 days at 28°C. Single colonies were picked and inoculated for plasmid analysis.

Activity 2: Agrobacterium /biolistic inoculation of the RNAi construct into tobacco A glycerol stock of Agrobacterium strain GV3103 harboring the desired CLCuV IR construct in a binary vector pART27, was used to inoculate 3 ml of LB in the presence of 30 µg/ml Gentamycin and100 µg/ml Spectinomycin. The culture was incubated overnight in a

28 °C shaker. On the following day, 300 µl of this culture was used to subculture 30 ml of LB with 30 µg/ml Gentamycin and and100 µg/ml Spectinomycin; which was left to grow in a 28 °C shaker overnight once more. On the day of transformation, 10-15 medium-sized Nicotiana benthamiana and N. tabacum leaves were sterilized in 70% ethanol and rinsed with distilled water. The leaves were then placed in 1% bleach for 20 minutes. After the incubation period was over, the leaves were thoroughly rinsed with sterile ddH2O to remove any residual bleach. In the fume hood, small circles were cut from the leaves to create bacterial-entry sites. The leaf discs were then incubated in the 30 ml agrobacteria cultures for 5 minutes. Once infected, the leaf discs were blotted dry on sterile filter paper and transferred to Petri plates of MS modified medium(4.4 g/L MS salts, 3% sucrose, 2 g MES, 1 mg/L 6-benzyl-aminopurine (BAP), 0.1 mg/L naphthalene acetic acid (NAA), and 9 g/L agar, pH 5.8). The Petri plates were incubated for 3 days under constant light at 24 °C. The leaf circles were then transferred to Petri plates with selection medium (MS modified, 400 µg/ml Carbenicillin and 120 µg/ml kanamycin) to stimulate the formation of transgenic calli. Approximately 3-4 weeks after the appearance of transgenic calli, primary shoots began to develop on the calli (Annexure 9; Fig.1A). These shoots were then transferred to sterile magenta boxes containing MS rooting medium (2.2 g/L MS salts, 1.5% sucrose, 2 g MES, 0.9% agar, pH 5.8, 400 µg/ml Carbenicillin, and 400µg/ml Kanamycin.

Plant materials and growth conditions for cotton The seeds of cotton (Gossypium hirsutum L., cvs. Coker 312, 815 and MNH-815) were delinted with sulfuric acid for 1 h in a rotary shaker. Seeds were washed with water and dried, then dipped in 70% ethanol for 1 min and 15% (v/v) Clorox (Commercial bleach containing 5.25% sodium hypochlorite) with a drop of Tween-20 for 15 min. Seeds were rinsed with sterile distilled water several times to remove the detergent completely and were blot-dried using sterile tissue papers. The seeds were germinated on 1/2-strength basal salts of MS medium supplemented with 3% maltose and 0.8% agar, and pH was adjusted to 5.8. Cultures were incubated at 28 ± 1°C under 16/8 h light/ dark cycle at light intensity 4000 lux.

Callus induction Hypocotyls were used as explants for callus initiation. Explants were excised from 6- to 8-day-old seedlings. About 6–8 explants were placed in a Petri plate containing approximately 30 ml medium for callus induction. MSDK media, i.e., MS salts supplemented with various concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D) and kinetin, were tested for callus induction. Maltose (3%) was used as sole carbon source. Cultures were

18 incubated at 28 ± 1°C under cool, white ﬂuorescent light (4000 lux) with 16/8 h light/dark cycle for callus induction (Annexure 9; Fig.1B). After 20 days, calli were cut into pieces and transferred to MSDiP medium containing MSmedium, 0.01 mg /L 2,4-D, and 0.5 mg l-1N6- (2-iso-pentenyl) adenine (2iP) for proliferation.

Agrobacterium Transformation Proliferating embryogenic calli were co-cultured with Agrobacterium carrying pART27+CLCV IR plasmid for 20 min, and the bacterial suspension was removed by passing through a sterile strainer. Co-culture of infected calli was continued for 36 h in the dark on basal MS medium. Co-cultured calli were transferred to a sterile Whatman ﬁlter paper placed on MSKC selection medium containing MS medium without any growth regulators, 3% maltose, 50–100 mg l -1 kanamycin, and 400 mg l /L carbencillin Antibiotics were ﬁlter sterilized before adding to the autoclaved medium. Petri plates were sealed with porous tape and cultured for 3–5 weeks under 16/8 h light/dark cycle period (Annexure 9; Fig.1C).

Activity 3: Verification for transgenic tobacco plants The successful transformation of transgenic plant lines were confirmed using plant chromosomal DNA (Annexure 9; Fig.2). PCR analysis was done by using forward and reverse primers

(Pdk-F a a c a a a g c g c a a g a t c t a t c a & Ocs-R t a g g c g t c t c g c a t a t c t c a)

Output 10 Testing of CLCuD infectious clones

Activity 1: To grow and maintain insects and disease free tobacco and cotton Insects and disease free cotton and tobacco plants were grown and maintained in growth chamber.

Activity 2: Agrobacterium mediated/biolistic inoculation through infectious clones and maintenance of infected plants Partial dimer Clones in the binary vector pBin19 were electroporated into Agrobacterium strain LB4404. For Agroinoculation of CLCuV DNA A and Beasatellite to tobacco glycerol stocks of Agrobacterium strain LB4404 with required clones were streaked on solid LB medium plates containing 12.5 μg/mL rifampicin and 50 μg/mL kanamycin and

19 incubated at 28 ˚C for 48 hours. A single colony of bacteria was picked with a sterile wire loop and inoculated into 50 mL LB medium containing the required antibiotics and placed in a shaker at 28 ˚C until the O.D600 of the culture was 1. The cells were harvested by centrifugation at 3220×g for 8 minutes and resuspended in LB medium (pH 5.6) containing acetosyringone. For agroinoculation to N. benthiamiana, plants at the 4 to 5 leaf stage were not watered for 24 hours before inoculation. The Agrobacterium inoculum was infiltrated into fully expanded leaves using a 5 mL sterile syringe. Plants were grown in a growth room at 25 ˚C with supplementary lighting to give a 16 hour photoperiod.

Output 11 Testing of CLCuD resistant transgenic tobacco and cotton

Activity 1: Agrobacterium and biolistic inoculation of CLCuD infectious clones onto transgenic tobacco and cotton Transgenic and non-transgenic plants shown in (Annexure 10; Fig.1, 2, 3 & 4) were also challenged with ToLCNDV by Agroinoculation. Non transgenic plants produced viral symptoms after 20 days whereas transgenic plants remained symptomless.

Activity 2: Test of resistance for CLCuD onto transgenic tobacco and cotton through whitefly Transgenic and non-transgenic plants shown in (Annexure 10; Fig.5A, 5B, 6A & 6B) were also challenged with CLCuD by whiteflies. Non transgenic plants produced viral symptoms after approx. 30 days whereas transgenic plants remained symptomless.

Output 12 (Laboratory of Virology, Department of Cell and Systems, University of Toronto, Canada)

Testing of CLCuD resistant transgenic tobacco and cotton T1 plants Resistance of T1 generation to CLCuD was checked through Agrobacterium mediated begomovirus inoculation and whitefly inoculation. Transgenic plants remained symptomless whereas control plants exhibited severe symptoms of CLCuD. This shows that IGS-IR construct is protecting the plants.

Screening for T1 transgenic plants:

Axenic transgenic (T0) lines of Nicotiana benthamiana L. harboring CLCuV -IR region were maintained and grown under in vitro condition. These in vitro plants were acclimatized and grown in green house to collect seeds for T1 generation. Though tobacco is a highly self- pollinated species and natural cross-pollination is usually very low, however these transgenic lines were covered under polythene bags during their flowering stage to ensure and maintain their homozygosity. Harvested seeds of T1 progeny were first screened on MS medium containing 150 µg/ml kanamycin (segregation analysis). Seeds from non-transgenic plants were also grown on this medium to check the efficacy of kanamycin. There is no germination on this medium in case of non-transgenic seeds however seed of transgenic lines germinated normally on MS-kanamycin medium according to the Mendelian laws of inheritance as shown in the Annexure 11; Fig.1A & 1B. These in vitro screened transgenic lines were acclimatized and grown in greenhouse for further infectivity assays. Seeds of non-transgenic plants were also grown for control experiments.

Activity 1: Agrobacterium and biolistic inoculation of CLCuD infectious clones onto transgenic tobacco and cotton Agrobacterium mediated inoculation of Tomato Leaf Curl New Delhi Virus, Tomato Leaf Curl Palampur Virus and Mastrevirus (Chickpea Chlorotic Dwarf Virus) infectious clones were performed on transgenic and non-transgenic plants (Control). Transgenic plants remained symptomless whereas control plants exhibited severe symptoms of CLCuD. Non transgenic plants produced viral symptoms after approximately 13, 15 and 19 days post- inoculation (dpi) in Tomato Leaf Curl New Delhi Virus, Tomato Leaf Curl Palampur Virus and Mastrevirus (Chickpea Chlorotic Dwarf Virus) respectively.

Agrobacterium inoculation of CLCuD infectious clones onto transgenic and non- transgenic tobacco plants: A single colony of each infectious clones of CLCuV DNA-A and DNA- β in Agrobacterium strain of GV3101 was cultured in one ml of LB culture containing antibiotics 50µg/µl kanamycin and 20 µg/µl gentamycin and grown overnight at 28°C in a shaker. Again a 5ml LB media suspension was then inoculated with the overnight culture and grown at 28°C to an OD600 of ~0.5. The cells were harvested by centrifugation and resuspended in Agrobacterium induction medium (10mM MgCl2, 10mM MES pH 5.6 and 150 µM acetosyringone).

Cells were pelleted again by centrifugation at 1200g for 10 min and resuspended in 10 mM MES buffer and adjusted to OD600~0.5. Since the optical density (OD600) value of 1 8 corresponds to 10 cells/ml culture. This number( OD600~0.5 ) of bacterial cells harboring infectious clones is very high as compared to number of virus particle during a natural infection by white flies. At an exceptionally high inoculum, the virus resistance mechanism in transgenic plants will certainly be overcome. Consequently, transgenic plants will naturally produce large quantities of virus. Serial dilutions were produced and used to infect non- transgenic control plants. A dilution factor of 1000 fold (i.e. OD 600 = 0.0005, equivalent to about 10 cells/ml) was considered as adequate. Then both bacterial suspensions were mixed and one ml of this diluted suspension was taken in a syringe and infiltrated through the abaxial surface of two lower leaves of different transgenic lines (T1 generation) harboring CLCuV IR region and non-transgenic plants (control) at four to six leaf stage. Each experiment was repeated five times (five treatments). Five plants were also infiltrated with water alone used as a negative control. All agro-infiltrated plants were observed periodically for the appearance of symptoms. However the transgenic and non-transgenic plants showed no viral symptoms Consequently, determination of the virus quantity produced in transgenic and non-transgenic plants will be the method of choice to gage the virus resistance as also shown in the Annexure 11; Fig.4. However, when transgenic and non transgenic N. benthamiana plants harboring AEV-IR construct were challenged with infectious clones (DNA-A and DNA-B) for the infectivity of Tomato Leaf Curl New Delhi Virus. All non- transgenic plants showed symptoms of virus infection in the upper, newly emerging leaves at 35 days post-inoculation (dpi) consisting of foliar yellowing curling upwards and inwards and thickening of veins. In contrast, transgenic plants remained symptomless (Annexure 11; Fig.2 & 3). These results are consistent with the hpRNA construct providing resistance to virus infection. To investigate the resistance and effect of the blocking sequence on the accumulation of viral DNA (replication), total DNA was extracted from non-inoculated upper most fully expanded leaf tissues of all treatments inoculated with either infectious clones or water alone after two-week post inoculation and 1ug DNA of each plant was subjected to semi quantitative PCR using speciﬁc primer pairs to amplify a 226bp of coat protein of CLCuV. The expected size of coat protein could only be ampliﬁed from plants challenged with infectious clones of CLCuV DNA-A DNA- β whereas no bands was detected with DNA extracted from water treated plants. The 226bp PCR product is very faint in different transgenic lines (lanes 4, 5 and 6) harboring pART27 CLCuV-IR construct that indicates

22 various level of tolerance or resistance of transgenic lines against virus in the Annexure 11; Fig.4.

Activity 2: Test of resistance through whitefly inoculation Viruliferous whiteflies were obtained by caging virus free Bemisia tabaci adults on the agro-inoculated N. benthamiana plants (acquisition access period). In order to transmit the virus (IAP), healthy transgenic and non-transgenic N. benthamiana plants were placed in the same cages. These plants were then placed in insect-virus-free cages until symptom develop. Non transgenic plants (A) produced viral symptoms after approx. 25 to 30 days whereas transgenic plants (B) remained symptomless (Annexure 10; Fig.4.).

Field Trial of transgenic (T1) cotton plants First generation (T1) of transgenic cotton plants harboring pART27 IGS-IR construct was grown in CEMB/IAGS fields according to recommended biosafety guidelines. (Annexure 11; Fig.5, 6 & 7.).

PCR-based testing of non-transgenic and transgenic cotton plants First generation of transgenic cotton plants was assessed for various respective parameters and non-transformed plants served as a control.

Verification of IGS-IR construct PCR analysis was performed for the verification of IGS-IR construct in transgenic cotton plants (T1). The expected 456 bp PCR product was detected by using specific primers (Pdk_F and Ocs_R). (Annexure 11; Fig.8).Out of 35 transgenic plants 25 plants were with positive amplification.

To check Viral Load or viral accumulation PCR-based testing of non-transgenic and transgenic cotton plants harboring pART27 IGS-IR construct was performed to check their resistance against CLCuD. Primers CP-F and CP-R for 750bp product were used to check accumulation of viral DNA (Annexure 11; Fig.9). Transgenic lines showed less accumulation of virus as compared to non- transgenic plants.

PCR for internal control

To ascertain the PCR result, the same DNA samples from non-transgenic and transgenic plants were amplified by PCR using primers rbcla-F and rbcla-R (Annexure 11; Fig.10).

Southern Blot Analysis: To check Viral Load or viral accumulation Southern blot analysis was also performed for the detection of viral DNA accumulation in transgenic cotton plants harboring pART27 IGS-IR. Blot was probed with CLCuV. Transgenic lines showed less accumulation of virus as compared to non- transgenic plants (Annexure 11; Fig.11).

Output 13 Testing of CLCuD resistant transgenic tobacco and cotton T2 plants The transgenic cotton seeds of T2 were received from CEMB (5 g) and 30 seeds were sown at IAGS, PU field (Sowing Date 30th April 2013). 10 plants survived and were transplanted in field.

Activity 1: Agrobacterium and biolistic inoculation of CLCuD infectious clones onto transgenic tobacco and cotton Transgenic cotton plants (T2) has been analyzed regarding their resistant to CLCuV and allied begomoviruses results are very much promising.

Testing of CLCuD resistant transgenic tobacco T2 plants Agrobacterium inoculation of CLCuD infectious clones into putative transgenic tobacco plants (Annexure 12; Fig.1, 2, 3 & 4).

Screening for T2 transgenic plants: Seeds of axenic transgenic (T1) lines of Nicotiana benthamiana L. harboring CLCuV -IR region were screened and acclimatized in green house as mentioned above in T0 lines for T2 generation plants. The putative transgenic plantlets were. Seeds from non-transgenic plants were also grown on this medium to check the efficacy of kanamycin. There is either no germination or germinated plants became yellow and roots ceased to elongate because of their sensitiveness on this medium in case of non-transgenic seeds as shown in Annexure 12; Fig. 5 A, however seed of transgenic lines germinated normally on MS-kanamycin medium according to the Mendelian laws of inheritance (Annexure 12; Fig. 5B).

Agrobacterium inoculation of CLCuD infectious clones onto transgenic and non- transgenic tobacco plants Infectious clones of CLCuV DNA-A and DNA- B in Agrobacterium strain of GV3101 were cultured and infiltrated through the abaxial surface of two lower leaves of different putative transgenic lines (T2 generation) harboring CLCuV IR region and non- transgenic plants (control) at 4-6 leaf stage as mentioned above in case of T1 transgenic lines . Each experiment was repeated three times (three treatments). Three plants were also infiltrated with buffer alone used as a negative control. All agro-infiltrated plants were observed periodically for the appearance of symptoms. However the transgenic and non- transgenic plants showed no viral symptoms. Consequently, the virus quantity produced in transgenic and non-transgenic plants was determined to gage the virus resistance. However when transgenic and non-transgenic N. benthamiana plants harboring CLCuV-IR construct were challenged with infectious clones (DNA-A and DNA-B) for the infectivity of Tomato Leaf Curl Virus. All non-transgenic plants showed symptoms of virus infection in the upper, newly emerging leaves at 23 days post-inoculation (dpi) consisting of foliar yellowing ,curling upwards and thickening of veins (Annexure 12; Fig. 6A). In contrast, transgenic plants remained symptomless or appeared with mild symptoms (Annexure 12; Fig. 6B) for first 4 weeks. To investigate the resistance and/or tolerance effect on the accumulation of viral DNA (replication) in transgenic plants , total DNA was extracted from non-inoculated uppermost fully expanded leaf tissues of all treatments inoculated with either infectious clones or buffer alone after three-week post inoculation. One microgram DNA of each plant was subjected to semi-quantitative PCR using speciﬁc primer pairs to amplify a 226bp of coat protein of CLCuV. The expected size of coat protein gene could only be ampliﬁed from plants challenged with infectious clones of CLCuV DNA-A DNA- β whereas no bands was detected with DNA extracted from buffer treated plants. The 226bp PCR product is faint in different transgenic lines (lanes 3-7) harboring pART27 CLCuV-IR construct that indicates various level of tolerance or resistance of transgenic lines against virus (Annexure 12; Fig. 7A). To validate the semi-quantitative result, the same DNA samples from non-transgenic and transgenic plants were amplified by PCR using primers pairs for actin gene (internal control) (Annexure 12; Fig. 7B).

Activity-2: Test of resistance through whitefly inoculation

Viruliferous whiteflies were obtained by caging virus free Bemisia tabaci adults on the Tomato Leaf Curl New Dehli Virus agro-inoculated N. benthamiana plants (acquisition access period). In order to transmit the virus (IAP), healthy transgenic and non-transgenic N. benthamiana plants were placed in the same cages. These plants were then placed in insect- virus-free cages until symptom develop. Non transgenic plants (A) produced viral symptoms after approx. 25 to 30 days whereas transgenic plants (B) remained symptomless (Annexure 12; Fig. 8).

Output 14 Take care of IPR and Bio-safety rules

Activity 1: To apply for patent: Transcript for an international patent has been prepared and it is in process, patent application has been filed entitled: “Novel approach to generate wide spectrum resistance to all cotton begomoviruses infecting cotton and other cultivated crops” in higher education commission, Pakistan. Details of the application and claims is attached herewith (Annexure 14a).

Activity-2: Bio-safety clearance and handing over the product to PARB: Cotton plants grown in the field maintained their varietal characteristics or identity and nothing unusual has been observed which reflects that transformants are fairly stable and morphological and physiological functions are very much in routine. Various biosafety studies have been performed in this regard. Permission regarding handling of transgenic material has been obtained (Annexure 14b).

Output-15 (IAGS, University of the Punjab, Lahore) Evaluation of advanced generation

Activity 1: Molecular confirmation of knockdown ability of RNAi Second generation of transgenic cotton plants (T-2) was checked to verify the IGS-IR construct by PCR. A total of 24 samples were collected and expected 456 bp fragment was amplified by using specific primers (Pdk_F and Ocs_R). Only one sample No 21 was negative. Samples No. 16 and 19 were not sure, hence, the experiment was also repeated to ensure the results of PCR. Symptoms of infection exhibited by non- transgenic and transgenic cotton plants following inoculation with begomoviruses by the host vector Bemisia tabaci. These

26 photographs of transgenic events harbouring the pART27 IGS-IR construct indicates various level of tolerance or resistance of transgenic lines against virus. Transgenic cotton leaves are presented from T2-1 to T-24 plants along with two negative photographs of non-transgenic cotton. Photographs were taken from the plants grown in the IAGS field at boll formation stage. CLCuD was detected by visual examination of unhealthy looking plants. Figures of these leaves are attached in Annexure 15.

Activity 2: Evaluation of transgenic plants for viral titre in comparison with control through real time PCR

Real time PCR: Real time PCR was performed for expression of transgene Intergenic Region of Ageratum Enation Virus in second generation of transgenic cotton plants (T-2). For this purpose DNA was extracted and used as a template to run the real time PCR. Relative expression of virus titer in transgenic cotton (MNH-786) plants and control is depicted in Annexure 16; Fig. 1. Cotton Plants: C: Control, R: Resistant, T: Tolerant, S: Susceptible

Field Evaluation: Morphological characteristics like monopodial and sympodial branches per plant, no. of infected leaves per plant. %age infection per plant and no. of bolls per plant were observed. Plants were selected on the basis of infection percentage and categorized as resistant, tolerant, and susceptible with 3 replications. Comparison among mean values of seven morphological characters has been developed and shown in Annexure 16; Fig. 2. Correlation coefficient (r) with regression lines was also applied (Annexure 16; Fig. 3).

Activity 3: Selection of events on the basis of knockdown ability and viral titre and comparison of these events with CEMB to have mutual selection of best event Best event of transgenic cotton variety MNH-786 containing virus resistance genes was selected on the basis of viral symptoms and viral titer. Results attached in annexure 17.

Output-16 (Centre of Excellence in Molecular Biology) Evaluation of Advanced generation and Biosafety Studies of Transgenic Cotton Plants.

Activity 1: Molecular confirmation of knockdown ability of RNAi

Agrobacterium mediated transformation of virus resistant genes was completed (Annexure 17 Fig. 1) and its PCR analysis of putative transgenic cotton plants at T0 generation was achieved (Annexure 17 Fig 2), grafting of putative transgenic cotton plant on virus susceptible plant (Annexure 17 Fig. 3).

Activity 2: Evaluation of T2 & T3 generation of transgenic plants Sowing of seeds of confirmed transgenic cotton plants were sowed at field level and data was collected regarding their symptoms. These transgenic cotton plants were used for their analysis at T1 generation (Annexure 17 Fig. 4).

Activity 3: Selection of best event on the basis of plant performance (symptomless and low virus titer) Best event of transgenic cotton variety MNH-786 containing virus resistance genes was selected on the base of viral symptoms and viral titer.

Activity 4: Testing for purity and uniformity of the transgenic cotton plants Compare transgenic and control cotton plants were categorized on the bases of plant performance in field conditions (Annexure 17 Fig 5 - 9). Activity 5 Virus resistant transgenic cotton plants were used for analysis of horizontal gene flow towards weed plants of experimental area at the distance of 30cm, 60cm, 90cm, 120cm and 150cm (Annexure-18 Fig 1).

Activity 6: Detection of gene in root exudates of transgenic plants ELISA analysis of virus resistant transgenic cotton plants for its vertical gene flow from its root exudates and soil. Expression was not found in any well of ELISA plate (Annexure 18; Fig. 2).

Activity 7: Feeding assay of animals (rats) on transgenic plant feed Two groups of mice used for feeding analysis of virus resistant transgenic cotton plants.

Activity 8: Comparison of weight of transgenic diet fed rats with control Measured the difference of weight of two groups of mice fed on transgenic and control feed. On significant difference was not found in both groups (Annexure 18; Fig. 3).

Activity 9: Histological studies of different organs of transgenic diet fed rats Histological studies of different organs of transgenic diet fed rats with control (Annexure 18; Fig. 4). . Cross section of four organs such as liver, kidney, heart and intestine was examine under microscope to check the effects of transgenic cotton feed on mice. It results in no significant difference in mice organs of transgenic and control fed mice (Annexure 18; Fig. 5).

Activity 10: Results interpretation and report writing Results interpretation and report writing

Output-17 (Cotton Research Institute, Multan)

Reconfirmation of CLCuD incidence, multiplication of transgenic lines seed at multi location and crossing with other wise good material

Activity 1: Testing of purity, uniformity and crossing of transgenic Cotton lines with high yielding and good quality CRI lines

Activity II is completed. (i) CLCuD disease index %age recorded from three locations at maturity is attached as Annexure-20

• CRI: 19.09 to 56.25% • CRS, Sahiwal: 4.94 to 33.53% • Vehari: 20.31 to 64.13% • Summary of CLCuV data (ii) Summary of morphological data is given as Annexure 19.

(iii) Detail of F0 seed of crosses is given as Annexure 20; Table 1.

Activity 2: Picking of seed cotton of transgenic lines

Activity has been completed. Seed cotton has been picked. Yield Kg per hectare is given as Annexure 20; Table 2.

Activity 3: Fiber quality testing of transgenic lines.

Activity has been completed. Fiber quality trait data is given as Annexure 20; Table 3.

5. DESCRIPTION OF THE PROCESS IN A MANNER OF CARRYING IT OUT IN PRACTICE:

Tissue culture of G. herbaceum Seeds of the variety Gossypium herbaceum were delinted and sterilized by treating with a solution containing a few drops of Tween 20 these were later treated with 50% sodium hypochlorite for 20 minutes followed by 5 washings with autoclaved distilled water, the final washing for 1 hr, the seeds were the kept in dark for germination at 30oC embryo were isolated for these seed under aseptic conditions. Tissue culture and regeneration media were based on the formulation as described by Murashige and Skoog (1962).

Agrobacterium tumefacians Mediated Transformation Stable Agrobacterium-mediated transformation of N. benthamiana L. plants was performed by a standard protocol (Horsch et al. 1985) with some modifications. Three to four weeks old tissue cultured plants were used for transformation. Leaf discs were co-cultivated for 10 minutes with 36 hrs old Agrobacterium culture incubated at 28°C in a shaker. These leaf discs were cultured on MS medium containing 100 mg/L BAP and 0.4 mg/L NAA After three days, transformants were selected on MS medium containing 100 mg/L kanamycin, 400µg/ml carbenicillin, 1 mg/L BAP and 0.4 mg/L NAA. Developed shoots were transferred to a phytohormone-free ½MS medium containing 300 mg/L kanamycin, and 400 mg/L carbenicillin for root formation. Regenerated plants were transferred from Magenta boxes to pots, and further grown under greenhouse conditions (26 °C, 16L/8D). Every three weeks, the explants were sub-cultured to a fresh selection medium for shoot regeneration.

Transformation of Cotton Conditions were also developed to transform cotton varieties mentioned in section 2.0 with marker as well as genes mentioned in section 2.0 by SIDE method. The plants were generated and analyzed for the potential of integrated siRNA cassette.

Field Trial of transgenic lines First and second generation of plants containing the respective CLCuV resistance gene was grown in CEMB field according to recommended biosafety guidelines. The respective transgenic plants were assessed for various respective parameters while non-transformed plants served as a control.

Sonicated Induced DNA Entry (SIDE) Sonication, incubation and co-cultivation of isolated embryos with Agrobacterium were performed as described earlier.

Explant Preparation Seeds of local cotton variety CIM-482 were sterilized as mentioned in seed sterilization section. After sterilization, the seeds were soaked in autoclaved distilled water for one hour. After one hour excess water was removed & the seeds were kept in the dark at 30C overnight for germination. Next morning, testa of the seeds was removed carefully with a forceps and cotyledonary leaves were excised with surgical blades. Mature cotton embryos were isolated from the germinating seeds. During isolation process, the isolated embryos were kept on moist filter paper so that they may not become dry.

Sonication and Agrobacterium Culture Treatment The mature cotton embryos (500) after isolation from the seeds were shifted to 50ml 31noculums31e centrifuge tube containing 10ml MS broth. The number of pulses on sonicator was controlled as 3,6,9,12,15 and 18 pulses by an electronic timer (W-375 model, Heat systems, Ultrasonics Inc, 1938, New Highway, Farming Dale, New York 11735). The tip of sonicator was washed with 70% ethanol. Then sonicator was used at different number of pulses. After sonication treatment, embryos were immediately shifted to the Agrobacterium 31noculums suspension for treatment with bacterial culture for 1 hour on a rotary shaker at very slow speed. Total 8,000 embryos were used in the transformation experiments. Plants were sub cultured on selection medium containing 10ug/ml kanamycin for selection of transformed plants and cefotaxime 250 g/ml to kill Agrobacterium for 6-8 weeks before transferring to selection free medium for root formation. Control plants were also carried along with the co-cultivated plants on both selection medium (-ve control) and selection free medium (+ ve control).

Transgenic cotton plants were challenged with cotton leaf curl viruses by whitefly inoculation in field conditions (Fig. below). Out of 5 plants two plants S3 and S5 were severely infected whereas three plants S1, S2 and S4 were symptomless and so was revealed from Southern blot analysis. S3 and S5 were positive for Cotton leaf curl Burewala Virus whereas S1, S2 and S4 were negative.

6. Component wise salient achievements IAGS PU Lahore: First of all, five districts of Punjab and a neighbouring district of Sindh from the cotton belt were surveyed for the collection of cotton and related dicot plant infected with CLCuV/Begomovirus. After DNA extraction from the cotton infected plants, PCR, cloning and sequencing was performed, confirmation through sequencing of the clones helped in preparing infectious clones. These infectious clones were used to test the resistance of transgenic and non-transgenic plants. RNAi transformants were tested against several heterologus begomoviruses such as (Ageratum enation virus AEV, Tomato Leaf Curl New Delhi Virus ToLCNDV, a Mastrevirus and Cotton Leaf Curl Burewala Virus CLCuBV and others, details are given in the Annexures) and data showed promising results. Insect transmission system/facility by whitefly B. tabaci has also been established at IAGS. Several graduate students got training under the project. Research work was presented at various national and international forums. Discovery of a Mastrevirus (a leaf hopper transmitted virus found infecting cotton and other host plants) was made for the first time in Pakistan along with the inventory of several new begomovirus species/strains.

CEMB Achievement: CEMB has successfully transformed both RNAi construct AEV-IR and CLCuD RNAi IR construct and also evaluate this transgenic against CLCuD complex. Now transgenic T2 generation is passing through the testing channel.

Dept. of Cell and Systems Biology, University of Toronto AEV-IR and CLCuV RNAi IR constructs were conceived, prepared in collaboration with IAGS and in first hand transformed in model plant tobacco, Nicotiana benthamiana, N. tabaccum and in Cocker cotton variety. These transgenic plants were tested through PCR and southern blot and found promising. Transgenic as well as non-transgenic plants were also tested to check their resistance by agro-inoculation of two diverse viruses and the results depicted resistance.

7. Overall progress of the problem searched

Cotton leaf curl disease (CLCuD) constitutes a serious threat to cotton production worldwide including Pakistan, particularly in the main cotton producing regions. The disease is caused by several different begomoviruses and most of them have been associated with a betasatellite to induce symptoms in cotton plants. Begomoviruses; exclusively transmitted by whitefly (Bemisia tabaci) and are widely spread, mainly destructive viruses among the geminiviruses. RNAi technique was used to enhance plants resistance against viruses in the current research and plants show resilience when infected with viral attack.

Infected leaf samples of cotton and host plants were collected from five districts of Punjab. Infectious clones were prepared after sequencing of the clones and were used to test the resistance of transgenic and non-transgenic plants. Experiments were designed to evaluate the resistance of T1 and T2 generation of cotton plants to CLCuD and allied begomoviruses. First and second generation (T1 and T2) of transgenic cotton and tobacco plants harboring pART27 IGS-IR construct was grown under control as well as in CEMB/IAGS fields according to recommended biosafety guidelines.

Verification of IGS-IR construct in T1 and T2 was done by PCR based testing. Southern blot analysis was performed to check the viral load in T1 and T2 plants. Appearance of no or mild symptoms in transgenic tobacco and cotton and exhibition of typical symptoms of CLCuD in control plants proved that hpRNAi construct providing resistance to virus infection. Test of resistance was also performed through whitefly inoculation that further strengthens the current research and findings.

8. Varieties, breeds, Vaccines or products developed and patented Currently the third generation of transgenics is under field trials, encouraging level of tolerance/resistance have been observed in some of the lines/events, these findings will ultimately lead to develop a virus resistant cultivar and its release in the near future. Transcript for an international patent has been prepared and is being processed (Annexure 14).

9. No. of national and international papers published Hina S., Javed A, Haider M.S. and Saleem M. (2012) Isolation and sequence analyses of cotton infecting begomoviruses. Pakistan Journal of Botany, special issue March 2012. Vol. 44, 223-230. (Impact Factor 0.520)

• Ilyas M., Nawaz K., Shafiq M., Haider MS. and Shahid AA (2013). Complete nucleotide sequence of two begomoviruses infecting Madagascarp periwincle (Catharanthus roseus) from Pakistan. Archives of Virology 158, 505-510 (Impact Factor 2.282) Haider M.S. and Shafiq M. (2011) Cotton leaf curl disease, a potential threat to Pakistan Cotton. The Agricultural News Vol. 1, Page 1.

10. No. of PhD/M.Phil. Produced M. Phil. Produced = 5 Ph. D. Produced = 2 11. Paper presented in national/international institutes Haider M.S, Ilyas M, Ahmed T and AbouHaidar M.G (2011) A study of Begomoviruses from Malvaceous hosts and use of RNAi approach for their control. Challenges and Options for Plant Health Management, 8th National Conference of Phytopathology, held November 28-29, University of Agriculture, Faisalabad p-96.

Khan S. N., Anwar W., and Haider M. S. (2011) Effect of planting environment and input application on natural distribution pattern of entomopathogens. International Science and Technology Conference 2011, held December 7-9, at Istanbul University, Turkey.

M. Zia-Ur-Rehman, M.S. Haider and J. K. Brown (2011). Hollyhock (Alcea rosea) as a reservoir of the Cotton leaf curl disease (CLCuD) associated begomoviruses. 5th Meeting of the Asian Cotton Research & Development Network, held Feb. 23-25, Pearl Continental Hotel, Lahore, Pakistan.

Farah S., Haider M. S., Shafiq M. and Ilyas M. (2011) A study based on Molecular analyses of whitefly (Bemisia tabaci) populations from Punjab, Pakistan. Challenges and Options for Plant Health Management, 8th National Conference of Phytopathology, held November 28-29, University of Agriculture, Faisalabad p-97.

M. Zia-Ur-Rehman, M.S. Haider and J.K. Brown (2011). Molecular Characterization of a Novel Monopartite Begomovirus infecting Hollyhock (Alcea rosea) in

Pakistan. Challenges and Options for Plant Health Management, 8th National Conference of Phytopathology, held November 28-29, University of Agriculture, Faisalabad p-83.

M. Zia-Ur-Rehman, M.S. Haider and J. K. Brown (2011). Multiple infection and recombination among begomoviruses infecting Hollyhock (Alcea rosea) in Pakistan. Challenges and Options for Plant Health Management, 8th National Conference of Phytopathology, held November 28-29, University of Agriculture, Faisalabad p-97-98.

12. Any other achievement. Several infectious clones have been produced under the project. Some new viruses, recombinants, strains and variants have been reported through project studies, full length sequences of these have been submitted to Gene bank.

13. Current status of commercialization of the project. How many stakeholders adopted this technology along with monitory benefits

The technology developed in the current project can be negotiated with the private sector for its further use on other crops and the material developed can be discussed for its IPR commercialization with the private vendors. A pamphlet/brochure has been prepared and circulated among the farming community for the common understanding and diagnostic of CLCuD, (Annexure, page 132) that ultimately help the farmer to improve its crop to earn more benefit.

14. Impact of the project on strengthening of the institutional infrastructure, machinery, equipment and human resources Project has reasonably supported to strengthen the institutional infrastructure, such as improvement of glass house structure, conversion of some barren land into cultivated land, purchase of machinery and equipment has greatly helped the institute to establish its labs. Project has also contributed to train the young scholars as good scientists, while providing them with the opportunity to work and excel their skills for the development of human resources capability. Apparatus available at present under this project include following:

• Ultra deep freezer (-80 °C) • Refrigerator (4 °C -20 °C) • Heating Block (Model: TDCP-01) • Magnet stirrer with hot plate • Gel Electrophoresis & Documentation System (Gel-Doc) • Thermocycler (PCR machine) • pH meter bench top • Analytical balance & tube mixer • Micro-centrifuge • Single channel pipette • Rack steel • Insect cages • Computer with LCD and printer

15. Constraints in the Project

Implementation of the project Commercialization of the project a. Although there were no major constraints faced for the implementation of the project, but importance of electricity cannot be denied. Unscheduled load shedding was no doubt remained a major issue throughout the years

b. the commercialization of the project is concerned, it still requires some more scientific and preparatory work before we start its commercialization procedure.

16. Suggestions for future research and development

Research work regarding diversity of geminiviruses required to be monitored on continuous basis. Diagnostic kit should be developed to detect these viruses at field level. Genera and species specific primers could be developed. Developed constructs can be used to transform other related virus infected plants like Okra and some cucurbit vegetables ie Luffa cylindrica, cucumber, bitter gourd, pumkin etc, others diverse and important families plants include tomato, chillies etc. Some ornamentals plants like Zinnia, Pedilenthus can also be transformed while using these constructs, for this purpose tissue culture and

transformation to produce transgenes got to be improved. Developed cotton material can be further used in the breeding program to enhance other characteristics like fiber quality, fiber strength, and overall yield. RNAi technique can also be used to develop transgenes resistant to various insects.

17. References Anonymous. (2005). CLCuV de facto and life blood of Pakistan economy” the article published in the national magazine “Business Recorder” Feb 7, 2005 & daily “The Frontier Post”February and 4,2005 (http://www.pakissan.com/english/allabout/crop/cotton/clcuv.de.facto.and.the.life.blood. shtml).

Vanderschuren, H., Stupak, M., Fütterer, J., Gruissem, W. and Zhang, P. (2007). Engineering resistance to geminiviruses--review and perspectives. Plant Biotechnology Journal 5 (2), 207-220.

Vanderschuren, H., Alder, A., Gruissem, W. and Zhang, P. (2009). Dose-dependent RNAi- mediated geminivirus resistance in the tropical root crop cassava.Plant Molecular Biology 70 (3), 265-272

Hu, W. Y., Bushman, F.D. and Siva, A.C. (2004). RNA interference against retroviruses. Virus Research 102: 59–64.

Kon T., Rojas M.R., Abdourhamane K.I. and Gilbertson L.R.(2009). Roles and interactions of begomoviruses and satellite DNAs associated with okra leaf curl disease in Mali, West Africa. Journal of General Virology 90, 1001–1013.

Date: __July 31st, 2017______Signature of Project Manager

______

Signature of Head of Organization

Date: ______

ANNEXURE-1

L A B C D

Figure 1. PCR reaction of the AEV-A intergenic region produces a 200bp fragment corresponding to the IR region. A, B, C, D are all same PCR products.

L pH 1 2 3 4 5 6 7

Figure 2. Colonies screened after the first ligation/transformation. pH is empty pHannibal digested with NotI. Colonies 1-7 are potential clones with a 200bp fragment inserted into the KpnI/XhoI sites.

L A B

Figure 3. L.1Kb ladder (Fermentas), A. pHannibal insert contained AEV-IR region in pART27 digested with NcoI.B. Empty pART27 digested with Not I. The expected 3307bp fragment was detected in lane A.

ANNEXURE-2 Table 1. DNA from 66 samples were extracted by CTAB method and quantified by spectrophotometer DNA Samples S. Area Clones/colonies pg./book Seq Virus/ Glycerol µg/ml code Detection Betastellite .Stocks Code AEV - - - - Infectios clones - - G06 AEV Beta - - - - Infectios clones - - G07 1142 Pedilanthus P-01 KSK CPF/CPR + WTGF/R + 1a,1b 62-63/03 (M13F) PedLCV- G17, G18 G17 PLCV-G18 Ful + L1a,L1b 18-19/02 G01,G02 Length Beta + 2105 Cotton C-02 BWP CPF/CPR + WTGF/R + Ful + 1a, 1b 26-27/02 G03,G04 Length Beta + 3a 26-27/02 G05, 2β, 3β 62-63/03 G24, G25 Cotton C-03 BWP CPF/CPR + 640/ WTGF/R + 1,2,3 88-89/02 (M13F) CLCuBuV- G08,G09,G10 93.5 G09 Ful +/son Length Beta + 58.5 Cotton C-04 BWP CPF/CPR WTGF/R -clcv Ful Length Beta 562/ Cotton C-05 BWP CPF/CPR +clcv 71 WTGF/R + Ful Length Beta + 706 Cotton C-06 BWP CPF/CPR WTGF/R -clcv Ful Length Beta 1002 Cotton C-07 KWL CPF/CPR - WTGF/R - Ful - Length Beta + 1097 Cotton C-08 LHR CPF/CPR - WTGF/R - Ful -

Length Beta + 2072 Cotton C-09 SWL CPF/CPR WTGF/R Ful

Length Beta 33 Mungbean M-10 BWP CPF/CPR WTGF/R

Ful

Length Beta 674 Luffa L-11 BWP CPF/CPR WTGF/R + Ful

Length Beta 14 Sesamum S-12 BWP CPF/CPR WTGF/R Ful

Length Beta 183 Pedilanthus P-13 BWP CPF/CPR WTGF/R +clcv Ful

Length Beta 37 H. Cotton HDC- MTN CPF/CPR 14 WTGF/R Ful

Length Beta 49 H. cotton HC-15 MTN CPF/CPR WTGF/R Ful

Length Beta

468 Luffa L-16 RYK CPF/CPR WTGF/R +clcv Ful

Length Beta 432 Cotton C-17 RYK CPF/CPR WTGF/R - Ful

Length Beta 453/ Cotton C-18 RYK CPF/CPR 36/ 178 WTGF/R -clcv Ful

Length Beta - 418 Cotton C-19 RYK CPF/CPR - WTGF/R +clcv Ful -

Length Beta - 329-1 Cotton C-20 FRS CPF/CPR 257-2 /175 WTGF/R + Ful

Length Beta

547 Cotton C-21 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta - 380 Cotton C-22 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta - 140 Cotton C-23 VHI CPF/CPR WTGF/R -clcv Ful

Length Beta 371 (1) Cotton C-24 VHI CPF/CPR 769 (2) WTGF/R + 4b 62-63/03 M13F CLCuBV- G19

G19 Ful +

Length Beta + 5-6(1),5-6(2) 98-99/02 G13,G14,

3β, 4β 62-63/03 G26, G27 222 Cotton C-25 BWN CPF/CPR WTGF/R -clcv Ful

Length Beta - 39 Cotton C-26 BWN CPF/CPR

WTGF/R -clcv Ful

Length Beta 484 Cotton C-27 GTI CPF/CPR WTGF/R + 3-4(1),3-4(2), 98-99/02 M13F CLCuMV- G11,G12,G20

5a 62/63/03 G20 Ful +

Length Beta + 7-8(1),7-8(2) 98-99/02 G15,G16,

5β, 6β 62-63/03 G28, G29 268 Cotton C-28 GTI CPF/CPR WTGF/R + Ful

Length Beta 90 Cotton C-29 GTI CPF/CPR WTGF/R -clcv Ful

Length Beta 844 Cotton C-30 BRW CPF/CPR - WTGF/R - Ful -

Length Beta + 1212 Cotton C-31 BRW CPF/CPR WTGF/R -clcv Ful

Length Beta - 780 Cotton C-32 BRW CPF/CPR WTGF/R - Ful

Length Beta - 660 Cotton C-33 BRW CPF/CPR WTGF/R -clcv Ful

Length Beta - 656 Cotton C-34 BRW CPF/CPR WTGF/R +clcv Ful -

Length Beta + 822 Cotton C-35 BRW CPF/CPR WTGF/R Ful - +

Length Beta + 66 Cotton C-36 VHI CPF/CPR WTGF/R -clcv Ful +

Length Beta + 77 Cotton C-37 VHI CPF/CPR

WTGF/R +clcv Ful +

Length Beta + 66 Cotton C-38 VHI CPF/CPR WTGF/R -clcv Ful -

Length Beta defective 11 Cotton C-39 VHI CPF/CPR WTGF/R -clcv Ful +

Length Beta defective 52 Cotton C-40 VHI CPF/CPR WTGF/R -clcv Ful -

Length Beta 441/ Cotton C-41 VHI CPF/CPR - 192 /P WTGF/R Ful +

Length Beta -

defective 983 Cotton C-42 VHI CPF/CPR WTGF/R +clcv

Ful +

Length Beta + 1062 Cotton C-43 VHI CPF/CPR - WTGF/R Ful

Length Beta - 863/ Cotton C-44 VHI CPF/CPR - 50 WTGF/R Ful +

Length Beta - 938/ Cotton C-45 VHI CPF/CPR - 34 WTGF/R Ful +

Length Beta 548/ Cotton C-46 VHI CPF/CPR - 30 WTGF/R Ful

Length Beta 1060/ Cotton C-47 MTN CPF/CPR - 37 WTGF/R

Ful +

Length Beta 1080/ Cotton C-48 MTN CPF/CPR - 31 WTGF/R Ful

Length Beta 830/ Cotton C-49 MTN CPF/CPR - 41 WTGF/R Ful

Length Beta 522 Cotton C-50 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta 366 Cotton C-51 MTN CPF/CPR WTGF/R -clcv Ful +

Length Beta 233/ Cotton C-52 MTN CPF/CPR 68 WTGF/R +clcv Ful -

Length Beta - 495 Cotton C-53 MTN CPF/CPR - WTGF/R Ful

Length Beta 649 Cotton C-54 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta - 189 Cotton C-55 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta -- 425 Cotton C-56 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta - 203 Cotton C-57 MTN CPF/CPR - WTGF/R Ful

Length Beta 308 Cotton C-58 MTN CPF/CPR -

WTGF/R Ful

Length Beta 602 Cotton C-59 MTN CPF/CPR - WTGF/R Ful

Length Beta 289 Cotton C-60 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta 250 Cotton C-61 MTN CPF/CPR WTGF/R -clcv Ful

Length Beta 383 Cotton C-62 HAB CPF/CPR WTGF/R +clcv Ful

Length Beta + 476 Cotton C-63 ARW CPF/CPR WTGF/R -clcv Ful

Length Beta

224 Cotton C-64 ARW CPF/CPR WTGF/R -clcv Ful

Length Beta - 56 Chilli Ch-65 BWN CPF/CPR WTGF/R + 7b 62-63/03 M13F PepLCBDV G22 Ful

Length Beta + 7β 62-63/03 G30 24 Vinca V-66 MTN CPF/CPR WTGF/R + Ful

Length Beta 950 Gul-e- G-67 BWN Dophaii Tomato T-68 BWN C. pepo Cp-69 PWP Tomato T-70 PWP Tomato T-71 PWP TomatO T-72 SWL Okra O-73 PWP Water melon W-74 MTN Tomato T-75 MTN Bhendi B-76 KWL Hibiscus H-77 MTN Weed W-78 PTK

Ageratum A-79 PTK Shoe flower H-80 PTK Silvery S-81 PTK Melon M-82 LHR Malvestrum W-83 PTK Weed 1 W84 LHR Weed 2 W-85 PTK Duranta D-86 PTK Ornamental O-87 PTK Ornamental O-88 PTK 2 Melon1 M-89 LHR Dranta D-90 PTK repens Weed 4 W-91 PTK Weed 3 W-92 PTK Abutilon A-93 PTK Ornamental O-94 PTK S. nigrum S-95 MTN Lady finger L-96 VHI Chilli C-97 VHI Weed W-98 VHI Chibbar Cb-99 VHI Kaddu Cb- VHI 100 Cotton C-101 VHI Weed 2 W-102 VHI Shoe flower S-103 VHI

Kaddu K-104 BWN Weed W-105 BWN Shoeflower S-106 BWN Cucurbit Cu- BWN 107 L. cylindrica Cb- MTN 108 Pepper P-109 PWP Cowpea Cp- PWP 110 Cowpea Cp- PWP 111 L. cylindrica L-112 PWP Cowpea Cp- RYK 113 Pepper P-114 RYK Eclipta E-115 RYK Pepper P-116 RYK S. nigrum S-117 RYK

BWP = Bahawalpur; KSK = Kala Shah Kaku; KWL = Khanewal; LHR = Lahore, SWL = Sahiwal; MTN = Multan; RYL = Rahim Yar Khan, FRS = Fort Abbas; VHI = Vehari; GTI = Ghotki; BRW = Burewala; HAB = Haroon Abad; ARW = Arif wala, PTK= Pattoki BWN = Bahawal Nagar;

ANNEXURE-2

Figure 1. PCR amplifications of begomoviruses (full length: 2.8kb) from plants showing begomovirus like symptoms

Figure 2. PCR amplifications of betasatellites (~1.4kb) from plants infected with begomoviruses

Figure 3. Detection of begomoviruses in plants showing begomovirus like symptoms by diagnostic primers designed on Coat Protein region of the virus genome.

A B C Figure 4. (A) Cloning of betasatellites in cloning vector TA. Clones are digested with KpnI to remove insert from the vector. (B & C) Cloning of begomoviruses in cloning vector TA. Clones were linearised by single digestion (B) and digested with HindIII which chopped down the insert into multiple fragments (C).

Figure 5 A. Rolling circle amplification was also used to amplify viral DNA. Out of 85 samples tested 68 samples were found positive for begomoviruses as shown in pictures below.

Figure 5 B. Rolling circle amplification was also used to amplify viral DNA. Out of 85 samples tested 68 samples were found positive for begomoviruses as shown in pictures below.

ANNEXURE-3

Confirmation through sequencing of the clones

G17-PedLCV GTGANGTTTAGGACCGCGGTCGAATTTACGTCGCGTAACTCGCTTAATGCTNCTCAGATTGATTGTACGCATCCGCCTTTAATTTGAACTGGCTTTCCGTACTTGGTGT TGCTTTGCCAGTCCCTTTGGGCCCCCATAAATTCCTTAAAGTGCTTTAGGTAATGGGGATCGACGTCATCGATGACGTTGTACCAGGCCTCATTACTGTAGACCTTTG GACTAAGGCCTAAGTGACCACACAAATAATTATGTGGACCCAGTGACCTAGCCCACATCGTCTTCCCCGTACGACTATCGCCCTCTATGACAATACTTTTAGGTCTCA ATGGCCGCGCAGCGGCATCCATCACGTTCTCAGCAGCCCAGACTTCATATGTTCTTCCGGAACTTGATCAAAAGAAGAAGAAGAAAAAGGAGATACATAAACCTCC ATAGGAGGTGTAAAAATCCTATCTAAATTAGCATTTAAATTATGAAATTGAAGTACATAATCTTTTGGTGCTAATTCTTTAATTACTCTAAGAGCCTCTGACTTACTGC CTGCGTTAAGCGCTGCGGCGTAAGCGTCGTTGGCTGACTGTTGTCCCCCTCTTGCAGATCTTCCATCGATCTGAAACTGTCCCCAGTCGAGGGTGTCTCCGTCCTTCT CAGATAGGACTTGACGTCCGAGCTTGATTTACCTCCNGAATGTTCGGATGGAAATGTGCTGACCTGGTTGGGGGAGAAA G18-PaLCuV AGTAGATACACGGCCAGTGAATTCGAGCTCGGTACCTCGCGTAATGCATCTCAGATTGATTGTACGCGTCCTCCTTTAATTTGAACGGGCTCTCCGTACTTTGTATTTG ATTGCCAGTCTCTTTGTGCCCCCATGAATTCCTTAAAGTGCTTTAGGTAGTGGGGATCGACGTCATCAATGACGTTGTACCAGGCCTCGTTACTGTATACCTTTGGACT AAGGTCTAGATGACCACACAAATAATTATGTTGACCCAGTGACCTAGCCCACATCGTCTTGCCCGTTCTACTGTCACCCTCTATGACTATACTTATCGGTCTCAAAGG CCGCGCAGCGGCACTGACAACGTTCTCGGCAGCCCACTCTTCAAGTTCTTCTGGAACTTGATCAAAAGAGGAAGAAGAAAAAATAGAAACATAAACCTCCACTGGA GGTGTAAAAATCCTATCTAAATTACATTTTAAATTATGATATTGAAAAATAAAATCTTTAGGGAGTCTTTCTCTAATTATTGCTAAAGCAGCCTCAGCCGAACCTGCA TTTAGGGCCTCTGCTGCAGCATCATTAGCTGTCTGTTGACCTCCTCGAGCAGATCGTCCGTCGATCTGAAAGTGACCCCAGTCGATGTT G09-CLCuBuV GCGGAGGATACACGNTTTAAGACCCACGAGGCACAGGGTGATGCAAATCNTAACAAAAACGACCTCCGCGTTCAACACTCACGCGACCTTTTAGATTAGACATAAC TCCCACACGCACTATGTGAGTGACCCCGACGTTAGAGAACCTCTCCCGCGCTCCACACACTCGCGCCGCACCCCTCTCCTCCTCCCGACCCCCACTGGACCCTATCTT TGGGACCTTTTTTGTTGCTCGCACCCGACGNGCAACCACACTCGCGCGCGCGCCACGCCACGCCACCGCGCCTCCACCACTCACTCCCGCGCCTGCTCCCCCACCTCC GAAGAACGAAACGGCCGTTAACCTTCCGAAAGCCGGGCCGTGGAAAATGATTATATCTGCTGGTCGCTTCGACATCCCTCCCTCCCCCCCCTTATTACCAGGAATTTA AATCCCCTTTATTTCAAATTTC G19-CLCuBuV CAGTGAATCGAGCTCGGTACCTCGCGTAATGCATCTAGATTTATACGCGTGGCTTCGGTACATGGGCCTATTCGCCCATGCTTTTGCTTTGGTGACGCGGACAATGGG GGCAGCAGCACGGCTCACATATGGGCTGTCGAAGTTGAGACGACGGCGTACCTTCGAAGCGGGCGTGGAAATGATTATATCTGCTGGTCGCTTCGACATAATTCCTA GCCCTTATTACCAGGATTAAATCCCTTATCAAATCGTAACCCAATGTATCAGGAGAGTAAGTTTTCTCTACTAACTGCAAATATTTAACTGCTAACATACACCTAAAA CCGTGAACGGTATCGGGGAACTCATTTAACAGTGGATCCCACATTTTTCAAACGCATACTTAGCAACGAAGTACTTATAATAAGCGGGAGAATTATTTAAGCTTTGA GCGCGTCATATGATTGGCCGACAAGAGATAATGGTAGGGCCCACAAAAAAATCGCGCGGCCATCCGGTAATATAA

G20-CLCuMV GTTTTACGACGGCCAGTGAATCGAGCTCGGTACCTCGCGTAATGCATCTCAGATTTACACGCGTGGCTTCGGTACATGGGCCTGTTTGTCCATGCCTGTTGTTTTTGTG ACGCGGACAATGGGGGCAGCAGCACGGCTGGTGTATGGGCTGCCGAAGTTCAGACGCCGGCGTACTTTCGACGCGGGCGTAGAAATGACGATATCGGCAGCTCGCT TCGACATAATTACGGGAGCGTAAAATACAAATTAAATCCCGTATTAACTCGTACCCAAGCGTATCCGGTGAATAATCCTGCGACAAAAGTTGCAAATATTTCACAGA AAGCATACACCGAAACCCGTGAACCGTATCAGGAAATTCGTTTAATAGTGGATCCCACATGTTTGAATTTGAAACTTAGTGCGCAAGTACTTATAGTGTGCGGGAGC GTTATTTAGCTTTGAGGGAGCAATCTCATAAATCGGGGGCCCACAAAAAAATCGCGCGGCCATCCGGTAATATTAAACGGATGGCCGCTTTAGCCTTTTGATTTGAA TTTCAAATTAAAGTTTTTTTATTACCATTATGCCATTTGGTGATCACTATATATTGATCACCGATATACCGGGGAGAGTTGCAAGAGCGGCCATCGGTGATCAATTTA GTCACATGC G22-PepLCBDV AGATGTTAACACGGCGTGATACAGCCGGTACCTCTCGAATGCTCTAGATGTACACGCGTGGCTTCTGTACATGGGCCTGTTCGCCCATGCTCTGGCCTTTGTGACGCG GACATGGGGGCAGCAGCACGCTGGCATAAGGGCTGTCGAAGTTGAGACGCGCGTACCTTCGAGGCGGCGTGGAAATGATTATATCTGCTGGTCGCTTGGACATAAA TTCTTAGCCCCTAATAACAGAGAATCCAAATCCCTGAATTAAAATCGTACCCAACAGNGGTCTGGAGAAATATGTATTTTCTAGTAACTGCAGATATTTAACGGCTA ACATACACCTAAAGCCGTGAAACGGTTTCGGGGAACTGTTTTAACAATGGGATCCCACATTGGGTATGAGTGCACTAACTGGGGGACCAAGCCTAAAATAGGGGGA CCAGTGGAATAATTAAGCGAATGAAGGGACATTTTTTATTGGGTCCACAATGTTCTTTGTTCAGCACGTGCGGTGGTGGGGGTCAACGATGAAAAAATCCCCGCCAT TCCGGAATTTATCCGATGGCCCCATTTCGAAATGAATTATGGTTGTAAAATAACATTTGGCATTTTGGGGACCCCATATTAATTCCGTTCCCAAGGTGTTCCCCCAATT CCTCCACAAGTTTTTGG G23-CLCuB TTGATNGTTTACCACGGCCAGTGAATNCAAGCTCGGTACCTCGCGTAATGCATCTCAGATTACCACTACGGCTACGCAGCAGCCTTAGCTACGCCGGAGCTTAGCTC GCCCACTGTTCTAATATTACCGTGGGCGAGCGGTGCCCGGTTGCCGCGCAGTGGGTCCCACTGCTTGTCTTGACTGGATTTTACTTCTAATGGGCCAATTTAATGGGC TTGGAAGTGATCGGGCCTTTGAAGATGGCCGTTTATGGATTATGGGTCTGTTTGTCGTCCGGTGATATGTGTGTTAAATATGCATTACTGGGTCGTGGTCGGAATTTA AACTGTGAACTTCTTATTGAATATGTATGGTTCGATTACATCCATTCCCAATATCTCTGGGTTTTCCAAGTACAAGTATATCAAGTCTGTGAATCATATCTTCTATCCC GCACTCCTCTCCCTATTCTTCGCCCCCGTCGGTATTGCGACTACCGACCCTCCCGCTATGATGCTCCCCTTCCAGCCGTTGAAGTCGCAACTGGAACGTGTCTGTCTCC GTACGTGTACTGGACGATTCCTTCATACTTGATCAGCGATCGTGACTCCGGTGGATCCCATCCCTCACTGCCGAAATGACCCACCCCCCCCCTAATCCTTTCCCCCTGG AACTTGCCCGACAACCGCTCCCGAACCCTACCTCGCACCCCCCCCTCGCACCCCTCCCCCCCCTCCCCCTTTGG G05-CLCuMB ATAAAAACCTTTGACACTCATAACGGATACACTCATAAGGGAAAGCTTGCCTGTTTCAAGGCCCTGCTCGCCAGTGCGACGGGCCCGGGATCCGATTGGTAACCTAC CCTCCCAGGGGTACACACCCGCCCCGCCGCCGTGTCGTTAAAATCGATGCCGGAATCAGCCAGGTTTGGCCGTTTCCGGTTGAGATTTCGTGGAAAGAAGAAAGGTT CACCTTTTTTCAGCCGCAATTACCACGCCGCCCCTTCCAGAACGTCAAAAAGCGGGGGGTTTTTTTCGGGAAAAAGGCAAATTGAGTTGGTTCGTCCAAGTGGAGTC ACCGTAGTAGTAGTCGGAAAAATCAAATTCACCCTTATTCTGAAGTTCTCCTAATTTTTTTAACCCCTTTTTTTCAATTCAATTTACCATTTTACCGTCCCAGTTAAAGT GGGTAAAAACCACCCAGTTCACCTTGTTTTTTCCTTGTGGGGTTTTCCGTGNTTTCGAAATTCGGCGTGCCGCCTCCCCATTTTTCTTTTCAGTAACACCTCCCTCCTAC TCCCCCCCCTCCCCCTCCTTCCTTGCGTTCCTCCCCCCTCCTCCCAGCTCCCCGCTCCTTCCCCTTTTCATCACTCCGCTTTTCCCTAATCCCGCTATAGTAGTAGGTTAC TACACCGCGCCACCCAAACCCCGGTGTTTTTTACAGGACTCCCCCCCCCCCCCCCCTTGATCTACACTCGGTGCTAAGTACGTCCTCCCCTCCTCCTCCTCCACTCCTT TTAATGTGGACCCCTCCCCCTNTACGTNCGGTCCCCCCCCCCNCCACTCCNCCTCCC

G24-CLCuMB AAAAAGCCAGCTTTAAACCCCGGCCTGTAGTTAAAGCGTCNCGTGAGCTCNCGTCTAATCGCTNCTCAGATTGGTACCACTACGGCTACGCAGCAGCCTTAGCTACG CCGGAGCTTAGCTCGCCCACGCTTTAATATTACCGTGGGCGAGCGGTGCCCGGTGGCCGCGCAGTGGGTCCCACTGCTTGCCTTGACTGGATTTGACCTCTAATGGGC CAATTTAATGGGCTTGGAAGTGATTCGGGCCTTAGAAGATGGCCTTTTATGGAATAGGGCTCTGTTTGTTGTTGGTGATATGTGTGTTAAATATGCATTACTGGGTTG TGGTTCGGCACTCCAAACTGTGAATTCCCTCCTATCCGAATATTGNCCTCGGTCCCGAATTTACATTTCCACTTCCCCCTTTTCATTCCTCCTGGGGGTTTCCCAAAGTT ACCAACGTATATTCAAGGTCTGTGAATTCATACTCTTCTATCCTCGATCATCTCTCTCATACTTATGCCCCCGGTTGGTTATTGCCCGACATTAAGGGAAAATTTCCCC GGCATCAATTGAAATTGCCCTCCCCCCTTTCTCCCCCCCCCCCCCCCCCCCCCCGCACAAGTTTCCGGAAATTTGGGAAAACCCGTTTGTTTATTTGTTCCTTTCCCGG TAACCCGCTTGCTACCCTCGGCACCCGAATCCCCCCTTTCCATTACCCTTTGAAATTTANGCCGAAATGGGGGTCGCACCCTCTCTCGGTGGGGAATTTAAGGTTTAC CTTCCCCCTCCAATTTTGGTTTGGAAAAAATTGGAAAAAAGGGA G25-CLCuMB AGTTAGAATTACCACGGCCAGTTGATTCGAGCTCGGTACCTCGCTAATGCATCTCCAGATTGGTACCACTACAGGCTACGCAGCAGCCTTAGCTACGCCGGAGCTTA GCTCGTCCCACGCTTTAATATTACCGTGGGCGAGCGGTGCCCGGTGGCCGCGCAGTGGGTCCCACTGCTTGTCTTGACTGGATTTGACCTCTAATGGGCCAATTTAAT GGGCTTGGAAGTGATTGGGCCTTTGAAGATGGCCTTTTATGGAATAGGGCTCTGTTTGTTGTTGGTGATATGTGTGTTAAATATGCATTACTGGGTTGTGGTTGGCATT TAAACTGTGAATTTCTTATTGAATATGTATGGTTCGATTACATCCATTCCCATATATCTCTGGGTTTTCAAGTACAAGTATATCAAGTCTGTGAATTATATCTTCTATCT CGATCTCTTCTATCTTTGCCCCGTTGTATGCGAATAGGAAATTCGCTATGATGCTCCCTTCAAAGCCGTTGAAGTCGAATGGAACGTGTATGTCTCCCTACGTGTACTG GACGATCCCTTCATACTTGATTAGCGATGGTGACTTTGTGGGATAGTATCCTCATGTGAATGAAGATCTTCATCTTCTCCATGATGCGACCATCGACTATGAACCTGA CTCCCTCCGTGTTTGTTCCACTGGGTTGTCATTTCTGCCTTATTTTGATGGGAATNGTTT G13 CCGGCCAGTGAATACGAAGCTCGGTACCTCGACGTAATGCATCTAGATTACCACTACGGCTACGCAGCAGCCAAATTCTTTAGGTGAAACTAGATCATTGTTTAACA TTTTTGTAGTTGATAAAGCCATTCTTCCCATAGGATAATTTACTAGGACAACAGAGAAAAGAGCATGTAAATCTCTAGGAACACTCATTTCTATCATCTCATGAATCA CCGCAATGTAAACCGTGGAGCTTTGATCACTATTTTTGTTTCCTCCTACCATCCTTTAATCAAGTAAACTAATCATCACTGGCAACCCCTCATATAATTGACCTGCAAA ATGTTAAACTATTGCAAGAAAATAACAGAGGCTTTCTGAATCAAGAAGAATATATTGAAAAATTATATCTCTGTATAGAGGTTGCTAATACTTTTATACATCATAGCA AAACATGCTATCTACAGAGAACAAACTAACAGAATAACTAACAGCTAAA G14 AGTAGATTACGCACGGCCAGTGAATTCGAGCTCGGTACCTCGCGTATTGCATCTCGATTGGTACCACTACGAGCTACGCAGCAGCCCCACGGATAACGTGTGGAGAG GAGTGTCTGGGTTCAAAGAGCAGGTCGAGAACACTTGCTCTTTGCTCAGCTGATAGCGACGGCAGAGAGGAAACGGGTGGTAGGCTGTTCATGATTGAATGGAGAG TATGCAAGGACCAGACGATCGTGCATGTAGAATGTTGCAGCTCAGCTTGGTTTCTCCGTTCAGCTGAAGCTCGGGCAATCAGCTCACCATGCATATACCGAGCAAAG GCAGCCACTTTTCAACCCCAGCTAGAGCCAAGATAGACAAACGGCACAAGGGAAATCACTTTTATCAAGCTGTCCGGCACACGGCAGACTGATAACTCAAGATCTTG AGCCCCTTCCAAGCCATACCAATTTCAAGAAAGCGGGGAACACCGAGGCGGCATGAGGAGGTCGCGAGGTCGCGAGTCCGCAAGTCCGGATCCCCATGAATTTTAG TATGAGAAACCGATCCCCACTCTAAACTGGCTTATGTGGAGATCGAGGGAACGTACAACGAGTTTAGATGCACGACATGTCACATGCATAGTCAAACATACGACAG CTTTTGGTTCCTGAGAAAATCCCCGTGGGTTCAGCTAAGAGTGATGAGGNGTGAATATTGTCACCCCAGGACCAGGTTGG

G30-ChLCB GTATTCCACGGCCAGTGAATTCAAGCTCGGTACCTCGCTAATGCATCTCAGATTGGTACCACTACAGGCTACGCAGCAGCCTTAGCTACGCCGGAGCTGAGCTCGCC CACGTTCTAATATTACCGTGGGCGAGCGGGTTTTTTGGCGTTGAAAGTGGGTCCCACAATATCCAAAGGAAGACTAATGGACTGGGTCAATGCAATTGGGCCTTAGT TGAAATGGGCTTGGACCAGTAGATTCGATACTGGGCCAATATAATAAAATAAGAAATGGGTTCACAAGCAAAACAAAGCATTTATTCATCTCAAATACATTTCACAG TCACACACACACATTCGTATATACATCATATTCATCCCCTATACGTATATCAACTACAGGGGCCTCATGCATCATCAATATATCAATAGATTCTACCATGTCCTCCTGT CGAAACTCCCCTATATTAGAATCTCTGTACATGATCTTCAATATATTATGTATCCCGTCCTCCAAATTGTTGAAGTCGAAAGGCGGTATGATCCCATCATGGCCATAT GGGATCATGAAGGTCTTCTTTGCCAGTGCTGGTGATCGTGTTGAGCACAAGTCAACACGGACAAGAAGTGAATTGTCTTCGTTGATCTTCACGTTGATGGTAAACTCC ATCCCCATTCTCGTTATTATATTTTGAGCGTT G1-PedLCV CAGCATTCTCCTAAAACAGCACTCATCAAAGGCAAGCTGCTAGTCAGGCCTTCCGCAGTCGACGGGCCCGAGGATCCGATTAGACGCGTGGCTTCGGTACATGGGCC TGTTTCGCCCATGCCCTTGCTTTTTTGTGACGCGGACAATGGGGGCAGCAGCACGGCTCGCATATGGGCTGTCGAAGTTGAGACGGCGGCGTACCTTCGAGGCGGGC GTGGAAATGATTATATCTGCTGGTCGCTTCGACATAATTCCTAGACCTTACCACTGAAATTAAATCCCGAATTAAATCGAATCCCAGAGTATCTGGGGAATACGTACT TTCTACTAACTGCAAATATTTAACTGCTAACATACACCTAAAACCGTGAACGGTTTCTGGGAAACTCGTTCAATAACGGATCCCACATAGTGAATGTGAAACACAAC TTGCGCACTAAGTTTATAGGGGGGACCATGAAATAATTAGGCTATGAGGAACCATTCTCATTGGTCCATATGTCATTGTCAGTTAGTGCTCTGTGGGGGCCATAAAA AAAGCGCGGCCCTCCCCGTAATATTAGACGGATGGCCGCTTTAGCCTTTTCGTTCGACTCTCAAATTAGAGTCCTTTTATTACAATTATGCCATTTGGTACTCACTATA TATTGAGTACCGATATACAGGTGATAAACATCCAAGAACCAAATTGGTACCCA G26- GGGTAGAACGGGGTTCCCCGAGACGGAGGTCACGTATAAGGGACCCGCTCGCATCGCTCCGGCCCCCCCGCAGTCGACGCGGCCCGAGGATCCGATCCACGCCACC GCGTCGGCTCCGATCACATCGGGCCTCGTCTCGCCCATCGCTCCTCTGACCTTCCTGTCGACCCGAGCACAACTCGCGCGCGCGCACGCCACGCCACCGCGCCTCGGC CACCACGGCGACCTAGTCCCACACAGTTCCGCAGAACCGCACCGGGCGCTACCCCCCCCCAACCCCGGCGCCGTCGGACAATGGATTGACATACCTCGTCGCNTCGA GCTCCCCTCTCAGTACCTATCAAGATGTCCCGTAGGCCCCCTTAATATCAACCTGGANAACACCAAAAATCCCCCTAATCTGAAAAATCCGGTAAGCCCCAGGAACG TCGTCCTGGGCGCGACCTCACCGTTCATCCTGTCTAACCTAAGCCCTGGCNAGGAATCATCGCACCTCGGGCCTAATTCCTTACCTTTCNCTAGACACACCCCGGTGA ACNCGTGTTCCTCTTTGGAAAAACTCCGTCACCACTCCACTGGGACTCCCCAACTTTACAGGTAACNGATGTCGCACCTCACTTGGTCGCACCTAATGGTTAAATGNG GGGGGGGGACCCAAGGACCCCCACTTCACCCCTTCCAGAGGGACCCGAATCTTCTATTAGGGTTCCACGACTTCCATAGGTCCCATAAAGTGCCGCACTCGGGGTAC CACAAAAACCACTTGCGCGGCCTTCGGTCATCTACCCCGACGGCNGTNGGACTAGG

ANNEXURE-4

A B

Figure 1. A. Nicotiana benthamiana plantlets regenerated from calli on modified selective MS medium. B. In vitro transgenic plant cultured on modified selective rooting medium 5 4 3 2 1 L

Figure 2. PCR products of chromosomal DNA isolated from transgenic plants transformed with AEV-IR construct. The expected 456 bp PCR product was detected in lanes from 2 to 5 by using specific primers (Pdk_F and Ocs_R). Lane L contains a 100 bp DNA ladder.

ANNEXURE-5

Figure 1 (A &B). Healthy cotton plants for rearing of whiteflies and CLCuD transmission studies

Table 1: Study of whitefly samples from different areas of Punjab Sample code :Location Number of nucleotides Biotypes/Genetic group Accession number FS-1 Arifwala 865 Asia II unresolved HE578889 FS-3 Multan 865 Asia II unresolved HE578890 FS-5 Lodhran bypass 865 Asia II unresolved HE578891 FS-7 Shujaabad 866 Asia II unresolved HE578892 FS-8 Bahawalnagar bypass 866 Asia II unresolved HE578893 FS-10 Kabirwala 866 Asia II unresolved HE578894 FS-11 Tiba Sultanpur 866 Asia II unresolved HE578895 FS-12 Khanewal 866 Asia II unresolved HE578896

Figure 2: PCR analysis of cytochrome oxidase gene of whiteflies.

ANNEXURE-6

Figure 1. Transgenic (left) and non transgenic (right) plants shown in figure below were also challenged with ToLCNDV by agroinoculation. Non transgenic plants produced viral symptoms after approx. 20 days whereas transgenic plants remained symptomless.

Figure 2. Transgenic (right) and non transgenic (left) plants shown in figure below were challenged with ToLCNDV by whiteflies. Non transgenic plants produced viral symptoms after approx. 30 days whereas transgenic plants remained symptomless.

L 1 2 3 4 5 6 7 8

Figure 3. Semi-quantitative PCR-based testing of non-transgenic and putative transgenic N. Benthamiana plants harboring pART27 AEV-IR construct for their resistance against Agertum enation virus(AEV) after three weeks of challenging with infectious clones of AEV DNA-A and DNA- β in A. tumefaciens strain GV3101 using coat protein primer of DNA-A of AEV. Lane l: 100 bp ladder. Lane 1: Plasmid DNA- A for positive control. Lanes: 2,3,5 and 6 trasgenic lines. Lane 4: plant treated with water used as a negative control.Lanes 7and 8 healthy non transgenic plants infected with AEV infectious clones. The resulting PCR products were analyzed on a 2% agarose gel.

ANNEXURE 7

D C B A L 1kb Ladder

Figure 1. L.1Kb ladder (Fermentas), A. Undigested pART 27 vector with inserts B. Undigested empty pART 27 vector C. Empty pART 27 vector digested with NotI. D. pART27 with insert digested with Not I. The expected 3325bp fragment was detected in lane D.

ANNEXURE-8

Figure 1: Restriction analysis clones for the production of partial dimers.

Figure 2: Confirmation of partial dimers by restriction analysis

ANNEXURE 9

Figure 1. A. Invitro Nicotiana benthamiana plantlets regenerated from calli on modified selective MS medium. B. Callus induced from hypocotyls explants weeks under 16/8 h light/dark cycle period C. Callus formation on selection medium after Agrobacterium -mediated transformation

L 1 2 3 4 5 6

Figure 2. PCR products of chromosomal DNA isolated from transgenic plants transformed with pART27 CLCuV IR construct. The resulting PCR products were analyzed and the expected 590 bp product was detected in transgenic plants (Lanes 2, 3, 4 and 5 ) whereas this product is absent in case of non-transgenic plants (Lanes 1 and 6). Lane L contains a 100 bp DNA ladder.

ANNEXURE-10

A B

Figure 1. Symptomatic and non-symptomatic N. tabacum plants infected with infectious clones of Tomato leaf curl New Delhi virus (TLCNDV). Shown are TLCNDV inoculated non-transgenic (A & B) and transgenic (C) plants. Symptoms appeared after 13 days post-inoculation (dpi).

A B

Figure 2. Symptomatic and non-symptomatic N. benthamiana plants infected with tomato leaf curl palampur virus (ToLCuPLV). Shown are ToLCuPLV-inoculated non-transgenic (A & B) and transgenic (C) plants. Symptoms appeared after 15 days post-inoculation (dpi).

A B

Figure 3. Symptomatic and non-symptomatic N.benthamiana plants infected with infectious clones of Mastrevirus. Shown are Mastrevirus-inoculated non-transgenic (A & B) and transgenic (C) plants. Symptoms appeared after 19 days post-inoculation (dpi).

A B

Figure 4. Symptomatic and non-symptomatic N. benthamiana plants through whitefly (Bemisia tabaci) inoculation for Tomato leaf curl Palampur virus (ToLCuPLV). Shown are ToLCuPLV-inoculated non- transgenic (A) and transgenic (B) plants. Symptoms appeared after 25 to 30 days post-inoculation (dpi).

Figure 5 A. Transgenic cotton plants under field trials

Figure 5 B. Southern blot analysis for Cotton leaf curl Burewala virus in transgenic cotton.

Figure 6 A&B. Close views of Transgenic and Non-Transgenic Cotton Plants. (A) Transgenic cotton plant resistant to CLCuD (B) Non-Transgenic (Normal) diseased cotton plant

ANNEXURE 11

A B

Figure 1. Screening of seeds for kanamycin efficacy from non-transformed (A) and homozygous T0 tobacco plants transformed with the pART27CLCuV-IR construct and (B) on medium with 150µg/ml kanamycin. The transgenic seedlings are two weeks old.

Figure 2. Symptomless transgenic and non transgenic Nicotiana benthamiana plants after three weeks of post-inoculation with infectious clones of CLCuV DNA-A and DNA-β

Figure 3. Photographs of symptomatic and non-symptomatic N. benthamiana plants infected with infectious clones of Tomato leaf curl New Delhi virus. Shown are a ToLCNDV-inoculated transgenic (A) and non-transgenic (B) N. benthamiana plants. Photographs were taken at 35 days post-inoculation

Figure 4. A) Semi-quantitative PCR-based testing of non-transgenic and transgenic N. Benthamiana plants harboring pART27 CLCuV-IR construct for their resistance against CLCuV after two weeks of challenging with infectious clones of ClCuV DNA-A and DNA- β in A. tumefaciens strain GV3101. B) Actin gene was included for internal control experiments. Lanes 1 and 7: Plants treated with water used as a negative control. Lanes 2 and 3: Healthy (Non transgenic) plants infected with CLCuV infectious clones. Lanes 4, 5 and 6: Transgenic plants infected with CLCuV infectious clones. The resulting PCR products were analyzed on a 2% Agarose gel. To ascertain the semi-quantitative result, the same DNA samples from non-transgenic and transgenic plants were amplified by PCR using primers pairs for Actin gene. Samples described in lanes 1 to 7 are the same as in figure 2. Fragment size of 209 bp from Actin gene was detected in samples from both transgenic and non-transgenic plants (internal control)

Figure 5. Field view of T1 generation of Figure 6. Healthy transgenic cotton transgenic cotton plants harboring IGS-IR plants viewing that the hpRNA construct construct intermixed with non-transgenic providing resistance to virus infection cotton plants in IAGS, PU fields.

Figure 7. Field view of cotton plants in IAGS field showing typical symptoms of CLCuD through whitefly (Bemisia tabaci) inoculation.

Verification of

transgenic lines shown by arrows below harboring IGS-IR

construct

V2V2-4,- V21, V2-5, - V22, V2-6 - 3 L V2-7, V2-8, V2-11, V2-1 V3-1, V3-2 ,V3-3, V3-4, V3-5 L V3-6 V3-7A, V3-8, V3-9, V3-10

Figure 8: PCR analysis was performed for the verification of IGS-IR construct in transgenic cotton plants (T1). 1kB DNA marker (lane L) was loaded for size comparison. The expected 456 bp PCR product was detected in (V2-1), (V2-2), (V2-3) and (V3-7A) by using specific primers (Pdk_F and Ocs_R). The resulting PCR products were analyzed on a 1% Agarose gel.

Total DNA was extracted form transgenic and non-transgenic filed plants in order to investigate the accumulation of viral DNA. PCR assay was performed using specific primer pairs to amplify a 750 bp of coat protein of CLCuD. The expected size of coat protein could only be ampliﬁed in non- transgenic plants whereas no bands or very light bands were detected with DNA extracted from transgenic cotton plants from field. The 750bp PCR product is very faint in different transgenic lines (signified by arrows) harboring pART27 IGS-IR construct that indicates various level of tolerance or resistance of transgenic lines against virus.

Transgenic lines shown by arrows having less accumulation of viral DNA (replication) as compared to non- transgenic plants (no arrows)

Figure 9: PCR-based testing of non-transgenic and transgenic cotton plants harboring pART27 IGS-IR construct for their resistance against CLCuD. Primers CP-F and CP-R for 750bp product were used to check accumulation of viral DNA. The resulting PCR products were analyzed on a 1% Agarose gel.

To ascertain the PCR result, the same DNA samples from non-transgenic and transgenic plants were amplified by PCR using primers rbcla-F and rbcla-R. Fragment size of 600bp from was detected in samples from both transgenic and non-transgenic plants (internal control).

Transgenic lines shown by arrows and non-transgenic plants with no arrows

Figure 10: PCR of non-transgenic and transgenic cotton plants for internal control experiment. Primers rbcla-F and rbcla-R for 600bp product were used to detect cotton gene. The resulting PCR products were analyzed on a 1% Agarose gel.

Details for Southern Blot Analysis to Check Viral Load:

-ive 1 2 3 4 5 6 7 8 9 10 11 12

Figure 11. Southern blot analysis: Detection of viral DNA accumulation in transgenic cotton plants harboringpART27 IGS-IR. Samples are 8µg of genomic DNA of Non-transgenic (1-6) and transgenic transformed with pART27 IGS -IR (7-12) construct. Blot was probed with CLCuV.

ANNEXURE-12

Non-transgenic symptomatic plant Healthy transgenic plant

Figure 1. Symptomatic and non-symptomatic N. benthamiana plants infected with infectious clones of Tomato leaf curl Palampur virus (ToLCuPLV). Shown are ToLCuPLV-inoculated non-transgenic and transgenic plants.

Non-transgenic symptomatic plant

Healthy transgenic plant Figure 39. Symptomatic and non-symptomatic N. benthamiana plants infected Figure 2. Symptomatic and non-symptomatic N. benthamiana plants infected with infectious clones of Malvestrum yellow vein change manga virus. Shown are inoculated non-transgenic and transgenic plants. with infectious clones of

Malvestrum yellow vein change manga virus. Shown are inoculated non- transgenic and transgenic 83 plants. Tomato

Non-transgenic symptomatic plant Healthy transgenic plant

Figure 3. Symptomatic and non-symptomatic N. benthamiana plants infected with infectious clones of Mastrevirus

Non-transgenic symptomatic plant Non-transgenic symptomatic plant

Figure 4. Healthy transgenic plant

A B

Figure 5. Screening of seeds for kanamycin efficacy from non-transformed (A) and seeds from T1 tobacco plants transformed with the pART27CLCuV-IR construct (B) on medium with 150µg/ml kanamycin. The transgenic seedlings are 10 days old.

Figure 6. Infectivity of infectious clones of Tomato leaf curl virus in tobacco plants. Symptomatic non-transgenic plants (A), compared to putative transgenic plants showing mild symptoms (B). Photographs were taken at 24 days post-inoculation.

Figure 7. A) Semi-quantitative PCR-based testing of non-transgenic and putative transgenic N. Benthamiana plants harboring pART27 CLCuV-IR construct for their resistance against CLCuV after three weeks of challenging with infectious clones of ClCuV DNA-A and DNA- β in A. tumefaciens strain GV3101 using coat protein primer of DNA-A of CLCuV. B) Actin gene was included for internal control experiments (Lanes 0-7).Lane 0: Plants treated with buffer used as a negative control. Lanes 1and 2: Healthy (non-transgenic) plants infected with CLCuV infectious clones. Lanes 3-7: Transgenic plants infected with CLCuV infectious clones. The resulting PCR products were analyzed on a 2% agarose gel.

Test of resistance through whitefly inoculation (Asymptomatic and symptomatic response of transgenic and control plants respectively)

Non-transgenic plant tested Healthy transgenic plant through whitefly inoculation

Figure 8. Symptomatic and non-symptomatic N.benthamiana plants through whitefly (Bemisia tabaci) inoculation for Tomato leaf curl New Dehli virus (ToLCNDV). Shown are ToLCPLV-inoculated non-transgenic (A) and transgenic (B) plants. Symptoms appeared after 25 to 30 days post-inoculation (dpi).

ANNEXURE 13 Table-1 Details about Infectious clones (June 2012 Nov 2012) Agroinoculation dates and Infectivity of Tomato Leaf Curl Palampur Virus (ToLCPMV), Tomato Leaf Curl New Dehli Virus (ToLCNDV), Cotton Leaf Curl Burewala Virus (CLCuBV and Beta-satellite) and Malvestrum Yellow Vein Change Manga Virus clones to N. benthamiana and N. tabacum S Agro- Infectivity = No of plants showing symptoms / .No Infectious clones Code No. Inoculation Plants used Survival No. of plants inoculated . Date N. N. Tab Tab (Inoculum) benthami benthami Infectivity rate (%) aco aco na na Tomato Leaf Curl PDMV 26 B 1 14/07/2012 8 0 4 0 4 out of 8 plants 4/8 = 50% Palampur Virus PDMV 26 D

Malvestrum yellow vein 2 PDMV 10 14/07/2012 5 0 0 0 No symptoms Changa Manga virus

Cotton Leaf Curl 3 PDMV 12 15/08/2012 10 0 8 0 No symptoms Burewala Virus TLCNDV Tomato Leaf Curl New (DNA-A) 7/7 = 100% 4 31/08/2012 10 4 7 4 7 out of 7 plants Dehli Virus TLCNDV 4/4 = 100% (DNA-B) Cotton Leaf Curl 5 PDMV 15 12/09/2012 10 0 7 0 No symptoms Burewala Virus

6 Mastrevirus PDMV27 29/09/2012 5 0 5 0 2 0ut of 5 2/5 = 40%

Table-2 Details about Infectious clones (June 2012 Nov 2012)

Testing of resistance through the vector (Bemisiatabaci) to check the infectivity of Tomato Leaf Curl Palampur Virus (ToLCPMV) clone on seedlings of N. benthamiana

Infectivity = No of Inoculation plants showing S .No. Infectious clones Code No. Plants used Survival Date (AAP) symptoms / No. of plants inoculated N. N. Infectivity (Inoculum) Tabaco Tabaco benthamina benthamina rate (%) Tomato Leaf PDMV 26 B 6 out of 8 1 Curl Palampur 29/09/2012 15 0 10 0 6/8 = 75% PDMV 26 D plants Virus AAP= Acquisition access period

Table-3 Details for PCR analysis:

Non transgenic cotton plants = 11 Total number of Transgenic cotton plants (T1) = 43 PCR performed for plants = 35 Total number of samples with positive amplification = 27

Table-4 Details about Infectious clones (Dec 2012 May 2013) Infectivity rate of Tomato Leaf Curl New Dehli Virus (ToLCNDV), Cotton Leaf Curl Burewala Virus and Malvestrum Yellow Vein Change Manga Virus clones to N. benthamianaplants Agro- Infectivity = No of plants showing S. No. Infectious clones Inoculation Plants used symptoms / No. of plants inoculated Date (Inoculum) N. benthamiana Infectivity rate (%)

8 out of 10 8/10 = 80% 1 Tomato Leaf Curl New Dehli Virus 13/03/2013 10 plants

7 out of 10 2 Malvestrum Yellow Vein Changa Manga virus 13/03/2013 10 7/10 = 70% plants

3 Cotton Leaf Curl Burewala Virus 13/03/2013 10 No symptoms

2 out of 4 4 Cotton Leaf Curl Burewala Virus 09/04/2013 10 2/4 = 50% plants

5 out of 10 5 Malvestrum Yellow Vein Changa Manga virus 09/04/2013 10 5/10 = 50% plants

Table-5 Details about Infectious clones (Dec 2012 May 2013) Testing of resistance through the vector (Bemisiatabaci) to check the infectivity of Tomato Leaf Curl New DehliVirus (ToLCNDV) clone on seedlings of N. benthamiana Inoculation Infectivity = No of plants S .No. Infectious clones Date through Plants used showing symptoms / No. of whitefly plants inoculated (Inoculum) N. benthamina Infectivity rate (%)

7 out of 8 1 Tomato Leaf Curl New Dehli Virus 02/04/2013 10 7/8 = 90% plants

Table-6 Details about sowing of T2 generation of Cotton plants (Dec 2012 May 2013) Sr. No Total number of seeds No. Of transgenic No. Of plants survived Date of sowing from T1 generation cotton seeds obtained from T1 generation 1 ˂ 200 seeds of T1 30 10 31st April 2013

ANNEXURE 14a

(A) TITLE OF THE INVENTION

Development Of Pakistani Cotton Containing Virus Resistant Transgenes

ABSTRACT The present invention provides novel processes to overcome inherent deficiencies in the prior art when applied to Pakistani cotton varieties. A principal object of the present invention relates to the obtention of genetically transformed cotton (Gossypium hirsutum) plants which stably incorporate a genetic change, inherited in the said plant due to incorporation and stable integration of CLCuV resistant gene. The local cotton plant is transformed uniquely with an expression cassette comprising nucleotide sequences including those with unique modifications of previously reported sequences to induce new genetic traits. RNA interference (RNAi) was shown to play a major role in controlling infections caused by RNA viruses. Since the begomoviruses are DNA viruses, it was assumed that RNAi does not function against DNA viruses. Recent studies have revealed that RNAi may also function against DNA viruses. Although the molecular mechanisms are being deciphered, the results indicate that begomoviruses may also be targeted with an engineered RNAi system. Our very early studies were focused on the development of plant resistant to RNA viruses. Presently we are focusing on geminiviruses which are known to infect a large number of economically important plants. There are over 680 isolates of geminiviruses infecting over 200 plant species. All those viruses are transmitted in the field by whiteflies. Geminiviurses infecting major crops like cotton, vegetables (tomato, potato, pepper etc.) and ornamental plants cause enormous economic losses not only in the yield of those crops but also in the quality of crops. In this report we demonstrate that an engineered RNA system which targeted the conserved control region (CR) of many geminiviruses resulted in the protection of

93 transgenic plants from geminivirus infections. Our construct will generate a 293 base-pair double stranded RNA which encompasses most of the CR region of many begomo- and geminiviruses infecting a large number of economically important crops. This construct was tested against two begomoviruses (Cotton leaf curl Burewala virus (CLCuBV) and Mesta yellow vein Changa Manga virus (MYVCMV) as model studies. Data show that a very strong reduction in virus replication in transgenic Nicotiana benthamiana plants in comparison to non-transgenic healthy control plants. The long term goal of our study is the development of transgenic cotton plants resistant to cotton leaf curl disease (CLCuD) which is caused by a number of begomoviruses. Sequence alignments of our construct to available begomovirus sequences indicated that a large number of those viruses will be protected using our construct. Molecular mechanisms involved in the resistance, as well other molecular approaches for development of plant resistance will also be discussed. It is therefore a particular object of the present invention to provide processes that have been used to introduce desired gene into the genome of Pakistani cotton varieties, with high transformation efficiencies and increased expression of the foreign gene.

(B)

DESCRIPTION

The following specification partially ascertains the nature of this invention and describes the manner in which it is to be preformed. A full information is given under the following headings 1) Preamble 2) Nature of the invention 3) Description of the process in a manner of carrying it out in practice 4) The statement of claims.

1) Preamble:

Cotton is primarily a cash crop and especially so for a developing country like Pakistan where it is also used for cotton seed oil production. Its fiber and oil yield depend greatly upon resistance to Cotton Leaf Curl Virus damage. High resistant to Cotton Leaf Curl Virus has a direct correlation with the

94 weight of fiber per boll hence correlatively fiber yield. The fatal CLCuV, a viral disease of cotton, was first recognized in 1912 in Nigeria with the common symptoms of small vein thickening and upward curling leaves. Later on it was reported from Tanzania in 1926 and from Sudan in 1934. Cotton leaf curl virus (CLCuV) is a group of whitefly-transmitted Gemini viruses that cause extensive damage to cotton. The serious notice was taken only in 1991 when a large area about 35000 acres was reported to be affected, and a huge yield losses occurred after a record crop (12.8 million bales) in 1991-92 and decreased to 8-9 million bales per year in the next two years. In Punjab over an area of 6 million acres, the crop yield was dropped from 343 kg per acre to 199-232 kg per acre. The total loss due to this disease for three years (1992-93 to 1994-95) was estimated about three million bales valued at rupees 30 billion. Conventional breeding has proved useful to breed genetic resistance to Cotton Leaf curl Virus, however, no variety has so far been released exhibiting complete resistance Cotton Leaf curl Virus. The modern techniques of biotechnology offer potential to overcome this problem by the introduction of genes encoding Cotton Leaf curl Leaf Virus, one of the major problems of economic importance. In Pakistan large numbers of chemical pesticides are being used to control white fly which is vector for Cotton Leaf curl Virus. There are over 680 isolates of geminiviruses infecting over 200 plant species. All those viruses are transmitted in the field by whiteflies. Geminiviurses infecting major crops like cotton, vegetables (tomato, potato, pepper etc.) and ornamental plants cause enormous economic losses not only in the yield of those crops but also in the quality of crops. RNAi ia s natural defence mechanaism in plants against invading virsus and potential transpons. It acts via dsRNA homologous in the target gene, these dsRNA fragments are called siRNA. Genetically engineered plants containing CLCuV resistance gene can reduce the effect of virus attack on Cotton crops. CEMB (Centre of Excellence in Molecular Biology) and Institute of Agricultural Sciences, University Of The Punjab, New Campus, Lahore has succeeded in the development of a few cotton lines containing gene which is against the CLCuV.

2) Prior Art 2.1 Source of Gene Integrated siRNA sense and antisense sequence from CLCuV conserved region separated by interonic loop sequence. Length of the sense , antisense is 187nt each which play regulatory role and in plants. siRNA are mediators of gene silencing against viruses and transposons in natural defense mechanism. Our siRNA is specific against SCMV coat protein gene.

2.2 Genotype Specific Transformation Introduction of foreign genes in elite genotypes is limited by the genotype specific nature of the gene transfer in cotton. Coker genotypes which are amenable for regeneration in vitro by somatic embryogenesis are widely used in genetic transformation. However, alternate procedure to transform non- coker genotypes have been reported. Kumar et al (1998) attempted to transfer the regenerative competence from coker varieties to recalcitrant elite cultivars and developed a Coker 310 FR line which could be used for genetic transformation. The transgene from the Coker 310 FR can then be transferred to elite genotypes by conventional breeding. However this could also lead to introgression of undesirable characteristics from Coker 310FR. Thus transformation of elite genotype is desirable. We developed SIDE method for introduction of transgene in local Pakistan cotton varieties.

References

Anonymous. (2005). CLCuV de facto and life blood of Pakistan economy” the article published in the national magazine “Business Recorder” Feb 7, 2005 & daily “The Frontier Post” February and 4,2005 (http://www.pakissan.com/english/allabout/crop/cotton/clcuv.de.facto.and.the.life.blood.shtml) Vanderschuren, H., Stupak, M., Fütterer, J., Gruissem, W. and Zhang, P. (2007). Engineering resistance to geminiviruses--review and perspectives. Plant Biotechnology Journal 5 (2), 207-220.

Vanderschuren, H., Alder, A., Gruissem, W. and Zhang, P. (2009). Dose-dependent RNAi-mediated geminivirus resistance in the tropical root crop cassava.Plant Molecular Biology 70 (3), 265-272 Hu, W. Y., Bushman, F.D. and Siva, A.C. (2004). RNA interference against retroviruses. Virus Research 102: 59–64.

3) Nature of the invention: The invention is related to the development of new Cotton lines containing the following genes.

Sr. No. Parent Variety Gene 1 MNH-93 siRNA 2 CIM-482 siRNA 3 CIM-446 siRNA 4 CIM-497 siRNA 5 CIM-443 siRNA 9 A Variety siRNA 10 CIM-496 siRNA 11 VH-259 siRNA 12 MNH-786 siRNA

3.1 Summary of the invention:

SUMMARY The present invention seeks to overcome inherent deficiencies in the prior art by providing novel processes that will allow genetic transformation of local elite varieties of cotton without crossing with unconventional foreign cotton varieties such as coker. The present invention thus relates to innovations that allows direct transformation of local cotton varieties and do not absolutely involve crossing with any variety local or foreign thus completely preventing genetic contamination. This invention discloses processes for producing stably transformed local elite cotton cultivars from freshly isolated or mature embryos. The invention also discloses methods for the improved introduction of the transgene by a novel method, named as SIDE (Sonication Induced DNA Entry) and regeneration within a short period of time resulting in a fertile CLCuV resistant plant. The transformation frequency by using this method, is considerably higher than published methods using prior art in other plant systems. In view of the foregoing, a first aspect of the present invention is a method of making recombinant cotton plant that was the capacity to resist against CLCuV through the natural defense mechanism. The transformation frequency by using this method, is considerably higher than published methods using prior art in other plant systems. This invention also discloses a methodology in which resistance against a particular virus was achieved by enhancing natural defense mechanism of plants. In view of the foregoing, a first aspect of the present invention is a method of making recombinant Cotton plant that have a very short sequence integrated in it that is non-translateable and thus eliminate chance of recombination A second aspect of the present invention is that we have designed siRNA cassette in such a way that after transcription inside in plants the shape of hairpin RNA will be formed by siRNA. A third aspect of the present invention is a DNA construction, inserted in plant transformation vector and used above. A fourth aspect of the present invention is a plant containing DNA construct as given above.

The main principal of the invention was to transform siRNA cassette against CLCuV in cotton varieties CIM-497, CIM-482, CIM-446, MNH- 93, CIM-443 CIM-496 VH-259M NH-786 and others with CLCuV-resistant gene SIDE method. Tissue culture conditions of Cotton were optimized. Field trials were also conducted to assess the performance of newly developed cotton variety under severe attack of CLCuV.

4) DESCRIPTION OF THE PROCESS IN A MANNER OF CARRYING IT OUT IN PRACTICE: 4.1 Tissue culture of G. herbaceum: Seeds of the variety Gossypium herbaceum were delinted and sterilized by treating with a solution containing a few drops of Tween 20 these were later treated with 50% sodium hyprochlorite for 20 minutes followed by 5 washings with autoclaved distilled water, the final washing for 1 hr, the seeds were the kept in dark for germination at 30oC embryo were isolated for these seed under aseptic conditions. Tissue culture and regeneration media were based on the formulation as described by Murashige and Skoog (1962).

4.2 Agrobacterium tumefaicens Mediated Transformation Stable Agrobacterium-mediated transformation of N. benthamiana L. plants was performed by a standard protocol (Horsch et al. 1985) with some modifications. Three to four weeks old tissue cultured plants were used for transformation. Leaf discs were co-cultivated for 10 minutes with 36 hrs old Agrobacterium culture incubated at 28°C in a shaker. These leaf discs were cultured on MS medium containing 100 mg/L BAP and 0.4 mg/L NAA After three days, transformants were selected on MS medium containing 100 mg/L kanamycin, 400µg/ml carbenicillin, 1 mg/L BAP and 0.4 mg/L NAA. Developed shoots were transferred to a phytohormone-free 1/2MS medium containing 300 mg/L kanamycin, and 400 mg/L carbenicillin for root formation. Regenerated plants were transferred from Magenta boxes to pots, and further grown under greenhouse conditions (26°C, 16L/8D). Every three weeks, the explants were sub-cultured to a fresh selection medium for shoot regeneration.

4.3 Transformation of Cotton: Conditions were also developed to transform cotton varieties mentioned in section 2.0 with marker as well as genes mentioned in section 2.0 by SIDE method. The plants were generated and analyzed for the potential of integrated siRNA cassette. 4.4 Molecular and entomological analysis: Various tests were performed to find out the integration and expression of the respective genes in Cotton. Dot blot, PCR amplification, southern hybridization and bioassay. 4.5 Field Trial of transgenic lines: First generation of plants containing the respective CLCuV resistance gene was grown in CEMB field according to recommended biosafety guidelines. The respective transgenic plants were assessed for various respective parameters while non-transformed plants served as a control. 4.6 Sonicated Induced DNA Entry (SIDE) Sonication, incubation and co-cultivation of isolated embryos with Agrobacterium were performed as described earlier. 4.6.1 Explant Preparation Seeds of local cotton variety CIM-482 were sterilized as mentioned in seed sterilization section. After sterilization, the seeds were soaked in autoclaved distilled water for one hour. After one hour excess water was removed & the seeds were kept in the dark at 30C overnight for germination. Next morning, testa of the seeds was removed carefully with a forceps and cotyledonary leaves were excised with surgical blades. Mature cotton embryos were isolated from the germinating seeds. During isolation process, the isolated embryos were kept on moist filter paper so that they may not become dry. 4.6.2 Sonication and Agrobacterium Culture Treatment The mature cotton embryos (500) after isolation from the seeds were shifted to 50ml polystyrine centrifuge tube containing 10ml MS broth. The number of pulses on sonicator was controlled as 3,6,9,12,15 and 18 pulses by an electronic timer (W-375 model, Heat systems, Ultrasonics Inc, 1938, New Highway, Farming Dale, New York 11735) (Fig.2). The tip of sonicator was washed with 70% ethanol. Then sonicator was used at different

100 number of pulses. After sonication treatment, embryos were immediately shifted to the Agrobacterium innoculum suspension for treatment with bacterial culture for 1 hour on a rotary shaker at very slow speed. Total 8,000 embryos were used in the transformation experiments. Plants were subcultured on selection medium containing 10ug/ml kanamycin for selection of transformed plants and cefotaxime 250 g/ml to kill Agrobacterium for 6-8 weeks before transferring to selection free medium for root formation. Control plants were also carried along with the co- cultivated plants on both selection medium (-ve control) and selection free medium (+ve control).

4.7 Polymerase Chain Reaction. 4.7.1 PCR for siRNA. Following set of Primers can be used for the confirmation of this construct in plants are: For S CCACTATCCTTCGCAAGACC Rev O GGCGGTAAGGATCTGAGCTA Product length 1353 bp

Pdk_F AACAAAGCGCAAGATCTATCA Ocs_R TAGGCGTCTCGCATATCTCA Product length 456 bp

4.8 Dot Blot Five g of plant DNA was diluted in 10 l of water, denatured in boiling water bath and quickly chilled on ice. The DNA was spotted on nitrocellulose membrane. DNA fixation was done by incubating at 130oC for 30 minutes. DNA from untransformed control plants was also isolated and spotted in the

101 same way. 10 ng of plasmid DNA was used as positive control. DIG labeling kit (Boehringer Mannheim) was used and probe was prepared according to Manufacturer’s instructions. Standard capillary transfer (Southern, 1975) was used to blot DNA onto nylon (Hi-bond) membrane. The DNA was blotted from gel to membrane using 20X SSC (1.5 M NaCl and 0.1 M sodium citrate) for 16 hours. Transfer membranes were baked at 130oC for 30 minutes. Prehybridization, hybridization and detection of the labeling signals was done according to Genius manual.

4.9 Flourescent In situ hybridization

Growing root tips were fined and treated with pectinase and cellulase and spread on microscopic slides and airdried. The slide was RNase treated and hybridized with Prob DNA. The h ybridized slides were washed with SSC at 40 ̊C for 10 minutes. Propidium Iodide stock solution was added and slides were washed with PBS and signals were detected by flourescent microscope (Zeiss Ax10100) with red filter. The picture of fluorescence signal was taken by CCD camera and analysed by software Genus 3.7 (Cytovision Applied Imaging System) Fluorescence in situ hybridization was performed by using Propidium Iodide (PI) as counter stain. Two gene lines of cotton showed stable integration Cry1Ac. Four lines (CEMB 3010-14, CEMB 3013-101, CEMB 3016-13 and CEMB 3037-2) were heterozygous and line (CEMB 3034-10) was homozygous.

102

4.13 Publications

Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultivars. Plant Physiol. 150: 473-497.

Chilton, M.D., Currier,T.C., Frand,S.k., Bendich, A.j., Gordon, M.P.,Nester E.W.,(1974). Agrobacterium tumefaciens DNA and PS8 bacteriophage DNA not detected in Crown Gall Tumors. Proc. Natl. Acad. Sci. USA.71:3672-3676 Ali, R.M., Husnain, T., Hussain, S.S., Mahmood, N. and Riazuddin. S. (2004). Multiple Shoot regeneration response of recalcitrant cotton (Gossypium hirsutum) cultivar CIM-443. PJBS. 7(8).1371-1375.

5) THE STATEMENT OF CLAIMS Following are the note worthy features that are claimed: 1. A process for producing transgenic cotton plants containing foreign siRNA cassette which have been introduced into Pakistani cotton plant varieties using a novel method named as, SIDE (Sonication Induced DNA Entry), and which process does not involve back crossing with foreign cotton cultivars such as coker 312 and thus the process completely eliminates the chances of genetic contamination which crossing with foreign cultivar such as coker will inevitably result. 2. A transgenic plant as claimed in claim 1 with enhanced resistance to CLCuV 3. Commercial use of cotton plants and products and processes there of as claimed in Claim-1 above.

Annexure 14b, Permission regarding Biosafety issues

103

104

ANNEXURE-15 1 2 3 4 5 6 7 L 8 9 10 11 12 13 14

15 16 17 18 19 20 L 21 22 23 24

Lane No. 1 to 22 = transgenic T2 DNA samples Lane No. = 23 Negative PCR Lane No. 24 Positive Plant sample

25 26 27 28 29 L 30 31 32

Lane No. 25 & 26 = transgenic T2 DNA samples Lane No. 27, 28 & 29 = Positive transgenic plants Lane No. = 31 Negative PCR Lane 32. = Positive Plant Sample

105

Figure 1: Total DNA was extracted form transgenic and non-transgenic filed plants and PCR analysis was performed for the amplification of pART27 IGS-IR construct in transgenic cotton plants (T2). 1kB DNA marker (lane L) was loaded for size comparison. The expected 456 bp PCR product was detected in cotton plants by using specific primers (Pdk_F and Ocs_R). The resulting PCR products were analyzed on a 1% Agarose gel.

T2-1 T2-2 T2-3 T2-4

106

T2-5 T2-6

T2-1 to T2-6 Transgenic leaves showing fewer veins thickening as compared to non-transgenic leaves (Negative control leaves)

T2-7 T2-8 T2-10

107

T2-11 T2-12 T2-13

T2-7 to T2-13 Transgenic leaves showing fewer veins thickening as compared to non-transgenic leaves (Negative control leaves)

108

T2-14 T2-15 T2-16

T2-17 T2-18 T2-19

T2-14 to T2-19 Transgenic leaves showing fewer veins thickening as compared to non-transgenic leaves (Negative control leaves) 109

T2-20 T2-21 T2-22

T2-24 T2-23

T2-22

T2-20 to T2-24 Transgenic leaves showing fewer veins thickening as compared to non-transgenic leaves (Negative control leaves) 110

-Ve -Ve Control Control

Transgenic leaves showing fewer veins thickening as compared to non-transgenic leaves (Negative control leaves).

111

ANNEXURE 16 Description of RT-PCR Real time PCR was performed for expression of transgene Intergenic Region of Ageratum. For this purpose DNA was extracted and used as a template to run the real time PCR (Figure 1).

Relative Expression (Fold) RelativeExpression 0

C. G. arborium C. WM3 R. MNH-786 T. MNH-786 S. MNH-786 Figure 1: Relative Expression of Virus Titer in Transgenic cotton (MNH-786) plants and control. Cotton Plants: C: Control, R: Resistant, T: Tolerant, S: Susceptible

2. Field Evaluation Morphological characteristics like monopodial and sympodial brances per plant, no. of infected leaves per plant. %age infection per plant and no. of bolls per plant were observed. Plants were selected on the basis of infection percentage and categorized as Resistant, Tolerant, and susceptible with 3 replications. Comparison among mean values of seven morphological characters was evaluated as shown in Figure 2. Correlation coefficient (r) with regression lines was also applied (Figure 3).

112

Figure 2: Comparison among seven morphological characters with of control resistant tolerant and susceptible plants with infection

113

Figure 3: Correlation between %age infection and morphological characters with regression lines and its significance. A: Relationship between Sympodial branches and %age of infection per plant. B: Relationship between Monopodial branches and %age of infection per plant. C: Relationship between total no. of leaves and %age of infection per plant. D: Relationship between total no. of bolls and %age of infection per plant. E: Relationship between no. of open boll and %age of infection per plant.

114

ANNEXURE 17

Figure 1: Agrobacterium mediated Transformation of intergenic region of ageratum along with RNAi genes in MNH-786 local cotton variety.

Amplification of Intergenic region of Ageratum gene in putative transgenic cotton plants

Size 456bp

Figure 2: PCR Amplification of intergenic region of ageratum gene (CLCuV resistant gene); Lane 1-7: samples of putative transgenic cotton plants; lane 8: negative control; lane 9: 100bp DNA marker

115

Virus Free Scion

Grafted Union

Symptomatic Root Stock

Virus Free Scion

Grafted Union

Symptomatic Root Stock

Figure 3: Grafted Twigs of Transgenic Cotton Showing resistance against CLCuV

116

Figure 4: Field Layout of Transgenic cotton plants containing SiRNA INTERGENIC REGION OF AGERATUM (virus resistant gene)

Transgenic Contro

Figure 5: Comparison of Transgenic and Control Plants with virus resistance gene in different views

117

Confirmation of Transgene in transgenic cotton plants at field level Genomic DNA Extraction DNA from selected transgenic cotton variety MNH-786 was extracted and DNA was analyzed on 0.8 % agarose gel electrophoresis with Lambda Hind III Ladder to observe the concentration of extracted DNA. Estimated DNA isolated from transformed plants is shown in the figure 1.

1 2 3 4 5 6 7 8 9 10 11 12

Figure 6: DNA isolated from transgenic cotton (MNH-786) plants. Lane 1: Lambda Hind III Ladder, Lane 2- 12: DNA Samples from transgenic plants. PCR for virus Resistant gene In order to confirm the presence of transgene in the transformed plant, PCR analysis was done. For this purpose genomic DNA from transgenic plants was isolated and amplified through Polymerase Chain Reaction by using gene specific primers as were discussed in previous chapter. Out of 51 transgenic plants 41 (Annexure I) showed positive results for target gene INTERGENIC REGION OF AGERATUM (virus resistant gene) while the rest of the plants including control (non-transgenic) showed negative results. PCR confirmation results with gene specific primers after run on 1% agarose gel in which required transgene is amplified at 456 bp.

118

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Figure 7: Amplification of transgenic cotton plants with INTERGENIC REGION of AGERATUM (virus resistant gene); A: lane 1: 1Kb DNA marker, lane 2-6 & 8-12: putative transgenic cotton plants with virus resistant gene, lane 7 & 13-15: negative amplification of transformed plant, 16: negative control, B: lane 1: 1Kb DNA marker, lane 2-9 & 12-16: putative transgenic cotton plants with virus resistant gene, lane 10 & 11: negative amplification of transformed plant, 17: negative control, C: lane 1: 100bp DNA marker, lane 7-14: putative transgenic cotton plants with virus resistant gene, lane 2-6: negative amplification of transformed plant, 15: negative control, D: lane 1: 100bp DNA marker, lane 2-15: putative transgenic cotton plants with virus resistant gene, 16: negative control.

Optimization PCR for Titer PCR was performed to optimize the virus load for the confirmation of transgenic plants. Titer primers were used to amplify the fragment at 180 bp in which resistant and tolerant plants shown without virus load while susceptible with virus load. Plants were selected on the basis of symptoms at maturity stage from Cotton (MNH-786) plot situate in CEMB (Centre for Excellence in Molecular Biology). Selected plants were categorized into Resistant, Tolerant and Susceptible on the basis of vein thickening and leaf enation.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

180bp

Figure 8: Optimized PCR for virus load in transgenic plants or to confirm the transgenes: lane 1: 50bp DNA ladder. Lane 2-7: Resistant plants without virus load. Lane 8-13: Tolerant plants without virus load. Lane14-19: Susceptible plants with virus load.

120

Figure 9: Categorized transgenic plants on the basis of symptoms at maturity: A: Resistant plants were showed healthy leaves without vein thickening and leaf enation, B: Tolerant plants were showed thickening of tertiary veins, secondary and primary veins C: Susceptible plants were showed leaf enation and stunted growth.

121

ANNEXURE 18

Figure 1: PCR analysis for analysis of horizontal gene flow of virus resistant transgenic cotton plants to weeds of experimental area at the distance of 30cm, 60cm, 90cm, 120cm and 150cm

Figure 2: ELISA analysis of virus resistant transgenic cotton plants for its vertical gene flow from its root exudates and soil. Expression was not found in any well of ELISA plate.

122

A B

Figure 3: Comparison of Mice weight; Weight of mice was observed after fifteen days interval A. Mice weight fed with transgenic diet B. Mice weight fed with normal diet

A B C

E D

Figure 4: Morphology of Rats after feeding transgenic cotton plants with intergenic region of ageratum (SiRNA); A: Fainted mice with chloroform B: Dissection of mice C: Profusion of mice organs, D: Cutting of Mice organs E: Preservation of Mice organs in 4% Formalin.

123

Figure 5: Overview of transverse sections of different organs of Mice after feeding transgenic diet at different stages Histology of mice organ Two mice from transgenic group and two mice from control group are used for the analysis of morphological studies with four vital organs e.g. liver, heart, kidney and intestine.

124

ANNEXURE 19

CLCuV data of GMO MNH-786 at CRI, Faisalabad (22-07-2016)

Number of plants in disease rating Av. Disease Category of Resistance Disease Disease Index Severity based upon Disease Rating Total Plants scale VARIETY 0 1 2 3 4 (%age) (%age) (%age) Resistant (0) MNH-786 E1 76 41 0 19 16 0 46 2.7 28.3 Tolerant MNH-786 E2 28 14 4 5 5 0 50 2.1 25.9 Tolerant MNH-786 E3 27 11 0 6 10 0 59 2.6 38.9 Susceptible MNH-786 E4 78 49 0 16 13 0 37 2.5 22.8 Tolerant MNH-786 E5 45 19 0 14 12 0 58 2.5 35.6 Susceptible MNH-786 E6 55 33 6 12 4 0 40 1.9 19.1 Tolerant MNH-786 E9 27 14 0 10 3 0 48 2.2 26.9 Tolerant MNH-786 E10 20 11 0 5 4 0 45 2.4 27.5 Tolerant 786/1 check 24 11 0 7 6 0 54 2.5 33.3 Susceptible 786/2 check 41 13 0 19 9 0 68 2.3 39.6 Susceptible 786/3 check 20 2 0 9 9 0 90 2.5 56.3 Highly Susceptible

CLCuV data of GMO MNH-786 at CRS, Sahiwal (22-07-2016)

No. of plants in Av. Disease Disease Category of Resistance Disease disease rating scale Severity Index based upon Disease Rating VARIETY Total Plants 0 1 2 3 4 (%age) (%age) (%age) Resistant (0) MNH-786 E1 88 61 4 6 8 9 31 2.8 21.6 Tolerant MNH-786 E2 48 36 3 2 4 3 25 2.6 16.2 Tolerant MNH-786 E3 41 22 3 2 8 6 46 2.9 33.5 Susceptible MNH-786 E4 86 75 7 2 2 0 13 1.6 4.9 Highly Tolerant MNH-786 E5 44 35 2 2 5 0 20 2.3 11.9 Tolerant MNH-786 E6 44 27 3 1 8 5 39 2.9 27.8 Tolerant MNH-786 E9 44 31 3 2 6 2 30 2.5 18.6 Tolerant MNH-786 E10 46 35 2 3 4 2 24 2.6 15.2 Tolerant 786/1 check 43 30 3 4 5 1 30 2.3 17.4 Tolerant 786/2 check 43 34 1 3 3 2 21 2.7 14.0 Tolerant 786/3 check 36 29 2 1 2 2 19 2.6 12.5 Tolerant

126

CLCuV data of GMO MNH-786 at CRS, Vehari (22-07-2016)

No. of plants in Av. Disease Category of Resistance Disease Disease Index disease rating scale Severity based upon Disease Rating VARIETY Total Plants 0 1 2 3 4 (%age) (%age) (%age) Resistant (0) MNH-786 E1 111 58 8 11 14 20 48 2.9 34.2 Susceptible MNH-786 E2 98 40 11 14 12 21 59 2.7 40.6 Susceptible MNH-786 E3 104 37 13 16 17 21 64 2.7 43.3 Susceptible MNH-786 E4 141 58 19 20 14 30 59 2.7 39.2 Susceptible MNH-786 E5 121 44 10 17 19 31 64 2.9 46.5 Susceptible MNH-786 E6 100 40 8 10 20 22 60 2.9 44.0 Susceptible MNH-786 E9 95 41 11 11 14 18 57 2.7 38.7 Susceptible MNH-786 E10 112 79 5 9 8 11 29 2.8 20.3 Tolerant 786/1 check 92 9 13 18 21 31 90 2.8 64.1 Highly Susceptible 786/2 check 107 38 12 21 17 19 64 2.6 42.3 Susceptible 786/3 check 110 60 9 12 11 18 45 2.8 31.4 Susceptible

127

Summary of CLCuV data (Disease Index %age) at three locations PARB Project No. 127 Variety CRI, Faisalabad CRS, Sahiwal CRS, Vehari Average MNH-786 E1 28.29 21.59 34.23 28.04 MNH-786 E2 25.89 16.15 40.56 27.53 MNH-786 E3 38.89 33.54 43.27 38.57 MNH-786 E4 22.76 4.94 39.18 22.29 MNH-786 E5 35.56 11.93 46.49 31.33 MNH-786 E6 19.09 27.84 44.00 30.31 MNH-786 E9 26.85 18.75 38.68 28.09 MNH-786 E10 27.50 15.22 20.31 21.01 786/1 check 33.33 17.44 64.13 38.30 786/2 check 39.63 13.95 42.29 31.96 786/3 check 56.25 12.50 31.36 33.37

Morphological data of GMO MNH-786 under PARB Project No. 127 during 2016-17

Event Plant Height (cm) Bolls/plant Monpodia/plant Sympodia/plant Nodes/plant Av. boll Wt. (g) MNH-786 (E1) 121.0 27.8 2.4 23.8 6.2 4.0 MNH-786 (E2) 145.0 36.6 2.2 33.0 9.0 3.5 MNH-786 (E3) 146.0 44.0 2.2 27.4 7.2 3.4 MNH-786 (E4) 135.8 47.8 3.0 26.4 6.2 3.2 MNH-786 (E5) 105.6 22.2 2.4 26.2 6.6 4.0 MNH-786 (E6) 135.0 26.0 4.0 18.0 12.0 3.2 MNH-786 (E9) 127.0 33.0 2.8 21.4 9.8 3.5 MNH-786 (E10) 99.0 28.4 2.0 22.0 5.6 3.8 MNH-786/1 (check) 118.0 44.8 1.8 26.0 6.2 3.8 MNH-786/2(check) 91.8 36.8 1.8 21.2 6.6 4.0 MNH-786/3 (check) 82.8 24.2 1.4 21.6 4.8 4.0

128

ANNEXURE 20

Table 1: Detail of F0 seed of crosses under PARB Project No. 127

Cross No. PARENTAGE Seed Weight (g)

1 FH-142 × MNH-786 (E4) 55

2 MNH-886 × MNH-786 (E6) 44

3 MNH-886 × MNH-786 (E9) 48

4 FH-LALAZAR × MNH-786 (E10) 60

Table 2: Yield data of GMO MNH-786 under PARB Project No. 127 during 2016-17

Event Seed cotton yield (kg/ha) MNH-786 (E1) 3494 MNH-786 (E2) 3305 MNH-786 (E3) 3229 MNH-786 (E4) 4166 MNH-786 (E5) 3167 MNH-786 (E6) 2153 MNH-786 (E9) 4305 MNH-786 (E10) 2153 MNH-786/1 2691 MNH-786/2 2115 MNH-786/3 2368

129

Table 3: Fiber quality traits data of GMO MNH-786 under PARB Project No. 127 during 2016-17

Staple length Fibre fineness (ug/inch) Fibre strength Event GOT (%) (mm) (g/tex) MNH-786 (E1) 41 27.0 5.1 31.8 MNH-786 (E2) 40 27.7 5.2 30.5 MNH-786 (E3) 42 27.1 5.4 24.7 MNH-786 (E4) 39 27.1 5.4 28.4 MNH-786 (E5) 41 27.4 5.1 29.1 MNH-786 (E6) 40 26.5 5.3 27.2 MNH-786 (E9) 40 26.8 5.4 28.8 MNH-786 (E10) 39 26.7 5.2 31.7 MNH-786/1 42 27.5 5.3 32.3 MNH-786/2 44 24.7 5.9 25.8 MNH-786/3 42 23.5 6.0 28.4

130

Pictures taken from PARB Project No. 127 at maturity during 2016-17

131

Brochure/Booklet printed for the understanding of

common- man and farmers

132