DOCSLIB.ORG

INTROGRESSION of COTTON LEAF CURL VIRUS RESISTANCE GENES from Gossypium Arboreum

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
INTROGRESSION of COTTON LEAF CURL VIRUS RESISTANCE GENES from Gossypium Arboreum FINAL RESEARCH PROGRESS REPORT OF PARB’S CGS PROJECT NO. 127 NOVEL APPROACH TO GENERATE WIDE SPECTRUM RESISTANCE TO ALL COTTON BEGOMOVIRUSES INFECTING COTTON AND OTHER CULTIVATED CROPS Transgen Contr Submitted by: Professor Dr. Muhammad Saleem Haider, Director, Institute of Agricultural Sciences, University of the Punjab, Lahore. Table of contents S. No. Title Page No. Basic information of the Project 1 Executive Summary 4 1 Introduction 5 2 Project Objective 5 3 Outputs planned for the project 5 4 Detailed component wise methodology adopted, data 6 analyzed and results obtained 5 Description of the process in a manner of carrying it out in 30 practice 6 Component wise salient achievements 32 7 Overall progress of the problem searched 33 8 Varieties, breeds, vaccines or products developed and 33 patented 9 No. of national and international papers published 33 10 No. of Ph.D/M.Phil. produced 34 11 Papers presented in national and international institutes 34 12 Any other achievement 35 13 Current Status of Commercialization of Project 35 14 Impact of the project on strengthening of the institutional 35 infrastructure, machinery, equipment and human resources 15 Constraints in the Project 36 16 Suggestions for future research and development 36 17 References 37 Annexure 38 2 Basic Information of the Project Name of the project Novel approach to generate wide spectrum resistance to all cotton begomoviruses infecting cotton and other cultivated crops Project period June 1st 2009 to May 31st 2016 Total project duration 48 Months Total Project cost Rs. 32.039 million Total Expenditures Rs. 32.035 millions Name of the Project Dr. M. Saleem Haider Manager with designation Professor and Director Phone and Email Telephone: 042-99231847 Email: [email protected] Host Institute Institute of Agricultural Sciences, University of the Punjab, Lahore Name and Designation of the COLABBORATING SCIENTIST Team Leader with Name of Name of the Team Leader: Dr. M.G. AbouHaidar the Collaborating institute Institute: University of Toronto, Canada Qualification and Experience): Telephone: 416 978 5615 Email: [email protected] Fax: 416 978 5878 Overseas cooperating a. Name of Organization: scientist and organization University of Toronto (Canada) b. Institute/Division/Section/ Department of Cell and Systems Biology c. Administrative Contacts: Tamar Mamourian d. Head of the Institution (Director/Chairman/Division Head etc.) Name: Dr. D. Goring Title: Professor and Chair Telephone: 416 978 2378 Email: [email protected] COLABBORATING SCIENTIST Name of the Team Leader: Dr. M.G. AbouHaidar Institute: University of Toronto, Canada Qualification and Experience): Telephone: 416 978 5615 Email: [email protected] Fax: 416 978 5878 3 Executive Summary The largest genus of the family Geminiviridae, Begomovirus, derives its name from Bean golden mosaic virus (Idris et al., 1999) which is now called Bean golden yellow mosaic virus (BGYMV). These are dicotyledonous-infecting, whitefly-transmitted geminiviruses. Cotton is a cash crop and begomoviruses cause serious yield losses in cotton and other crops in Pakistan particularly in the Punjab region, due to spread of a fatal viral disease CLCuD. RNAi technique can be used to enhance plants resistance against viruses (Nahid et al., 2011). Due to this technique the transgenic plants in the current research have shown resistance when infected with viral attack. Five districts of Punjab i.e. Vehari, Multan, Bahawalpur, Bahawalnagar and Rahim Yar Khan were surveyed for collection of virus infected plant samples. DNA from these samples were extracted by CTAB method and quantified by spectrophotometer. Confirmation through sequencing of the clones helped in preparing infectious clones. These infectious clones were used to test the resistance of transgenic and non-transgenic plants. Transgenic plants (T1 and T2 generation) have been analyzed and have shown promising results regarding their resistance to CLCuD and allied begomoviruses. In order to assess the resistance of transgenic plants, plants were inoculated with CLCuD infectious clones or through whitefly under natural conditions (T1 and T2 generations) and as control non-transgenic plants were also inoculated. Appearance of no or mild symptoms in transgenic tobacco, cotton and exhibition of typical symptoms of CLCuD in control plants proved that hp RNAi construct providing resistance to virus infection. First and second generation (T1 and T2) of transgenic cotton plants harboring pART27 IGS-IR construct were sown in CEMB/IAGS fields according to recommended biosafety guidelines. Verification of IGS-IR construct in T1 was done by PCR based testing. Southern blot analysis was performed to check the viral load in T1 plants. Nevertheless, patent has been filed in Higher Education Commission, Islamabad and for bio-safety clearance National biosafety commission, Islamabad has been intimated regarding certification of our product and response in this regard is awaited. 4 1. Introduction Begomoviruses are known to be a major problem in the cotton and other crops in Pakistan particularly in the Punjab region. Crops infected with these viruses show a notable decrease in the yield which results in major losses for farmers in particular and for the nation’s economy in general. Viruses of the genus Begomovirus (family Geminiviridae) are a major constraint to the agricultural output of many tropical and sub-tropical countries including Pakistan. The majority of the economically important geminiviruses fall into the genus Begomovirus. These viruses are transmitted exclusively by the whitefly Bemisia tabaci and affect almost all dicotyledonous crop species. The most prominent example is cotton leaf curl disease (CLCuD), which is caused by a complex of begomoviruses, and caused huge losses to Pakistan economy since its emergence in early 1990s. Occurrence of whitefly-transmitted diseases in plants, particularly in vegetables, ornamental plants, agricultural and economic crops presents a challenge for plant scientists concerned with the yield and quality in plant production. In recent years, the role of whitefly and begomoviruses both in yield and quality interest has been recognized. 2. Project Objective To develop transgenic cotton plants with RNAi-based resistance to cotton leaf curl disease (CLCuD) caused by begomoviruses. 3. Outputs planned for the project:(As per project document) Output-1: Generation of proper binary plasmid AEV construct Output-2: Survey of field for CLCuD/ whitefly sampling from cotton or other host plants (exhibiting CLCuD like symptoms). Five districts of Punjab i.e. Vehari, Multan, Bahawalpur, Bahawalnagar and Rahim Yar Khan and a neighbouring district of Sindh from the cotton belt will be surveyed. On an average twenty five samples will be collected from each district. Output-3: Analysis of samples collected in output 2 Output-4: Development of AEV Transgenic tobacco Output-5: Rearing of whiteflies and CLCuD transmission studies Output-6: Testing for resistance of transgenic tobacco plants Output-7: Generation of proper binary plasmid CLCuD construct Output-8: Production of CLCuD infectious clones Output-9: Development of CLCuD resistant transgenic tobacco and cotton Output-10: Testing of CLCuD infectious clones 5 Output-11: Testing of CLCuD resistant transgenic tobacco and cotton Output-12: Testing of CLCuD resistant transgenic tobacco and cotton T1 plants Output-13: Testing of CLCuD resistant transgenic tobacco and cotton T2 plants Output-14: Take care of IPR and Bio-safety rules Output-15: Evaluation of Advanced generation Output-16: Evaluation of Advanced generation and Biosafety Studies of Transgenic Cotton Plants. Output-17: Reconfirmation of CLCuD incidence, multiplication of transgenic lines seed at multi location and crossing with otherwise good material. 4. Detailed component wise methodology adopted, data analyzed and results obtained (Attach raw data as annexure) Output-1 (Institute of Agricultural Sciences, University of the Punjab, Lahore) Generation of proper binary plasmid AEV construct Activity-1: Designing of primer and amplification of RNAi product The following primers are designed with appropriate restriction enzyme sites to amplify sequence from AEV–A itergenic region (Annexure: 1; Fig. 1) by using PCR method For Sense region (actccaatggcataattgtaataacaaaactttaatttgaaatttaaaaaaaaggctaaagcggccatccgtataatattaccggatggccgcg atttttttaaagtggtcccccctgacaaagacatgtccaccaatctaaagcgtcgctcaaagcttaattgtttcgtggtccc) AEVKpnIFoR: 5′ CTGACAGGTACCACTCCAATGGCATAATTGTA 3′ AEVSalIRev: 5′ GACTGAGTCGACGGGACCACGAAACAATTAAG3′ For antisense region AEVForClaI: 5′ CTGACAATCGATACTCCAATGGCATAATTGTA3′ AEVNheIRev: 5′ GACTGAGCTAGCGGGACCACGAAACAATTAAG3′ Activity-2: Ligation and cloning of the RNAi fragment into Binary vector The PCR products having sense and antisense region were digested with appropriate enzymes and ligated into the plasmid (pHANNIBAL with ampicillin resistance gene as a bacterial selectable marker) also digested with the appropriate enzymes by using existing laboratory standard protocols. The plasmid was transformed into E. coli for plasmid DNA amplification by using heat-shock method. The hairpin cassette was then removed from pHANNIBAL vector using NotI sites and cloned into pART27 (binary vector with spectinomycin/streptomycin resistance gene as a bacterial selectable marker) in a single step 6 using the NotI restriction sites. The clone was confirmed by digestion with NotI restriction enzyme (Annexure: 1; Fig.
Load more

Recommended publications
  • Cotton Leaf Curl Disease – an Emerging Threat to Cotton Production Worldwide
    Journal of General Virology (2013), 94, 695–710 DOI 10.1099/vir.0.049627-0 Review Cotton leaf curl disease – an emerging threat to cotton production worldwide M. Naeem Sattar,1 Anders Kvarnheden,1 Muhammad Saeed2 and Rob W. Briddon2 Correspondence 1Department of Plant Biology and Forest Genetics, Uppsala BioCenter, Swedish University of Anders Kvarnheden Agricultural Sciences and Linnean Center for Plant Biology, Box 7080, SE-750 07 Uppsala, [email protected] Sweden 2National Institute for Biotechnology and Genetic Engineering, PO Box 577, Jhang Road, Faisalabad, Pakistan Cotton leaf curl disease (CLCuD) is a serious disease of cotton which has characteristic symptoms, the most unusual of which is the formation of leaf-like enations on the undersides of leaves. The disease is caused by whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) in association with specific, symptom-modulating satellites (betasatellites) and an evolutionarily distinct group of satellite-like molecules known as alphasatellites. CLCuD occurs across Africa as well as in Pakistan and north-western India. Over the past 25 years, Pakistan and India have experienced two epidemics of the disease, the most recent of which involved a virus and satellite that are resistance breaking. Loss of this conventional host–plant resistance, which saved the cotton growers from ruin in the late 1990s, leaves farmers with only relatively poor host plant tolerance to counter the extensive losses the disease causes. There has always been the fear that CLCuD could spread from the relatively limited geographical range it encompasses at present to other cotton-growing areas of the world where, although the disease is not present, the environmental conditions are suitable for its establishment and the whitefly vector occurs.
    [Show full text]
  • CHEMISTRY and HISTOLOGY of the GLANDS of the COTTON PLANT, with NOTES on the OCCURRENCE of SIMILAR GLANDS in RELATED Plantsl
    CHEMISTRY AND HISTOLOGY OF THE GLANDS OF THE COTTON PLANT, WITH NOTES ON THE OCCURRENCE OF SIMILAR GLANDS IN RELATED PLANTSl By ERNEST E. STANFORD, Scientific Assistant, and ARNO VIEHOEVER, Pharmacog- nosist in Charge, Pharmacognosy Laboratory, Bureau of Chemistry, United States Department of Agriculture INTRODUCTION The work herein reported forms a portion of a chemical and biological investigation of the cotton plant (Gossypium spp.), the purpose of which is to isolate and determine the substance or substances which attract the boll weevil. A previous paper (77)2 discusses the isolation of certain glucosids and the products of their hydrolysis, as well as preliminary studies of an ethereal oil which manifested some attraction for the boll weevil. Both the glucosids and this oil, as well as several other sub- stances, are largely localized in prominent internal glands which are very numerous in nearly all parts of the cotton plant. The main purpose of this paper is to discuss the occurrence, formation, structure, and con- tents of these glands. Glands of another type, more properly referred to as "nectaries/' also occur in the cotton plant. These are superficial in position and definitely localized. The internal glands have nothing in common with these nectaries save the function of secretion. In certain taxonomic and other literature, however, either or both types are referred to indis- criminately simply as "glands." Therefore, it seems advisable also to discuss briefly in this paper the nature and occurrence of the nectaries, in order to distinguish them clearly from the internal secretory organs, which form the main subject of the present study.
    [Show full text]
  • Assessment of Gene Flow Between Gossypium Hirsutum and G
    G3: Genes|Genomes|Genetics Early Online, published on May 25, 2017 as doi:10.1534/g3.117.041509 Assessment of gene flow between Gossypium hirsutum and G. herbaceum: evidence of unreduced gametes in the diploid progenitor. Montes E *1, Coriton O †, Eber F †, Huteau V †, Lacape JM ‡, Reinhardt C §2, Marais D §, Hofs JL **, Chèvre AM † 2, Pannetier C * ‡ 2 *: Institut Jean-Pierre Bourgin, INRA, AgroParisTech, CNRS, Université Paris-Saclay, RD10, F-78026 Versailles Cedex, France †: Institut de Génétique, Environnement et Protection des Plantes, INRA, Agrocampus Ouest, Université de Rennes I., BP35327, 35653 Le Rheu, France ‡: CIRAD, UMR AGAP, Amélioration Génétique et Adaptation des Plantes méditerranéennes et tropicales, 34398 Montpellier, France. §: Department of Plant and Soil Sciences, University of Pretoria, Pretoria 0001, South Africa ** : CIRAD, UR AIDA, Agro-écologie et Intensification Durable des cultures Annuelles, 34398 Montpellier, France. 1 present address: UMR 1349, IGEPP, INRA BP35327, 35653 Le Rheu, France 2 corresponding authors Running title Unreduced gametes in diploid cotton 1 © The Author(s) 2013. Published by the Genetics Society of America. Key words Gene flow, natural hybridization, unreduced gamete, Gossypium hirsutum, Gossypium herbaceum Corresponding authors: UMR 1349, Institut de Génétique, Environnement et Protection des Plantes, Institut National de la Recherche Agronomique (INRA), BP35327, F-35653 Le Rheu, France. Email [email protected] and UMR1318, Institut Jean-Pierre Bourgin, INRA F-78026 Versailles, France. Email [email protected]. 2 Abstract In the framework of a gene flow assessment, we investigated the natural hybridization rate between Gossypium hirsutum (AADD genome) and G. herbaceum (AA genome). The latter species, a diploid progenitor of G.
    [Show full text]
  • Malvales Nymphaeales Austrobaileyales
    Amborellales Malvales Nymphaeales Austrobaileyales Acorales G Eenzaadlobbigen G Alismatales Petrosaviales Huerteales Pandanales Een recente ontwikkeling is het Dioscoreales Dipentodontaceae in een nieuw Liliales Asparagales hout- en anatomische kenmerke 2 geslachten en 5 soorten van b Arecales en samengestelde bladeren, die G Commeliniden G Dasypogonales Poales werden geplaatst. De Dipentod Commelinales sinicus, een boom uit China en Zingiberales die vroeger in de Violales werd Ceratophyllales Malvales Chloranthales De Malvales zijn voor het meren Canellales warme streken. Ze hebben vers Piperales G Magnoliiden G De bast is nogal eens vezelig, st Magnoliales veel voor. De kroonbladen ligge Laurales Ze hebben meestal een lange st Ranunculales De zaden en de binnenkant van Sabiales bezet. Deze orde omvatte al de Proteales Trochodendrales Dipterocarpaceae, Bixaceae, Ne Buxales Sphaerosepalaceae. De Lindefam Gunnerales Bombacaceae zijn nu opgenom Berberidopsidales (Malvaceae). De Muntingiaceae Dilleniales afgesplitst. Nieuwkomers in de Caryophyllales Santalales (Cistaceae), uit de Violales, en d Saxifragales (Thymelaeaceae) uit de Euphorb Cytinaceae (vroeger Rafflesiales G Geavanceerde tweezaadlobbigen G Vitales Crossosomatales ook in deze orde thuis. Geraniales Myrtales Sapindales Zygophyllales De meeste soorten in deze orde Celastrales houtige gewassen, vaak met sam Malpighiales G Fabiden G Oxalidales Fabales Rosales Bixaceae G Rosiden G Cucurbitales Malvaceae Fagales Muntingiaceae Cistaceae Huerteales Dipterocarpaceae G G Malviden Brassicales
    [Show full text]
  • Larly in Gossypium
    CHROMOSOMES IN GOSSYPIUM AND RELATED GENERA^ By A. E. LoNGLEy2 Associate Botanist, Division of Genetics and Biophysics, Bureau of Plant Industry, United States Department of Agriculture INTRODUCTION An investigation of the chromosomes in the Malvaceae, particu- larly in Gossypium, was undertaken because of the repeated failures of cotton breeders in their attempts to hybridize such cottons as Garo Hill {Gossypium cernuum Tod.) with any of the varieties of upland cotton (G. hirsutum L.). In 1923 a study was made of the chromosomes in a few repre- sentative species of Gossypium growing in the greenhouses at Wash- ington, D. C. Among these were found some species with 13 and some with 26 as their haploid chromosome number. Neither number corresponded with that found earlier by Cannon (4) ^ or Balls (1). Simultaneously with two other investigators, Denham (5, 6), of England, and Nikoljeva as reported by Zaitzev (15, 16), of Russia, the writer found that cultivated varieties of Gossypium fall into two classes, those with 13 chromosomes and those with 26 chromosomes. This classification corresponds with the taxonomic separation of Gos- sypium species into the Old World, or Asiatic, and the New World, or American, groups. MATERIAL AND METHODS The present investigation has been confined to pollen mother cells during the reduction phases. Young buds were selected and the staminal column removed and put at once into Bouin^s, Carnoy's, or chromo-acetic (1:1:100) killing solution, embedded, sectioned, and stained. It was soon found that very satisfactory preparations of pollen mother cells in which the chromosomes were dividing could be made from fresh material stained in aceto-carmine fluid.
    [Show full text]
  • Cotton: the Fabric of Our Lives
    Cotton: The Fabric of Our Lives By Angela Box Oils, balls, swabs, bandages, tissue, paper, napkins, diapers, socks, underwear, shirts, shorts, sweaters, pants, coats, towels, linen, cushions, drapery, upholstery, rugs, carpet, comforters, mattresses, insulation, filtration, and many other things that are used daily by everyone are composed of, or inspired by cotton. Cotton is a soft, fluffy, naturally occurring fiber plant that can be processed into an array of materials and goods. Many, many things that we wear, sleep on, sleep under, walk on, or utilize in wound-care, etc., contain some percentage of cotton. It is a fiber that is used everyday, by everyone, in one way or another. It has qualities that have made it a choice crop for centuries around the world. Today though, cotton is being largely displaced by synthetic fibers that have qualities that exceed the natural crop plant. These fibers can also be mass-produced and sold at relatively lower costs. Still, cotton stands alone as the most utilized fiber crop plant used around the world. Also known as "King Cotton," in the United States, it was the major force behind the institution of the American age of slavery, and cotton prevailed as the economic source for the southern states of the United States and its antebellum prosperity before the civil war. It holds an important place in America's past, present, and future. Cotton is truly the "Fabric of Our Lives". Characteristics Cotton is an annual, biennial or perennial plant, but in cultivation it is generally treated as an annual; herbaceous to short shrub or small tree - two to six feet tall.
    [Show full text]
  • Evaluation of Gossypium Herbaceum Germplasm Race Wightianum Under Different Sowing Dates in the Central Cotton Zone of India
    Evaluation of Gossypium herbaceum germplasm race Wightianum under different sowing dates in the central cotton zone of India D.V. PATIL, PUNIT MOHAN and V. N. WAGHMARE ICAR - Central Institute for Cotton Research Division of Crop Improvement (Indian Council of Agricultural Research) Nagpur – 441 108, MS, India E-mail: [email protected] Mob: 8975615439 Introduction • Cotton, popularly known as ‘White Gold’, is important commercial fiber crop in India. Cotton has long history and evolved in India millions of years ago. • 6000 BC Mehrgarh, Now Pakistan: G. arboreum • 3500 BC Tehaucan valley, Mexico: G. hirsutum • 2700 BC Mohenjodaro, Indus valley: G. herbaceum • 2500 BC Huaca Preita Peru: G barbadense • The genus Gossypium comprises of 51 species, among them 6 are tetraploids and 45 are diploids (G. ekmanianum Wittmack, AD6) The magic of Dhaka muslins Suleiman the Arab traveler wrote in the 9th century that cotton fabrics in Rahmi (now, Bangladesh) are so fine and delicate that they pass through a signet ring. Dhaka Muslin yarn was one of the finest ever heard of 345-356 counts. Andhra Khadi work women spin 70 -100 counts yarn with 15 mm cotton, which will yield only 12s counts yarn in machine spinning. • India is the only country in the world growing all the four cultivated species of cotton and successfully exploiting heterosis through cultivation of intra and inter specific hybrids. • India is the ancient home of Gossypium arboreum L. races bengalense, cernuum and indicum and also wightianum of G. herbaceum (Hutchinson et al.1947) • Diploids possess highly desirable traits such as stress, disease tolerance and adaptive features (Samba Murthy et al.1994) Diploid species of genus Gossypium G.
    [Show full text]
  • Ohio Plants with Extra-Floral Nectaries and Other Glands
    Mar., 1904.] Extra-Floral Nectaries and Glands. 103 OHIO PLANTS WITH EXTRA=FLORAL NECTARIES AND OTHER GLANDS.* JOHN H. SCHAFFNER. The existence of glands and nectaries outside of the flower or inflorescence has been a subject of much interest to biologists. Delpino, Darwin, Trelease, and many others have given a large amount of information in regard to the occurence and nature of these organs ; yet much is still obscure and any one so inclined may at least obtain considerable pleasure by making observations along this line. Various views have been held as to the cause and use of extra- floral glands and their secretions. Delpino considered that the power to secrete nectar by any extra-floral organ has been speci- ally gained in every case for the sake of attracting ants and wasps as a body-guard, or as defenders of the plant against enemies. Darwin while admitting that this may be the case in some plants did not think that all such glands originated in this way. He held that the saccharine matter in nectar was excreted as a waste product of chemical changes in the sap and that this product might then become useful for accomplishing cross-fertilization or for attracting a body-guard, and thus the nectary would become an object for selection. He cites the case of the leaves of certain trees where a saccharine fluid, often called honey-dew, is excreted without the aid of special glands. By some, the special use of «xtra-floral nectar is supposed to be to divert ants and other insects from visiting flowers which they might otherwise injure.
    [Show full text]
  • Red Cotton Leaves: Causes and Implications
    W 344 Red Cotton Leaves: Causes and Implications Tyson B. Raper, Assistant Professor, Cotton and Small Grains Specialist Heather Young-Kelly, Assistant Professor, Field Crops Plant Pathology Frank Yin, Associate Professor, Cropping Systems Specialist Department of Plant Sciences Observing canopy characteristics during the growing season is a good way to understand the plant’s response to its environment. Occasionally, portions of the canopy may develop reddish-purple or red tones. This publication describes this phenomenon and discusses possible causes for this shift. Leaf color is a function of leaf pigment content and concentration. Pigments commonly present in cotton leaves include chlorophylls, carotenoids, tannins and anthocyanins. Each of these types of pigments has a unique structure and absorbs energy from different regions and at different wavelengths within the electromagnetic spectrum. These properties give each pigment color characteristics; for example, chlorophylls a and b absorb light in the blue and red regions while reflecting light in the green. Similarly, carotenoids are visually associated with yellows and reds, tannins with browns, and anthocyanins with reds and purples. The content and concentration of these pigments can additionally provide insight into the plant’s current or past growing conditions. For instance, reddening of a leaf can indicate the plant has experienced abiotic or biotic stress such as excessive radiation (Fig. 1) or a nitrogen (N) deficiency (Fig. 2). Since changes in pigment content and concentration within the plant also changes the color of the leaf, visual observations of the canopy collected through the growing season can be used to gauge plant health. In the case of a reduction of chlorophyll due to an N deficiency, a reduction in chlorophyll is directly associated with a shift from dark green to light green leaf color.
    [Show full text]
  • INTERNATIONAL JOURNAL of CURRENT RESEARCH International Journal of Current Research Vol
    z Available online at http://www.journalcra.com INTERNATIONAL JOURNAL OF CURRENT RESEARCH International Journal of Current Research Vol. 10, Issue, 10, pp.74168-74173, October, 2018 DOI: https://doi.org/10.24941/ijcr.32501.10.2018 ISSN: 0975-833X RESEARCH ARTICLE POLLEN MORPHOLOGY OF SOME PLANT SPECIES OF ORDER MALVALES 1, *Vibhavari K. Vyas and 2Dr. Gohil, T. G. 1Biology Department, The P. G. Science College, Bardoli-394601 D: Surat, Gujarat, India 2The B. K. M. Science College, Valsad, Gujarat, India ARTICLE INFO ABSTRACT Article History: Present paper deals with the pollen diversity of some plant species of order Malvales, which belongs Received 19th July, 2018 to subclass Polypetalae of class Dicotyledon. Malvales is the most important order of subclass Received in revised form Polypetalae. Here investigated plants were taken from Malvaceae, Sterculiaceae and Tiliaceae 09th August, 2018 families. Mostly plants are multipalynous in porate grains the common type were polyporate. The Accepted 14th September, 2018 pollen grains varies in their size from large to very large, the most common are large sized grains. The th Published online 30 October, 2018 shape of the pollen grains seems to be more or less constant i. e. prolate, spheroidal to oblate. Spine morphology is variable may have blunt or pointed tips and with long or short spines. The pore size has Key Words: been observed whereas the shape of pores seems to be fairly constant being more or less circular. The Pollen diversity, nexine is thicker than sexine. Malvales, Acetolysis, Symmetrical, Porate, Spine, Nexine, Sexine. Copyright © 2018, Vibhavari Vyas and Gohil.
    [Show full text]
  • Mechanisms of Plant Tolerance to RNA Viruses Induced by Plant-Growth-Promoting Microorganisms
    plants Review Mechanisms of Plant Tolerance to RNA Viruses Induced by Plant-Growth-Promoting Microorganisms Maksimov I. V 1,*, Sorokan A. V 1, Burkhanova G. F 1, Veselova S. V 1, Alekseev V. Yu 1, Shein M. Yu 1, Avalbaev A. M 1, Dhaware P. D 2, Mehetre G. T 2, Singh B. P 2 and Khairullin R. M 1 1 Institute of Biochemistry and Genetics, Ufa Federal Research Center of the Russian Academy of Sciences, pr. Oktyabrya 71, 450054 Ufa, Russia; [email protected] (S.A.V.); [email protected] (B.G.F.); [email protected] (V.S.V.); [email protected] (A.V.Y.); [email protected] (S.M.Y.); [email protected] (A.A.M.); [email protected] (K.R.M.) 2 Department of Biotechnology, Aizawl, Mizoram University, Mizoram 796004, India; [email protected] (D.P.D.); [email protected] (M.G.T.); [email protected] (S.B.P.) * Correspondence: [email protected] Received: 16 October 2019; Accepted: 4 December 2019; Published: 5 December 2019 Abstract: Plant viruses are globally responsible for the significant crop losses of economically important plants. All common approaches are not able to eradicate viral infection. Many non-conventional strategies are currently used to control viral infection, but unfortunately, they are not always effective. Therefore, it is necessary to search for efficient and eco-friendly measures to prevent viral diseases. Since the genomic material of 90% higher plant viruses consists of single-stranded RNA, the best way to target the viral genome is to use ribonucleases (RNase), which can be effective against any viral disease of plants.
    [Show full text]
  • Cottonseed Oil Profile Integrated Pest Management Cornell Cooperative Extension Program
    http://hdl.handle.net/1813/56123 New York State Cottonseed Oil Profile Integrated Pest Management Cornell Cooperative Extension Program Cottonseed Oil Profile Active Ingredient Eligible for Minimum Risk Pesticide Use Brian P. Baker and Jennifer A. Grant New York State Integrated Pest Management, Cornell University, Geneva NY Label Display Name: Cottonseed oil CA DPR Chem Code: 1015 Active Components: Cottonseed oil composed of Other Names: Cotton oil, cottonseed acidulated various fatty acids, including gossypol soapstock, Deodorized cottonseed oil, Gossypium oil, Oleum gossypii, Aceite de algodon (Spanish), CAS Registry #: 8001-29-4 cottonseed oil U.S. EPA PC Code: 031602 Other Codes: CHEMBL2108929; EINECS 232-280-7 Summary: Cottonseed oil is an edible oil that is commonly used in a wide range of foods. Some people are allergic. Carcinogenicity studies are equivocal; cottonseed oil may be a co-carcinogen. As a pesticide, it is mainly used as an adjuvant or carrier with insecticides. The mode of action for cottonseed oil is consid- ered non-toxic to insects and mites, acting mainly through suffocation. Pesticidal Uses: Primarily used as a carrier or solvent. Other uses include as a pediculicide (lice control); acaricide, insecticide, a postharvest protective coating for fruit and grains, and a preservative fungicide for fruit. Also used as an antimicrobial, fungicide, or herbicide. Formulations and Combinations: Various anti-oxidants such as BHA, BHT, tocopherols, or olibanum (Boswellia carterii) oil. Basic Manufacturers: Abitec, Amber, Arista, British Arkady, Cargill, Columbus, Goodfood, JG Boswell; National Cottonseed; Penta; Ruger; Sigma-Aldrich; Spectrum; Tri-K. Safety Overview: A small percentage of the population has allergic reaction to cottonseed and its constit- uent, gossypol.
    [Show full text]