Article Synthesis of Quenchbodies for One-Pot Detection of Stimulant Drug Methamphetamine

Hee-Jin Jeong 1,2, Jinhua Dong 3,4,5, Chang-Hun Yeom 2 and Hiroshi Ueda 5,* 1 Department of Biological and Chemical Engineering, Hongik University, 2639 Sejong-ro, Jochiwon-eup, Sejong-si 30016, Korea; [email protected] 2 Department of Chemical System Engineering, Hongik University, 2639 Sejong-ro, Jochiwon-eup, Sejong-si 30016, Korea; [email protected] 3 Key Laboratory of Biological Medicines in Universities of Shandong Province, Weifang Key Laboratory of Antibody Medicines, School of Bioscience and Technology, Weifang Medical University, Shandong 261053, China; [email protected] 4 World Research Hub Initiative, Institute of Innovative Research, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503, Japan 5 Laboratory for Chemistry and Life Science, Institute of Innovative Research, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8503, Japan * Correspondence: [email protected]; Tel.: +81-45-924-5785



Received: 7 May 2020; Accepted: 9 June 2020; Published: 11 June 2020


Abstract: The problem of illicit drug use and addiction is an escalating issue worldwide. As such, fast and precise detection methods are needed to help combat the problem. Herein, the synthesis method for an anti-methamphetamine Quenchbody (Q-body), a promising sensor for use in simple and convenient assays, has been described. The fluorescence intensity of the Q-body generated by two-site labeling of Escherichia coli produced anti-methamphetamine antigen-binding fragment (Fab) with TAMRA-C2-maleimide dyes increased 5.1-fold over background in the presence of a hydroxyl methamphetamine derivative, 3-[(2S)-2-(methylamino)propyl]phenol. This derivative has the closest structure to methamphetamine of the chemicals available for use in a laboratory. Our results indicate the potential use of this Q-body as a novel sensor for the on-site detection of methamphetamine, in such occasions as drug screening at workplace, suspicious substance identification, and monitoring patients during drug rehabilitation.

Keywords: Quenchbody; antibody; methamphetamine; illicit drug; in-situ immunoassay

1. Introduction The issue of drug abuse is increasing worldwide and has been associated with various social problems. Methamphetamine (MA) is a highly addictive psychostimulant that causes adverse biological effects, such as acute toxic effects on the cardiovascular system, acute renal failure, altered behavioral and cognitive functions, and permanent brain damage [1,2]. Therefore, illicit use of MA is prohibited in many countries. An accurate and rapid detection system for MA is required for clinical diagnostics and criminal forensics, such as drug screening at the workplace and monitoring patients during drug rehabilitation. One of the current methods for quantitating MA is the Duquenois-Levine colorimetric test, in which an indicator reacts with MA and is compared with standardized color charts visually [3]. Such a colorimetric approach is economic and simple, and can be performed without complicated training. However, the visual interpretation affects the accuracy of results, which is occasionally presumptive and limits the quantification. Immunochromatography, which uses a colloidal gold-labeled antibody or antigen as a detection agent provides a simple analytical procedure for drug screening

Methods Protoc. 2020, 3, 43; doi:10.3390/mps3020043 www.mdpi.com/journal/mps Methods Protoc. 2020, 3, x FOR PEER REVIEW 2 of 15

Methods Protoc. 2020, 3, 43 2 of 15 or antigen as a detection agent provides a simple analytical procedure for drug screening in biological specimens [4]. However, as the test result is typically interpreted by the observation of a color band onin biologicalthe membrane, specimens the determination [4]. However, of as thea positive test result or isnegative typically result interpreted is also by subjective the observation. Another of method,a color bandthin-layer on the chromatograph membrane, they (TLC) determination has been ofused a positive to detect or MA negative. However, result TLC is also has subjective. limited accuracyAnother when method, used thin-layer on complex chromatography samples due to (TLC) low resolution has been usedof separation; to detect thus MA., However,the method TLC is typicallyhas limited used accuracy for preliminary when used identification on complex samples[3]. Chromatographic due to low resolution methods of, separation;including thus, gas chromatogrthe methodaphy is typically and liquid used chromatography for preliminary, identificationcan be used in [ 3combination]. Chromatographic with mass methods, spectrometry including to providegas chromatography high precision and results liquid [5,6 chromatography,]. However, these can methods be used involve in combination long sample with pre massparation spectrometry times, complicatedto provide high experimental precision resultsprocedure [5,6].s that However, require these a high methods-level of involve scientific long knowledge sample preparation and advanced times, skillcomplicateds and expensive experimental instruments procedures. Enzyme that-linked require immunosorbent a high-level of scientificassay (ELISA knowledge) has been and used advanced as a primaryskills and tool expensive for the qu instruments.antification Enzyme-linkedof MA [7]. However, immunosorbent ELISA involves assay multiple (ELISA) hassteps been, including used as severala primary washing tool for and the incubating quantification steps, of MA which [7]. require However, one ELISA or two involves days multipleto complete steps, the including entire procedureseveral washing. Thus, anda high incubatingly accurate steps, assay which with require easy sample one or treatment two days tois completeneeded for the rapid, entire onsite procedure. MA detection.Thus, a highly accurate assay with easy sample treatment is needed for rapid, onsite MA detection. AAntibody-basedntibody-based reagentless reagentless fluorescence fluorescence immu immunoassaysnoassays offer offer the the advantages advantages of of only only taking taking minutesminutes to complete complete by by eliminating eliminating washing washing steps steps as well as aswell the as use the of secondary use of secondary antibodies. antibodies. However, However,these types these of types assays of oassaysffer a fewoffer challengesa few challenges in the in developmental the developmental stage, stage, such such as di asff erentdifferent dye dyeconjugation conjugation efficiencies efficienc toies individual to individual antibodies antibodies and non-specific and non-specific binding to binding nontarget to nontarget molecules. moleculesFor example,. For example, labeling anlabeling N-hydroxysuccinimide an N-hydroxysuccinimide ester-conjugated ester-conjugated dye to the dye lysine to the (Lys) lysine R-group (Lys) Ramines-group is amines advantageous is advantageous due to the due numerous to the numerous Lys residues Lys on residues the antibody on the surface. antibody However, surface. However,this method this hasmethod the disadvantage has the disadvantage such that such a good that numbera good number of Lys residues of Lys residues are distributed are distributed all over allthe over antibody, the antibody, making making it difficult it difficult to exactly to quantifyexactly quantify a target a antigen target antigen due to the due random to the random labeling labelingof the of fluorescent the fluorescent dye, dye which, which is not is not consistently consistently producing producing a a conjugate conjugateproduct product with a a known known dye:antibodydye:antibody conjugation conjugation ratio ratio.. Another Another potential potential issue issue is is that that the the Lys Lys residues residues in in the the antigen antigen binding binding regionregion might might be be conj conjugatedugated to to the the dye, dye, which which could could hamper hamper the the antigen antigen-binding-binding activity activity.. T Too increase increase thethe site site-specific-specific dye dye-antibody-antibody conjugation conjugation efficiency, efficiency, we we developed developed a a new new antibody antibody-labeling-labeling method method usingusing a acysteine cysteine (Cys) (Cys)-containing-containing peptide peptide tag tag (Cys (Cys-tag;-tag; MSKQIEVNCSNET MSKQIEVNCSNET [8] [8,], aa mimic mimic of of ProX ProX-tag-tag (MSKQIEVN*SNET,(MSKQIEVN*SNET, * == amberamber codon codon [ 9[9]]) that) that was was developed developed for the for incorporationthe incorporation of unnatural of unnatural amino aminoacids), acids) and applied, and applied it to the it generation to the generat of variousion of Quenchbodiesvarious Quenchbodies (Q-bodies). (Q- Abodies). Q-body A is Q an-body innovative is an innovativeimmunosensor immunosensor that fluoresces that upon fluoresces antigen-dependent upon antigen removal-dependent of the removal fluorophore of the quenchingfluorophore [9]. quenchingIn the absence [9]. Inof thean antigen, absence the of an fluorescence antigen, the of fluorescence the dye is quenched of the dye by is a photo-induced quenched by a electron photo- inducedtransfer electron from the transfer tryptophan from (Trp)the tryptophan residues in (Trp) the nearby residues antigen-binding in the nearby antigen sites of-binding antibody. sites When of antibodyan antigen. When binds an to antigen an antibody, binds theto an binding antibody stabilizes, the binding the conformation stabilizes the of the conformation antibody variable of the antibodyregion and variable the dye region associated and the with dye the associate antigen-bindingd with the site antigen is sterically-binding hindered site is from sterically interacting hindered with fromthe Trp, interacting which leads with tothe de-quenching Trp, which leads (Figure to de1).-quenching (Figure 1).

FigureFigure 1. 1. Schematic representation representation of the of mechanismsthe mechanisms of (A ) offluorescence (a) fluorescence and (B) fluorescence and (b) fluorescence quenching. quenching. In addition to the dye-Trp interaction, a quenching effect can be achieved by dimerization of two neighboring dyes called H-dimer [10–12]. For example, a double-labeled antigen-binding fragment

Methods Protoc. 2020, 3, 43 3 of 15

(Fab)-type Q-body, in which the same dye was incorporated in both the H and L chains, showed a higher fluorescent response in the presence of antigen than single-labeled one, which might be due to dye-dye interaction-mediated deeper quenching [8]. The advantage of Q-body-based assays over conventional immunoassays is its simplicity and rapid quantification of various antigens. Q-body assays function in a one-step, one-pot manner. The Q-body reagent is added to the sample and fluorescence is measured after a short incubation time, without any other experimental steps, which is inherent to the conventional immunoassay that needs several incubation and washing steps with blocking agent or additional antibody. Since the fluorescence of the Q-body is quenched in the absence of antigen, its signal-to-background ratio is higher than that of other conventional dye-conjugated antibodies. We have utilized Q-bodies as biosensors for the rapid detection of various targets in a solution, and in some cases on cells, without the need for washing steps [13,14]. Moreover, Q-body assay for detecting BGP peptide was successfully performed not only in the biochemical buffer-based samples but also in 50% plasma with no apparent loss of response [8]. Therefore, Q-body has potential as a universal reagent for monitoring MA in biological fluid such as blood sample. The anti-MA Q-body was previously generated using an amber-codon-based cell-free transcription and translation system. This Q-body showed a dose-dependent response to the MA derivative concentration up to 7.2-fold [8]. However, as the Q-body is produced via an in vitro translation system, the high cost of reagents including unnatural aminoacyl-tRNA-conjugated dye and the low yield remain as obstacles in practical applications. In this paper, we detail the synthesis of a Q-body using a combination of Escherichia coli (E. coli) expression for high yields and Cys-tagging for site-specific fluorescence dye conjugation. The conjugating involves the mild reduction of the sulfhydryl group of a Cys-tag followed by labeling with a maleimide-conjugated dye. To develop a one-pot MA detection method, we generated a Q-body that recognizes 3-[(2S)-2-(methylamino)propyl] phenol, a MA derivative with high structural similarity. A major focus was the position and number of the fluorophore, as well as the length of the spacer between the maleimide and dye to synthesize a Q-body with a high response to the antigen. The results indicate the potential use of high yield E. coli-based recombinant antibody production and thiol-based antibody labeling with fluorescent dyes against various biomarkers, including MA.

2. Experimental Design The protocol detailed in this paper can be divided to two parts; the expression of anti-MA Fab and its conversion to Q-body. The pUQ1H(MeM9), pUQ1L(MeM9), and pUQ2(MeM9) plasmids are generated and transformed in the E. coli, respectively. The expression of anti-MA Fab is induced in a large quantity of bacterial culture. The expressed Fabs are present as soluble form, and are purified using a His-tag at the C-terminus of H chain by immobilized metal affinity chromatography (IMAC). The second part is the labeling of Fab and confirming the efficiency of the Q-body as a probe for detecting MA derivative. After reduction of cysteine residue on the Cys-tag(s) using TCEP agarose beads, its labeling with either TAMRA-C0-maleimide, TAMRA-C2-maleimide, or TAMRA-C5-maleimide is performed via maleimide-thiol reaction. Q-body is purified using His-tag-based IMAC followed by Flag-tag-based affinity purification. The buffer is exchanged to phosphate-buffered saline added with 0.05% Tween20 (PBST) by using 3 k MWCO ultra-filtration column. The fluorescence intensity of Q-bodies with denaturant is measured using a spectrofluorometer to compare their quenching capacities and to select the most efficient type of Q-body through a total of nine variation (three Fab constructs with different numbers and positions of Cys-tag, and three dyes with different length of linkers between TAMRA and maleimide). Next, various concentrations of 3-[(2S)-2-(methylamino)propyl]phenol, phenethylamine, methoxyphenamine, or PBST are added for titration, and fluorescence titration curves are drawn at the emission maxima of each spectrum.

2.1. Materials KOD-Plus-Neo DNA polymerase (Toyobo, Osaka, Japan; Cat. No.: TOKOD-401) • Methods Protoc. 2020, 3, 43 4 of 15

Midori Green advance nucleic acid staining solution (Nippon Genetics, Tokyo, Japan; Cat. • No.: MG04) In-Fusion HD cloning kit (Toyobo, Osaka, Japan; Cat. No.: 639650) • Restriction enzymes (NdeI-HF, and BamHI-HF) (NEB, Tokyo, Japan; Cat. Nos.: R3131, R3136) • Bacto Tryptone (BD Difco, NJ, USA; Cat. No.: 211705) • Bacto Yeast Extract (BD Difco, NJ, USA; Cat. No.: 212750) • Sodium Chloride (Wako, Osaka, Japan; Cat. No.: 191-01665) • LB Agar (BD Difco, NJ, USA; Cat. No.: 214010) • Ampicillin sodium (Wako, Osaka, Japan; Cat. No.: 014-23302) • Sodium phosphate dibasic anhydrous (Wako, Osaka, Japan; Cat. No.: 194-02875) • Sodium phosphate monobasic dihydrate (Wako, Osaka, Japan; Cat. No.: 199-02825) • Imidazole (Wako, Osaka, Japan; Cat. No.: 095-00015) • Potassium chloride (Wako, Osaka, Japan; Cat. No.: 160-03555) • Plasmid Miniprep kit (Promega, Tokyo, Japan; Cat. No.: A1223) • SHuffle T7 Express LysY Competent Cells (New England Biolabs, Tokyo, Japan; Cat. No.: C3030) • Isopropyl β-D-1-thiogalactopyranoside (Wako, Osaka, Japan; Cat. No.: 090-05146) • Centrifugal filter tube Ultra-4, MWCO 3 k (Millipore, Tokyo, Japan; Cat. No.: UFC800396) • Immobilized Tris(2-carboxyethyl)-phosphine (TCEP) disulfide-reducing gel (Pierce Biotechnology, • Thermo Fisher Scientific, Rockford, IL, USA; Cat. No.: 77712) TAMRA-C0-maleimide (AnaSpec, Fremont, CA, USA; Cat. No..: AS-81445) • TAMRA-C2-maleimide (AnaSpec, Fremont, CA, USA; Cat. No.: AS-81441-5) • TAMRA-C5-maleimide (Biotium, Hayward, CA, USA; Cat. No.: 91040) • Ni Sepharose High Performance IMAC resin (GE Healthcare, Piscataway, NJ, USA; Cat. • No.: 17526801) Empty gravity flow column (Bio-Rad, Hercules, CA, USA; Cat. No.: 7321010) • Empty spin columns (Bio-Rad, Hercules, CA, USA; Cat. No.: 7326204) • Anti DYKDDDDK-tag antibody beads (Wako, Osaka, Japan; Cat. No.: 012-22781) • DYKDDDDK peptide (Wako, Osaka, Japan; Cat. No.: 040-30953) • Bovine serum albumins (Sigma-Aldrich, Tokyo, Japan; Cat. No.: A2153) • Unstained protein standards (Bio-Rad, Hercules, CA, USA; Cat. No.: 1610396) • Dual color protein standards (Bio-Rad, Hercules, CA, USA; Cat. No.: 1610374) • 3-[(2S)-2-(methylamino)propyl]phenol (NetChem, New Brunswick, NJ). • Phenethylamine (Sigma-Aldrich, Tokyo, Japan; Cat. No.: 128945) • Methoxyphenamine (Sigma-Aldrich, Tokyo, Japan; Cat. No.: M1641) • 2.2. Equipment Gel electrophoresis (GELmieru) (Wako, Osaka, Japan; Cat. No.: 290-33891) • Thermal cyclers for PCR (T100 Thermal Cycler) (Bio-Rad, Hercules, CA, USA; Cat. No.: 1861096) • Nanodrop (Optizen NanoQ Lite) (KLab, Daejeon, Korea; Cat. No.: S23-3269-031) • Shaking incubator (Shaking Incubator) (Haneul Techpia; Seoul, Korea; Cat. No.: SI-600R) • Sonicator (VC750 Ultrasonic Processor) (Sonics&Materials, Newtown, CT, USA; Cat. No.: CV-750) • Centrifuge with a swinging-bucket rotor (Centrifuge: Combi 514R, Swing rotor: S750T-4B) • (Hanil Science, Daejeon, Korea; Cat. No: Combi-514R) UV-visible spectrophotometer (Vis Spectrophotometer) (Human Corporation, Seoul, Korea; Cat. • No.: X-MA1200V) Water bath (High precision Water-Bath) (Changshin Science, Seoul, Korea; Cat. No.: C-AWBP) • Fluorescence spectrophotometer (FP-8500) (JASCO, Tokyo, Japan; Cat. No.: FP-8500DS) • Methods Protoc. 2020, 3, 43 5 of 15 Methods Protoc. 2020, 3, x FOR PEER REVIEW 5 of 15

3.3. Procedure

3.1.3.1. DNA CloningCloning (Time(Time forfor Completion:Completion: 1414 Days)Days) ToTo construct construct a DNAa DNA for for generating generating a heavy a heavy (H) chain-labeled (H) chain-labeled Fab-type Fab Q-body-type Q (H1L0),-body (H1L0) the pUQ1H, the vectorpUQ1H on vector which on a Cys-tagwhich a (MSKQIEVNCys-tag (MSKCSNETG)QIEVNCSNETG) is encoded is encoded at the N-terminus at the N-terminus of the H of chain the ofH anti-MAchain of anti Fab.-MA To construct Fab. To construct a DNA sequence a DNA sequence for generating for generating a light (L)-chain a light (L) labeled-chain Fab-typelabeled Fab Q-body-type (H0L1),Q-body the(H0L1) pUQ1L, the pUQ1L vector on vector which on awhich Cys-tag a Cys is encoded-tag is encoded at the at N-terminus the N-terminus of the of L the chain L chain of Fab. of InFab parallel,. In parallel, to construct to construct a DNA a DNA for for generating generating H H and and L L chains-labeled chains-labeled Fab-type Fab-type Q-bodyQ-body (H1L1),(H1L1), thethe pUQ2 pUQ2 vector vector on which two Cys Cys-tags-tags are encoded at the N-terminusN-terminus of H and L chains of Fab.

3.1.1.3.1.1. Construction ofof H1L0-TypeH1L0-Type Anti-MAAnti-MA Q-bodyQ-body ExpressionExpression GeneGene µ µ µ 1.1. Prepare 10 10 MM diluted diluted DNA DNA primer primer solutions solutions by mixing by mixing 10 L 10 of 100L of M 100 primerM primerstock with stock 90 µ withL ultrapure 90 L ultrapurewater. The water. primer Thesequences primer for sequences inserting the for anti inserting-MA Fab the DNA anti-MA sequences Fab DNA with thesequences N-termin withal Cys the-tag N-terminal into a pUQ1H Cys-tag is Fw into-primer a pUQ1H for the isH Fw-primerchain of Fab for (Fd the): ProxNdeBack H chain of (FabAAGGAGATATACAtATGTCTAAACAAATCGAAG (Fd): ProxNdeBack (AAGGAGATATACAtATGTCTAAACAAATCGAAG),), Rv-primer for Fd: CH1ForOverlap Rv-primer for (ATATCTCCTTCTAGATTATTACTTGTCATCGTCG)Fd: CH1ForOverlap (ATATCTCCTTCTAGATTATTACTTGTCATCGTCG),, Fw-primer for Lch: Fw-primer OverlapProxBack for Lch: (TCTAGAAGGAGATATCACATGTCTAAACAAATCGAAG),OverlapProxBack (TCTAGAAGGAGATATCACATGTCTAAACAAATCGAAG), and Rv-primer and Rv-primer for Lch: CforLforBamHI Lch: CLforBamHI (CTTGTAGTCGGATCCTTATTAATGATGATGATGATGATGAG (CTTGTAGTCGGATCCTTATTAATGATGATGATGATGATGAG)) 2.2. Prepare reaction mix mix in in ice ice as as follows follows for for amplify amplifyinging H H chain chain of of MeM9 MeM9:: 5 5Lµ Lof ofdNTPs dNTPs,, 1  1Lµ ofL 10of 10Mµ MFw Fw-primer-primer for for Fd Fd,, 1 1Lµ Lof of 10 10 µMM Rv Rv-primer-primer for for Fd Fd,, 50 50 ng DNA template (tgcHchain)(tgcHchain) (Table1), 3 µL of MgSO , 5 µL of Enzyme buffer, 1 µL of KOD-Plus Neo enzyme, and ultrapure (Table 1), 3 L of MgSO44, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure water up to 50 µLL.. 3.3. Prepare reaction mix mix in in ice ice as as follows follows for for amplify amplifyinging L L chain chain of of MeM9: MeM9: 5 5Lµ Lof ofdNTPs dNTPs,, 1  1Lµ ofL 10of 10Mµ ProxNdeBackM ProxNdeBack,, 1 L 1 µofL 10 of 10M µCLforBamHIM CLforBamHI,, 50 ng 50 DNA ng DNA template template (tttLchain) (tttLchain) (Table (Table 1) 3 1)L of3 µ MgSOL of MgSO4, 5 L4 ,of 5 EnzymeµL of Enzyme buffer, bu1 ffLer, of 1 KODµL of-Plus KOD-Plus Neo enzyme, Neo enzyme, and ultrapure and ultrapure water up water to 50 upL. to50 µL. 4.4. Combine each mixture in ice in 0.2 mL PCR tube, mix gently and centrifuge brieflybriefly (1(1 s,s, RT).RT). CRITICALCRITICAL STEP STEP ItIt is important to use DNA polymerase polymerase with proofreading proofreading activity activity to to minimize DNA amplification amplification error.

5.5. Use the following following conditions conditions to to amplify amplify the the DNA DNA fragments: fragments: 94 94°C◦ forC for 2 min, 2 min, [98 [98°C for◦C 10 for s 10, Tm s, Tmfor 30 for s, 3068 s,°C 68 forC 30 for s] 30× 35, s] hold35, holdat 25 at°C 25. C. ◦ × ◦ 6.6. Prepare a 1.5 1.5%% (wt/vol) (wt/vol) agarose gel in TAE bufffferer (40(40 mMmM Tris,Tris, 2020 mMmM aceticacetic acidacid andand 11 mMmM EDTA) with Midori Green DNADNA GelGel StainStain diluteddiluted 1:20,0001:20,000 (5(5 µLL ofof dyedye inin 100100 mLmL ofof TAE).TAE). 7.7. Mix 3 µL of the PCR product with 0.6 µL of 5 × gelgel loadingloading dyedye andand separateseparate byby runningrunning the the gelgel × at 15 V/cm V/cm for for 30 30 min. min. Load Load 3 3Lµ Lof of 1 1kb kb Plus Plus DNA DNA ladder ladder on on the the same same gel. gel. Then Then,, visualize visualize the DNAthe DNA fragments fragments using using a gel a imaging gel imaging system. system. The Theexpected expected PCR PCR product product size sizefor H for chain H chain is 800 is bp800 and bp andfor L for chain L chain is 777 is 777bp. bp. 8.8. Use a a NucleoSpin NucleoSpin P PCRCR Clean Clean-Up-Up kit kit according according to tothe the manufacturer’s manufacturer’s instructions instructions to purify to purify the PCRthe PCRproduc products.ts.

9.9. Measure the DNA concentration using UV absorbance on a spectrophotometer (Nanodrop)(Nanodrop) 10. Prepare reaction mix in ice as follows for combine H chain and L chain: 5 L of dNTPs, 1 L of 10. Prepare reaction mix in ice as follows for combine H chain and L chain: 5 µL of dNTPs, 1 µL of 10 M Fw-primer for Fd, 1 L of 10 M Rv-primer for Lch, 50 ng purified H chain 50 ng purified 10 µM Fw-primer for Fd, 1 µL of 10 µM Rv-primer for Lch, 50 ng purified H chain 50 ng purified L chain, 3 L of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure L chain, 3 µL of MgSO4, 5 µL of Enzyme buffer, 1 µL of KOD-Plus Neo enzyme, and ultrapure water up to 50 L. water up to 50 µL. 11. To ligate the combined Fab fragment into the pUQ1H vector, digest the pUQ0H1L(DON)[15] 11. To ligate the combined Fab fragment into the pUQ1H vector, digest the pUQ0H1L(DON) [15] with NdeI and BamHI restriction enzymes using the following mixture: 1 g DNA, 5 L NEB with NdeI and BamHI restriction enzymes using the following mixture: 1 µg DNA, 5 µL NEB CutSmart Buffer (10 ×), 1 L of NdeI-HF (20 U), 1 L of BamHI-HF (20 U), and ultrapure water CutSmart Buffer (10 ), 1 µL of NdeI-HF (20 U), 1 µL of BamHI-HF (20 U), and ultrapure water up up to 50 L. After that,× incubate the digestion mixture at 37 °C for 1 h. Cool the mixture to 4 °C . to 50 µL. After that, incubate the digestion mixture at 37 C for 1 h. Cool the mixture to 4 C. 12. Separate the digested pUQ1H DNA vector using a 0.7%◦ (wt/vol) agarose gel at 15 V/cm ◦for 30 min. The expected DNA size for pUQ1H vector is 5404 bp. 13. Extract the desired band and purify it using a NucleoSpin Gel Clean-Up Kit according to the manufacturer’s instructions.

Methods Protoc. 2020, 3, 43 6 of 15

Table 1. Sequence of template DNAs. (underline: tag for labeling or for non-labeling; bold: site for the same; italic: linker).

Template Name Sequence atgtctaaacaaatcgaagtaaacTGCtctaatgagaccggtggcggttcaggcggcggatcacaggtcca gctgcagcagtctggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggtta cccatccactcgcttctacatctactgggtgaagcagagccacggaaagagccttgagtggattggaaatat tgatccttacaatggtggtactacctacaaccagaagttcaagggcaaggccacattgactattgacaagtcc tccaccacagcctacgtgcatctcaacagcctgacatctgaggactctgcagtctattactgtgcaggatttc tgcHchain attactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgtttcctcggccaaaac gacacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctgggat gcctggtcaagggctatttccctgagccagtgacagtgacctggaactctggatccctgtccagcggtgtgc acaccttcccagctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacct ggcccagcgagaccgtcacctgcaacgttgcccacccggccagcagcaccaaggtggacaagaaaattg tgcccagggattgtggggggggttctgactacaaggacgacgatgacaagtaataa atgtctaaacaaatcgaagtaaacTTTtctaatgagaccggtggcggttcaggcggcggatcacaggtcc agctgcagcagtctggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggtta cccatccactcgcttctacatctactgggtgaagcagagccacggaaagagccttgagtggattggaaatatt gatccttacaatggtggtactacctacaaccagaagttcaagggcaaggccacattgactattgacaagtcct ccaccacagcctacgtgcatctcaacagcctgacatctgaggactctgcagtctattactgtgcaggatttca tttHchain ttactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgtttcctcggccaaaacga cacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctgggatgcc tggtcaagggctatttccctgagccagtgacagtgacctggaactctggatccctgtccagcggtgtgcacac cttcccagctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacctggccc agcgagaccgtcacctgcaacgttgcccacccggccagcagcaccaaggtggacaagaaaattgtgccc agggattgtggggggggttctgactacaaggacgacgatgacaagtaataa atgtctaaacaaatcgaagtaaacTGCtctaatgagaccggtggcggttcaggcggcggatcagatattgt tatgacccagtctccagcattcatgtctgcatctcctggggagaaggtcaccttgacctgcagtgccagctc aagtgtaagttccaccttcttgtactggtaccagcagaagccaggatcctcccccaaactctggatttatagca catccaacctggcttctggagtcccttctcgcttcagtggcagtgggtctgggacctcttactctctcacaatca acagcatggaggctgaagatgctgcctcttatttctgccatcagtggagtaattacccattcacgttcggaagt tgcLchain gggaccaagctggaaatcaaacgtgctgatgctgcaccaactgtatccatcttcccaccatccagtgagca gttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaa gattgatggcagtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagcacc tacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggc cactcacaagacatcaacttcacccattgtcaagagcttcaacaggaatgagtgtggggggggttctcatcat catcatcatcattaa atgtctaaacaaatcgaagtaaacTTTtctaatgagaccggtggcggttcaggcggcggatcagatattgtt atgacccagtctccagcattcatgtctgcatctcctggggagaaggtcaccttgacctgcagtgccagctca agtgtaagttccaccttcttgtactggtaccagcagaagccaggatcctcccccaaactctggatttatagcacat ccaacctggcttctggagtcccttctcgcttcagtggcagtgggtctgggacctcttactctctcacaatcaaca gcatggaggctgaagatgctgcctcttatttctgccatcagtggagtaattacccattcacgttcggaagtgggac tttLchain caagctggaaatcaaacgtgctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatct ggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggca gtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagcacctacagcatgagc agcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatc aacttcacccattgtcaagagcttcaacaggaatgagtgtggggggggttctcatcatcatcatcatcattaa

12. Separate the digested pUQ1H DNA vector using a 0.7% (wt/vol) agarose gel at 15 V/cm for 30 min. The expected DNA size for pUQ1H vector is 5404 bp. 13. Extract the desired band and purify it using a NucleoSpin Gel Clean-Up Kit according to the manufacturer’s instructions. 14. Measure the DNA concentration using UV absorbance. 15. Clone the Fab DNA into the pUQ1H vector by setting up the following ligation reaction: 2 µL of Infusion enzyme, 10 ng of insert DNA (Fab), and 10 ng of vector DNA (pUQ1H).

16. Gently mix the reactions and incubate at 50 ◦C for 150 min. Then, chill the mixture on ice. 17. Transfect the ligation reaction into DH5a chemically competent cells by first thawing the cells (100 µL per vial for each transfection) on ice. Add 10 µL of the ligated mixture from Step 14 to the cells and incubate the mixture for 30 min on ice. After that, incubate the cells for 45 s at 42 ◦C, and then immediately chill the cells on ice. Add 500 µL of LB medium (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl and ultrapure water up to 1 L) to the cells and incubate them for 1 h at 37 ◦C with vigorous shaking (200 rpm). Spin it at 10,000 g for 10 min at room temperature in a microcentrifuge and remove 400 µL of the supernatant. After pipetting, spread the cells on pre-warmed LB plate (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl, 15 g Agar and ultrapure Methods Protoc. 2020, 3, x FOR PEER REVIEW 6 of 15

14. Measure the DNA concentration using UV absorbance. 15. Clone the Fab DNA into the pUQ1H vector by setting up the following ligation reaction: 2 L of Infusion enzyme, 10 ng of insert DNA (Fab), and 10 ng of vector DNA (pUQ1H). 16. Gently mix the reactions and incubate at 50 °C for 150 min. Then, chill the mixture on ice. 17. Transfect the ligation reaction into DH5a chemically competent cells by first thawing the cells (100 L per vial for each transfection) on ice. Add 10 L of the ligated mixture from Step 14 to the cells and incubate the mixture for 30 min on ice. After that, incubate the cells for 45 s at 42 °C , and then immediately chill the cells on ice. Add 500 L of LB medium (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl and ultrapure water up to 1 L) to the cells and incubate them for 1 h at Methods37 Protoc. °C with2020 ,vigorous3, 43 shaking (200 rpm). Spin it at 10,000 g for 10 min at room temperature7 ofin 15 a microcentrifuge and remove 400 L of the supernatant. After pipetting, spread the cells on pre- Methodswarmed Protoc. 20 L20B, 3plate, x FOR (10 PEER g Tryptone, REVIEW 5 g Yeast Extract, 10 g NaCl, 15 g Agar and ultrapure water5 of up 15 µ waterto 1L) upcontaining to 1L) containing 100 g/mL 100 ampicillin,g/mL ampicillin, and then and, incubate then,incubate the plate the overnight plate overnight at 37 °C at. Inspect 37 ◦C. 3. ProcedureInspectthe LB plate the LB for plate colony for formation. colony formation. Normally, Normally, tens of colonies tens of colonies of Fab DNA of Fab inserted DNA insertedinto pUQ1H into pUQ1His expected is expected on a cloning on a plate. cloning plate. 3.1. DNA Cloning (Time for Completion: 14 Days) 18.18. Use a sterilesterile pipette tip to inoculate fivefive single colonies into fivefive tubestubes eacheach containingcontaining 44 mLmL ofof ToLB construct medium supplemented a DNA for generating with 100 µ agg/mL heavy/mL ampicillin.ampicillin. (H) chain Incubate-labeled the Fab culture-type Q tubestubes-body atat (H1L0) 3737 ◦°CC ,withwith the pUQ1Hvigorous vector shaking on which (200 a rpm)Cys-tag overnight. (MSKQIEVN CSNETG) is encoded at the N-terminus of the H 19.chain19. Use of anti a plasmid-MA Fab. DNA To construct purificationpurification a DNA kit to sequence isolate plasmidplasmid for generating DNADNA fromfrom a light thethe (L) 44 mLmL-chain ofof bacterial bacteriallabeled Fab culture.culture.-type Q-body PAUSE(H0L1)PAUSE, STEPthe STEP pUQ1L PlasmidPlasmid vector DNA DNA on can canwhich be be stored storeda Cys- fortag for severalis several encoded years years at at atthe − 20N20 -°CterminusC.. of the L chain of − ◦ Fab20.20. . InConfirmConfirm parallel, theto construct presence a DNA of Fab Fabfor generating DNA DNA by by H Sanger Sangerand L chain sequencing sequencings-labeled Fab using using-type T7 T7 Q - promoter-Fwbody promoter (H1L1)-Fw, the pUQ2(TAATACGACTCACTATAGGG) vector on which two Cys-tags and areand T7 encoded terminater-Rv T7 terminater at the N (GCTAGTTATTGCTCAGCGG)-terminus-Rv (GCTAGTTATTGCT of H and L chains CAGCGG)of primers. Fab. 3.1.2.primers. Construction of H0L1-Type Anti-MA Q-body Expression Gene 3.1.1. Construction of H1L0-Type Anti-MA Q-body Expression Gene To insert a Cys-tag into the N terminus of L chain of anti-MA Fab, H chain was amplified with 1. PrepareTable 1. Sequence10 M diluted of template DNA DNAs. primer (underline: solutions tag by for mixing labeling 10 or  forL of non 100-labeling M primer; bold: sitestock for withthe 90 the primers ProxNdeBack and CH1ForOverlap and tttHchain (Table1) as a template DNA, and sameL ultrapure; italic: linker water.). The primer sequences for inserting the anti-MA Fab DNA sequences with L chain was amplified with the primers OverlapProxBack and CLforBamHI and tgcLchain (Table1) as theTemplate N-termin al Cys-tag into a pUQ1H is Fw-primer for the H chain of Fab (Fd): ProxNdeBack a template DNA. The amplified DNA fragments wereSequence linked by splice-overlap-extension (SOE) PCR (AAGGAGATATACAtATGTCTAAACAAATCGAAGname ), Rv-primer for Fd: CH1ForOverlap with ProxNdeBack and CLforBamHI, then cloned into the NdeI-/BamHI-digested pUQ0H1L(DON) [15]. (ATATCTCCTTCTAGATTATTACTTGTCATCGTCG)atgtctaaacaaatcgaagtaaacTGCtctaatgagaccggtggcggttcaggcggcggatca, Fw-primer for Lch:caggtccagctgcagcagt OverlapProxBack Follow Steps 1–20. (TCTAGAAGGAGATATCACATGTCTAAACAAATCGAAG),ctggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggttacccatccactcgcttctacatcta and Rv-primer for Lch: CLforBamHI ctgggtgaagcagagccacggaaagagccttgagtggattggaaatattgatccttacaatggtggtactacctacaaccag(CTTGTAGTCGGATCCTTATTAATGATGATGATGATGATGAG) 3.1.3. Constructionaagttcaagggcaaggccacattgactattgacaagtcctccaccacagcctacgtgcatctcaacagcc of H1L1-Type Anti-MA Q-body Expression Gene tgacatctgagga 2. Prepare reaction mix in ice as follows for amplifying H chain of MeM9: 5 L of dNTPs, 1 L of ctctgcagtctattactgtgcaggatttcattactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgt 10TotgcHchain insertM Fw Cys-tags -primer into for theFd N, 1 terminus L of 10 of  bothM Rv H-primer and L chains for Fd of, anti-MA50 ng DNA Fab, Htemplate chain was (tgcHchain) amplified with the primers ProxNdeBackttcctcggccaaaacgacacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctggga and CH1ForOverlap and tgcHchain (Table1) as a template DNA, and (Table 1), 3 Ltgcctggtcaagggctatttccctgagccagtgacagtgacctggaactctggatccctgtccagcggtgtgca of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, andcaccttccca ultrapure L chain was amplified with the primers OverlapProxBack and CLforBamHI and tgcLchain (Table1) as water up to 50gctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacctggcccagcgagaccgtcacctgc L. 3.a templatePrepare DNA. reaction Theaacgttgcccacccggccagcagcaccaaggtggacaagaaaattgtgcccagggattgtggggggggttctgactacaa amplifiedmix in ice DNAas follows fragments for amplify were linkeding L chain by splice-overlap-extension of MeM9: 5 L of dNTPs (SOE), 1  PCRL of with10 ProxNdeBack M ProxNdeBack and CLforBamHI,, 1 L of 10  thenM CLforBamHI clonedggacgacgatgacaagtaataa into the, 50Nde ng DNAI-/Bam templateHI-digested (tttLchain) pUQ0H1L(DON) (Table 1) 3 [ 15L]. Followof MgSO Steps 1–20.4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure water up to 50 L. atgtctaaacaaatcgaagtaaacTTTtctaatgagaccggtggcggttcaggcggcggatcacaggtccagctgcagcagt 3.2. Fab Expression in E. coli (Time for Completion: 4 Days) 4. Combine eachctggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggttacccatccactcgcttctacatcta mixture in ice in 0.2 mL PCR tube, mix gently and centrifuge briefly (1 s, RT). ctgggtgaagcagagccacggaaagagccttgagtggattggaaatattgatccttacaatggtggtactacctacaaccag CRITICALCRITICAL STEP STEP AllIt is steps important in this section to use mustDNA be polymerase carried out in with a sterile proofreading environment. activity to aagttcaagggcaaggccacattgactattgacaagtcctccaccacagcctacgtgcatctcaacagcctgacatctgagga 1. minimizeTransformtttHchain DNA pUQ1H,ctctgcagtctattactgtgcaggatttcattactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgt amplification pUQ1L, error. or PUQ2 plasmid vector containing anti-MeM9 Fab, Cys-tag(s) 5. Useat the the N-terminal followingttcctcggccaaaacgacacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctggga conditions of H and/ orto Lamplify chain, the His-tag DNA at fragments: the C-terminal 94 °C for of 2 H min, chain, [98 and °C for Flag-tag 10 s, Tm at forthe 30 C-terminal s, 68 °Ctgcctggtcaagggctatttccctgagccagtgacagtgacctggaactc for of 30 L chains] × 35, into hold SHu atffl 25e T7°C . LysY competent cells.tggatccctgtccagcggtgtgcacaccttccca Add 5 µL of plasmid to 100 µL of 6. Preparecompetent a 1.5 cells%gctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacctggcccagcgagaccgtcacctgc (wt/vol) and incubate agarose the gel mixture in TAE for bu 30ffer min (40 on mM ice. Tris, Incubate 20 mM the acetic cells foracid 45 and s at 1 42 mM◦C, EDTA)and then with immediately Midoriaacgttgcccacccggccagcagcaccaaggtggacaagaaaattgtgcccagggattgtggggggggttctgactacaa Green chill DNA the cells Gel onStain ice. diluted Add 500 1:20,000µL of LB(5  mediumL of dye toin the100 cellsmL of and TAE). incubate ggacgacgatgacaagtaataa 7. Mixthem 3  forL of 1 hthe at PCR 37 ◦C product with vigorous with 0.6 shakingL of 5 × (200 gel rpm).loading Spin dye itand at 10,000separate g forby 10running min at the room gel

attemperature 15 V/cm for in 30 a microcentrifugemin. Load 3 L of and 1 kb remove Plus DNA 1 mL ladder of the supernatant.on the same gel. After Then pipetting,, visualize spread the atgtctaaacaaatcgaagtaaacTGCtctaatgagaccggtggcggttcaggcggcggatcagatattgttatgacccagtc DNA fragments using a gel imaging system. The µexpected PCR product size for H chain is 800 the cells on pre-warmedtccagcattcatgtctgcatctcctggggagaaggtcaccttgacctgcagtgccagctcaagtgtaagttccaccttcttgtact LB plate containing 100 g/mL ampicillin, and then incubate the plate bptgcLchain and for L chain is 777 bp. for 16 h at 37ggtaccagcagaagccaggatcctcccccaaactctggatttatagcacatccaacctggcttctggagtcccttctcgcttcag◦C. 8. UseCRITICAL a NucleoSpintggcagtgggtctgggacctcttactctctcacaatcaacagcatggaggctgaagatgctgcct STEP PCRDo Clean not-Up overgrow kit according the colonies. to the manufacturer’s This can result instructions incttatttctgccatcagtgg local breakdown to purify the of PCRthe ampicillin,products.agtaattacccattcacgttcggaagtgggaccaagctggaaatcaaacgtgctgatgctgcaccaactgtatccatcttccca and formation and survival of satellite colonies that lack the plasmid. 9. Measure the DNA concentration using UV absorbance on a spectrophotometer (Nanodrop) PAUSE STEP The plates can be removed from the incubator, sealed in Parafilm, and stored 10. Prepare reaction mix in ice as follows for combine H chain and L chain: 5 L of dNTPs, 1 L of upside down at 4 ◦C for up to 2 weeks. 10 M Fw-primer for Fd, 1 L of 10 M Rv-primer for Lch, 50 ng purified H chain 50 ng purified 2. Add 4 µL of 100 mg/mL ampicillin stock to 4 mL culture tube containing 4 mL of LB medium. L chain, 3 L of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure Pick a single colony and inoculate it in the culture tube. water up to 50 L. 3. Incubate the culture tube in a tabletop shaker at 200 rpm at 37 C. Monitor growth using 11. To ligate the combined Fab fragment into the pUQ1H vector, digest◦ the pUQ0H1L(DON)[15] a UV-visible light spectrophotometer measuring absorbance at 600 nm. Grow the colonies until with NdeI and BamHI restriction enzymes using the following mixture: 1 g DNA, 5 L NEB the optical density (OD) 600 value reaches 0.9 (typically 16–18 h). CutSmart Buffer (10 ×), 1 L of NdeI-HF (20 U), 1 L of BamHI-HF (20 U), and ultrapure water up to 50 L. After that, incubate the digestion mixture at 37 °C for 1 h. Cool the mixture to 4 °C . 12. Separate the digested pUQ1H DNA vector using a 0.7% (wt/vol) agarose gel at 15 V/cm for 30 min. The expected DNA size for pUQ1H vector is 5404 bp. 13. Extract the desired band and purify it using a NucleoSpin Gel Clean-Up Kit according to the manufacturer’s instructions.

Methods Protoc. 2020, 3, x FOR PEER REVIEW 5 of 15

3. Procedure

3.1. DNA Cloning (Time for Completion: 14 Days) To construct a DNA for generating a heavy (H) chain-labeled Fab-type Q-body (H1L0), the pUQ1H vector on which a Cys-tag (MSKQIEVNCSNETG) is encoded at the N-terminus of the H chain of anti-MA Fab. To construct a DNA sequence for generating a light (L)-chain labeled Fab-type Q-body (H0L1), the pUQ1L vector on which a Cys-tag is encoded at the N-terminus of the L chain of Fab. In parallel, to construct a DNA for generating H and L chains-labeled Fab-type Q-body (H1L1), the pUQ2 vector on which two Cys-tags are encoded at the N-terminus of H and L chains of Fab.

3.1.1. Construction of H1L0-Type Anti-MA Q-body Expression Gene 1. Prepare 10 M diluted DNA primer solutions by mixing 10 L of 100 M primer stock with 90 L ultrapure water. The primer sequences for inserting the anti-MA Fab DNA sequences with the N-terminal Cys-tag into a pUQ1H is Fw-primer for the H chain of Fab (Fd): ProxNdeBack (AAGGAGATATACAtATGTCTAAACAAATCGAAG), Rv-primer for Fd: CH1ForOverlap (ATATCTCCTTCTAGATTATTACTTGTCATCGTCG), Fw-primer for Lch: OverlapProxBack (TCTAGAAGGAGATATCACATGTCTAAACAAATCGAAG), and Rv-primer for Lch: CLforBamHI (CTTGTAGTCGGATCCTTATTAATGATGATGATGATGATGAG) 2. Prepare reaction mix in ice as follows for amplifying H chain of MeM9: 5 L of dNTPs, 1 L of 10 M Fw-primer for Fd, 1 L of 10 M Rv-primer for Fd, 50 ng DNA template (tgcHchain) (Table 1), 3 L of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure Methodswater Protoc. up 20 20to, 503, x  FORL. PEER REVIEW 6 of 15 3. Prepare reaction mix in ice as follows for amplifying L chain of MeM9: 5 L of dNTPs, 1 L of 14. Measure the DNA concentration using UV absorbance. 10 M ProxNdeBack, 1 L of 10 M CLforBamHI, 50 ng DNA template (tttLchain) (Table 1) 3 L 15. Clone the Fab DNA into the pUQ1H vector by setting up the following ligation reaction: 2 L of of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure water up to 50 MethodsInfusion Protoc. 2020 enzyme,, 3, 43 10 ng of insert DNA (Fab), and 10 ng of vector DNA (pUQ1H). 8 of 15 L. 16. Gently mix the reactions and incubate at 50 °C for 150 min. Then, chill the mixture on ice. 4. Combine each mixture in ice in 0.2 mL PCR tube, mix gently and centrifuge briefly (1 s, RT). 17. Transfect the ligation reaction into DH5a chemically competent cells by first thawing the cells CRITICAL STEP STEPGrowth It is important rates will be to dependent use DNA upon polymerase the protein with of interest.proofreading For each activity protein, to (100 L per vial for each transfection) on ice. Add 10 L of the ligated mixture from Step 14 to minimizeit is recommended DNA amplification to experimentally error. determine the ideal expression time for optimal expression. the cells and incubate the mixture for 30 min on ice. After that, incubate the cells for 45 s at 42 5. UseOvergrowth the following will deplete conditions the ampicillin,to amplify resultingthe DNA infragments: the growth 94 of°C cells for 2 lacking min, [9 the8 °C plasmid. for 10 s, Tm °C , and then immediately chill the cells on ice. Add 500 L of LB medium (10 g Tryptone, 5 g for 30 s, 68µ °C for 30 s] × 35, hold at 25 °C . 4. AddYeast 200 Extract,L of 10 ampicillin g NaCl and stock ultrapure to 1 L flasks water containing up to 1 L) either to the 200 cells mL and of incubate LB medium. them for 1 h at 6. Prepare a 1.5% (wt/vol) agarose gel in TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM 5. Inoculate37 °C with the vigorous medium shaking with 2(200 mL rpm). of confluent Spin it 4at mL10,000 culture g for from 10 min Step at 4room (1 mL temperature per 100 mL in of a EDTA) with Midori Green DNA Gel Stain diluted 1:20,000 (5 L of dye in 100 mL of TAE). culture).microcentrifuge Incubate and the remove culture 400 flask L in of a the shaker supernatant. at 200 rpm After at 37 pipetting,◦C. spread the cells on pre- 7. Mix 3 L of the PCR product with 0.6 L of 5 × gel loading dye and separate by running the gel 6. Monitorwarmed L growthB plateusing (10 g Tryptone, a UV-visible 5 g lightYeast spectrophotometer Extract, 10 g NaCl, measuring15 g Agar and absorbance ultrapure at water 600 nm. up at 15 V/cm for 30 min. Load 3 L of 1 kb Plus DNA ladder on the same gel. Then, visualize the Growto 1L) thecontaining colonies 100 until g/mL the OD600ampicillin, value and reaches then, incubate 0.6. Troubleshooting: the plate overnightIf the at OD600 37 °C . value Inspect is DNA fragments using a gel imaging system. The expected PCR product size for H chain is 800 higherthe LB plate than 0.6,for colony dilute theformation. sample Normally, until the value tens of reaches colonies 0.3 of and Fab re-incubate DNA inserted the sampleinto pUQ1H until bp and for L chain is 777 bp. itsis expected OD600 value on a cloning reaches plate. 0.6. 8. Use a NucleoSpin PCR Clean-Up kit according to the manufacturer’s instructions to purify the 7.18. InduceUse a ster theile cells pipette with tip 80 toµ Linoculate of 1 M IPTGfive single in ultrapure colonies water into five (0.4 tubes mM finaleach concentration)containing 4 mL and of PCR products. incubateLB medium the supplemented culture flasks in with a shaker 100  forg/mL 16 ampicillin. h at 200 rpm Incubate at 16 ◦C. the culture tubes at 37 °C with 9. Measure the DNA concentration using UV absorbance on a spectrophotometer (Nanodrop) 8. Transfervigorous theshaking sample (200 to rpm) 50 mL overnight. centrifuge tubes and pellet the cells by spinning down them at 10. Prepare reaction mix in ice as follows for combine H chain and L chain: 5 L of dNTPs, 1 L of 19. 4000Use a rpmplasmid for 30 DNA min purification at 4 ◦C in a centrifuge. kit to isolate Decant plasmid the supernatantDNA from the without 4 mL disturbingof bacterial the culture. pellet. 10 M Fw-primer for Fd, 1 L of 10 M Rv-primer for Lch, 50 ng purified H chain 50 ng purified PAUSEPAUSE STEP STEP PlasmidThe pellets DNA can can be storedbe stored at 4 for◦C forseveral at least years 1 week at −20 or °C20. ◦C for at least 4 weeks. L chain, 3 L of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Ne−o enzyme, and ultrapure 20. Confirm the presence of Fab DNA by Sanger sequencing using T7 promoter-Fw water up to 50 L. 3.3. Antibody(TAATACGACTCACTATAGGG) Purification (Time for Completion: and 1 Day) T7 terminater-Rv (GCTAGTTATTGCTCAGCGG) 11. To ligate the combined Fab fragment into the pUQ1H vector, digest the pUQ0H1L(DON)[15] primers. 1. withTake theNde cellI and pellets BamH fromI restriction the refrigerator enzymes or using freezer the and following allow them mixture: to thaw 1  ong DNA, ice. Add 5 L 10 NEB mL of His-binding buffer× [50.8 mM Disodium hydrogen phosphate, 18.5 mM Sodium dihydrogen CutSmartTable 1. Sequence Buffer of(10 template ), 1 LDNAs. of Nde (underline:I-HF (20 tagU), f or1 labelingL of Bam or HforI- HFnon -(labeling20 U), and; bold: ultrapure site for the water phosphate, 300 mM Sodium chloride (NaCl), pH 7.4] per original 100 mL culture. Mix gently by upsame to; italic:50 L. linker After). that, incubate the digestion mixture at 37 °C for 1 h. Cool the mixture to 4 °C . 12. Separateswirling thethe budigestedffer by usingpUQ1H pipet DNA aid. vector using a 0.7% (wt/vol) agarose gel at 15 V/cm for 30 2. LyseTemplate the cells by sonicating the pellet on ice with the tapered probe for 10 min of operation time min. The expected DNA size for pUQ1H vector Sequenceis 5404 bp. 13. withExtractname a 50% the dutydesired cycle. band Place and the purify end ofit using the tip a atNucleoSpin about the point Gel Clean where-Up the Kit tube according tapers. Adjust to the atgtctaaacaaatcgaagtaaacTGCtctaatgagaccggtggcggttcaggcggcggatcacaggtccagctgcagcagt manufacturer’sthe probe setting instructions. so that the probe has a low growl sound, rather than a high-pitched whine. ctggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggttacccatccactcgcttctacatcta CRITICAL STEP It is important to maintain a low temperature (4 ◦C) during sonication. ctgggtgaagcagagccacggaaagagccttgagtggattggaaatattgatccttacaatggtggtactacctacaaccag Therefore, the samples must be sonicated on ice with pulse intervals short enough to prevent aagttcaagggcaaggccacattgactattgacaagtcctccaccacagcctacgtgcatctcaacagcctgacatctgagga overheating thectctgcagtctattactgtgcaggatttcattactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgt sample when lysing the cells. tgcHchain 3. Transfer the samplettcctcggccaaaacgacacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctggga to a 50 mL centrifuge tube and spin it at 4000 rpm for 30 min at 4 ◦C in a centrifuge totgcctggtcaagggctatttccctgagccagtgacagtgacctggaactctggatccctgtccagcggtgtgca pellet the cellular debris. caccttccca 4. Prepare the His-bindinggctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacctggcccagcgagaccgtcacctgc column by packing 200 µL of His-beads into empty gravity column followed by applyingaacgttgcccacccggccagcagcaccaaggtggacaagaaaattgtgcccagggattgtggggggggttctgactacaa 5 column volume (CV) of phosphate-buffered saline (PBS, 145 mM NaCl, 15.5 mM Disodium hydrogen phosphate,ggacgacgatgacaagtaataa 1.7 mM Sodium dihydrogen phosphate, pH 7.4).

5. Apply the supernatant from Step 3 to the column, close the cap of the column, and allow it bind atgtctaaacaaatcgaagtaaacTTTtctaatgagaccggtggcggttcaggcggcggatcacaggtccagctgcagcagt to the beads forctggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggttacccatccactcgcttctacatcta 2 h at 25 ◦C by gently stirring it with a rotator. Note: His-tagged Fab and H chain should be retainedctgggtgaagcagagccacggaaagagccttgagtggattggaaatattgatccttacaatggtggtactacctacaaccag on the column. 6. Pass throughaagttcaagggcaaggccacattgactattgacaagtcctccacca the column by gravity flow and wash the beadscagcctacgtgcatctcaacagcctgacatctgagga by applying 5 CV of His-washing butttHchainffer [50.8 mMctctgcagtctattactgtgcaggatttcattactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgt Disodium hydrogen phosphate, 18.5 mM Sodium dihydrogen phosphate, 300 mM NaCl, 5 mM Imidazole,ttcctcggccaaaacgacacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctggga pH 7.4) to the column. Drain the buffer. Repeat this step three times. 7. Stop the flowtgcctggtcaagggctatttccctgagccagtgacagtgacctggaactc and close the cap of column. Apply 1.5 CV of His-elutiontggatccctgtccagcggtgtgcacaccttccca buffer [50.8 mM Disodium gctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacctggcccagcgagaccgtcacctgc hydrogen phosphate, 18.5 mM Sodium dihydrogen phosphate, 300 mM NaCl, 500 mM Imidazole, aacgttgcccacccggccagcagcaccaaggtggacaagaaaattgtgcccagggattgtggggggggttctgactacaa pH 7.4). Agitate the resin by gently stirringggacgacgatgacaagtaataa it for 1 h at 25 ◦C. Start the flow and collect the elution. 8. Confirm that Fab is in the elution by running an SDS-PAGE and staining with Coomassie blue. (SDS-PAGEatgtctaaacaaatcgaagtaaa gel: 12% SeparatingcTGC gel;tctaatgagacc 2 mL 30%ggtggcggttcaggcggcggatca Acrylamide, 1.25 mLgatattgttatgacccagtc 1.5 M Tris (pH 8.8), 1.65 mL ultrapuretccagcattcatgtctgcatctcctggggagaaggtcaccttgacctgcagtgccagctcaagtgtaagttccaccttcttgtact water, 25 µL 10% SDS, 50 µL 10% APS, 2 µL TEMED. Staking gel; 165 µL 30% tgcLchain Acrylamide, 125ggtaccagcagaagccaggatcctcccccaaactctggatttatagcacatccaacctggcttctggagtcccttctcgcttcagµL 0.5 M Tris (pH 6.8), 0.7 mL ultrapure water, 10 µL 10% SDS, 10 µL 10% APS, 2 µL TEMED)tggcagtgggtctgggacctcttactctctcacaatcaacagcatggaggctgaagatgctgcctcttatttctgccatcagtgg CRITICALagtaattacccattcacgttcggaagtgggaccaagctggaaatcaaacgtgctgatgctgcaccaactgtatccatcttccca STEP We recommend running the eluted sample and the flow-through sample from Step 6 on the same gel for comparison. In the case that the protein of Fab and/or H chain is found in the flow-through sample and not in the elution, re-initialize the His-binding column (Step Methods Protoc. 2020, 3, x FOR PEER REVIEW 5 of 15

3. Procedure

3.1. DNA Cloning (Time for Completion: 14 Days) To construct a DNA for generating a heavy (H) chain-labeled Fab-type Q-body (H1L0), the pUQ1H vector on which a Cys-tag (MSKQIEVNCSNETG) is encoded at the N-terminus of the H chain of anti-MA Fab. To construct a DNA sequence for generating a light (L)-chain labeled Fab-type Q-body (H0L1), the pUQ1L vector on which a Cys-tag is encoded at the N-terminus of the L chain of Fab. In parallel, to construct a DNA for generating H and L chains-labeled Fab-type Q-body (H1L1), the pUQ2 vector on which two Cys-tags are encoded at the N-terminus of H and L chains of Fab.

3.1.1. Construction of H1L0-Type Anti-MA Q-body Expression Gene 1. Prepare 10 M diluted DNA primer solutions by mixing 10 L of 100 M primer stock with 90 L ultrapure water. The primer sequences for inserting the anti-MA Fab DNA sequences with the N-terminal Cys-tag into a pUQ1H is Fw-primer for the H chain of Fab (Fd): ProxNdeBack (AAGGAGATATACAtATGTCTAAACAAATCGAAG), Rv-primer for Fd: CH1ForOverlap (ATATCTCCTTCTAGATTATTACTTGTCATCGTCG), Fw-primer for Lch: OverlapProxBack (TCTAGAAGGAGATATCACATGTCTAAACAAATCGAAG), and Rv-primer for Lch:

MethodsC Protoc.LforBamHI2020, 3, 43(CTTGTAGTCGGATCCTTATTAATGATGATGATGATGATGAG) 9 of 15 2. Prepare reaction mix in ice as follows for amplifying H chain of MeM9: 5 L of dNTPs, 1 L of 10 M Fw-primer for Fd, 1 L of 10 M Rv-primer for Fd, 50 ng DNA template (tgcHchain) (Table4). Repeat 1), 3 Steps L of 5–7, MgSO starting4, 5 L with of Enzyme reapplication buffer, of 1 theL flow-throughof KOD-Plus thatNeo containsenzyme, theand remaining ultrapure waterFab and up/or toH 50 chain. L. 9.3. PrepareExchange reaction the bu ffmixer of in eluted ice as samplefollows tofor PBS amplify usinging a 3L k chain MWCO of MeM9: Amicon 5 centrifugalL of dNTPs ultrafilter., 1 L of Add10 M the ProxNdeBack eluted sample, 1 inL the of 10 top M part CLforBamHI of the filter,and 50 ng centrifuge DNA template at 4000 ( rpmtttLchain) until the(Table volume 1) 3  ofL ofthe MgSO sample4, 5 is  0.2L of mL. Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure water up to 50 10. LoadingL. 5 mL of PBS and centrifuge at 4000 rpm until 0.2 mL of the sample remains. Repeat 4. Combinethis step threeeach mixture times. in ice in 0.2 mL PCR tube, mix gently and centrifuge briefly (1 s, RT). CRITICALCRITICAL STEP STEP DoIt isnot important let the volume to use reduce DNA below polymerase 0.2 mL. with This can proofreading cause aggregation activity of to minimizethe protein. DNA amplification error. Methods Protoc. 2020, 3, x FOR PEER REVIEW 6 of 15 5. UseCRITICAL the following STEP conditionsDo not let to theamplify filters the dry DNA out. fragments: This may result 94 °C in for poor 2 min, recovery. [98 °C for 10 s, Tm for 30 s, 68 °C for 30 s] × 35, hold at 25 °C . µ 11.14. RecoverMeasure thethe buDNAffer concentration exchanged protein using fromUV absorbance the membrane,. use a 200 L pipette tip, and insert 6. Prepare a 1.5% (wt/vol) agarose gel in TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM 15. theClone tip the in theFab bottomDNA into of thethe filterpUQ1H unit. vector by setting up the following ligation reaction: 2 L of EDTA) with Midori Green DNA Gel Stain diluted 1:20,000 (5 L of dye in 100 mL of TAE). InfusionCRITICAL enzyme, STEP 10 ngWithdraw of insert DNA the sample (Fab), and in several10 ng of aliquots; vector DNA be careful(pUQ1H) not. to puncture 7. Mix 3 L of the PCR product with 0.6 L of 5 × gel loading dye and separate by running the gel 16. theGently membrane. mix the reactions and incubate at 50 °C for 150 min. Then, chill the mixture on ice. at 15 V/cm for 30 min. Load 3 L of 1 kb Plus DNA ladder on the same gel. Then, visualize the 17. TraCRITICALnsfect the ligation STEP Recover reaction the into bu ffDH5aer exchanged chemically sample competent from the cells filter byimmediately first thawing after the finalcells DNA fragments using a gel imaging system. The expected PCR product size for H chain is 800 centrifugation(100 L per vial to for maximize each transfection) recovery yield. on ice. Add 10 L of the ligated mixture from Step 14 to bp and for L chain is 777 bp. 12. Checkthe cells the and protein incubate expression the mixture and protein for 30 puritymin on with ice. 10AfterµL ofthat, sample incubate by running the cells an for SDS-PAGE. 45 s at 42 8. Use a NucleoSpin PCR Clean-Up kit according to the manufacturer’s instructions to purify the Determine°C , and then the immediately protein concentration chill the cells by generatingon ice. Add a 5 standard00 L of curveLB medium of bovine (10 serumg Tryptone albumin, 5 g PCR products. (BSA)Yeast Extract, [16]. Prepare 10 g NaCl serial and dilution, ultrapure ranging water up from to 1 0.31 L) to to the 1 mg cells/mL, and from incubate a stock them solution for 1 h ofat 9. Measure the DNA concentration using UV absorbance on a spectrophotometer (Nanodrop) 1037 °C mg with/mL BSA.vigorous Load shaking the purified (200 rpm). protein Spin of unknownit at 10,000 concentration, g for 10 min at molecular room temperature mass markers, in a 10. Prepare reaction mix in ice as follows for combine H chain and L chain: 5 L of dNTPs, 1 L of andmicrocentrifuge multiple BSA and samples remove to 400 each L well of the of gel.supernatant. Following After sample pipetting, preparation spread and the separation cells on pre by- 10 M Fw-primer for Fd, 1 L of 10 M Rv-primer for Lch, 50 ng purified H chain 50 ng purified electrophoresis,warmed LB plate the (10 proteins g Tryptone, are stained 5 g Yeast with Extract, Coomassie 10 g NaCl, blue. 15 The g gelAgar is and de-stained ultrapure to eliminatewater up L chain, 3 L of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure background,to 1L) containing dried 100 between g/mL ampicillin, two sheets and of cellophane, then, incubate and the scanned plate overnight with a common at 37 °C desktop. Inspect water up to 50 L. scanner,the LB plate and thefor resultingcolony formation. image is imported Normally, into tens the of freeware colonies program of Fab DNA ImageJ inserted (NIH) forinto analytical pUQ1H 11. To ligate the combined Fab fragment into the pUQ1H vector, digest the pUQ0H1L(DON)[15] analysis.is expectedTroubleshooting: on a cloning plate.If you find protein degradation, try to perform the purification with NdeI and BamHI restriction enzymes using the following mixture: 1 g DNA, 5 L NEB 18. stepsUse a atster 4ile◦C pipette and/or tip add to proteaseinoculate inhibitors five single to colonies the cell into lysis five bu fftubeser and each purification containing bu 4 ffmLer toof CutSmart Buffer (10 ×), 1 L of NdeI-HF (20 U), 1 L of BamHI-HF (20 U), and ultrapure water preventLB medium degradation. supplemented with 100 g/mL ampicillin. Incubate the culture tubes at 37 °C with up to 50 L. After that, incubate the digestion mixture at 37 °C for 1 h. Cool the mixture to 4 °C . 13. Dilutevigorous the shaking dialyzed (200 protein rpm) overnight. to 1 mg/mL using PBS with 15% glycerol. Prepare aliquots of 12. Separate the digested pUQ1H DNA vector using a 0.7% (wt/vol) agarose gel at 15 V/cm for 30 19. theUse samples,a plasmid freeze DNA thempurification on dry ice,kit to and isolate lyophilize. plasmid Store DNA the from samples the 4 at mL80 of◦ bacterialC. culture. min. The expected DNA size for pUQ1H vector is 5404 bp. − PAUSEPAUSE STEP STEP PlasmidLyophilized DNA proteincan be stored has been for several stored years for several at −20 °C years. at 80 C with no 13. Extract the desired band and purify it using a NucleoSpin Gel Clean-Up Kit −according◦ to the 20. observableConfirm the eff ects presence on protein of function Fab DNA or structure by Sanger upon re-solubilization. sequencing using T7 promoter-Fw manufacturer’s instructions. (TAATACGACTCACTATAGGG) and T7 terminater-Rv (GCTAGTTATTGCTCAGCGG)

3.4. Labelingprimers. Fab with Maleimide-Conjugated Fluorescent Dye (Time for Completion: 1 Day) 1. Add 100 µL of TCEP reducing gel slurry to a spin-cup column placed in a microcentrifuge tube. CentrifugeTable 1. Sequence at 1000 of rpmtemplate in a DNAs. microcentrifuge (underline: fortag f 30or s.labeling Remove or for and non discard-labeling the; bold: supernatant. site for the same; italic: linker). 2. Apply 100 µL of purified protein to the top of the gel in the tube. Gently vortex or mix the sampleTemplate and gel, and incubate sample by placing the tube on a rotating wheel to keep the gel in Sequence suspensionname for 1 h (Sample concentration: incubation time, <0.1 mg/mL: 15 min; 0.1–0.5 mg/mL: 30 min; 0.5–0.9atgtctaaacaaatcgaagtaaac mg/mL: 45 min; >1 mgTGC/mL:tctaatgagacc 1 h). Note:ggtggcggttcaggcggcggatcaThe rotating speedcaggtccagctgcagcagt must be sufficient to maintain thectggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggttacccatccactcgcttctacatcta gels in suspension. Adjust the rotating speed to not settle the gels and to perfectly mix the gels toctgggtgaagcagagccacggaaagagccttgagtggattggaaatattgatccttacaatggtggtactacctacaaccag proteins. aagttcaagggcaaggccacattgactattgacaagtcctccaccacagcctacgtgcatctcaacagcctgacatctgagga 3. Place an empty spin column in a new tube. Apply the sample with gel, and centrifuge at 1000 rpm ctctgcagtctattactgtgcaggatttcattactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgt tgcHchain for 1 min. Note:ttcctcggccaaaacgacacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctgggaThe collected flow-through is the reduced protein. 4. Prepare a 10 mMtgcctggtcaagggctatttccctgagccagtgacagtgacctggaactctggatccctgtccagcggtgtgca TAMRA-maleimide dye stock solution using 10% DMSO. caccttccca 5. Add a volumegctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacctggcccagcgagaccgtcacctgc of dye stock solution to result in a molar ratio of 20 dyes per Fab. Incubate aacgttgcccacccggccagcagcaccaaggtggacaagaaaattgtgcccagggattgtggggggggttctgactacaa the reaction solution at RT for 2 h or at 4 ◦C for 16 h. CRITICAL STEP the sample needs protectionggacgacgatgacaagtaataa from light.

atgtctaaacaaatcgaagtaaacTTTtctaatgagaccggtggcggttcaggcggcggatcacaggtccagctgcagcagt ctggacctgagctggtgaagcctggggcttcagtgaaggtatcctgcaaggcttctggttacccatccactcgcttctacatcta ctgggtgaagcagagccacggaaagagccttgagtggattggaaatattgatccttacaatggtggtactacctacaaccag aagttcaagggcaaggccacattgactattgacaagtcctccaccacagcctacgtgcatctcaacagcctgacatctgagga tttHchain ctctgcagtctattactgtgcaggatttcattactccggccagttggataccgatgtctggggcgcagggaccaaggtcaccgt ttcctcggccaaaacgacacccccatctgtctatccactggcccctggatctgctgcccaaactaactccatggtgaccctggga tgcctggtcaagggctatttccctgagccagtgacagtgacctggaactctggatccctgtccagcggtgtgcacaccttccca gctgtcctgcagtctgacctctacactctgagcagctcagtgactgtcccctccagcacctggcccagcgagaccgtcacctgc aacgttgcccacccggccagcagcaccaaggtggacaagaaaattgtgcccagggattgtggggggggttctgactacaa ggacgacgatgacaagtaataa

atgtctaaacaaatcgaagtaaacTGCtctaatgagaccggtggcggttcaggcggcggatcagatattgttatgacccagtc tccagcattcatgtctgcatctcctggggagaaggtcaccttgacctgcagtgccagctcaagtgtaagttccaccttcttgtact tgcLchain ggtaccagcagaagccaggatcctcccccaaactctggatttatagcacatccaacctggcttctggagtcccttctcgcttcag tggcagtgggtctgggacctcttactctctcacaatcaacagcatggaggctgaagatgctgcctcttatttctgccatcagtgg agtaattacccattcacgttcggaagtgggaccaagctggaaatcaaacgtgctgatgctgcaccaactgtatccatcttccca

Methods Protoc. 2020, 3, 43 10 of 15

3.5. Purification of Q-body (Time for Completion: 1–2 Days) Methods Protoc. 2020, 3, x FOR PEER REVIEW 5 of 15 1. Note: Use anti-Flag tag (DYKDDDDK) antibody immobilization beads to purify DYKDDDDK µ 3. Proceduretagged Q-bodies by the competitive elution of DYKDDDDK peptide. Prepare 20 L (beads net volume 10 µL) of bead slurry to a tube and centrifuge at 5000 g for 1 min. × 2.3.1. DNAAfter C removingloning (Time the for supernatant, Completion: prewash14 Days) the beads three times by using 500 µL of PBS. 3. Add fluorescent dye-labeled Fab sample into a tube of prewashed beads and mix by rotator at To construct a DNA for generating a heavy (H) chain-labeled Fab-type Q-body (H1L0), the 4 C for 16 h. pUQ1H◦ vector on which a Cys-tag (MSKQIEVNCSNETG) is encoded at the N-terminus of the H 4. Centrifuge the beads at 5000 g for 1 min and remove the supernatant. chain of anti-MA Fab. To construct× a DNA sequence for generating a light (L)-chain labeled Fab-type 5. Add 500 µL of PBS, centrifuge the beads at 5000 g for 1 min, and remove the supernatant. Repeat Q-body (H0L1), the pUQ1L vector on which a Cys-tag× is encoded at the N-terminus of the L chain of this step three times. Troubleshooting: If there is a loss of beads while removing the supernatant, Fab. In parallel, to construct a DNA for generating H and L chains-labeled Fab-type Q-body (H1L1), use an empty spin column, which was used for step 3.4. the pUQ2 vector on which two Cys-tags are encoded at the N-terminus of H and L chains of Fab. 6. Add 100 µL of 150 µg/mL DYKDDDDK peptide solution in PBS into a tube of step 6, and mix by 3.1.1.rotator Construction at 4 ◦C of for H1L0 1 h. -Type Anti-MA Q-body Expression Gene 7. Centrifuge the beads at 5000 g for 1 min and transfer the supernatant into a new tube. Store 1. Prepare 10 M diluted DNA ×primer solutions by mixing 10 L of 100 M primer stock with 90 the recovered supernatant at 4 ◦C. L ultrapure water. The primer sequences for inserting the anti-MA Fab DNA sequences with 8. Prepare the His-binding column by packing 50 µL of His-beads into empty spin column followed the N-terminal Cys-tag into a pUQ1H is Fw-primer for the H chain of Fab (Fd): ProxNdeBack by applying 5 CV of PBS. (AAGGAGATATACAtATGTCTAAACAAATCGAAG), Rv-primer for Fd: CH1ForOverlap 9. Apply the sample from Step 7 to the column, close the cap of the column, and allow it to bind to (ATATCTCCTTCTAGATTATTACTTGTCATCGTCG), Fw-primer for Lch: OverlapProxBack the beads for 1 h at 25 C by gently stirring it with a rotator. (TCTAGAAGGAGATATCACATGTCTAAACAAATCGAAG),◦ and Rv-primer for Lch: 10. CPassLforBamHI through ( theCTTGTAGTCGGATCCTTATTAATGATGATGATGATGATGAG column by gravity flow and wash the beads by applying 5 CV of) His-washing 2. Preparebuffer to reaction the column. mix in Drain ice as the follows buffer. for Repeat amplify thising step H three chain times. of MeM9: 5 L of dNTPs, 1 L of 11. 10Stop M the Fw flow-primer and add for applyFd, 1 1.5L CVof 10 of His-elutionM Rv-primer buff er.for AgitateFd, 50 theng resinDNAby template gentlystirring (tgcHchain) it for 1(Table h at 25 1)◦, C.3  StartL of MgSO the flow4, 5 and L of collect Enzyme the elution.buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure 12. waterExchange up to the 50 bu Lff.er to PBS using a 3 k MWCO Centricon centrifugal ultrafilter. Add the eluted 3. Preparesample inreaction the top mix part in of ice the as filter. follows Centrifuge for amplify at 10,000ing L rpm chain until of theMeM9: volume 5 L of of sample dNTPs is, 0.11 L mL. of 13. 10Loading M ProxNdeBack 0.5 mL of PBS, 1  andL of centrifuge10 M CLforBamHI at 10,000 rpm, 50 ng until DNA the template 0.1 mL of(tttLchain) sample are (Table remaining. 1) 3 L ofRepeat MgSO this4, 5step L of three Enzyme times. buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure water up to 50 14. RecoverL. the buffer exchanged protein from the membrane, use a 200 µL pipette tip, and insert 4. Combinethe tip in each the bottom mixture of in the ice filter in 0.2 unit. mL PCR tube, mix gently and centrifuge briefly (1 s, RT). CRITICALCRITICAL STEP STEP It isFailure important to wash to use theDNA unreacted polymerase free with dye proofreading may result activity in high to minimizebackground DNA fluorescence. amplification error. 15.5. UseCheck the the following labeling conditions efficiency andto amplify purity withthe DNA 10 µL fragments: of sample by94 running°C for 2 min, an SDS-PAGE [98 °C for followed 10 s, Tm forby scanning30 s, 68 °C the for gel 30 usings] × 35, a fluorescencehold at 25 °C scanner.. 16.6. PrepareDilute the a 1.5 dialyzed% (wt/vol) protein agarose to 1gel mg in/mL TAE using buffer PBS (40 with mM 15%Tris, glycerol.20 mM acetic Prepare acid aliquotsand 1 mM of EDTA)the samples, with Midori freeze themGreen on DNA dry Gel ice, andStain lyophilize. diluted 1:20,000 Store the(5  samplesL of dye at in 18000◦ mLC. of TAE). 7. Mix 3 L of the PCR product with 0.6 L of 5 × gel loading dye and separate− by running the gel 3.6. Fluorescenceat 15 V/cm Measurementsfor 30 min. Load (Time 3  forL of Completion: 1 kb Plus 1DNA Day) ladder on the same gel. Then, visualize the 1. DNATo evaluate fragments the quenchingusing a gel capacity, imaging mixsystem. 2 nM The Q-body expected and PCR 250 µ productL of PBST size or for denaturant H chain is (7 800 M bpGdnHCl and for and L chain 100 mM is 7 DTT)77 bp. in quartz microcuvette. 8. Use a NucleoSpin PCR Clean-Up kit according to the manufacturer’s instructions to purify the 2. Measure the emission intensity with excitation at 546 nm using an FP-8500 spectrofluorometer. PCR products. 3. To measure the antigen-dependent fluorescence response of Q-body, mix 2 nM Q-body and 250 µL 9. Measure the DNA concentration using UV absorbance on a spectrophotometer (Nanodrop) of PBST in a cuvette, and add various concentrations of 3-[(2S)-2-(methylamino)propyl]phenol, 10. Prepare reaction mix in ice as follows for combine H chain and L chain: 5 L of dNTPs, 1 L of phenethylamine, or methoxyphenamine in 2 µL of PBST for titration to give final concentrations 10 M Fw-primer for Fd, 1 L of 10 M Rv-primer for Lch, 50 ng purified H chain 50 ng purified of 0 to 104 µg/mL. As a control, add the same volume of PBST to normalize the signal. L chain, 3 L of MgSO4, 5 L of Enzyme buffer, 1 L of KOD-Plus Neo enzyme, and ultrapure 4. Measure the emission intensity with excitation at 546 nm using an FP-8500 spectrofluorometer. water up to 50 L. 5. Draw fluorescence titration curves at the emission maxima of each spectrum using KaleidaGraph 11. To ligate the combined Fab fragment into the pUQ1H vector, digest the pUQ0H1L(DON)[15] 4.5 (Synergy Software, Reading, PA, USA). with NdeI and BamHI restriction enzymes using the following mixture: 1 g DNA, 5 L NEB CutSmart Buffer (10 ×), 1 L of NdeI-HF (20 U), 1 L of BamHI-HF (20 U), and ultrapure water up to 50 L. After that, incubate the digestion mixture at 37 °C for 1 h. Cool the mixture to 4 °C . 12. Separate the digested pUQ1H DNA vector using a 0.7% (wt/vol) agarose gel at 15 V/cm for 30 min. The expected DNA size for pUQ1H vector is 5404 bp. 13. Extract the desired band and purify it using a NucleoSpin Gel Clean-Up Kit according to the manufacturer’s instructions.

MethodsMethods Protoc.Protoc. 20202020,,3 3,, 43x FOR PEER REVIEW 1111 ofof 1515 Methods Protoc. 2020, 3, x FOR PEER REVIEW 11 of 15 4. Results and Discussion 44.. Results Results and and Discussion Discussion The anti-MA scFv gene M9 used in this study was originally cloned and affinity-matured by G. The anti-MA scFv gene M9 used in this study was originally cloned and affinity-matured by G. Georgiou’sThe anti-MA group scFv[17]. geneSince M9this used anti-MA in this antibody study washad originallythe same number cloned andof Trp affi residuesnity-matured in both by the G. Georgiou’s group [17]. Since this anti-MA antibody had the same number of Trp residues in both the Georgiou’sheavy chain group variable [17 (].VH Since) and this light anti-MA chain variable antibody (VL had) domains the same (three number Trp residues of Trp residuesin each domain), in both heavy chain variable (VH) and light chain variable (VL) domains (three Trp residues in each domain), thewe constructed heavy chain three variable different (VH) DNA and lightgenes chain with variabledifferent (VL)sites domainsfor fluorophore (three- Trplabeling residues: close in to each the we constructed three different DNA genes with different sites for fluorophore-labeling: close to the domain),H chain, weto the constructed L chain, or three to both different the chains. DNA genes We inserted with diff aerent Cys- sitestag for for conjugating fluorophore-labeling: a dye at the close N- H chain, to the L chain, or to both the chains. We inserted a Cys-tag for conjugating a dye at the N- toterminal the H chain,regions to of the the L H chain, and L orchain to boths (Figure the chains.2). The anti We- insertedMA Fab agene Cys-tag with fora single conjugating Cys-tag aat dye the terminal regions of the H and L chains (Figure 2). The anti-MA Fab gene with a single Cys-tag at the atN- theterminal N-terminal region regions of the ofH/L the chain H and was L chainscloned (Figure into the2). pUQ1H/pUQ1L The anti-MA Fab vector. gene withSimilarly, a single we N-terminal region of the H/L chain was cloned into the pUQ1H/pUQ1L vector. Similarly, we Cys-taggenerated at thea gene N-terminal for a double region-dye of the-labeled H/L chain Q-body was with cloned two into Cys the-tags pUQ1H at the/pUQ1L N-terminal vector. regions Similarly, of generated a gene for a double-dye-labeled Q-body with two Cys-tags at the N-terminal regions of weboth generated the H and a L gene chain fors. a double-dye-labeled Q-body with two Cys-tags at the N-terminal regions of bothboth the the H H and and L L chain chains.s.

Figure 2. Schematic representations of Q-body expression genes with different fluorescent dye- FigureFigure 2. 2. SchematicSchematic representations representations of Q of-body Q-body expression expression genes genes with with different diff erent fluorescent fluorescent dye- binding sites. bindingdye-binding sites. sites. Previously,Previously, thethe VH and VL VL gene geness of of clone clone M9 M9 had had been been codon codon-optimized-optimized and and subcloned subcloned into into the Previously, the VH and VL genes of clone M9 had been codon-optimized and subcloned into the thepROX pROX vector vector to generate to generate a cell a cell-free-free transcription transcription-translation-translation system system-based-based anti anti-MA-MA Q- Q-bodybody with with a pROX vector to generate a cell-free transcription-translation system-based anti-MA Q-body with a afluorophore fluorophore located located at atthe the N- N-terminalterminal region region of the of the H chain H chain [pROX1H [pROX1H(MeM9)](MeM9)] [9]. [In9]. this In thisstudy, study, the fluorophore located at the N-terminal region of the H chain [pROX1H(MeM9)] [9]. In this study, the theDNA DNA was subcloned was subcloned into pUQ1H into pUQ1H,, pUQ1L pUQ1L,, and pUQ2 and pUQ2to express to express each Fab each in the Fab cytoplasm in the cytoplasm of E. coli DNA was subcloned into pUQ1H, pUQ1L, and pUQ2 to express each Fab in the cytoplasm of E. coli of[8].E. The coli anti[8].-MA The Fabs anti-MA were Fabsexpressed were in expressed soluble form in soluble and then form purified and then by immobilized purified by metal immobilized affinity [8]. The anti-MA Fabs were expressed in soluble form and then purified by immobilized metal affinity metalchromatography affinity chromatography (IMAC) via the (IMAC) His-tag vias. After the His-tags. a mild reduction After a mild of th reductione cysteine of thiol the cysteine group of thiol the chromatography (IMAC) via the His-tags. After a mild reduction of the cysteine thiol group of the groupCys-tag, of a the maleimide Cys-tag,-conjugated a maleimide-conjugated fluorescent dye fluorescent was conjugated dye was to the conjugated reduced tothiol the group reduced utilizing thiol Cys-tag, a maleimide-conjugated fluorescent dye was conjugated to the reduced thiol group utilizing groupthe maleimide utilizing- thethiol maleimide-thiol reaction (Figure reaction 3). Next (Figure, the 3Q).-bodies Next, the were Q-bodies tandem werely purified tandemly by purifiedIMAC and by the maleimide-thiol reaction (Figure 3). Next, the Q-bodies were tandemly purified by IMAC and IMACanti-Flag and affinity anti-Flag beads affi tonity remove beads the to removeexcess free the dyes excess. The free Q dyes.-bodies The were Q-bodies then used were for then fluorescence used for anti-Flag affinity beads to remove the excess free dyes. The Q-bodies were then used for fluorescence fluorescencemeasurements measurements in the presen ince theof denaturant presence of or denaturant antigen. or antigen. measurements in the presence of denaturant or antigen.

Figure 3. (a) Scheme for the construction of Fab type Q-body from Escherichia coli. Q-body with both Figure 3. (a) Scheme for the construction of Fab type Q-body from Escherichia coli. Q-body with both FigureH- and 3. L-chain (a) Scheme labeling for the sites construction is represented. of Fab Fab type is Q expressed-body from in EscherichiaE. coli cytoplasm coli. Q- andbody purified with both by H- and L-chain labeling sites is represented. Fab is expressed in E. coli cytoplasm and purified by HIMAC- and viaL-chain His-tag. labeling After sites mild is reductionrepresented. of the Fab exposed is expressed SH group in E. ofcoli N-terminal cytoplasm Cys-tag, and purified the dyes by IMAC via His-tag. After mild reduction of the exposed SH group of N-terminal Cys-tag, the dyes are IMACare conjugated via His-tag. and After unbound mild reduction dyes are eliminated;of the exposed (b) SH schematic group of representation N-terminal Cys of-tag, maleimide-thiol the dyes are conjugated and unbound dyes are eliminated; (b) schematic representation of maleimide-thiol conjugatedreaction-based and conjugating unbound dyes method are for elimin labelingated; a Fab (b) with schematic a fluorescent representation dye. of maleimide-thiol reaction-based conjugating method for labeling a Fab with a fluorescent dye. reaction-based conjugating method for labeling a Fab with a fluorescent dye. Our previous study utilizing a Fab-type Q-body against bone Gla protein (BGP) showed that Our previous study utilizing a Fab-type Q-body against bone Gla protein (BGP) showed that the the diOurfferences previous in linkerstudy utilizing length between a Fab-type the maleimideQ-body against and Cys-tagbone Gla aff proteinected the (BGP) fluorescent showed response that the differences in linker length between the maleimide and Cys-tag affected the fluorescent response of differenceof the Q-bodys in linker in the length presence between of antigen the maleimide [8]. Based and on Cys these-tag results, affected we the varied fluorescent the spacer response length of the Q-body in the presence of antigen [8]. Based on these results, we varied the spacer length between thebetween Q-body the in dyethe presen and maleimide:ce of antigen TAMRA-CO-maleimide [8]. Based on these results, (C0), we varied TAMRA-C2-maleimide the spacer length between (C2), or the dye and maleimide: TAMRA-CO-maleimide (C0), TAMRA-C2-maleimide (C2), or TAMRA-C5- theTAMRA-C5-maleimide dye and maleimide:(C5) TAMRA (Figure-CO4a).-maleimide We evaluated (C0), the TAMRA maximum-C2-maleimide degree of quenching (C2), or TAMRA (quenching-C5- maleimide (C5) (Figure 4a). We evaluated the maximum degree of quenching (quenching capacity) maleimidecapacity) of (C5) each (Fig Q-bodyure 4a by). measuringWe evaluated the fluorescencethe maximum intensities degree of in quenching the presence (quenching of a denaturant capacity) (7 M of each Q-body by measuring the fluorescence intensities in the presence of a denaturant (7 M ofguanidine each Q- hydrochloridebody by measuring and 100 the mM fluorescence dithiothreitol) intensities and normalizing in the presenthe valuesce of against a denaturant those obtained (7 M guanidine hydrochloride and 100 mM dithiothreitol) and normalizing the values against those guanidine hydrochloride and 100 mM dithiothreitol) and normalizing the values against those obtained under the non-denatured condition (PBST added instead of the denaturant). The responses obtained under the non-denatured condition (PBST added instead of the denaturant). The responses

Methods Protoc. 2020, 3, 43 12 of 15

Methods Protoc. 2020, 3, x FOR PEER REVIEW 12 of 15 under the non-denatured condition (PBST added instead of the denaturant). The responses of theof the denatured denatured Q-bodies Q-bodies werewere 1.561.56 ± 0.030.03-,-, 1.19 1.19 ± 0.150.15-,-, 0.73 0.73 ± 0.380.38-,-, 2.48 2.48± 0.26-,0.26-, 2.80 ± 2.80 0.24-, 5.130.24-, ± ± ± ± ± ± 5.130.79-, 2.350.79- ±, 0.36 2.35-, 3.670.36-, ± 0.68 3.67-, and0.68-, 2.31 and ± 2.310.33-fold0.33-fold for the for C0 the-labeled C0-labeled H, C0 H,-labeled C0-labeled L, C0 L,-labeled C0-labeled HL, ± ± ± ± HL,C2-labeled C2-labeled H, C2 H,-labeled C2-labeled L, C2 L,- C2-labeledlabeled HL, HL, C5 C5-labeled-labeled H, H, C5 C5-labeled-labeled L, L, and and C5 C5-labeled-labeled HL, respectivelyrespectively (Figure(Figure4 b,c).4b and For 4c the). For C2-linker, the C2- thelinker responses, the response of twos singleof two dye-labeled single dye- Q-bodieslabeled Q (H-bodies and L)(H wereand L) similar, were andsimilar, these and values thes weree values approximately were approximately two times lowertwo times than lower for the than double for dye-labeledthe double Q-bodydye-labeled (HL), Q- asbody estimated (HL), as based estimated on the based same on number the same of numb Trp residueser of Trp in residues the VH in and the VL VH domains. and VL Thedomains C0/C5-linker. The C0/C5 Q-bodies-linker didQ-bodies not show did this not trend. show Although this trend the. Although three-dimensional the three- structuresdimensional of thesestructures Q-bodies of these have Q- notbodies been have determined, not been determined we can state, we that can the state optimal that positionthe optimal of dyes position around of dyes the Trparound residues the Trp affects residues the degree affects of the quenching. degree of Wequenching. estimated W thate estimate the C0d linker that the was C0 too linker short was to staytoo closeshort toto thestay Trp close residues to the inTrp VH residue as wells in as VH in VL. as well However, as in VL the. C2However and C5, linkersthe C2 and were C5 a suitablelinkers were length a tosuitable increase length the quenchingto increase capacity.the quenching capacity.

Figure 4. (A) Chemical structures of TAMRA-C0-maleimide, TAMRA-C2-maleimide, Figure 4. (a) Chemical structures of TAMRA-C0-maleimide, TAMRA-C2-maleimide, and TAMRA- and TAMRA-C5-maleimide; (B) fluorescence intensities of Q-bodies in the presence of denaturants (7 M C5-maleimide; (b) fluorescence intensities of Q-bodies in the presence of denaturants (7 M guanidine guanidine hydrochloride and 100 mM dithiothreitol) or PBST. Error bars represent 1 SD (n = 3); (C) hydrochloride and 100 mM dithiothreitol) or PBST. Error bars represent ±1 SD (n = 3);± (c) normalized normalized fluorescence intensities of each Q-body, which were calculated by dividing the maximum fluorescence intensities of each Q-body, which were calculated by dividing the maximum fluorescence intensity in the presence of denaturants by the maximum in the presence of PBST. Error fluorescence intensity in the presence of denaturants by the maximum in the presence of PBST. Error bars represent 1 SD (n = 3). bars represent ±±1 SD (n = 3). The double TAMRA-C2-maleimide labeled Q-body had the highest quenching capacity and was The double TAMRA-C2-maleimide labeled Q-body had the highest quenching capacity and was used for testing the antigen dose-dependency. Since MA is an illicit drug, it was not generally available. used for testing the antigen dose-dependency. Since MA is an illicit drug, it was not generally Therefore, we used 3-[(2S)-2-(methylamino)propyl]phenol as a surrogate since the only structural available. Therefore, we used 3-[(2S)-2-(methylamino)propyl]phenol as a surrogate since the only difference was the addition of a hydroxyl group on the benzene ring (Figure5a). The fluorescence of structural difference was the addition of a hydroxyl group on the benzene ring (Figure 5a). The the double TAMRA C2-labeled Q-body was measured at different concentrations (0.1 to 104 µg/mL) fluorescence of the double TAMRA C2-labeled Q-body was measured at different concentrations (0.1 of 3-[(2S)-2-(methylamino)propyl]phenol. The fluorescence intensity increased to 4.40 0.12- fold at to 104 µg/mL) of 3-[(2S)-2-(methylamino)propyl]phenol. The fluorescence intensity increased± to 4.40 104 µg/mL of 3-[(2S)-2-(methylamino)propyl]phenol, similar to the fluorescence intensity in the presence ± 0.12- fold at 104 µg/mL of 3-[(2S)-2-(methylamino)propyl]phenol, similar to the fluorescence of denaturant (Figures4c and5b). This indicated that the dye was almost completely de-quenched intensity in the presence of denaturant (Figure 5b and 4c). This indicated that the dye was almost by the antigen. This data suggested that the fluorescence dye was successfully incorporated into completely de-quenched by the antigen. This data suggested that the fluorescence dye was the antigen-binding domain of the Fab fragment and displaced by antigen, and that quenching was successfully incorporated into the antigen-binding domain of the Fab fragment and displaced by removed in an antigen-concentration-dependent manner. antigen, and that quenching was removed in an antigen-concentration-dependent manner.

Methods Protoc. 2020, 3, 43 13 of 15 Methods Protoc. 2020, 3, x FOR PEER REVIEW 13 of 15

Figure 5. (a) Chemical structures of methamphetamine, 3-[(2S)-2-(methylamino)propyl]phenol, phenethylamine,Figure 5. (a) Chemical and methoxyphenamine; structures of methamphetamine, (b) normalized 3 fluorescence-[(2S)-2-(methylamino)propyl]phenol, intensities of double TAMRA-C2-maleimide-labeledphenethylamine, and methoxyphenamine; Q-bodies in ( theb) normalized presence of fluorescence 3-[(2S)-2-(methylamino)propyl]phenol, intensities of double TAMRA- phenethylamine,C2-maleimide-labeled or methoxyphenamine Q-bodies in at the the indicated presence concentrations. of 3-[(2S)-2- Methamphetamine(methylamino)propyl]phenol, itself was notphenethylamine, used for generating or methoxyphenamine the titration curve because at the indicated illicit drug concentrations. was not available Methamphetamine for use in our laboratory. itself was Thenot normalized used for generating fluorescence the intensity titration of eachcurve sample because based illicit on drug the fluorescence was not available intensity for at zero-dose use in our was plotted. Error bars represent 1 SD (n = 3). laboratory. The normalized fluorescence± intensity of each sample based on the fluorescence intensity at zero-dose was plotted. Error bars represent ±1 SD (n = 3). In our previous study, a single labeled Fab-type Q-body was generated through a cell-free translation and transcription system. The resultant Ultra Q-body showed MA-dependent fluorescence In our previous study, a single labeled Fab-type Q-body was generated through a cell-free increases up to 7.2-fold [8]. The lower response of the Q-bodies generated in this study may reflect translation and transcription system. The resultant Ultra Q-body showed MA-dependent the differences in the dye conjugation method. The previously published cell-free based Q-body fluorescence increases up to 7.2-fold [8]. The lower response of the Q-bodies generated in this study was generated with a TAMRA-tRNA conjugated to the amber-tag with the (GlySer) linker on may reflect the differences in the dye conjugation method. The previously published cell2 -free based the N-terminus of the H chain. Therefore, the distance between the dye and Trp was not the same Q-body was generated with a TAMRA-tRNA conjugated to the amber-tag with the (GlySer)2 linker as that of the TAMRA-C2-maleimide-labeled Q-body. As a primary reason for the higher EC of on the N-terminus of the H chain. Therefore, the distance between the dye and Trp was not the50 same this double-labeled Q-body than the value of the single-labeled Q-body [8], we think that the dye-dye as that of the TAMRA-C2-maleimide-labeled Q-body. As a primary reason for the higher EC50 of this stacking occurred between the two dyes, resulting in the need of high concentration of antigen for double-labeled Q-body than the value of the single-labeled Q-body [8], we think that the dye-dye de-quenching [10–12]. Additionally, we removed the cysteine residues at the C-terminal of the Fd and stacking occurred between the two dyes, resulting in the need of high concentration of antigen for L chains, which are used for the disulfide bond between them, to increase the efficiency of site-specific de-quenching [10–12]. Additionally, we removed the cysteine residues at the C-terminal of the Fd labeling at the cysteine of the Cys-tag. This could have caused the Q-body to have somewhat lower and L chains, which are used for the disulfide bond between them, to increase the efficiency of site- antigen affinity and resultant lower sensitivity. Although the fluorescence response and sensitivity specific labeling at the cysteine of the Cys-tag. This could have caused the Q-body to have somewhat were lower than the cell-free based one, the E. coli-based approach for constructing Q-bodies have lower antigen affinity and resultant lower sensitivity. Although the fluorescence response and several advantages. First, the yield of Q-body produced by E. coli is higher than the cell-free system. sensitivity were lower than the cell-free based one, the E. coli-based approach for constructing Q- Better yield increases cost efficiency, which is one of the major obstacles for the large-scale production bodies have several advantages. First, the yield of Q-body produced by E. coli is higher than the cell- of Q-bodies for practical applications. The expression of recombinant antibody fragments in E. coli has free system. Better yield increases cost efficiency, which is one of the major obstacles for the large- a higher yield than hybridoma-based production of full-sized antibodies, and such an inexpensive scale production of Q-bodies for practical applications. The expression of recombinant antibody bacterial production may result in lower product costs. Thus, this concept holds promise as a general fragments in E. coli has a higher yield than hybridoma-based production of full-sized antibodies, and strategy for the development of a commercially available biosensor. Second, the maleimide-conjugated such an inexpensive bacterial production may result in lower product costs. Thus, this concept holds dye is less expensive to synthesize than the tRNA-conjugated dye, and has a wider range of colors. promise as a general strategy for the development of a commercially available biosensor. Second, the The wider range of multi-color labels for Q-bodies provides greater flexibility in developing multi-plex maleimide-conjugated dye is less expensive to synthesize than the tRNA-conjugated dye, and has a drug screening kits. Finally, to test the cross-reactivity of anti-MA Q-body against other MA derivatives, wider range of colors. The wider range of multi-color labels for Q-bodies provides greater flexibility we used phenethylamine and methoxyphenamine. These chemicals have fewer structural similarities in developing multi-plex drug screening kits. Finally, to test the cross-reactivity of anti-MA Q-body to those of MA than 3-[(2S)-2-(methylamino)propyl]phenol. The anti-MA Q-body exhibited a negligible against other MA derivatives, we used phenethylamine and methoxyphenamine. These chemicals response in the presence of phenethylamine or methoxyphenamine. The lack of response indicates have fewer structural similarities to those of MA than 3-[(2S)-2-(methylamino)propyl]phenol. The that there is no cross-reactivity to other MA derivatives, which suggests that the anti-MA Q-body has anti-MA Q-body exhibited a negligible response in the presence of phenethylamine or a high MA selectivity (Figure5). methoxyphenamine. The lack of response indicates that there is no cross-reactivity to other MA We produced an E. coli-based Q-body against a hydroxyl MA derivative with the goal of developing derivatives, which suggests that the anti-MA Q-body has a high MA selectivity (Figure 5). a fast and convenient on-site MA screening kit. In particular, we focused on the number and position of We produced an E. coli-based Q-body against a hydroxyl MA derivative with the goal of fluorescent dyes with different linker lengths to produce a Q-body with an optimized response range. developing a fast and convenient on-site MA screening kit. In particular, we focused on the number In addition, the Q-body reported here is highly selective to 3-[(2S)-2-(methylamino)propyl]phenol. and position of fluorescent dyes with different linker lengths to produce a Q-body with an optimized The major advantage of the Q-body is that the test takes a few minutes of incubation followed by response range. In addition, the Q-body reported here is highly selective to 3-[(2S)-2- the fluorescence measurement. It is a single step test with no need for multiple incubation and washing (methylamino)propyl]phenol. The major advantage of the Q-body is that the test takes a few minutes of incubation followed by the fluorescence measurement. It is a single step test with no need for

Methods Protoc. 2020, 3, 43 14 of 15 steps, like those required for other conventional immunoassays such as ELISA. Therefore, this anti-MA Q-body has potential as a reagent in a drugs-of-abuse analysis platform when used in conjunction with a portable fluorophotometer. This type of rapid and simple assay tool may be useful in a range of areas, such as drug screening at the workplace, multiplexed point-of-care testing for simultaneous on-site detection of various stimulant drugs including cocaine, morphine, and suspicious substance identification, and monitoring patients during drug rehabilitation. Additionally, the Cys-tag-based Q-body-synthesis method reported in this study can be applied to the generation of Q-bodies of interest by fusing fluorescence dye to antibodies in a number of different antibody formats.

Author Contributions: Conceptualization, H.-J.J. and H.U.; methodology, H.-J.J., J.D. and H.U.; formal analysis, H.-J.J. and J.D.; investigation, H.-J.J., J.D., and H.U.; data curation, H.-J.J. and C.-H.Y.; writing—original draft preparation, H.-J.J. and C.-H.Y.; writing—review and editing, J.D. and H.U.; supervision, H.U.; project administration, H.U.; funding acquisition, H.-J.J., J.D., and H.U. All authors have read and agreed to the published version of the manuscript. Funding: H.U. was funded by JSPS KAKENHI Grant Numbers JP18H03851 from the Japan Society for the Promotion of Science, Japan, and by JST-Mirai Grant Number JPMJMI18D9 from Japan Science and Technology Agency, Japan. J.D. was funded by the National Natural Science Foundation of China, grant number: 21775064, Natural Science Foundation of Shandong Province, grant number: ZR2017MB037. H.-J.J. was funded by the NRF grant funded by the Korean government (MSIT), grant number: 2018R1C1B5044988, and the 2020 Hongik University Research Fund, Korea. Acknowledgments: We thank Ryoji Abe and Hiroyuki Ohashi for providing pROX1H(MeM9) plasmid. We thank the Biomaterials Analysis Division, Technical Department, Tokyo Institute of Technology for DNA sequence analysis, and the support by Dynamic Alliance for Open Innovation Bridging Human, Environment and Materials from MEXT, Japan. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Barr, A.M.; Panenka, W.J.; MacEwan, G.W.; Thornton, A.E.; Lang, D.J.; Honer, W.G.; LeComte, T. The need for speed: An update on methamphetamine addiction. J. Psychiatry Neurosci. 2006, 31, 301–313. 2. E Albertson, T.; Derlet, R.W.; E Van Hoozen, B. Methamphetamine and the expanding complications of amphetamines. West. J. Med. 1999, 170, 214–219. 3. Harper, L.; Powell, J.; Pijl, E.M. An overview of forensic drug testing methods and their suitability for harm reduction point-of-care services. Harm Reduct. J. 2017, 14, 52. [CrossRef][PubMed] 4. Xiong, Y.; Chen, X.; Chen, Y. Development of a colloidal gold immuno-chromatography assay to detect methamphetamine. Wei sheng yan jiu = J. Hyg. Res. 2010, 39, 120–122. 5. Miyaguchi, H.; Iwata, Y.T.; Kanamori, T.; Tsujikawa, K.; Kuwayama, K.; Inoue, H. Rapid identification and quantification of methamphetamine and amphetamine in hair by gas chromatography/mass spectrometry coupled with micropulverized extraction, aqueous acetylation and microextraction by packed sorbent. J. Chromatogr. A 2009, 1216, 4063–4070. [CrossRef][PubMed] 6. Yang, C.-A.; Liu, H.-C.; Lin, D.-L.; Hsieh, Y.-Z.; Wu, S.-P. Simultaneous Quantitation of Methamphetamine, Ketamine, Opiates and their Metabolites in Urine by SPE and LC–MS-MS. J. Anal. Toxicol. 2017, 41, 679–687. [CrossRef][PubMed] 7. Choi, J.; Choi, M.J.; Kim, C.; Cho, Y.S.; Chin, J.; Jo, Y.-A. The optimization of ELISA for methamphetamine determination: the effect of immunogen, tracer and antibody purification method on the sensitivity. Arch. Pharmacal Res. 1997, 20, 46–52. [CrossRef][PubMed] 8. Abe, R.; Jeong, H.-J.; Arakawa, D.; Dong, J.; Ohashi, H.; Kaigome, R.; Saiki, F.; Yamane, K.; Takagi, H.; Ueda, H. Ultra Q-bodies: quench-based antibody probes that utilize dye-dye interactions with enhanced antigen-dependent fluorescence. Sci. Rep. 2014, 4, 4640. [CrossRef][PubMed] 9. Abe, R.; Ohashi, H.; Iijima, I.; Ihara, M.; Takagi, H.; Hohsaka, T.; Ueda, H. “Quenchbodies”: Quench-Based Antibody Probes That Show Antigen-Dependent Fluorescence. J. Am. Chem. Soc. 2011, 133, 17386–17394. [CrossRef][PubMed] 10. Schäfer, G.; Müller, M.; Häfner, B.; Habl, G.; Nolte, O.; Marmé, N.; Knemeyer, J.-P. Self-quenching DNA probes based on aggregation of fluorescent dyes. Genet. Eng. Opt. Probes Biomed. Appl. III 2005, 5704, 30–40. [CrossRef] Methods Protoc. 2020, 3, 43 15 of 15

11. Shiba, A.; Kinoshita-Kikuta, E.; Kinoshita, E.; Koike, T. TAMRA/TAMRA Fluorescence Quenching Systems for the Activity Assay of Alkaline Phosphatase. Sensors 2017, 17, 1877. [CrossRef][PubMed] 12. Ogawa, M.; Kosaka, N.; Choyke, P.L.; Kobayashi, H. H-Type Dimer Formation of Fluorophores: A Mechanism for Activatable, in Vivo Optical Molecular Imaging. ACS Chem. Boil. 2009, 4, 535–546. [CrossRef][PubMed] 13. Jeong, H.-J.; Kawamura, T.; Iida, M.; Kawahigashi, Y.; Takigawa, M.; Ohmuro-Matsuyama, Y.; Chung, C.-I.; Dong, J.; Kondoh, M.; Ueda, H. Development of a Quenchbody for the Detection and Imaging of the Cancer-Related Tight-Junction-Associated Membrane Protein Claudin. Anal. Chem. 2017, 89, 10783–10789. [CrossRef][PubMed] 14. Dong, J.; Oka, Y.; Jeong, H.; Ohmuro-Matsuyama, Y.; Ueda, H. Detection and destruction of HER2-positive cancer cells by Ultra Quenchbody-siRNA complex. Biotechnol. Bioeng. 2020, 117, 1259–1269. [CrossRef] [PubMed] 15. Yoshinari, T.; Ohashi, H.; Abe, R.; Kaigome, R.; Ohkawa, H.; Sugita-Konishi, Y. Development of a rapid method for the quantitative determination of deoxynivalenol using Quenchbody. Anal. Chim. Acta 2015, 888, 126–130. [CrossRef][PubMed] 16. Carter, J.; Petersen, B.P.; Printz, S.A.; Sorey, T.L.; Kroll, T.T. Quantitative Application for SDS–PAGE in a Biochemistry Lab. J. Chem. Educ. 2013, 90, 1255–1256. [CrossRef] 17. Harvey, B.R.; Shanafelt, A.B.; Baburina, I.; Hui, R.; Vitone, S.; Iverson, B.L.; Georgiou, G. Engineering of recombinant antibody fragments to methamphetamine by anchored periplasmic expression. J. Immunol. Methods 2006, 308, 43–52. [CrossRef][PubMed]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).