The Interaction of the Epha2 Receptor and Microglia in Glioblastoma

The Interaction of The EphA2 Receptor and Microglia in Glioblastoma

Dr Manasi Jiwrajka B.A Neuroscience (Hons.)., MBBS

0000-0003-4040-124X

A thesis submitted for the degree of Master of Philosophy at The University of Queensland in 2020 Medicine Faculty

ABSTRACT

Introduction

Glioblastoma (GBM) is the most malignant primary tumour of the central nervous system (CNS) in adults. The median survival for patients despite maximal surgical resection and chemoradiation therapy is approximately 15 months. Resident macrophages of the brain, microglia, have been implicated in promoting glioblastoma despite their immune function. Eph receptors and their corresponding ephrin ligands are tyrosine kinase receptors that promote cell invasion and proliferation in the context of tumours. However, the role of Eph receptors on microglia have not been investigated to-date.

Aim

The aim of this study is to investigate the role of microglia and the EphA2 receptor in the context of GBM by focusing on three main components: (i) Eph and ephrin expression on microglia, (ii) the functional role of EphA2 in a human microglia cell line and in co-culture with primary GBM cell line, and (iii) the expression and co-localization of EphA2 and microglia markers in patient GBM samples as they correlate to clinical demographic and outcomes.

Methods

The study utilises a variety of techniques to investigate the above-mentioned aims, especially cell culture, flow cytometry, quantitative polymerase chain reaction (qPCR) and immunohistochemistry. Microglia cytokine release, phagocytosis, migration, and proliferation were assessed using new and unique models involving microscopy. Additionally, fluorescent labelling of microglia and primary tumour cells (from intraoperative tumour specimens) allowed for novel methods of 2D and 3D coculture to be conducted. A 3D human GBM organoid model was created for the first time to observe the behaviour of both the tumour and microglia cells. Tissue microarrays were created for tumour immunohistochemistry. Iba1 was used as a microglia marker, and EphA2 antibody (both in-house and commercial) in conjunction with its high-affinity ligand, EphrinA1 was utilised for receptor activation assays. The Queensland Oncology Online (QOOL) database was used in conjunction with patient files to obtain clinical data.

Jiwrajka 2020

Results

The primary findings of this study show that a number of Eph and ephrin family members are expressed on microglia, and in particular EphA2 is highly expressed and functional on human microglia cells. EphA2 activation induced microglia cells to undergo a phenotypic change with increased proliferation and decreased migration. The opposite effect was achieved when EphA2 was down regulated using shRNA. EphA2 knockdown induced increased phagocytosis while decreased microglia proliferation. In co-culture, with primary human GBM cells, microglia promoted GBM cell growth while the proliferation rate of microglia was reduced under these conditions. To better assess the interaction of microglia with primary GBM cells a 3D organoid approach combined with optical barcoding was utilised. Results under organoid conditions highlighted a contact repulsion mechanism, where microglia rapidly segregated and encircled GBM cells. In patient GBM samples, EphA2 and the microglia marker Iba1 were co- localised, but not as frequently as expected from our in vitro studies. Interestingly, patient samples with a high level of co-localisation of EphA2 on microglia had a worse survival prognosis compared to those who have a lower co-localization level. Additionally, as predicted and validated by The Cancer Genome Atlas (TCGA) datasets, high grade GBM have a higher expression of EphA2 and Iba1 compared to low grade glioma. Patients who are IDH mutant (a positive prognostic marker), have a lower EphA2 expression. Interestingly paired patients with ‘normal’ and tumour cores demonstrated an increase in Iba1 expression in tumour samples. Paired patients who developed recurrent GBM displayed lower Iba1 expression.

Conclusion

In summary, this study has identified novel findings regarding the expression of Eph and ephrin family members on microglia and further identifies a functional role of EphA2 in mediating the proliferation and migration capabilities of microglia. This is significant in the context of GBM as microglia actively migrate to the tumour site and promote tumour growth. This study is a first of its kind and paves the way for future opportunities to target EphA2 present on microglia which may result in significant GBM anti-tumour responses.

Jiwrajka 2020

DECLARATION BY THE AUTHOR

This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, financial support and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my higher degree by research candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School.

I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis and have sought permission from co- authors for any jointly authored works included in the thesis.

iii

Jiwrajka 2020

PUBLICATIONS INCLUDED IN THE THESIS

No publications included

SUBMITTED MANUSCRIPTS INCLUDED IN THIS THESIS

No manuscripts submitted for Publication

OTHER PUBLICATIONS DURING CANDIDATURE

Pratap, K., Jiwrajka, M. Weber, L., Richardson, A 2019 “Severe Symptomatic Hyponatraemia Secondary to Bowel Preparation" BMJ Case Reports

Jiwrajka, M., Ranasinghe, S., Yaxley, W., Perera M., and Yaxley, J. 2018 “Drugs for benign prostatic hypertrophy” Australian Prescriber

Jiwrajka, M., Yaxley, W., Perera, M., Roberts, M., Dunglison, N., Yaxley, J., Esler, R. 2018 “Review and Update of Benign Prostatic Hyperplasia (BPH) in General Practice” Australian Journal of General Practice

Jiwrajka, M. Pratap, K. Yaxley, W. Dunglison, N. 2017 “Result of Health Illiteracy and Cultural Stigma: Fournier’s Gangrene, A Urological Emergency” BMJ Case Reports

Jiwrajka, M. Mahmoud, A., Uppal, M. 2017 “A Rohingya Refugee’s Journey in Australia And The Barriers To Accessing Healthcare” BMJ Case Reports

Jiwrajka, M., Biswas, S., 2016 “Why Should Students Write a Global Health Case Report?” Australian Medical Student Journal

Jiwrajka, M., Phillips, A., Butler, M., Rossi, M., Pocock, JM. 2016, “The Plant-Derived Chalcone 2,2′,5′-Trihydroxychalcone Provides Neuroprotection against Toll-Like Receptor 4 Triggered Inflammation in microglia,” Oxidative Medicine and Cellular Longevity, vol. 2016, Article ID 6301712, 10 pages. http://dx.doi.org/10.1155/2016/6301712

Jiwrajka 2020

CONTRIBUTION BY OTHERS TO THE THESIS

The cell lines HMC3 and BV2 were donated by Prof Glen Boyle and Prof Peter Parsons.

The PLVX virus used to transfect microglia cells with synthetic proteins was designed by Dr Seckin Akgul.

Tissue Microarrays were created by Ms Crystal Chang from QIMR Histology department. Immunohistochemistry staining was performed with the assistance of Ms Crystal Chang and Mr Clay Winterford. from the QIMR Histology department.

All microscopy was with the assistance of Dr Tam Hong Nguyen from the QIMR Flow Cytometry and Imaging Department.

The organoid matrix was created by Dr Ulrich Baumgartner.

FACS sorting was performed by Dr Amanda Stanley from the QIMR Flow Cytometry and Imaging Department.

Statistical analysis on the tumour bank was performed with the assistance of Ms. Anita Pelecanos from the QIMR Statistics Department.

Jiwrajka 2020

STATEMENT OF PARTS OF THE THESIS SUBMITTED TO QUALIFY FOR THE AWARD OF ANOTHER

DEGREE

None

Jiwrajka 2020

RESEARCH INVOLVING HUMAN OR ANIMAL SUBJECTS

HREC/17/QRBW/577 Novel Therapies for Brain Cancer approved by the RBWH HREC

vii

Jiwrajka 2020

ACKNOWLEDGEMENTS

Firstly, I would like to sincerely thank Prof Bryan Day for agreeing to supervise this project, and for his support throughout.

My sincere thanks to my review panel who provided feedback at each milestone: Prof Glen Boyle, Dr Adrian Wiegmans and Dr Hamish Alexander.

Dr Tam Nguyen, Ms Crystal Chang, Mr Clay Winterford and Ms Anita Pelecanos, thank you for your considerable assistance, time, and teaching.

I would also like to acknowledge the wonderful scientists of the Sid Faithfull Cancer Laboratory who helped me with every Western Blot that went wrong and cheered me on when an experiment worked. In particular, I would like to thank Dr Rochelle D’Souza, Dr Ulrich Baumgartner, Dr Seckin Akgul, Dr Caroline Offenhauser, Ms Michelle Li, Ms Fiona Smith, and Ms Anja Kordowski.

Dr Rochelle D’Souza and Dr Mariska Miranda, thank you for keeping me sane throughout with coffee, Nutella cake and sharing your lunches with me.

Shelley, Christina, Maneeta, Ahmad, Gabi, Ravneet, Samira, Orane and Trish: you have been wise, kind and patient. “Be calm, be kind, be human.” Cannot wait to celebrate with you.

Words cannot describe how grateful I am for Aanchal, Mummy and Papa. Your unconditional love and support got me through this. Thank you for being close even when you were far away. Thank you for putting up with me during our ‘holiday’.

Lastly, and most importantly, my boyfriend who became my fiancé during the course of this degree, Zach: sorry and thank you. I could not have done this without your constant motivation and love. Thank you for driving me to the lab in the middle of the night. Thank you for just about everything. It is done. You know what this means.

viii

Jiwrajka 2020

FINANCIAL SUPPORT

This project could not have been feasible without the donation from the Sid Faithfull family, and University of Queensland Research Scholarship.

KEYWORDS cancer cell biology, tumour immunology, surgery, neurosciences, oncology, glioblastoma, microglia

AUSTRALIAN AND NEW ZEALAND STANDARD RESEARCH CLASSIFICATIONS (ANZSRC)

111201 Cancer Cell Biology 50%

110709 Tumour Immunology 40%

110323 Surgery 10%

FIELDS OF RESEARCH (FOR) CLASSIFICATION

1109 Neurosciences 60%

1107 Immunology 20%

1112 Oncology and Carcinogenesis 20%

Jiwrajka 2020

TABLE OF CONTENTS

Abstract ...... i

Declaration by the author ...... iii

Publications included in the thesis ...... iv

Submitted manuscripts included in this thesis ...... iv

Other publications during candidature ...... iv

Contribution by others to the thesis ...... v

Statement of parts of the thesis submitted to qualify for the award of another degree ... vi

Research involving human or animal subjects ...... vii

Acknowledgements ...... viii

Financial Support...... ix

Keywords ...... ix

Australian and New Zealand Standard Research Classifications (ANZSRC) ...... ix

Fields of Research (FoR) Classification ...... ix

List of Figures ...... xiii

List of Tables ...... xiv

List of abbreviations ...... xv

1 CHAPTER 1: INTRODUCTION ...... 1

1.1 Glioblastoma ...... 1

1.1.1 Current therapeutic targets for GBM ...... 3 1.1.2 Tumour Immunology and Immunotherapy ...... 4

1.2 Microglia ...... 6

1.2.1 Microglia Structure and Classification ...... 9 1.2.2 Microglia priming ...... 10 1.2.3 Microglial Function ...... 11 1.2.4 Microglia and GBM ...... 11

1.3 Eph Receptors and ephrin ligands ...... 13

Jiwrajka 2020

1.3.1 Classification of Eph/ephrins ...... 13 1.3.2 Structure and Signalling ...... 13 1.3.3 Eph/Ephrin Function ...... 14 1.3.4 Eph/ephrins in cancer ...... 15 1.3.5 Eph/ephrins in brain cancer ...... 15 1.3.6 Eph receptors in immunity ...... 16 1.3.7 EphA2 ...... 16 1.3.8 Microglia and Eph receptors ...... 16 1.3.9 Aims and Scope of the Thesis ...... 17

2 CHAPTER 2: EPH AND EPHRIN FAMILY EXPRESSION IN MICROGLIA .... 18

2.1 INTRODUCTION...... 18

2.2 METHODS ...... 19

2.2.1 Cell Culture ...... 19 2.2.2 RT-QPCR ...... 19 2.2.3 Western Blot (WB) ...... 19 2.2.4 Immunofluorescence ...... 20 2.2.5 Flow Cytometry ...... 20 2.2.6 Lipopolysaccharide (LPS) stimulation ...... 20 2.2.7 Griess Assay...... 20 2.2.8 List of primers used for RT-qPCR (Table 3)...... 21

2.3 RESULTS ...... 21

2.4 CONCLUSION ...... 28

3 CHAPTER 3: THE FUNCTION OF EPHA2 ON MICROGLIA AND CONTRIBUTION TO GBM PROGRESSION ...... 30

3.1 INTRODUCTION...... 30

3.2 METHODS ...... 31

3.2.1 Cell Culture ...... 31 3.2.2 Lipopolysaccharide (LPS) stimulation ...... 31 3.2.3 EphrinA1-Fc activation of EphA2 ...... 31 3.2.4 PLVX Puro fluorescent protein transduction ...... 32 3.2.5 RT-QPCR ...... 32

Jiwrajka 2020

3.2.6 Western Blot (WB) ...... 32 3.2.7 Enzyme-linked Immunosorbent Assay (ELISA) of secreted cytokines ...... 32 3.2.8 Proliferation assays ...... 32 3.2.9 Scratch Wound Assay ...... 33 3.2.10 siRNA Transfection ...... 33 3.2.11 Phagocytosis ...... 33 3.2.12 Dyno Organoid Platform Fabrication ...... 33 3.2.13 Human glioblastoma organoid (hGBMo) Fabrication ...... 33

3.3 RESULTS ...... 34

3.4 CONCLUSION ...... 47

4 CHAPTER 4: EPHA2 AND TUMOUR ASSOCIATED MACROPHAGES IN PATIENT GBM SAMPLES ...... 48

4.1 INTRODUCTION...... 48

4.2 METHODS ...... 49

4.2.1 Patient Samples and Clinical Data ...... 49 4.2.2 Immunohistochemistry (IHC) ...... 49 4.2.3 Quantification of Iba1 and EphA2 expression ...... 49 4.2.4 EphA2 and Iba1 expression using The Cancer Genome Atlas (TCGA) ...... 49

4.3 RESULTS ...... 50

4.4 CONCLUSION ...... 64

5 CHAPTER 5: DISCUSSION (LIMITATIONS AND FUTURE DIRECTIONS) ... 65

6 REFERENCES ...... 70

APPENDIX ...... 90

6.1 Supplementary data ...... 90

6.2 Ethics Approval ...... 92

xii

Jiwrajka 2020

LIST OF FIGURES

Figure 1: Molecular Classification of Glioblastoma ...... 3 Figure 2: Various microglial phenotypes and activation states...... 8 Figure 3: Schematic representation of EphA and EphB structure and interaction with ephrinA and ephrin B ligands (adapted from Ferluga and Debinski, 2014 (7))...... 14 Figure 4: Eph/Ephrin expression in microglia cell lines...... 23 Figure 5: Cell surface expression of EphA2...... 24 Figure 6: Characterisation of HMC3 microglia...... 25 Figure 7: TNFα and nitrite on LPS activation...... 27 Figure 8: EphA2 expression in LPS activated microglia at (6, 12, 24, 48 and 72 hours)...... 28 Figure 9: mRNA and protein expression of EphA2 on EphrinA1Fc activation of EphA2. .... 35 Figure 10: HMC3 microglia profile on EphrinA1Fc activation of EphA2...... 36 Figure 11: Migration HMC3 microglia post EphrinA1Fc activation of EphA2 activation. .... 38 Figure 12: Effect of EphA2 activation of HMC3 Microglia by ephrinA1Fc on proliferation. 39 Figure 13: HMC3 microglia profile post EphA2 KD...... 40 Figure 14: Proliferation and migration of HMC3 microglia post EphA2 KD...... 41 Figure 15: Phagocytosis of HMC3 microglia post EphA2 KD...... 43 Figure 16: 2D and 3D co-culture of HMC3 (Microglia) with HW1 (GBM)...... 44 Figure 17: Co-culture of HMC3 microglia with human GBM cell line HW1...... 45 Figure 18: Immunohistochemical staining of patient GBM samples...... 55 Figure 19: Total EphA2 expression and Iba1 Expression in patient tumour samples correlated with survival...... 57 Figure 20: RNA-seq expression data on glioma samples from the TCGA in comparison with IHC expression data from tumour bank...... 59 Figure 21: Kaplan Meier Survival Estimates based on tumour grade...... 60 Figure 22: Demographic data and correlation with EphA2 and Iba1...... 61 Figure 23: Paired samples from select patients...... 62

xiii

Jiwrajka 2020

LIST OF TABLES

Table 1: List of abbreviations ...... xv Table 2: World Health Organisation classification of astrocytic tumours (13)...... 2 Table 3: List of primers used for RT-qPCR...... 21 Table 4: Patient demographics for tumour samples used in the development of TMAs and IHC analysis...... 51 Table 5: Recurrent GBM patient demographics for tumour samples used in the development of TMAs and IHC analysis...... 53 Table 6: EphA2, Iba1 and Co-localisation Expression in GBM and Recurrent GBM samples from paired patients ...... 63 Table 7: EphA2, Iba1 and Co-localisation Expression in Normal (overly or control) and Tumour samples from paired patients ...... 63

xiv

Jiwrajka 2020

LIST OF ABBREVIATIONS

Table 1: List of abbreviations

DAB 3,3′-Diaminobenzidine Glioblastoma GBM Erythropoietin producing hepatocellular Eph Eph family receptor interacting protein Ephrin Epidermal growth factor receptor EGFR Fluorescence –activated cell sorting FACS Hematoxylin and Eosin H&E Ionized calcium-binding adaptor molecule 1 Iba1 Isocitrate Dehydrogenase IDH Interferon Gamma IFN-γ Interleukin IL Inducible nitric oxide synthase iNOS Immunofluorescence IF Lipopolysaccharides LPS Major Histocompatibility Complex MHC Matrix metalloproteinases MMP Nitric Oxide NO Receptor Tyrosine Kinase RTK Queensland Institute of Medical Research QIMR Quantitative polymerase chain reaction QPCR Royal Brisbane and Women’s Hospital RBWH The Cancer Genome Atlas TCGA Temozolomide TMZ Transforming growth factor beta TGF-β Tumour Necrosis Factor TNF-α Tumour Microarray TMA Western Blot WB World Health Organisation WHO

1 CHAPTER 1: INTRODUCTION

Glioblastoma (GBM) is a high-grade brain tumour of the central nervous system that is clinically aggressive and associated with a poor prognosis (1, 2). In recent years, novel therapeutic targets have emerged based on recent findings understanding the potential role of cell surface proteins, and other immunological markers in the progression and proliferation of GBM (3, 4). One such family of cell surface proteins are the Eph receptors which constitute the largest family of receptor tyrosine kinases. These receptors bind with high specificity to ephrin family ligands. Eph and ephrins were first characterized in foetal development, where they mediate mechanisms such as cell adhesion, repulsion and tissue boundary formation (5- 7). Eph receptors have also been implicated in cancer where both oncogenic and tumour suppressive functions have been described (8). In the context of GBM, Eph receptors have described roles in tumour cell migration, proliferation and the maintenance of a more aggressive stem cell-like phenotype (9). In addition, microglia have been implicated as key players in GBM proliferation. Current evidence suggests that microglia, which have predominantly anti-inflammatory roles, are pro-tumorigenic in GBM (10-12). This study therefore aims to examine the interaction between microglia and Eph receptors in the progression and maintenance of GBM.

1.1 GLIOBLASTOMA Glioblastoma (GBM) is the most common and aggressive adult brain cancer that thus far has very limited treatment options (13). GBMs arise from astrocytes, a type of glial cell of the central nervous system (13). Based on the World Health Organisation (WHO) grading system for astrocytic tumours (Table 1), GBM is a high-grade or Grade IV tumour. As such, GBM are the most common malignant primary brain tumour (13). Typically, GBM occur within the cerebral cortex, but may also present anywhere in the CNS. GBM were previously classified as either primary or secondary; primary GBM typically arise as de novo tumours, with no prior history of astrocytoma and are the most common form of GBM comprising approximately 80% of tumours. In contrast, secondary GBM progress from lower grade astrocytoma and occur in younger patients (4). In addition, astrocytoma, has been characterized into molecular subtypes proneural, classical and mesenchymal (3, 14, 15). The new histological re-classification groups all GBMs as either IDH wild type (WT) or IDH mutant, further molecular and genetic characterization in loss of nuclear ATRX expression and 1p/19q co-deletion (Figure 1) (16). These revised classifications are significant as they assist in understanding the complexity of

Jiwrajka 2020

GBM biology, as well as aid in disease management and survival stratification. Approximately, two-thirds of all primary brain tumours are GBM (17, 18). Patients with GBM present with a variety of different neurological symptoms, including headache, seizures, sensorimotor deficits, memory loss and cognitive and personality changes (19). Management of GBM is multimodal, involving surgical resection, adjuvant radiotherapy and adjuvant chemotherapy with temozolomide (TMZ) (1, 19-23). Despite these treatments have prolonged survival, population-based studies have shown that the median survival of patients with newly diagnosed GBM is approximately 12-14 months. The 5-year survival for patients with GBM is approximately 5-10%, and infiltrative nature of GBM and tumour are inherently resistant to the current standards of care, leading to recurrence(2, 24-27). As such, exploring novel targets for therapy is essential to better define approaches with the potential to extend the life of GBM sufferers.

Table 2: World Health Organisation classification of astrocytic tumours (13).

Astrocytic Tumour Tumour Grade (WHO) Pilocytic astrocytoma I Diffuse astrocytoma II Anaplastic astrocytoma III Glioblastoma IV

Jiwrajka 2020

Figure 1: Molecular Classification of Glioblastoma

Disease pathology of GBM and its molecular diagnostics based on diagnostic biomarkers such as IDH mutation, ATRX expression, 1p/19q co-deletion and H3-K27M mutation. MGMT promotor methylation is indicative of response of tumour to alkylating agent chemotherapy (adapted from K. Masui et al., 2016 (28)).

1.1.1 Current therapeutic targets for GBM Surgical resection is the primary treatment option, coupled with external beam radiation and concurrent chemotherapy (29). Surgical resection is necessary to relieve any immediate symptoms of mass effect and obtaining tissue for a histological diagnosis of the tumour. The extent of (safe) resection is correlated positively with survival (30-32).However, despite surgery and radiation, the median survival for GBM patients is <15 months. This aggressive form of cancer is due to resistance mechanisms established by the tumour cells.

1.1.1.1 Temozolomide (TMZ) and Radiation Therapy The standard of care for GBM is maximal safe surgical resection followed by chemoradiation and adjuvant TMZ. Post maximal surgical resection, local radiation therapy and systemic TMZ is commenced. Radiation is delivered to the field with sufficient margins (1-3cms) and concurrent TMZ, an oral DNA-alkylating agent is given daily, followed by a course of adjuvant TMZ for 6 months (29). The mean progression free survival, and median survival with TMZ and radiotherapy is 6.9 months and 14.6 months respectively (33). Methylated MGMT

Jiwrajka 2020 promoter is positively correlated with survival when compared to unmethylated MGMT promoter. Methylation of the MGMT promoter causes DNA of the tumour cells to be more susceptible to alkylating agents such as TMZ (29).

1.1.1.2 Tyrosine kinase inhibitors Several studies, including comprehensive genomic characterisation by The Cancer Genome Atlas (TCGA) have shown that as much as 50% of all GBMs have receptor tyrosine kinases (RTK) amplification (34-38). RTKs are cell-surface receptors are commonly involved in signalling, proliferation, differentiation and angiogenesis in cancer (39). The most commonly altered genes in GBM include EGFR, PTEN, PIK3CA and PIK3R1 (40, 41). Epidermal growth factor receptor (EGFR) is altered in approximately 40-50% of GBM cases making this RTK an ideal target for therapy (42). Despite intense study and numerous clinical trials testing a number of potent EGFR inhibitors, responses in GBM patients have been modest at best. Erlotinib, an EGFR TKI, in phase II trials has shown improved survival outcomes when used in combination with TMZ, however gefitinib, another potent EGFR TKI, did not show improved outcomes in phase II trials despite promising results in vitro. Blood brain barrier (BBB) reducing CSF penetration and significant tumour heterogeneity are the most likely reasons of the poor clinical responses observed to-date (39).

1.1.2 Tumour Immunology and Immunotherapy The central nervous system was considered an ‘immune privileged’ site due to the BBB and the absence of lymphatics. Although the brain was initially thought to be free of lymphatics, a landmark study showed active lymphatic drainage from the brain, it is now accepted that the brain has lymphatic vessels in the venous sinuses (43, 44). Tumours in the CNS can have an immune effect by tumour cells presenting antigens and recruiting cytotoxic T-cells. These T- cells can cross the BBB and demonstrate effector capabilities; however, the function may not be specific to the antigen presented by the tumour cell. These T-cells need co-stimulation to be activated, and this is usually achieved by macrophages or microglia in the brain (45).

The role of the immune system in GBM has been an area of interest since a study that showed patients with post-operative infection post GBM resection had improved outcomes (46). GBM can create a more immunosuppressive tumour microenvironment, resulting in increased tumour proliferation. Although the presence of tumour associated lymphocytes is associated with improved outcomes, the immune mechanisms within the brain are altered by GBM cells causing normal immune responses to become pathological (and tumour promoting) such as T-

Jiwrajka 2020 regulatory cells and immunosuppressive microglia (47-49). A number of unique immunological barriers in GBM patients exist including the recruitment of immune cells to the tumour site, an immunosuppressive microenvironment, and the BBB.

1.1.2.1 Check point inhibitors Immune checkpoints can be defined as the balance between the co-stimulatory and inhibitory signals that the T-cells rely on to elicit an immune response (50). In physiological conditions, immune checkpoints facilitate pathogen recognition and destruction without self-destruction or autoimmunity, however in tumours they can be dysregulated to avoid immune recognition. Tumours, especially GBM, alter the microenvironment of the surrounding area that they infiltrate, and therefore can dysregulate the immune checkpoints. Tumour cells display these dysregulated proteins, or tumour associated antigens that are recognised by the host immune system (51), and whilst there might be an initial targeted response, the tumour cells become resistant to these responses.

Checkpoint inhibitor therapeutic antibodies inhibit immune cells and the response that creates resistant tumours. Common targets include CTLA4, PD1 and PDL1; targeting these receptors has been extensively tested in numerous clinical trials worldwide. Although antibodies against CTLA4 and PD1 (Iplimumab, tremelimumab, nivolumab and pembrolizumab) have shown promising pre-clinical data, limited clinical response was observed in large multi-site GBM studies (52, 53). New checkpoint targets such as TIM3, IDO1, LAG3 and TIGIT are in early stage trials. The reason GBM may not be an amenable cancer for check point inhibition therapy is likely due to the tumour mutational load in GBM compared to other solid cancers such as non-small cell lung cancer and melanoma (54). Additionally, it seems that there are major resistance mechanisms that may play a role including T-cell exhaustion at tumour site (55). Promising results have emerged from neo-adjuvant approaches using pembrozulimab that overcome T-cell exhaustion by activating both local and systemic anti-tumour responses. Neo- adjuvant PD-1 blockade by pembrozulimab increases the infiltration of interferon (IFN) producing T cells that are also PD-1 suppressed. This subsequently results in a downregulation of cell cycle-related gene expression of the tumour cells. Moreover, with neo-adjuvant therapy, there is an increased clonal expansion of T-cells compared to those who receive only adjuvant therapy (56).

Jiwrajka 2020

1.1.2.2 CAR-T therapy Given that GBM cells facilitate the presentation of tumour associated antigens, a number of studies have attempted to genetically engineer T-cells that express chimeric antigen receptors (CARs). This approach typically uses tumour-specific antigens to generate a targeted T-cell response. It is known that T-cells can infiltrate the CNS, and therefore using T-cells that target a specific antigen can overcome the challenge of a therapeutic agent crossing the BBB (57, 58). A study by O’Rourke et al., 2017 showed CAR-T cells engineered against epidermal growth factor receptor variant III (EGFRvIII) were able to infiltrate the CNS into the GBM post infusion and pre-surgical resection (59). Similar studies have also shown the involvement of chemokines and adhesion molecules in the first adherence of the T-cell blasts to the microvasculature of the blood-spinal cord barrier, and second the extravasation across the barrier into the immune-privileged CNS parenchyma (58). CAR-T cells have shown promising results in-vitro against glioma stem cells, which are a population of cells within the glioma repopulating the tumour (60). However, given GBM tumour heterogeneity, and tumour recurrence, CAR-T therapy has limitations, and targeting more antigens is required to overcome this heterogeneity (61). One potential target of CAR-T therapy can be macrophages, or microglia, the main antigen presenting cells of the CNS. In hypoxic conditions, tumour associated macrophages inhibit T cell proliferation via PKA activation; this effect can be reversed by inhibiting PKA, which leads to higher T cell trafficking and activity (61, 62).

1.2 MICROGLIA Microglia are the resident macrophages in the brain and central nervous system (CNS) that are involved in immune defence. Although there are multiple other macrophages in the CNS including the perivascular, meningeal, choroid plexus macrophages and the macrophages of the circumventricular organs, microglia are the most studied (63). In the 1900s, the hallmark study by Rio Hortega illustrated that developmentally, microglia originate from stem cells in the yolk sac at the time of bone marrow haematopoiesis, and subsequently cross the incomplete BBB to the brain where they reside during adulthood (63, 64). Microglia play a significant role in the development of the CNS during embryogenesis by shaping the CNS axonal and synaptic circuitry (65, 66). Microglia are associated with a multitude of processes involved in the pathogenesis of conditions of the brain including inflammation, neurotoxicity and neuroplasticity (67, 68).

Jiwrajka 2020

Commonly, microglia are known to protect neurons during infection or injury but they can also be neurotoxic, or kill neurons by inducing neuronal apoptosis (69). There has been increasing evidence to suggest the involvement of microglia not only in inflammation but also supporting neurons and assisting in neurogenesis, or the production of neurons in the brain (70). Neurogenesis can be instigated by microglia through the release of chemokines that are responsible for promoting neural precursor cell (NPC) growth (71). Recently, microglia have been implicated not only in a variety of neurodegenerative conditions but also in some mental health disorders such as depression, schizophrenia, and autism (69, 72-76).

Jiwrajka 2020

Figure 2: Various microglial phenotypes and activation states.

Microglia dynamics vary in the healthy brain as a result of functional plasticity (adapted from Gomez-Nicola and Perry, 2015 (77) and Choi et al., 2018 (78)).

Jiwrajka 2020

1.2.1 Microglia Structure and Classification

Microglia classification remains an area of much research focus and is highly debated. Whilst some experts model microglia classification based on the macrophage classification of M1 and M2 (based on an antigenic profile), others argue that microglia cannot be classified in such a dichotomous way and deserve a more dynamic classification method. M1 is considered to be pro-inflammatory and therefore is tumour-inhibitory, whereas the M2 phenotype is considered to be tumour proliferative (79). Figure 2 is classifies microglia based on their functional phenotypes such as ‘surveillant’, ‘phagocytic’, ‘proliferating’ and ‘pruning’ microglia (77).

1.2.1.1 Amoeboid, Ramified and Reactive Microglia Microglia can be of different morphology depending on whether they are in development (gestation) or mature, or whether they are in physiological or pathological conditions. There are many different classifications of microglia based on morphology (80). They can be clustered together into three main types: amoeboid, ramified and reactive microglia (81). Amoeboid microglia are present during gestation but are only seen briefly in the post-natal period (82-85). It is believed that amoeboid microglia have a phagocytic function primarily. When amoeboid microglia grow, they become ramified, displaying long processes with very little cytoplasm. Ramified microglia are the main type of microglia present in the adult brain and make up approximately 20% of the total glial population (86, 87).

Initially it was believed that ramified microglia were ‘inactive’ or ‘resting’ and mostly found in normal physiological conditions but recent findings suggest that in fact, ‘inactive’ or ‘resting’ is a misnomer, as ramified microglia are quite motile even in resting conditions (88- 91). The function of ramified microglia is to clear metabolites released by neurons, and given the multi-potency of these microglia to become other forms of glia and neurons, ramified microglia are involved in healing post injury (92). Although ramified microglia are not exactly inactive as they are motile and surveying the CNS, under pathological conditions, ramified microglia can become ‘alerted’ in the case of a small insult or under a large insult, change morphology to a rod-like appearance without branching processes, and become reactive microglia (93). These reactive microglia are the key players in neuroprotection by phagocytosis of debris and damage caused by injury (94-96). The reactive microglia are antigen presenting cells as they express major histocompatibility complex (MHC) class II, and other surface receptors, and as such also release cytokines and inflammatory mediators such as superoxide and nitric oxide to initiate an immune response (97-99).

Jiwrajka 2020

1.2.1.2 M1 vs M2 A simplistic and debated model is to define microglia as two types: M1 and M2. This dichotomous classification does not provide a comprehensive understanding of microglia function, but rather a broad classification which defines M1 as pro-inflammatory and M2 as anti-inflammatory and alternatively activated (89, 100). The M2 polarisation is further divided into types a, b and c and collectively, they have been shown to contribute to wound healing in the brain (101). Specifically, M1 microglia can be pro-inflammatory, release pro-inflammatory cytokines, and fight a pathological insult. M1 microglia in this state can cause, in some cases, neuronal damage to healthy tissue. Conversely, M2 microglia can be neuroprotective as they are anti-inflammatory (69, 71, 102-106). It is, however, important to remain cautious of this polarised classification. M2 microglia, although neuroprotective in a basic sense, can also enhance disease development due to their pro-angiogenic features (107, 108). Therefore, in neurovascular disorders, such as any malignancy of the brain, M2 microglia can in fact, worsen the progression of brain cancers (109). The specific role of microglia in brain cancers and gliomas in particular will be discussed in the following sections.

It is speculated that M2 may be the ‘default setting’ of microglia, which when influenced by inflammation (m-CSF mediated) switches to the M1 phenotype displaying ramified or reactive morphology (110). Other opinions suggest that M2 polarisation is caused by TGFB1, CSF1 and IL10 (111). It is possible that microglia normally are somewhere on the spectrum of M1 and M2 phenotype or simultaneously express both phenotypes, but get influenced by their microenvironment to become more polarised towards either M1 or M2 (112, 113).

1.2.2 Microglia priming The ability for microglia to be influenced by their microenvironment has given rise to a new concept called microglia priming. It is defined as a hyper-responsive state that causes microglia to be overly sensitive to stimuli (114). It was first described by Perry and colleagues as an intensified response to inflammatory stimuli causing a phenotypic change (115-119). In simpler terms, it can be seen as the ‘pre-activation state’ of microglia, a state between they are surveying and being fully activated.

Microglia can be primed in such a way that the response to injury or inflammation is exacerbated and leads to increased neurodegeneration. Although most of microglia priming has been explored in the context of inflammation or neurodegenerative conditions, the concept of priming can be useful in understanding the role of tumour microenvironment on microglia, and

Jiwrajka 2020 microglial behaviour in the context of tumours. The role of tumour microenvironment and the possible effects on microglia are discussed later.

1.2.3 Microglial Function

1.2.3.1 Microglia in neurodegenerative conditions Microglia can play a dual role in neurodegenerative conditions by either causing increased inflammation and therefore harm, or by phagocytosing debris and therefore being neuroprotective. In Alzheimer’s disease in particular, microglia are involved in degrading the Aβ plaques, and a reduction in microglia results in increased accumulation of these plaques. However, microglia can also have detrimental effects in Alzheimer’s disease because of their ability to produce inducible nitric oxide synthase (iNOS), causing a more pro-inflammatory response and a reduction in phagocytic response (120, 121). In Parkinson’s disease, microglial activation in vitro through LPS or in vivo in pathological conditions, can result in an increase in IFN-γ, subsequently resulting in increased destruction of dopaminergic neurons (122, 123).

1.2.3.2 Microglia in inflammation and injury In animal models of ischemic stroke, knocking down microglia resulted in increased neuronal apoptosis and overall increased ischemic damage (124, 125). Blocking microglia and macrophages in chronic inflammatory conditions such as Multiple Sclerosis or Guillan-Barre Syndrome results in an improved clinical outcome and decreased disease progression by reducing demyelination (126-128). It is also known that in inflammation, injury and neurodegenerative diseases, there is an infiltration of T-cells in the CNS, which have shown to reduce neuronal damage (129, 130). Microglia being the main antigen presenting cells in the CNS are involved in activating T-cells via major histocompatibility complex (MHC) Class II, which thereby changes the phenotype of the effector CD4+ T-cells from the periphery. The T- cell and microglia interaction is important in creating an equilibrium within the CNS for adaptive immunity after injury, whilst at the same time preventing auto-immunity to self- antigens within the CNS (129) .

1.2.4 Microglia and GBM The role of microglia in gliomas was first discovered by Penfield in 1925 using a silver staining process showing that microglia could phagocytose neuroglia in gliomas, and cause destruction of cerebral tissue (131). It was also found that there was a high number of macrophages in gliomas; in fact a third of all cells in glioma biopsies were shown to have macrophages markers(132, 133). In the past it was believed that microglia were largely anti-tumourigenic;

Jiwrajka 2020 however recent studies have shown that in fact, microglia can be pro-tumourigenic (134, 135). Microglia release mediators that promote tumour growth: especially MMP2 and MMP9 which are involved in glioma progression, they function by breaking the bond of the tumour cell with the extracellular matrix and facilitate tumour cell invasion (136, 137). If there is dissolution of the extracellular matrix, cancer cells can detach and metastasize. An interesting feature of microglia in the context of glioma, is that glioma cells can induce a different phenotype in microglia, a phenotype that is different to the inflammatory M1 or M2 phenotype. This phenotype does not cause the release of pro-inflammatory cytokines but instead, upregulates MMP2 (10, 91, 138). Gliomas control microglial behaviour by preventing microglial attack on glioma cells, and as such resulting in an increase in glioma invasion and proliferation (132).

Recent studies have provided further evidence that microglia are involved in tumour invasion. When microglia were artificially depleted in brain slices using clodronate or in vivo, results demonstrated a significant reduction of glioma cell invasion and reduced glioma volume respectively (11, 139). However, interestingly, when macrophages and not microglia were depleted in vivo, there was an increase in glioma volume by 33%. These data therefore highlight the difference between macrophages and microglia in the context of CNS tumours.

It is thought that microglia or macrophages are attracted towards the site of the tumour because of chemokines released by the glioma cells. Astrocytomas including GBM, release factors such as CSF-1 and MCP-1 that attract microglia, which possess cell surface receptors for these chemokines, causing microglia chemotaxis (132). Some studies have explored specifically what causes microglia migration towards the tumour, and it is speculated that HGF/SF a type of growth factor acts as a chemokine for microglia (140). Microglia release cytokines when activated such as iNOS, IL-1β and TGF-β. There is a correlation between high IL-1β and GBM survival; a negative correlation between TGF-β release and GBM survival (132). There is no correlation between iNOS and GBM survival. One study has shown that propentofylline (PPF), a glial modulator reduces microglial proliferation and expression of cytokines (141, 142). Interestingly, they found that PPF specifically targets microglia and not peripheral macrophages (136, 143).

LPS is often used to activate microglia in vitro, and promote an M1, or inflammatory phenotype. When mouse microglia are activated by LPS they become ‘anti-tumourigenic’ thereby causing autophagy dependent cell-death in glioma cells. LPS activated microglia intratumorally in mice also increased survival times, suggesting that the M1 phenotype may in

Jiwrajka 2020 fact be helpful in targeting gliomas. In contrast, however, there is not sufficient evidence to suggest that LPS activation can be used as a therapy for gliomas because (i) in gliomas, microglia do not belong to a particular M1 or M2 polarisation, and (ii) the tumour microenvironment in gliomas has the ability to alter microglial behaviour (132, 137, 144).

1.3 EPH RECEPTORS AND EPHRIN LIGANDS Eph receptors are the largest family of receptor tyrosine kinases that are implicated in cell to cell signaling (5, 145-148). These membrane-bound receptors and their corresponding ligands, ephrins, were first found in an erythropoietin producing human hepatocellular carcinoma cell line, which gave rise to the Eph nomenclature. Eph family receptor interacting proteins, are therefore termed as ephrins (149).

1.3.1 Classification of Eph/ephrins There is a total of 16 known Eph receptors, 10 in the EphA class, and 6 in the EphB class. The Eph receptors are distinguished into two sub-classes based on sequence homology, and affinity for binding to either the ephrin A or ephrin B ligands. Ephrin A ligands are linked to the cell- membrane by a glycosyl phosphatidylinositol (GPI) linkage, whereas the ephrin B ligands are have a cytoplasmic tail (5). There are 9 known ephrin ligands, ephrin A1-A6 as well as ephrin B1-B3. Although EphA receptors mostly interact with ephrin A ligands, and EphB receptors with ephrin B ligands, they do show a degree of cross reactivity with other classes of ligand (147, 150).

1.3.2 Structure and Signalling A schematic representation of Eph/ephrin structure is illustrated in Figure 3: Schematic representation of EphA and EphB structure and interaction with ephrinA and ephrin B ligands (adapted from Ferluga and Debinski, 2014 (7).

Jiwrajka 2020

Figure 3: Schematic representation of EphA and EphB structure and interaction with ephrinA and ephrin B ligands (adapted from Ferluga and Debinski, 2014 (7)).

1.3.3 Eph/Ephrin Function

1.3.3.1 Injury These forward and reverse signaling mechanisms causing adhesion and detachment, are important in understanding Eph/ephrin functions. Eph receptors have been studied extensively in both rodent and fish models of spinal cord injury (SCI), which has shown that the adhesion properties of EphA4 receptors can prevent healing post-surgery. After a spinal cord hemisection, EphA4-null mice have axonal regeneration, and reduced astrocytic infiltration, suggesting the role of EphA4 in injury (151). Similarly, in traumatic brain injury, it has been found that EphA4 is upregulated, and may be a potential target for therapy to prevent injury in the brain (5).

1.3.3.2 Development There are multiple mechanisms in which Eph/ephrin affect physiological and pathological development. As seen in Figure 3, forward signalling of the Eph/ephrin pair regulates the cytoskeleton, resulting in cell movement and structural changes in cells, which are important in embryogenesis and developmental structure (152). Similarly, Eph/ephrins play a role in

Jiwrajka 2020 promoting angiogenesis, a process significant in development of both normal embryos, as well as pathological conditions such as malignancies (146, 152-155).

1.3.4 Eph/ephrins in cancer The role of Eph and ephrins in cancer has been widely documented; however there appears to be both tumour suppressive and oncogenic roles described (6, 8, 156). There has been a high degree of Eph and ephrin expression noted in many different types of cancers, and these receptors and ligands have usually been found to promote tumour growth and tumour angiogenesis (152, 154-158). Previous studies have shown a correlation between high Eph expression and cancers of the skin, kidney, gut, breast and brain (157, 159-161). In colorectal cancer, for example, the tumour environment causes EphB expression to reduce, and subsequently promoting tumour growth (162-164). However, EphA1 expression in colorectal cancer seems to be biphasic, wherein there is high expression of EphA1 in early-stage cancer but a reduced expression in end-stage cancer, also correlating to the poor survival in end-stage colorectal cancer. Similarly, Liu et al., found that overexpression of ephrin B2 resulted in suppression of tumour growth (165).

EphB4 demonstrates both a tumour promoting as well as antioncogenic function in breast cancer. This is dependent on whether there is active kinase signalling or a ligand-independent phosphorylation. In the case of EphB4, activation EphB4 by its high affinity ligand ephrinB2, activates the Abl-Crk pathway the subsequent downregulation of matrix metalloproteases (MMP) causes an antioncogenic effect. However, overexpression of EphB4 in the absence of ephrin B2 causes a ligand-independent pathway to be activated and contributes to tumour promotion (166, 167). The role of Eph/ephrin family in malignancies is therefore complex and provides a huge scope for research.

1.3.5 Eph/ephrins in brain cancer Whilst primary gliomas are the main interest of this research, other research has found that primary triple negative breast cancer metastasising to the brain demonstrates a 5-fold increase in ephrinB1 expression., and therefore there is an emerging role of eph and ephrins in cancers of the brain, both primary and secondary (168). Eph receptors and ephrin ligands are expressed in gliomas, and can promote glioma invasiveness as well as tumour suppression (7, 169, 170). Specifically, EphB2 and the corresponding ligand, ephrin B3 are overexpressed in gliomas (171, 172). Additionally, EphA2 and its corresponding ligand ephrinA1 are involved in gliomas; whilst EphA2 is highly expressed in GBMs, the ligand ephrinA1 has low levels of

Jiwrajka 2020 expression in GBMs (173-176). EphA3 is particularly expressed in mesenchymal GBM, and it was found that EphA3 caused tumour cells to remain in a more de-differentiated stem cell-like state. Subsequently, this study also showed that targeting EphA3 with an Eph Specific mAb prevented tumour regrowth (6, 177). Additionally, overexpression of EphA5 in GBMs and an association of EphA7 with poor prognosis and increased tumour invasiveness. As in other cancers, eph and ephrins can also have an antioncogenic effect. This is seen in the case of ephrinA5, which downregulates EGFR, a common oncoprotein involved in glioma, and subsequently contributes to tumour suppression (170). Although these studies show both oncogenic and tumour suppressive effects of Eph and ephrins, the role of Eph receptors in gliomas is still largely undefined (7, 9).

1.3.6 Eph receptors in immunity The study of atherosclerotic plaques has been the primary field in which an interaction between Eph receptors and macrophages has been demonstrated. On immunohistochemical staining one study found a co-expression of EphA4 and ephrin-A1 ligand in CD68 macrophage areas (178).

1.3.7 EphA2 EphA2, on a particular type of Eph receptor is highly expressed in GBM and is involved in angiogenesis, tumour cell migration, proliferation and invasion (179-181). It is also associated with adverse outcomes in primary and recurrent GBM patients (182, 183). In human tissue, EphA2 is highly expressed in malignant GBM tissue compared to non-malignant tissue; it is localised to the astrocytoma cells as well as the tumour vascular endothelial cells. EphrinA1, the high-affinity soluble ligand for EphA2 is expressed in low quantities in GBM, however treatment of GBM cells causes the expression of EphA2 to increase for 10 minutes but then cause internalisation and degradation of EphA2, suggesting that treatment of GBM with ephrinA1 may have decrease EphA2 expression in tumour cells, and may play a role in treatment and improved outcomes (184). EphA2 has been studied as a target for immunotherapy for glioblastoma and shown promising results. CAR-T cells engineered specifically for EphA2 were able to identify EphA2 positive GBM cells and elicited a cytotoxic response towards tumour cells as well as towards glioma initiating stem cells (185).

1.3.8 Microglia and Eph receptors It has been previously established that glioma cells have an effect on microglia that causes them to be pro-tumourigenic and assist glioma cells to proliferate and invade. It has also been established that Eph receptors have pro-tumourigenic properties.

Jiwrajka 2020

There is limited evidence of the interaction of microglia and Eph/ephrins. Ephrin-A3 and ephrin-A4, have been previously found to be pro-angiogenic and were upregulated when treated with microglia culture supernatant, secondary to the upregulation of TNF-α. Four hours post treatment with microglia supernatant, ephrin-A3 and ephrin-A4 mRNA expression was elevated for 12 hours post treatment, suggesting a time dependent correlation. Interestingly, ephrin-A1 expression was reduced post microglial treatment. Additionally, microglia-induced brain endothelial angiogenesis was reduced by (i) knockdown of ephrin-A3 and ephrin-A4 and (ii) blocking TNF-α in vitro. These findings show that microglia release TNF-α resulting in upregulation of ephrin-A3 and ephrin-A4 resulting in increased angiogenesis (153). EphA3 co-localises with CD163, a microglia marker, and CD68 a macrophage marker in cells (169). One study has found co-localization of CD68, a macrophage marker and EphA3 in mouse GBM both in the core of the tumour as well as in the perivascular regions of the tumour (186). However the role of Ephs in the tumour microenvironment has not been extensively studied (154).

1.3.9 Aims and Scope of the Thesis Eph receptors are cell surface proteins which are discretely expressed throughout the body, making them particularly good targets for therapy, not only for injury and inflammation, but also tumour suppression. Therefore, in this study, the interaction between microglia and Eph receptors in promoting GBM growth was investigated. This study hypothesised that Eph receptors are expressed on microglia and functionally contribute to microglia activation and homing in GBM to support tumour growth and maintenance. In Chapter 2, an Eph and ephrin screen on human and mouse microglia cell lines was conducted, followed by a functional analysis of EphA2 on human immortalized microglia cell lines and in vitro GBM co-culture assays in Chapter 3. Finally, in Chapter 4, the interaction, and clinical correlates of EphA2 and microglia in human (patient) tumour samples was demonstrated.

Jiwrajka 2020

2 CHAPTER 2: EPH AND EPHRIN FAMILY EXPRESSION IN MICROGLIA

Chapter 2: Key Points • Eph/ephrin expression on human and mouse microglia was established • EphA2 is highly expressed in human (HMC3) microglia – both on the surface as well as inside the cell • HMC3 cells are human immortalized microglia that demonstrate microglial plasticity on LPS stimulation • LPS stimulation of HMC3 cells modulates EphA2 expression

2.1 INTRODUCTION Eph and ephrins play a role in cell adhesion, immune cell activation, homing of leukocytes and proliferation of cells primarily during embryonic development (187). Given that they were initially discovered in human hepatocellular carcinoma cells, Eph and ephrins have been extensively studied in carcinogenesis. Recently, studies have also shown Eph and ephrin expression in other disease pathogenesis including atherosclerosis, neuroinflammation and infectious diseases (188, 189). Of particular note is the presence of Eph receptors on immune cells including monocytes and macrophages, however no study to date has screened for Eph/ephrin expression in microglia (190-196). The brain’s immune system is a highly regulated system and comprises of cells including microglia, T-cells, B-cells, dendritic cells, natural killer (NK) cells and peripheral macrophages. However microglia form approximately 80% of the immune cell population, making these cells the most dominant immune cell, and therefore of particular relevance in the context of GBM (197).

Previous studies have shown that Eph receptors are expressed and functional in glioblastoma, with associated poor clinical outcome (176, 182, 183). Specifically, EphA2 is associated with mesenchymal and classical subtypes of GBM, and is associated with proliferation, invasion and angiogenesis (198, 199). Targeting EphA2 is associated with an anti-oncogenic effect (200). Therefore, this study was established in the context of studying therapeutic targets for GBM, previous established studies on Eph receptors both in the setting of GBM and immune cells, particularly microglia (6, 9).

Jiwrajka 2020

2.2 METHODS

2.2.1 Cell Culture BV2 (mouse microglia) and HMC3 (human microglia) cell lines were kindly given to the lab by Prof Peter Parsons, and Prof Glen Boyle (201-203). These cells were grown in DMEM or RPMI (with penicillin streptomycin and glutamine) and 10% Foetal Calf Serum (FCS) at 37oC. Accutase® (Sigma) was used to detach cells for passaging.

Alternate mouse microglia cell lines EOC2, EOC 13.31 and EOC 20 were purchased from the American Type Culture Collection (ATCC). LADMAC cells (CRL- 2420) needed to grow the EOC cells were also purchased from the ATCC. LADMAC cells were grown as recommended and supernatant collected. Culture medium was made with RPMI (with pen-strep and glutamine), 10% FCS and 20% LADMAC media. The cells were detached using trypsin- EDTA.

2.2.2 RT-QPCR RNA was extracted from cell pellets using Qiagen RNAeasy kit followed by cDNA synthesis using Superscript IV (Invitrogen) as per manufacturer’s protocol. SYBR Green (Applied Biosystems) was used to conduct RT-QPCR. Please see Table 3 for a list of primers and their catalogue numbers. The assay was run in a 384 well plate using the ABI Viia7. GraphPad Prism was used for statistical analysis.

2.2.3 Western Blot (WB) To conduct a Western Blot experiment, cells at 70-90% confluency were washed 3x with ice- cold PBS, and subsequently lysed on ice with Radioimmunoprecipitation assay (RIPA) buffer (Thermofisher). Cells were disrupted using a scraper, and the lysate stored at -80°C until further use. The protein concentration was measured by the BCA Protein Kit Assay (Thermofisher) as per the manufacturer’s protocol. Between 50-100 µg of protein was loaded in SDS-PAGE gel lanes. The 10% SDS-PAGE gels were made using 30% acrylamide, SDS, APS, TEMED and Tris buffers. The gels were run, transferred, and then blocked with either 5% milk powder/TBST or 5% BSA/TBST prior to antibody staining. EphA2 (6997S CST at 1:2000) and β-actin (4970S CST at 1:20000) primary antibodies were used and the membranes were incubated at 4°C overnight. The membranes were washed with TBST and stained with Goat Anti-Rabbit HRP (BioRad 1:5000) for 1hr before developing the membrane using film or Syngene G:BOX Chemi XX6.

Jiwrajka 2020

2.2.4 Immunofluorescence HMC3 cells were seeded on 24-well plate coverslips at fixed for 10 minutes in ice cold methanol. EDTA pH9.0 was used as the antigen retrieving agent. The coverslips were boiled then electroporated using steep pulse treatment for 10 minutes. The coverslips were blocked with Sniper, a universal blocking reagent for 10 minutes. EphA2 (CST #6997) at 1:200 was used as the primary antibody and incubated for 60 minutes at room temperature. MACH2 Rabbit HRP was then used for 30 minutes, followed by Tyramide Opal 520 for 15 minutes, and the coverslips were subsequently mounted onto a slide. The Vectra Perkin Elmer microscope was used for imaging and inForm software for processing the images.

2.2.5 Flow Cytometry The flow cytometry protocol was adapted from laboratory protocol previously established (177). In-house mAbs for EphA1 (1E9), EphA2 (1F7), EphA3 (IIIA4) and EphA4 (1A7) were used for flow cytometric analysis. CD11b-PECy5 and CD45-FITC were used as microglia markers along with Iba1 (abcam). Microglia are Iba1+, CD11b high/CD45 low, which was confirmed by flow cytometry on BV2 and HMC3 cells. Propidium Iodide (PI) was used as a live/dead marker. Intracellular staining of TNF-α- FITC (Thermofisher) was done after surface receptor staining using the BD Cytoperm/Cytofix Kit as per the manufacturer’s protocol, which included cell fixation and permeabilization. Brefeldin A was added to media 2 hours prior to detachment of cells and staining. BD FACSDiva Canto II or BD Fortessa Laser was used for flow cytometry, and the data were subsequently analysed using FlowJo v.10 software. GraphPad Prism was used for development of the graphs and statistical analysis.

2.2.6 Lipopolysaccharide (LPS) stimulation LPS was obtained from Sigma Cat number #L4524, Serotype number 055:B5. Microglia cell lines were grown in media with 10% FCS but were serum starved with 1% FCS in media prior to use. Cells were incubated with LPS for the duration of LPS treatment (0.1-2µg/ml) in 37oC as per a protocol previously established (204).

2.2.7 Griess Assay Microglia release Nitric Oxide (NO) when stimulated by LPS, and the release of NO in microglia cell culture supernatant can be used as a surrogate marker for LPS induced inflammation. The Griess reaction has been described elsewhere (205). Supernatants from HMC3 cell culture were collected after LPS activation and stored at -80oC until used in the assay.

Jiwrajka 2020

2.2.8 List of primers used for RT-qPCR (Table 3). Table 3: List of primers used for RT-qPCR

Gene MW Sequel (5'-3) CD68 Forward 6048 GTACTGAACCCCAACAAAAC Reverse 6150 ATGTAGCTCAGGTAGACAAC IFNγ Forward 6132 GGTAACTGACTTGAATGTCC Reverse 6031 TTTTCGCTTCCCTGTTTTAG IL6 Forward 6201 GCAGAAAAAGGCAAAGAATC Reverse 5484 CTACATTTGCCGAAGAGC TNFα Forward 5313 CTCAGCCTCTTCTCCTTC Reverse 5837 AGAAGATGATCTGACTGCC TREM1 Forward 6101 ACAGATATCATCAGGGTTCC Reverse 6086 CCTAGGGTACAAATGACCTC IL1β Forward 6110 CTAAACAGATGAAGTGCTCC Reverse 5531 GGTCATTCTCCTGGAAGG CD163 Forward 6003 ATGAGTCCCATCTTTCACTC Reverse 6421 CAGTATAAGCTAACAGTGGAG SRA1 Forward 6503 CAGTATAAGCTAACAGTGGAG Reverse 5963 TCATCACATACCTGCTTCTC TGFβ1 Forward 6063 AACCCACAACGAAATCTATG Reverse 6043 CTTTTAACTTGAGCCTCAGC

2.3 RESULTS We hypothesised that Eph receptors are expressed on microglia and functionally contribute to microglia activation and homing in GBM to support tumour growth and maintenance.

To determine Eph/ephrin expression in microglia, qPCR, Western Blot (WB) and Flow Cytometry (FACS) techniques were utilised. Initially five cell lines were assessed, and all known Eph/ephrin family members were screened by qPCR. Four out of the five cell lines were of mouse origin, whereas the HMC3 cell line is an human microglia cell line (201). mRNA expression analysis of EphA family receptors showed HMC3 had high EphA2 (Figure 4A). EphB2 and EphB4 were also elevated in the HMC3 model (Figure 4B). Analysis of ephrin

Jiwrajka 2020 ligand expression showed particularly high expression of the high affinity EphA2 ligand, Ephrin A1. Ephrin A3 and A5 were also expressed in HMC3 cells, these ligands also have the ability to interact with EphA2, albeit at lower levels (Figure 4C). In general, Eph/ephrin levels were somewhat lower in the other models tested. Of the genes identified, EphA2 appeared the most attractive as it has been most associated with cell migration and the promotion of GBM (9, 206); therefore, this gene was selected for further analysis. EphA2 protein levels were assessed by WB and showed particularly high expression in HMC3 cells comparable to a high EphA2 expressing GBM positive control cell line (U373) (Figure 4E). Based upon the elevated Eph expression profile and human origin, the HMC3 model was selected for further detailed analysis.

Immunofluorescence (IF) staining of HMC3 cells for EphA2 (Figure 5A) showed cell surface receptor expression in keeping with our flow cytometric data (Figure 5B,C). Interestingly, staining also showed rapid internalisation of EphA2 receptor complexes following antibody binding indicating induction of receptor phosphorylation. Flow cytometry confirmed EphA2 protein levels were expressed on the cell surface of HMC3 cells and were elevated above other EphA family members (EphA1, A3 and A4) (Figure 5B).

Jiwrajka 2020

a b EphA receptors EphB receptors

20 15 B

Eph A1 Eph A5 B Eph B1 T

T Eph B4 C

Eph A2 Eph A6 C Eph B2 Eph B6 A

Eph A3 Eph A7 A Eph B3 r

15 Eph A4 Eph A8 r

i s

10 s

p x

x 5

m m 0 0 3 2 2 1 0 3 2 2 1 0 C V C .3 2 C V C .3 2 M B O 3 C M B O 3 C E 1 O E 1 O H C E H C E O O E E

Human Mouse Human Mouse c d EphrinA ligands EphrinB ligands

8 8 B

ephrin A1 B ephrin B1 T ephrin A4 T

ephrin A2 ephrin B2 C

ephrin A5 C ephrin B3 A

ephrin A3 A r

6 r 6

i s

s 4 4

2 2

m m 0 0 3 2 2 1 0 3 2 2 1 0 C V C .3 2 C V C .3 2 M B O 3 C M B O 3 C E 1 O H E 1 O H C E C E O O E E

Human Mouse Human Mouse

Figure 4: Eph/Ephrin expression in microglia cell lines.

(a) EphA (b) EphB (c) EphrinA and (d) EphrinB mRNA expression in microglia cell lines; HMC3 (human microglia); BV2, EOC2, EOC13.31 and ECO20 (mouse microglia) (e) Protein expression on Western Blot showing EphA2 expression on microglia and U373 (Positive Control). (Results are presented as mean ±SEM (n=4)). Please see Supplementary Figure 1 for mRNA expression of U373 (positive control).

Jiwrajka 2020

Figure 5: Cell surface expression of EphA2.

EphA2 is expressed on the surface of the cell and is internalised when activated. EphA2 protein expression (a) Immunofluorescence as performed on fixed HMC3 cells; and (b) Flow Cytometry analysis was performed on unpermeabilised, steady state HMC3 microglia at 4°C (b) MFI (n=3) and (c) plot showing EphA2 expression. (Two-way ANOVA; Error bars represent SEM). The observed increase in EphA2 expression was not found to be statistically significant.

Jiwrajka 2020

Figure 6: Characterisation of HMC3 microglia.

Jiwrajka 2020

(a) Western Blot of activated microglia marker, Iba1 in LPS activated microglia; (b) HMC3 microglia expressing microglia markers on flow cytometry Iba1, CD11bhigh/CD45low;(control is secondary antibody only) (c) mRNA expression of microglia phenotypic markers (n=3) (Two-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

As an initial step to confirm the macrophage and specific microglia phenotype of HMC3 cells, we performed flow cytometry for the macrophage markers CD11bhigh and CD45low and the microglia specific marker Iba1 (207, 208) (

Figure 6A, B). In

Figure 6A it was established that with LPS stimulation the Iba1 expression varies, as is expected from microglia cells. Further, in order to characterise the HMC3 microglia, an immortalized microglia cell line (201), mRNA expression of antigenic and phenotypic markers were also assessed (see Table 3 for RT-qPCR primer sequences).

RT-qPCR mRNA expression analysis was used to confirm microglia cell plasticity when activated with lipopolysaccharide (LPS), using a previously established protocol (204). HMC3 cells behaved as expected following LPS activation. CD163, a known M2 phenotypic macrophage marker, did not change following LPS stimulation, However, following LPS stimulation, we observed increases in the expression of CD68, IFNγ, IL1β, IL6, TREM1, SRA1 and TGF-β (

Figure 6C). All the above phenotypic markers represent an M1 phenotype except transforming growth factor beta (TGF-β). TGF-β expression is usually increased post LPS treatment. However, LPS can also suppress downstream signalling of TGF-β, and therefore can downregulate the expression of pro-inflammatory cytokines. (209). These findings were consistent with previous studies showing LPS typically induces a strong M1 phenotype.

Jiwrajka 2020

Figure 7: TNFα and nitrite on LPS activation.

TNF-α expression in HMC3 microglia on (a) Flow Cytometry and (b) qPCR post LPS activation; (c) Griess assay to demonstrate nitrite production following LPS stimulated microglia (HMC3); (One-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

To assess microglia activation kinetics expression levels of tumour necrosis factor alpha (TNFα) as well as nitric oxide (NO) release were tested following LPS activation (Figure 7). (210, 211). TNFα expression peaked 12-24 hours post stimulation (Figure 7A, B). This result was further confirmed using qPCR, which shows a significant increase in TNFα mRNA levels 24 hours post LPS stimulation (Figure 7B). Similarly, the Griess assay results show NO induction commenced 6 hours post stimulation and peaked at 48-72 hours in HMC3 cells (Figure 7C).

Taken together NO and TNF-α kinetic studies show that microglia are activated between 12- 48 hours post LPS stimulation. This was consistent with the Iba1 protein expression analysis

Jiwrajka 2020 from Figure 6A. Given these microglia activation results we next wanted to assess EphA2 protein levels in HMC3 cells following LPS stimulation. Flow cytometry was used to assess EphA2 levels following activation. Analysis of mean fluorescence intensity (MFI) levels showed a significant reduction in EphA2 protein levels 24 hours post LPS stimulation (Figure 8). This coincided with peaking TNF-α at 12- and 24-hours post stimulation, indicating that a reduction of EphA2 could be linked to microglia activation states.

a EphA2 Protein Expression 5000

t i

s 4000

c 3000

e r

o 2000

n a

e 1000 M

0 ) ) ) ) ) ) d e r r r r r e p S h h h h h n ty P 6 2 4 8 2 i o L ( 1 2 4 7 a s o S ( ( ( ( t I S S S S s (N P n l L P P P P U o L L L L tr n o C

Figure 8: EphA2 expression in LPS activated microglia at (6, 12, 24, 48 and 72 hours).

EphA2 expression in HMC3 post LPS activation on Flow Cytometry (One-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

2.4 CONCLUSION Here we show that Eph and ephrin family members are expressed in microglial cell lines (both human and mouse). The highest Eph receptor identified was EphA2, this was particularly attractive given the previously described functional oncogenic roles of EphA2 in GBM maintenance and progression. There is a relative paucity of microglia cell lines for laboratory analysis, this is even more the case for human cell lines. Given the increased translational relevance of studies conducted on human cell lines, the HMC3 human model was selected for further analysis. The EphA2 level was particularly high in this model making it an excellent candidate for this study. As a first step, a detailed analysis of HMC3 plasticity was conducted. Microglia can be readily activated using LPS and these approaches are well-established. HMC3

Jiwrajka 2020 cells responded as expected following LPS activation as shown by our M1/M2 expression marker analysis and NO and TNF-α kinetics. This chapter demonstrated that HMC3 cells express the antigenic markers of microglia and are readily activated with the endotoxin LPS. Furthermore, we show that EphA2 and the highly affinity ligand ephrin A1 are upregulated in the human HMC3 microglia model indicating that the receptor is likely undergoing forward activation involving active kinase phosphorylation. Lastly, we noted modulation of EphA2 protein levels following LPS stimulation suggesting EphA2 may play an active role in microglia function and state change.

Jiwrajka 2020

3 CHAPTER 3: THE FUNCTION OF EPHA2 ON MICROGLIA AND

CONTRIBUTION TO GBM PROGRESSION

Chapter 3: Key Points • Microglia demonstrate a pro-inflammatory phenotype when stimulated by Ephrin A1-Fc (causing EphA2 activation) • Ephrin A1-Fc activation of EphA2 however downregulates Iba1 • HMC3 cells proliferate more, migrate slower when EphA2 is activated • HMC3 cells proliferate less, migrate faster and phagocytose more when EphA2 is knocked down • Unique 2D and 3D co-culture models were developed in this study demonstrating segregation of GBM cells and microglia • In co-culture with GBM cells, microglia proliferate less but have a tumour proliferative effect on HW1 (primary human GBM cell line) • When EphA2 is knocked down on microglia and co-cultured with GBM cells, microglia have a cytostatic effect on GBM cells • EphA2 expression is upregulated in microglia co-cultured with GBM cells in organoids • Other microglia markers including CD163, TREM1, IL1β and SRA1 are also upregulated in microglia when co-cultured with GBM cells in organoids

3.1 INTRODUCTION The expression and function of Eph and ephrin RTKs have not previously been studied in the context of microglia. Our initial expression studies detected high EphA2 levels on the cell surface of HMC3 cells which was reduced following microglia activation with LPS. These findings indicated that EphA2 may therefore play a functional role in microglia state change and hence affect GBM growth and progression. Eph and ephrins are widely implicated in cell migration, adhesion and proliferation during embryogenesis and cancer (7, 187, 212). This is especially true for EphA2 which has been reported as a central receptor during many of these cell processes in both development and disease (8). Specifically, this chapter assesses the contribution of EphA2 to microglial migration, proliferation, cytokine/antigenic profile, and phagocytosis. Whilst it was previously assumed that microglia have a slow turnover in the brain once they have migrated to the CNS in the postnatal stage, it has now been shown that microglia

Jiwrajka 2020 proliferate continuously in the brain and maintain homeostasis via rapid apoptosis (213). Additionally, one study found that ephrinA1-Fc treatment mediated a macrophage M2a phenotype decreasing cell migration (214). In order to fully understand the role of EphA2 on microglia, the effects of EphA2 activation (through a soluble ephrinA1-Fc ligand) and EphA2 down regulation (siRNA) on microglia (i) proliferation, (ii) migration, (iii) cytokine/antigenic profile, and (iv) phagocytosis were studied. To assess the interaction of microglia and EphA2 in the context of GBM, this study also established a unique 2D and 3D co-culture organoid approach. The co-culture assays examined the effects of microglia in co-culture with a primary human early passage GBM cell line.

3.2 METHODS

3.2.1 Cell Culture HMC3 (human microglia) cell lines were kindly donated to the lab by Prof Glen Boyle. These cells were grown in DMEM (with penicillin streptomycin and glutamine) and 10% foetal calf serum (FCS) at 37oC. Accutase was used to dissociate cells for passaging. The culture method for the in-house generated HW1 human primary GBM models has been described extensively before (215-217). HWI cells were grown in serum-free conditions as glioma neural stem (GNS) cultures (218). A 96-well plate was used to grow HW1 and HMC3 cells in co-culture, and images captured using a Cytell microscope.

3.2.2 Lipopolysaccharide (LPS) stimulation LPS was obtained from Sigma Cat number #L4524, Serotype number 055:B5. Microglia cell lines were grown in media with 10% FCS but were serum starved with 1% FCS in media prior to use. Cells were incubated with LPS for the duration of LPS treatment (0.1-2µg/ml) in 37oC as per a protocol previously established (204).

3.2.3 EphrinA1-Fc activation of EphA2 EphA2 can be activated using its high affinity ligand ephrinA1 for in vitro studies. EphrinA1- Fc soluble protein (in-house) was clustered, or dimerized with human IgG (Jackson Immunoresearch AffiniPure Rabbit AntiHuman IgG, Fcγ Fragment) at 4oC for 1 hour, and then immediately used to activate EphA2 on microglial cell cultures at various concentrations (174, 219, 220). The process of dimerizing and clustering ephrin-Fc prior to using it for activating the corresponding Eph receptor has been previously described by Vearing et al., 2005 (220).

Jiwrajka 2020

3.2.4 PLVX Puro fluorescent protein transduction The plasmid constructs with fluorescent proteins were prepared by Dr Seckin Akgul as described previously (215). Following transduction cells were stably selected using puromycin (0.5µg/ml).

3.2.5 RT-QPCR RNA was extracted from cell pellets using a Qiagen RNAeasy kit followed by cDNA synthesis using Superscript IV (Invitrogen). SYBR Green (Applied Biosystems) was used to conduct real-time PCR. Table 3 lists the primers used and their catalogue numbers.

3.2.6 Western Blot (WB) To conduct a Western Blot experiment, cells at 70-90% confluency were washed 3x with ice- cold PBS, and subsequently lysed on ice with Radioimmunoprecipitation assay (RIPA) buffer (Thermofisher). Cells were disrupted using a scraper, and the lysate stored at -80°C until further use. The protein concentration was measured by the BCA Protein Kit Assay (Thermofisher) as per the manufacturer’s protocol. Between 50-100 µg of protein was loaded in SDS-PAGE gel lanes. The 10% SDS-PAGE gels were made using 30% acrylamide, SDS, APS, TEMED and Tris buffers. The gels were run, transferred, and then blocked with either 5% milk powder/TBST or 5% BSA/TBST prior to antibody staining.

3.2.7 Enzyme-linked Immunosorbent Assay (ELISA) of secreted cytokines Supernatants from three independent HMC3 cultures post treatment were collected and a range of neuroinflammation markers were analysed using the Neuroinflammation ELISA strip assay according to the manufacturer’s protocol (Signosis #EA1121). Values are presented as absorbance (OD).

3.2.8 Proliferation assays Promega’s CellTitre 96 Non-Radioactive Cell Proliferation Assay was used to conduct the MTT assay as per manufacturer’s protocol. For manual counting, cells were dissociated using Accutase, and washed with PBS, and cell number determined using haematocytometer. Cells that were transfected with a synthetic fluorochrome were imaged using an Incucyte or Cytell microscope, and proliferation subsequently analysed using Incucyte in-built analyser and InCell Developer, respectively.

Jiwrajka 2020

3.2.9 Scratch Wound Assay Microglia cell lines were seeded in a 96-well flat-bottomed plate followed by incubation with 0.5µg/ml mitomycin for 30 minutes. EphrinA1Fc and LPS treatment was added prior to creating a scratch in each well using the Incucyte Scratch Woundmaker. Cells were washed with PBS twice, 0.5% FCS media was added, and the plates were imaged using Incucyte.

3.2.10 siRNA Transfection Lipofectamine RNAiMax (Thermofisher) was used to transfect the siRNA (MISSION® esiRNA Merck Cat # EHURLUC-20UG and #EHU075051-20UG) into the HMC3 TdTomato cells as per manufacturer’s protocol. Optimem media was topped up 6 hours after transfection with DMEM, and the transfected cells were used for experiments at least 24h post transfection.

3.2.11 Phagocytosis HMC3 conjugated with AmCyan fluorochrome were seeded into a 24 well plate followed by a transfection of Control and EphA2 esiRNA. Optimem media was topped up 6h post with DMEM. Twenty four hours post transfection, E.Coli beads (Thermofisher pHrodo™ Red E. coli BioParticles™ Conjugate for Phagocytosis Catalog no. P35361) were added at a 10µg/ml concentration, and incubated at 37°C for 15 minutes prior to the plate being imaged using the Incucyte Zoom microscope. Phagocytosis was measured by comparing the red fluorescence of the beads to the green fluorescence of the HMC3-AmCyan.

3.2.12 Dyno Organoid Platform Fabrication Dyno organoid culture platforms were fabricated using standard SU-8 photolithography and PDMS moulding practices (221). The Dyno was moulded by soft lithography with PDMS (Sylgard 184; Dow Corning; mixed in 10:1 ratio of monomer: catalyst), with curing at 65°C for 35 min. The moulds were cut using a 6 mm hole punch and placed into 96-well plates, after which they were then sterilized with 70% ethanol and UV light, washed with PBS, and coated with 3% BSA (Sigma) to prevent cell attachment to the bottom of the wells (222).

3.2.13 Human glioblastoma organoid (hGBMo) Fabrication For each hGBMo, 6 × 104 HW1, 6 × 104 HMC3 or a mix of 3 × 104 HW1 plus 3 × 104 HMC3 cells, respectively, in complete NSA medium were mixed with collagen I to make a 3.5µL final solution containing 2.6 mg/mL collagen I and 9% Matrigel. The bovine acid-solubilized collagen I (Devro) was first salt-balanced and pH-neutralized using 10X DMEM and 0.1 M NaOH, respectively, prior to mixing with Matrigel and cells. The mixture was prepared on ice and pipetted into the Dyno. The Dyno was then centrifuged at 100 × g for 10 s to ensure the

Jiwrajka 2020 hGBMo form halfway up the posts. The mixture was then polymerised at 37°C for 30 min prior to the addition of NSA medium to cover the tissues (150 μl/hGBMo). The organoid platform design facilitates the self-formation of tissues around in-built PDMS posts (designed to deform ∼0.07 μm/μN). The medium was changed every 2-3 days (150 μl/ hGBMo).

3.3 RESULTS As an initial step, we sought to determine EphA2 activation kinetics and to assess if the kinase was functional in HMC3 cells. The high affinity ligand ephrin-A1 was clustered with antihuman Fc to promote stability and promote EphA2 receptor clustering and subsequent downstream kinase activation. EphA2 activation was assessed via WB using a phospho- specific EphA receptor monoclonal antibody (mAb). Results highlight a clear signalling response with kinase activation peaking at between 5-15 minutes post activation and decreasing to baseline one-hour post activation (Figure 9A). Interestingly, EphA2 activation also decreased Iba1 expression following ephrin A1-Fc stimulation for 60 minutes. This finding indicated that EphA2 forward kinase signalling could play a role in microglial activation states. EphA2 expression typically is reduced following activation due to internalisation of receptor complexes and subsequent degradation. To examine this QPCR was conducted at each activation time point. Results confirmed the activation kinetics data showing a significant down regulation of EphA2 expression 60 minutes post ephrin A1-Fc stimulation (Figure 9B).

To understand the function of EphA2 on microglia we assessed the expression of microglia activation/profile markers following EphA2 activation. Firstly, the microglia profile was studied to assess the effects of ephrinA1-Fc mediated activation of EphA2 (Figure 10). Overall, EphA2 activation caused microglia to be more activated as measured by the mRNA expression of CD163, IL1β, TREM1, IFNγ, TNFα, IL6, SRA1 and TGFβ (Figure 10A). The effect appears in many cases to show a time dependent response following ephrinA1-Fc stimulation though the kinetic of each marker tested varied. SRA1 expression did not increase until one-hour post activation, while TGFβ expression increased as early as 15 minutes post activation. CD163 showed a linear dose dependent increase in expression, whereas IFNγ showed a cyclical pattern. ELISA for IL6 and TGFβ showed a significant increase in the release of IL6 at 60 minutes but no difference in TGFβ release (Figure 10B).

Jiwrajka 2020

b EphA2 with ephrin activation

n o

i **

B s

T 40

e A

p 20

R m 0 Iso 15m 60m 3h

Figure 9: mRNA and protein expression of EphA2 on EphrinA1Fc activation of EphA2.

(a) Activation of EphA2 with EphrinA1Fc on HMC3 (and U373 as positive control for EphA2) on Western Blot (phosphorylated EphA2, total EphA2 and Iba1); (b) mRNA expression of EphA2 post activation of EphA2 with EphrinA1Fc. (Two-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001). Normalised ratio of phosphorylated EphA2 to total EphA2 is demonstrated in Supplementary Table 1.

Jiwrajka 2020

a CD163 with ephrin activation CD68 with ephrin activation IFN with ephrin activation

0.8 40 0.6

e e

0.6 30 e

n n

n 0.4

o ***

s s

20 s

0.4 e

x x

E 0.2

A 10

A 0.2

m m 0 m 0.0 0.0 Iso 15m 60m 3h Iso 15m 60m 3h Iso 15m 60m 3h

IL1 with ephrin activation SRA1 with ephrin activation TNF with ephrin activation

0.6 50 3

A A

r *** *** r

40 r

n n

0.4 n 2

i i

30 i

p p

20 p

x x

0.2 x 1

A A

10 A

m m 0.0 0 0 Iso 15m 60m 3h Iso 15m 60m 3h Iso 15m 60m 3h

TREM1 with ephrin activation IL6 with ephrin activation TGF with ephrin activation

0.4 1.0 40

B B

B *

T T

* T

A A

r r

0.8 r

e e

0.3 e 30

i i

0.6 i

s s

0.2 s 20

p p

0.4 p

A 0.1 A

A 10

0.2

m m m 0.0 0.0 0 Iso 15m 60m 3h Iso 15m 60m 3h Iso 15m 60m 3h b IL6 release with TGF release with ephrin activation (ELISA) ephrin activation (ELISA)

2.0 **** 2.0

)

) D

D 1.5 1.5

(

n a

a 1.0 1.0

b A A 0.5 0.5

0.0 0.0 Iso 60m Iso 60m

Figure 10: HMC3 microglia profile on EphrinA1Fc activation of EphA2.

(a) mRNA expression of microglia antigenic and phenotypic markers on EphrinA1Fc activation of EphA2; (b) ELISA of IL6 and TGFβ (Two-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

Jiwrajka 2020

In order to better visualise and track HMC3 cell growth and movement, cells were optically barcoded with lentiviral particles (PLVX-puro vector carrying AmCyan, ZsGreen or TdTomato, or E2Crimson) (Figure 11A).

To assess HMC3 cell migration following EphA2 activation a scratch wound assay was conducted. Migration was assessed using increasing ephrin A1-Fc concentrations (2, 3 and 4 µg/ml). Results show a decrease in migration potential for all concentrations tested, 3 µg/ml did not reach statistical significance while 2, 4 µg/ml was found to significantly (p<0.05) reduce migration potential (Figure 11B, C, D). Representative images of wound closure following activation are shown over a 24 hour period (Figure 11E). This finding suggested that EphA2 forward kinase signalling may switch microglia to a more ‘activated’ and hence less migratory state (223).

We next assessed HMC3 cell proliferation following EphA2 activation using two independent approaches, MTT assay and direct cell counting using a haemocytometer. Results highlight a significant (p<0.05) decrease in proliferation using both approaches (Figure 12A,B). This finding was somewhat counterintuitive, but previous studies have shown microglial proliferation and migration can be independent of each other (224). These data combined indicate that EphA2 forward kinase signalling plays a functional role in mediating microglia activation, migration, and proliferation states.

Jiwrajka 2020

a b

) 80 %

( Isotype

t EphrinA1Fc 2ug/ml i

s 60

n ***

n 40

e * v

i 20

e R 0 0 6 12 18 24 30 36 Hours

c d )

80 ) 80

% (

Isotype ( Isotype Control

y y

t EphrinA1Fc 4ug/ml

EphrinA1Fc 3ug/ml ns t

i s

60 s 60 ***

d ** n

40 n 40

v i

20 i 20

R R 0 0 0 6 12 18 24 30 36 0 6 12 18 24 30 36 Hours Hours e

Figure 11: Migration HMC3 microglia post EphrinA1Fc activation of EphA2 activation.

Jiwrajka 2020

(a) PLVX plasmid sequence used to transduce cells with a synthetic fluorescing protein; (b,c,d) Scratch Wound Analysis of HMC3 cells and EphA2 activation with 2, 3, 4µg/ml of EphrinA1Fc; (e) Representative image showing scratch assay of HMC3 microglia comparing Control (top) and EphrinA1Fc (2µg/ml) activated cells at 0, 6 and 24 hours (Two-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

a b Manual Proliferation MTT Assay Day 7 60 60000 Isotype Control

EphrinA1Fc 5ug/ml * s

l 40

e h

40000 t

* w

r 20

b %

m 20000 u

N 0

0 -20 l l l l l 0 3 5 o y y y tr /m /m /m /m a a a n g g g g D D D o u u u u 2 3 4 5 C c c c c e F F F F Days p 1 1 1 1 ty A A A A o n n n n s ri ri ri ri I h h h h p p p p E E E E

Figure 12: Effect of EphA2 activation of HMC3 Microglia by ephrinA1Fc on proliferation.

(a) Number of cells post EphA2 activation with EphrinA1Fc (5µg/ml) over 5 days when compared to isotype control; (b) MTT assay showing % growth at day 7 (n=3) at various concentrations (2-5µg/ml) when compared to isotype control. (One-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

To further explore the contribution of EphA2 to microglial function we performed siRNA mediated knockdown (KD) of EphA2. Transient EphA2 KD using siRNA led to a >50% KD of gene expression (Figure 13A). Interestingly, EphA2 KD had the opposite effect of EphA2 activation on microglia antigenic and phenotypic markers. mRNA expression analysis revealed that whilst SRA1 expression increased with EphA2 activation (Figure 10A), EphA2 KD significantly decreased SRA1 expression (Figure 13B). Similarly, IL1β, IL6, IFNγ, TNFα, TREM1 expression also decreased upon EphA2 KD. There was no effect on M2 phenotypic markers such as TGFβ and CD163, suggesting that EphA2 may selectively activate microglia.

Analysis of microglia proliferation and migration following EphA2 siRNA mediated KD, demonstrating that EphA2 KD reduced cell proliferation using both MTT (Figure 14A) and

Jiwrajka 2020

IncuCyte approaches (Figure 14B). KD also increased HMC3 migration using a wound closure assay (Figure 14C). Representative images of wound closure following EphA2 KD are shown over a 36-hour period (Figure 14D).

a mRNA expression of EphA2

150

B e

T 100

A **

p 50

R m 0 Control siRNA KD b CD68 post EphA2 KD IL6 post EphA2 KD IFN post EphA2 KD

1.5 10 n

300 n

i s

s 8

B e

**** e

T T

e 1.0

r r

T 200

C C

p 6

E r

e p

p 0.5 A

p 100

N R

R 2

m m 0 0.0 0 Control siRNA KD Control siRNA KD Control siRNA KD

IL1 post EphA2 KD TNF post EphA2 KD TREM1 post EphA2 KD

4 3 0.5

s s

s 0.4

s s

3 B

T T

T 2

C p

C 0.3

A A

A 2

E r

* r

0.2

A p

p 1

N N

N 1

R R

R * 0.1 *

m m 0 0 0.0 Control siRNA KD Control siRNA KD Control siRNA KD

CD163 post EphA2 KD TGF post EphA2 KD SRA1/CD204 post EphA2 KD

50 50 50

s s

s 40 40 40

C C

C 30 p p 30

p 30

20 e

N N

N ****

R R

R 10 10 10

m m 0 0 0 Control siRNA KD Control siRNA KD Control siRNA KD

Figure 13: HMC3 microglia profile post EphA2 KD.

(a) mRNA expression of EphA2 post siRNA KD; (b) mRNA expression of CD68, IL6, IFNγ, IL1β, TNFα, TREM1, CD163, TGFβ and SRA1/CD204 post EphA2 KD (n=2) (One-way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

Jiwrajka 2020

a b MTT Assay Day 7 Microglia Proliferation post EphA2 KD post EphA2 KD

150 1.5

)

100 e 1.0

d g

w ****

1 (

% 50 0.5

m r

o Control N siRNA EphA2 KD 0 0.0 Control siRNA EphA2 KD 0 6 12 18 24 30 36 42 48 54 60 66 72 78 84 90 Hours c Microglia Migration post EphA2 KD 50

d n

) *

o (

n t

e 20

e R 10 Control siRNA EPhA2 KD 0 0 10 20 30 40 Hours

Figure 14: Proliferation and migration of HMC3 microglia post EphA2 KD.

Jiwrajka 2020

(a) MTT assay of HMC3 cells at Day 7 post siRNA KD of EphA2 shows a decrease in total growth; (b) Time-lapse imaging (Incucyte) of HMC3 cells with Control siRNA vs EphA2 KD siRNA over 4 days demonstrating a decreased proliferation of EphA2KD cells; (c) Scratch wound analysis of EphA2 KD cells compared to control siRNA cells showing an increase in migration with the EphA2 KD; (d) Representative images of the scratch wound assay imaged on Incucyte demonstrating a slower wound closure in control cells compared to EphA2 KD cells at 0, 24 and 36 hours (n=3) (Student T-test; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

Among the normal functions of microglia include the phagocytosis of neurons or debris within the brain. We tested the on the phagocytic potential of HMC3 cells via treatment with pH sensitive E. Coli beads that fluoresce following phagocytosis (Figure 15). As expected, activation using LPS increased phagocytic ability (Figure 15A). We next examined phagocytosis levels following EphA2 siRNA mediated KD. Results show an increase in phagocytic ability following KD, which could in part be attributed to the increased migration observed following EphA2 KD (Figure 15B). Figure 15C and D show a representative image of the phagocytic beads (red) phagocytosed or engulfed by the microglia (green).

Jiwrajka 2020

a b Phagocytosis of Microglia with Phagocytosis of Microglia

LPS stimulation post EphA2 KD

)

) n

n 0.15 0.4

0.3

a t

t 0.10

/ o

o 0.2

a r

r 0.05

h a

a 0.1

P e

e Control Control

r a

a LPS esiRNA EphA2 KD ( ( 0.00 0.0 1 9 7 5 3 1 9 7 5 3 1 9 0 0 0 0 0 0 0 0 0 1 2 3 4 4 5 6 7 8 8 1 2 3 4 5 6 7 8 9 Hours Hours c d

Figure 15: Phagocytosis of HMC3 microglia post EphA2 KD.

(a) Phagocytosis increases with LPS stimulation of microglia; (b)Phagocytosis increases with siRNA KD of EphA2 on microglia; period between 24-48 hours is demarcated by the dotted line to highlight the difference in the rate between the control and siRNA KD groups in achieving phagocytosis saturation; (c,d) Representative images showing phagocytosis (red dots) within the microglia (green fluorescing cells). Please see Supplementary Figure 2Error! Reference source not found. for phagocytosis with LPS and siRNA KD of EphA2.

We next wanted to assess the interaction of microglia in co-culture with primary GBM cells. To do this we adopted an in vitro organoid approach. Microglia cells were co-cultured with an in-house generated primary GBM culture (HW1) (215-217). We have also found that HW1 cells express Eph/ephrins including EphA2 (data not shown). Previous co-culture studies involving radio-labelled microglia and glioma cells have been reported using murine models (225). As described above, we again utilised our lentiviral fluorescent protein constructs to optically barcode both HW1 (ZsGreen) and HMC3 (TdTomato) cells (Figure 16A). We developed a co-culture method both in a 2D and 3D setting to visualise cell interaction. In 2D co-culture GBM cells and microglia were grown in a serum free environment on a basement

Jiwrajka 2020 membrane of matrigel. Results at 24 hours and 7 days show a clear segregation of each cell type (Figure 16A). This finding is suggestive of a contact repulsion mechanism at play which could be mediated by Eph and ephrin receptor ligand interactions.

To assess a more biologically relevant system we adopted a 3D organoid approach modelled from a cardiac organoid platform (226). Following 24-48 hours culture we observed a similar segregation of the two cell types (Figure 16B). Intriguingly, microglia (red) rapidly encircled the GBM cell population (green), indicating a potential in vivo mechanism that is often observed in GBM patient specimens. This finding was encouraging, suggesting that organoid culture may indeed be a better system to study microglia/GBM cell interactions.

Figure 16: 2D and 3D co-culture of HMC3 (Microglia) with HW1 (GBM).

Jiwrajka 2020

(a) 2D co-culture of microglia (HMC3-TdTomato) and GBM (HW1-ZsGreen) at 40x zoom using Cytell; (b) 3D co-culture of microglia (HMC3-TdTomato) and GBM (HW1-Amcyan) in organoids (scale 1000µm); HW1 cells grown in single culture, HMC3 cells grown in single culture, and stark segregation seen in co-culture.

a b GBM in Coculture Microglia in Coculture 15 20

GBM (HW1) only Microglia (HMC3) Only

i i

t Microglia (HMC3) in Coculture

GBM (HW1) in Coculture t a

a 15

R R

s s

i 10

i l

l ** a

5 a

m m r *** **

r 5

o N

* N 0 0 1 2 3 4 5 6 7 1 2 3 4 5 6 y y y y y y y 7 a a a a a a a y y y y y y y D D D D D D D a a a a a a a D D D D D D D c d GBM in Coculture with Microglia Microglia in Coculture with GBM

2.5 5

i t

t 2.0 4

d 1.5 3

i l

l 1.0 2

r o

o 0.5 GBM (HW1) with Control Microglia 1 HMC3 (CTRL) in Coculture N N GBM (HW1) with EphA2 KD Microglia HMC3 (EphA2 KD) in Coculture 0.0 0

1 2 3 4 5 6 7 1 2 3 4 5 6 7 y y y y y y y y y y y y y y a a a a a a a a a a a a a a D D D D D D D D D D D D D D e f

mRNA Expression in 3D Coculture Cytokine Release (ELISA)

20 4 ****

)

g n

15 O 3

(

d 10 2

o 2

5 s 1

A l 0 0 Cd163 EphA2 IL1b SRA1 TREM1 a a b 4 6 0 3 b F 1 1 IL IL 1 1 F N IL IL IL IL G T T HMC3 3D Single Culture 3D Coculture (HMC3 + HW1)

Figure 17: Co-culture of HMC3 microglia with human GBM cell line HW1.

(a) Proliferation of HW1 (GBM) cells in co-culture with microglia, and (b) proliferation of microglia in co-culture with GBM cells (n=4); (c) measured proliferation of HW1 (GBM) cells with both EphA2 expressing and knockdown microglia; and (d) measured proliferation of

Jiwrajka 2020 microglia cells (with and without EphA2) in co-culture with GBM (n=2); (e) mRNA expression in dissociated microglia from 3D coculture organoids of EphA2, CD163, IL1β, SRA1/CD204 and TREM1 (depicted as a fold change in relation to microglia in single culture); (f) ELISA of HMC3 cell culture supernatant from single culture organoid and co-culture organoid. (Two- way ANOVA; Error bars represent SEM, *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

The combination of red and green optical barcoding was again utilised in 2D culture to allow for Cytell analysis using InCell software, and to better visualise the cells on imaging as organoids. The images from Figure 16A were analysed using InCell Developer software. Cells were grown either alone or in co-culture for 7 days. Proliferation of microglia (HMC3) and GBM (HW1) cells were analysed (Figure 17A). Results show increased proliferation (p<0.05) and growth of HW1 GBM cells in co-culture with HMC3 cells when compared to GBM cells grown alone. These findings are consistent with previous co-culture studies (227). Interestingly, we also noted a significant (p<0.05) decrease in proliferation and growth rate of microglia in co-culture compared to single culture (Figure 17B). To assess whether EphA2 was contributing to the microglia-associated tumour proliferation response, EphA2 KD studies were conducted and proliferation measured over 7 days. Interestingly, tumour cell growth in co-culture with microglia was delayed following EphA2 KD, but microglia proliferation in co- culture remain unaffected (Figure 17C, D). These findings suggest that there could be a cytostatic effect of EphA2 KD on microglia affecting GBM cell proliferation, and further suggests an active contribution of EphA2 presented on microglia to GBM progression.

Seven days post co-culture cells were dissociated and subsequently sorted to enrich both populations based on fluorescence and RNA was isolated from the two cell populations for qPCR expression analysis. Specifically, the microglia qPCR expression analysis shows an increase in CD163, TREM1, IL1β and SRA1 (Figure 17E). CD163, an M2 phenotypic marker, associated with worse prognosis (228-230), and SRA1 is involved in both an M1 and M2 phenotype of microglia (231-233). Interestingly, in co-culture, the EphA2 expression on microglia was increased when compared to microglia in single culture, once again suggesting that EphA2 is actively involved in microglia activation states and promoting tumorigenesis. An ELISA cytokine release showed that in co-culture, there was a significant (p<0.05) decrease in IL6 secretion (Figure 17F). This finding suggests, in keeping with literature, that tumour associated microglia polarise more towards an M2 phenotype which is immune suppressive and tumour promoting (49, 234, 235).

Jiwrajka 2020

3.4 CONCLUSION EphA2 activation via soluble clustered EphrinA1-Fc ligand stimulation effectively promoted a more pro-inflammatory state, with the exception of Iba1 and CD68 which were both downregulated following activation. Furthermore, EphA2 activation resulted in conversion of microglia from a surveillant state to an activated state resulting in decreased migration and increased proliferation. EphA2 siRNA mediated KD decreased microglia pro-inflammatory cytokine release but had little effect on the M2/anti-inflammatory cytokine expression levels (e.g. CD163 and TGFβ). EphA2 KD also reduced microglia proliferation, while increasing migration and phagocytosis capability, indicating a switch to a more ‘surveillant’ phagocytic phenotype. In co-culture with primary GBM cells, EphA2 expressing microglia positively affected tumour cell proliferation, this effect was attenuated when EphA2 was downregulated on HMC3 cells. Taken together, these data highlight a clear functional role of EphA2 on microglia not only in modulating microglia states but also in the progression of GBM.

Jiwrajka 2020

4 CHAPTER 4: EPHA2 AND TUMOUR ASSOCIATED MACROPHAGES IN

PATIENT GBM SAMPLES

Chapter 4: Key Points • Tissue Microarrays were created using the tumour bank comprising of ‘normal’ brain, low grade glioma, GBM and recurrent GBM • Immunohistochemistry staining was developed on the TMAs enabling multiple antibodies to be stained on the same slide • EphA2 and Iba1 expression was quantified through imaging software • Co-localisation of EphA2 and Iba1 was observed • EphA2 expression correlated with survival (trend seen, but did not reach significance) • Iba1 expression was not correlated with survival • Co-localisation correlated with survival • Expression of EphA2 and Iba1 was validated using TCGA database • Paired samples from 6 patients were examined for differences between EphA2 and Iba1 in GBM and recurrent GBM samples: Iba1 expression was consistently higher in GBM samples compared to recurrent GBM samples • Paired samples from 6 patients were examined for differences between expression levels of EphA2 and Iba1 in ‘normal’/overlying brain and tumour: Iba1 expression was consistently higher in normal brain compared to tumour brain

4.1 INTRODUCTION It is well established that nearly a third of glioma biopsies have significant macrophage and microglia infiltration (131). Previous studies have shown microglia marker expression in glioma patient specimens, but no study to date has established an interaction between microglia/macrophage markers and EphA2 in GBM patient samples. Chapters 2 and 3 show that EphA2 is functional on microglia and likely contributes to GBM tumourigenesis. Therefore, we investigated the expression of EphA2 and microglia in GBM clinical specimens. In this chapter, tumours from the QIMR Berghofer/RBWH brain cancer tumour bank were studied. First, the demographic breakdown of the patients is defined, followed by the levels of microglia and EphA2 expression within these tumours, and correlation with relevant clinical data was performed.

Jiwrajka 2020

4.2 METHODS

4.2.1 Patient Samples and Clinical Data Informed consent was obtained from patients (or their enduring power of attorney) requiring surgical resection of their intracranial tumours (HREC/17/QRBW/577). A sample of the tumour was sent to the QIMR for research, and the remaining for histological diagnosis. Clinical data was tabulated using patient medical records from the Royal Brisbane and Women’s Hospital (RBWH) and supplemented using Queensland Oncology Online (QOOL) (HREC/17/QRBW/577).

4.2.2 Immunohistochemistry (IHC) Tissue Microarrays were made using glioma tissue received from the RBWH with the help of QIMR Histology department. Slides from paraffin blocks were made at 3-4um thickness on positively charged slides and incubated overnight at 37oC. The slides were rehydrated using the Lecia ST5010 Autostainer XL2 and incubated in 2% hydrogen peroxide for 10 mins. Sections were then subjected to 15 minutes at 105oC in BioCare Medical Decloaker for antigen retrieval in EDTA solution. EphA2 (Cell Signalling #6997S) rabbit mAb was used at 1:200 in BioCare Medical Da Vinci Green for 60 mins, and then stained with BioCare Medical MACH1 Rabbit HRP for 30 mins. Sections were subjected to a second antigen retrieval step at 125oC for 5 mins in Citrate buffer, stained with rabbit anti-Iba1 (Thermofisher PA5-27436) diluted (1:5000) for 60 mins. MACH 1 Universal polymer HRP was added for 30 mins. DAPI was added to the slides and counterstained with Hematoxylin in Leica XL1 Autostainer. Slides were imaged using the Aperio FL microscope.

4.2.3 Quantification of Iba1 and EphA2 expression Representative TMA cores (tumour samples) were utilised to instruct the QuPath software how to analyse each cell within the tumour. Each cell was marked with a nucleus, a cytoplasm, and a cell membrane in relation to background staining. The total number of cells or ‘events’ were calculated using DAPI staining, and a percentage of all cells positive for (i) EphA2, (ii) Iba1 and (iii) EphA2 and Iba1 (co-localised) within the tumour were reported.

4.2.4 EphA2 and Iba1 expression using The Cancer Genome Atlas (TCGA) The Cancer Genome Atlas through the cBioPortal was accessed to measure the genetic expression of EphA2 and Iba1 in GBM and Low Grade Gliomas (LGG) (236, 237). The query on cBioportal was developed by selecting studies within the “CNS/Brain” tab. Two studies were included in the query: (i) Brain Lower Grade Glioma (TCGA, PanCancer Atlas) and (ii)

Jiwrajka 2020

Glioblastoma (TCGA, Cell 2013) comprising of 514 and 543 samples respectively (238-240). Subsequently, the genes of interest included “AIF1” and “EPHA2” corresponding to Iba1 and EphA2 respectively. The data for mRNA expression (RNA seq V2 RSEM) was downloaded based on the tumour type. Low grade gliomas comprised of astroyctomas, oligodendrogliomas and oligo-astrocytoma. GBM was limited to glioblastoma multiforme cancer type only. The data was subsequently plotted and analysed using GraphPad Prism.

4.3 RESULTS The Sid Faithfull Brain Cancer Laboratory generously receives patient tumour samples from the RBWH Neurosurgery department. Table 4 shows the demographic data of 89 patients and Table 5 shows the demographic data for 8 patients with recurrent GBM (in total out of 104 patients selected, only 97 analysed due to quality of the cores) that were selected from the tumour bank based on the pathology report and the quality of the tissue received. Each paraffin block was manually reviewed in consultation with the QIMR Histology department and three Tissue Microarrays (TMAs) were generated (Figure 18). Each TMA contained mouse liver as a control.

Jiwrajka 2020

Table 4: Patient demographics for tumour samples used in the development of TMAs and IHC analysis.

Demographics Number of Patients % (n=89)‡ Sex Female 31 37.35 Male 52 62.65 Total 83 100 Age <60 years 44 49.4 ≥60 years 45 50.6 Total 89 100 Tumour Location Frontal 36 42.86 Temporal 29 34.52 Parietal/Temporo-Parietal 11 13.10 Other (including Occipital, Insular, 8 9.52 Intraventricular) Total 84 100 Tumour Type Control (including mesial temporal 9 10.11 sclerosis, haemorrhage, no tumour) GBM 73 82.02 Low Grade Gliomas 7 7.87 Recurrent GBM Table 5 Table 5 Total 89 100 ECOG 0 5 15.38 1 14 53.85 2 6 23.08 3 2 7.69 Total 26 100 IDH Status

Jiwrajka 2020

WT 9 64.28 Mutant 5 35.71 Total 14 100 ‡Some patient data missing from QOOL database; Frequency and percentage of sex, tumour location, tumour type and ECOG scores of the 235 TMA core samples from 104 patients, out of which only 89 patients had cores that were able to be analysed; discrepancy in total number of patients demonstrates missing data for patients from the QOOL database.

Jiwrajka 2020

Table 5: Recurrent GBM patient demographics for tumour samples used in the development of TMAs and IHC analysis.

Demographics Number of Patients % (n=8) Sex Female 4 50 Male 4 50 Age <60 4 50 ≥60 4 50 Tumour Location Frontal 2 33.3 Parietal or Temporal-Parietal 2 33.3 Temporal 2 33.3 ECOG 0 3 75 1 1 25 Total 4 100 IDH status WT 6 75 Mutant 2 25

To assess levels of macrophage infiltrate present in brain tumours we performed immunohistochemistry (IHC) for Iba1. Initially, 3,3′-Diaminobenzidine (DAB) staining for Iba1, was optimised using mouse tissue and then from patient glioma tissue received from the RBWH (Figure 18A). Preliminary data showed high expression of Iba1 in tumour tissue compared to ‘normal’ brain tissue from the same patient (Figure 18B). We now propose to assess EphA2 expression on brain tumour infiltrating microglia.

The above protocol was developed after optimisation for tyramide staining on formalin-fixed paraffin-embedded (FFPE), as in the past DAB staining for EphA2 has only been possible on optimal cutting temperature compound (OCT) blocks. Tyramide staining allowed for both Iba1 and EphA2 antibodies to be stained on the same slide in order to assess co-localization of

Jiwrajka 2020

EphA2 and Iba1. The slides were imaged using the Aperio FL microscope, and analysed using QuPath Analysis Software (Figure 18D).

Expression levels were correlated with clinical data tabulated from Queensland Oncology Online (QOOL), and data received from RBWH. A demographic breakdown of the patient samples is shown in Table 4. Statistical analyses were conducted with the help of Ms Anita Pelecanos from the QIMR Statistics Unit. Statistical analyses were conducted using STATA and Graph Pad Prism.

Jiwrajka 2020

Figure 18: Immunohistochemical staining of patient GBM samples.

Jiwrajka 2020

(a) DAB staining of ADW1 tumour sample showing Iba1 staining (b) Analysis of % positivity of Iba1 DAB staining using Aperio Imaging and ImageJ software demonstrating a high Iba1 positivity in the intraoperative ‘tumour’ brain sample compared to intraoperative ‘normal’ or overlay brain sample; (c) H&E staining of three TMAs created of patient glioma samples, including low grade gliomas, GBM, recurrent GBM, non-tumour ‘control’ and mouse liver ‘negative control’ samples; (d) Representative image of tyramide staining demonstrating EphA2 (FITC/green), Iba1 (Cy3/red) and nuclear staining (DAPI) for three sample patients (Patient 1/MEH; Patient 2/PGC and Patient 3/JUM).

Overall, there was high levels of EphA2 and Iba1 across the tumour cores analysed, and co- localisation of Iba1 and EphA2 was seen in a fraction of tumour samples. Additionally, our data confirm previous findings from others that a high expression EphA2 is correlated with poor survival (Figure 19B) although statistical significance was not reached (198, 200). There was no effect on survival based on the Iba1 expression, but interestingly, the population of patients that had high co-expression of EphA2 and Iba1 had a poor survival prognosis (Figure 19B,C) (however, it is acknowledged that statistical significance was not reached).

Jiwrajka 2020

Figure 19: Total EphA2 expression and Iba1 Expression in patient tumour samples correlated with survival.

Jiwrajka 2020

(a) EphA2 expression and (b) correlation with survival in tumour samples (median survival “low <10%” = 433 days (SE 103.5, CI 333-641); median survival “high≥10%” = 358 days (SE 69.9, CI 243-605) χ2=1.35, p=0.2455; (c) Iba1 expression and (d) correlation with survival (median survival “low <10%” = 425 days (SE 49.4, CI 292-832); median survival “high≥10%” = 390 days (SE 47.5, CI 295-614) χ2=0.14, p=0.7081; (e) Co-localisation of EphA2 and Iba1 in tumour samples and (f) correlation with survival (median survival “low <10%” = 429 days (SE 88.6, CI 326-623); median survival “high≥10%” = 339 days (SE 47.4, CI 68-394) χ2=3.48, p=0.0620.

Upon categorising expression based on tumour type (control or normal brain, low grade glioma, GBM and recurrent GBM), our findings appeared consistent with larger datasets such as The Cancer Genome Atlas (TCGA) ( Figure 20) (38). We also validated that, as expected, patients with a low grade glioma survived longer than patients with GBM and patients with Recurrent GBM displayed the shortest survival times (Figure 21).

Jiwrajka 2020

EphA2 mRNA expression )

2 6000

(

E 4000

S ****

2 V

2000

0 N

R ) ) 3 n 1 a 0 C 2 n A a G P C A (T G C M T B ( G G G L e

AIF1 mRNA expression )

2 20000

(

M 15000

S R

10000

2 ****

q 5000

0 N

R ) ) 3 n 1 a 0 C 2 n A a G P C A (T G C M T B ( G G G L

Figure 20: RNA-seq expression data on glioma samples from the TCGA in comparison with IHC expression data from tumour bank.

(a) IHC expression of EphA2, (b) Iba1 and (c) Co-localisation (EphA2, Iba1) based on tumour grade (Control, Low grade glioma, GBM, Recurrent GBM) from the tumour bank; TCGA RNA-seq expression data on GBM and LGG for (d) EphA2 and (e) Iba1. (d, e represented as individual values and mean; Mann-Whitney U test; *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001).

Jiwrajka 2020

a b Kaplan-Meier Survial Estimate Kaplan-Meier Survial Estimate

LGG vs GBM GBM vs Recurrent GBM

l l

a 100

i v

LGG v r

r GBM u

GBM u Recurrent GBM

t n

50 n 50

r e e p=0.0024

p=0.0252 P P 0 0 0 500 1000 1500 2000 2500 0 500 1000 1500 2000 2500 Days Days

Figure 21: Kaplan Meier Survival Estimates based on tumour grade.

(a) Low Grade Gliomas (LGG) patients survive longer than patients with GBM (p=0.0252) and (b) patients with Recurrent GBM survive shorter than patients with GBM (p=0.0024).

Similarly, as expected patients younger patients (below 60 years of age) had a better prognosis compared to the older patients (Figure 22B). Within our tumour bank, we found that patients with frontal tumours expressed high EphA2, and we sought to correlate the same with survival (Figure 22C, D). Interestingly, parietal tumours had a better prognosis compared to the frontal tumours; however, this could be due to many other factors including surgical recovery.

In our in-house tumour bank, IDH1 WT patients expressed higher EphA2 compared to IDH1 mutant patients (Figure 22E). IDH1 status is a notable prognostic factor (241), however in our tumour bank, there was no correlation with IDH status and survival, possibly due to a limitation in the number of patients examined.

Jiwrajka 2020

a b Kaplan-Meier Survival Estimate Kaplan-Meier Survival Estimate

Sex Age l

l 100 100

i v

v Male <60

r u

u >60 s

Female s

t 50 t

n 50

r e

p=0.3750 e P P p=0.0007 0 0 0 1000 2000 3000 0 1000 2000 3000 c Days d Days Expression Kaplan-Meier Survival Estimate Location of Tumour Location of Tumour

e 100

i l

e Frontal

t 100

r v s Frontal o Parietal or Temporal-Parietal

80 i

c v

Parietal/Parieto-Temporal

Temporal r

u u

s 60 Other Temporal

e Other

m 50

n c

e e

f 20 p=0.0067

% 0 0 EphA2 Iba1 EphA2,Iba1 0 1000 2000 3000 e f Days Expression Kaplan-Meier Survival Estimate IDH Status IDH Status

e 100

l e

t 100

a i

r IDH WT

s o

80 i IDH WT o

c IDH Mutant

r p

r IDH Mutant

u u

s 60

t e

m 50

n c

e e

f 20

P p

o p=0.8810

% 0 0 EphA2 Iba1 EphA2,Iba1 0 500 1000 1500 2000 2500 Days

Figure 22: Demographic data and correlation with EphA2 and Iba1.

(a) Sex (b) Age and correlation with survival; (c) Expression of EphA2, Iba1 and colocalization based on location of tumour within the brain (d) Kaplan-Meier Survival curve for location of tumour; (e) IDH WT and Mutant expression of EphA2, Iba1 and co-localisation (f) Kaplan- Meier Survival curve for IDH status.

Jiwrajka 2020

a d

EphA2 Expression in Paired Samples EphA2 Expression in Paired Samples

v i

80 i 80

i r

r Overly s

GBM s

o o

c Tumour

60 c 60

Recurrent

l o

40 o 40

20 20

0 0

% % CM FGH LFW NG RR SS AL JRT RAH RE VT

b Patient e Patient

Iba1 Expression in Paired Samples Iba1 Expression in Paired Samples

v i

i ***

i r

r GBM Overly

s o

o 40 Recurrent 40 o

o Tumour

s u

u **

o e

e 20 20

e o

o 0 0

% % CM FGH LFW NG RR SS AL JRT RAH RE VT

Patient Patient c f

Colocalisation in Paired Samples Colocalisation in Paired Samples

v i

20 i 10

i r

GBM r

s o

Recurrent o Overly

o c

15 c

p Tumour

l l

l 5 o

10 o

e o

o 0

% % CM FGH LFW NG RR SS AL JRT RAH RE VT

Patient Patient

Figure 23: Paired samples from select patients.

(a) EphA2, (b) Iba1 and (c) Co-localisation EphA2, Iba1 expression in paired (n=6) patients with GBM and recurrent GBM; (d) EphA2, (e) Iba1 and (f) Co-localisation EphA2, Iba1 expression in paired (n=5) patients with normal/overlay and tumour brain (Two-way ANOVA; *p≤0.05, **p≤0.01, ***p≤0.001 and ****p≤0.0001; median and IQR depicted. Overall Median and IQR shown in Table 6).

In some cases, the SFBC Laboratory also receives tumours from the patient’s second surgical resection of GBM in the event they develop recurrent GBM. In our tumour bank, 6 such patients were identified, and the expression levels of EphA2, Iba1 and co-localization was compared between the patient’s initial GBM compared to the patient’s recurrent GBM (Table 6). Although no difference was noted between EphA2 expression, Iba1 expression seemed consistently higher in the initial tumour than the recurrent GBM, suggesting that perhaps the tumour associated microglia/macrophages lose their pro-inflammatory function, and are

Jiwrajka 2020 exhausted at recurrence (Figure 23B). This, of course, may be a by-product of systemic immunosuppression after chemotherapy.

Occasionally, ‘normal’ or overlying brain from a surgical resection is also banked, which is processed and stored in paraffin embedded blocks. Five patients were identified from the tumour bank who had both ‘normal’ and ‘tumour’ sections resected (Table 7). Although EphA2 expression was non-specific, overall, Iba1 expression seemed higher in the tumour rather than in the overlying ‘normal’ brain (Figure 23E). Although our 3D co-culture organoid model in Chapter 3 showed that microglia actively encircle tumour cells, the mechanism by which microglia infiltrate the tumour (as evidenced by the tumour biopsies and extensive Iba1 staining within tumours) remains unclear.

Table 6: EphA2, Iba1 and Co-localisation Expression in GBM and Recurrent GBM samples from paired patients

GBM, Median (IQR) Recurrent GBM, Difference, Median Median (IQR) (IQR) EphA2 9.20 (8.93 – 13.88) 8.03 (3.66 – 2.28 (-3.06 – 8.93) 14.63) Iba1 16.20 (12.63 – 7.03 (4.39 – 8.60 (6.08 – 12.81) 22.58) 12.71) Iba1/EphA2 0.84 (0.16 – 1.41) 0.44 (0.21 – 1.87) -0.14 (-0.90 – 1.08) (co-localization)

Table 7: EphA2, Iba1 and Co-localisation Expression in Normal (overly or control) and Tumour samples from paired patients

Normal, median Tumour, median Difference, median (IQR) (IQR) (IQR) EphA2 4.12 (1.32 – 5.25 (3.27 – 13.27) -2.89 (-4.68 – 1.06) 9.48) Iba1 7.52 (7.17 – 18.18 (6.21 – 33.50) -4.76 (-25.76 – 0.96) 9.16) Iba1/EphA2 0.27 (0.08 – 3.20 (0 – 4.06) -2.76 (-3.62 – 0) (colocalization) 0.44)

Jiwrajka 2020

4.4 CONCLUSION Analysis of clinical specimens from our in-house tumour bank were consistent with findings from others, and large genome database such as the TCGA. IHC analysis of tumour cores demonstrate a co-localisation of Iba1 with EphA2, further validating our in vitro functional studies. However, co-localisation was not as high as expected suggesting that EphA2 and Iba1 may have further mechanism to modulate the expression. EphA2 expression is associated with decreased survival and co-localisation of EphA2, Iba1 is associated with a very poor prognosis. Patients with recurrent GBM demonstrate lower Iba1 expression compared to the Iba1 expression levels in the primary GBM. This could be due to chemoradiation, therapy and high dose steroid treatment that the patient typically receive after the surgical resection of the initial tumour, causing immunosuppression.

Jiwrajka 2020

5 CHAPTER 5: DISCUSSION (LIMITATIONS AND FUTURE DIRECTIONS)

In this study, Eph and ephrin family member expression on microglia was assessed. In particular, EphA2 was found to be highly expressed on the cell surface of the human microglia cell line HMC3, where EphA2 expression was modulated during microglia activation states. Given this modulation, the next step was to study the functional role of EphA2 on microglia, by assessing first, the microglia antigenic/cytokine profile and subsequently, common cellular functions including migration, proliferation, and phagocytosis. It was found that microglia activation states are affected by ephrinA1-Fc mediated activation of EphA2. Overall, EphA2 activation resulted in a pro-inflammatory microglia phenotype, increasing cell proliferation, with a reduction in migration. Conversely, down regulation of the receptor, using siRNA, appeared to induce a more ‘anti-inflammatory’ phenotype, characterised by the expression of CD163 and TGFβ while a decreasing broad expression of known M1 phenotypic markers and increasing phagocytosis. EphA2 KD broadly induced opposite effects to EphA2 activation: i.e., decreased proliferation and increased migration, suggesting both kinase dependent and independent functions. This phenomenon is well described in the Eph receptor field in both development and disease (8).

A limitation of this thesis, due to a relative paucity of human microglial cell lines, was that the majority of the study was conducted on a single human cell line HMC3. Although HMC3 cells have been shown to work as a robust microglia model, the cells have not been fully characterised in previous studies (201). In order to fully characterise the HMC3 cell line, future studies including a comprehensive list of macrophage/microglia markers as well as ELISA arrays will be needed. Future studies would also include activation of microglia using IL-4 instead of LPS to induce a more M2, or ‘anti-inflammatory’ phenotype. Unfortunately, there are very few human microglia cell lines established for in-vitro studies, and future directions would also include experiments on induced pluripotent stem cells (iPSCs).

In order to further elucidate EphA2 expression in the microglia cell lines, and the location of the EphA2 expression, future studies would include repetition of the immunofluorescence and flow cytometry assays at both 4°C and room temperature to assess receptor internalisation. Additionally, flow cytometry assays with and without permeabilization would also be assessed to quantify expression of EphA2 both at the surface level and internally. Membrane specific markers would also be utilised in future experiments, to localise the EphA2 expression.

Jiwrajka 2020

Microglia function is a complex field of study that is still poorly understood. Although there are multiple classification methods of microglia phenotypic states, there is no one classification methodology that adequately summarizes microglia phenotypes and function. Microglia polarization into M1 and M2 is based on macrophage classification and does not always hold true in vivo. Similarly, the microglia ‘resting’ and ‘activated’ classification is antiquated and obsolete given that even in the ‘resting state’, microglia are functional and surveying the microenvironment. In order to understand Eph and ephrins in the context of microglia plasticity, this study attempted to utilise a series of phenotypic markers, however by no means comprehensive in fully understanding or characterising function (201, 242). Future studies would include a high-throughput screen stimulating and inhibiting microglia with soluble ligands released by tumour cells in addition to LPS to simulate a tumour microenvironment, and also measuring a larger panel of cytokines released with EphA2 activation and knockdown.

As is well known, microglia change morphology at various activation states, in order to determine a quantitative marker for microglial morphology, many different morphometric analyses were conducted for mean radius, ‘circularity’ or form factor, and number of ramifications of microglia. However, these measures did not adequately represent the changes in morphology of microglia (data not shown). Future studies would include morphometric analysis of microglia using established automated tools, which have been previously applied in the stroke setting (243).

Eph and ephrin signalling is also complex especially due to the promiscuity of Eph receptors and their ligands. Additionally, Eph receptor signalling can cause both ‘activation’ and ‘inactivation’ of the target cell or both adhesion and repulsion of the cell depending on whether the signalling is forward or reverse. Although ephrinA1-Fc is the high affinity ligand for EphA2, it is known that Eph/ephrins demonstrate promiscuity across the various Eph and ephrin groups. Therefore, although some of these effects can be attributed to EphA2 (as validated by the knockdown experiments), it is possible that other Eph and ephrins may also be playing a role. Future studies in EphA2 KD cells with and without ephrinA1-Fc treatment are necessary to fully elucidate the mechanism of action (244, 245).

Although it may be considered paradoxical that microglia proliferation and migration are inversely related, microglia phenotypic states are possibly the reason for these findings. It is hypothesized that although the microglia may proliferate more in the context of a tumour, the invasion of a GBM with macrophages are possibly bone marrow derived, and perhaps the less

Jiwrajka 2020 migratory and more proliferative resident microglia are involved in the initial response and further recruiting peripheral macrophages into the tumour.

In this study, effective knockdown of EphA2 was achieved using a transient siRNA approach. A constitutive stable knock down of EphA2 (e.g. shRNA mediated or CRISPR) would be useful both for in vitro and possible future in vivo studies. During this study, although the shRNA constructs had been created and amplified, transfection of HMC3 cells with the EphA2 KD shRNA is pending due to failed attempts with transfection thus far. Initially, the shRNA constructs were toxic to the cells, and upon optimisation of the transfection methodology, the construct failed to yield a >50% knockdown over subsequent passages. This may have been due to the fact that HMC3 are in-part dependent on EphA2 for survival and cells in which a greater KD was achieved were lost from the population. Another approach tested was to isolate EphA2low versus EphA2high expressing cells, utilising a FACS sorter, but this technique proved ineffective as low expressing cells rapidly re-expressed the receptor preventing effective functional studies.

In co-culture with human GBM cells, microglia and GBM cells displayed a strong segregation pattern, and notably microglia encircled GBM cells when cultured as 3D organoids, potentially suggesting a phenomenon seen in in vivo. Interestingly, GBM cells displayed a marked increase in proliferation when co-cultured with microglia, reinforcing the oncogenic role these cells play in promoting aggressive brain cancer growth. Down regulation of EphA2 on HMC3 cells was effective in reversing this GBM proliferation response highlighting a strong functional role in promoting GBM tumourigenesis. These co-culture experiments were intriguing, and future studies would be interesting to show a transmigration of microglia into the tumour, and immunohistochemical staining of EphA2 and its corresponding ligands. It would also be beneficial to track the movement of microglia cells with and without EphA2 to study the path microglia take when interacting with GBM cells in a 3D organoid environment. Furthermore, our 3D coculture model sheds light into how microglia may serve as growth limiting for the GBM cells and limit their local invasion of normal brain parenchyma. If microglia engulf and encircle the tumour as demonstrated in the organoid models, this may limit GBM infiltration of the normal tissue, and may explain why patients who have had infection may demonstrate increased response to therapy, including maximal safe resection, radiotherapy and chemotherapy. Therefore, this opens an avenue to therapies that promote microglia migration to encircle the tumour, which may in turn limit GBM invasion.

Jiwrajka 2020

It would also be important to validate these findings in-vivo and could be achieved by co- engraftment of microglia plus or minus EphA2 with GBM cells into the brains of immunocompromised mice. Animal models with the fluorescent labelled GBM and microglia might shed light into the migration and proliferation of the cells in-vivo. It would also be interesting to see a difference in GBM growth and microglia recruitment between immunosuppressed and immunocompetent animal models.

Future studies could include not only microglia as a therapeutic target, but also microglia as a possible diagnostic tool. Our study establishes that microglia do engulf tumours, and fluorescent or radiolabelling the microglia might provide a suitable margin for maximal safe resection.

The SFBC laboratory at QIMR Berghofer kindly receives tumour samples from patients who have granted informed consent for research at the RBWH. Although the tissue microarrays included a large proportion of patient samples, there remains a large proportion of tumour samples not included in the TMAs. Development of multiple TMAs with other samples would be interesting for staining to ascertain a difference between macrophages in general, and specifically microglia (using a microglia specific marker such as TMEM119). Co-localisation of other Eph and ephrins would also be interesting. This study utilised a tyramide IHC staining approach which allows for multi-panel staining, and with no restrictions on the antibody type. Therefore, up to six antibodies could potentially be stained onto one slide, opening an avenue to check multiple types of interactions between Eph and ephrins and microglia in the context of GBM. Access to the clinical database QOOL was delayed during the course of the study but has provided updated information on survival data and pathology reports for the QIMR Berghofer brain cancer tumour bank. Some patients, however, who are not included on this database, and as such their clinical information is still pending. Further in-depth analysis of the clinical data, including epidemiological information, would also be of benefit to find correlates of poor or better response.

In summary, this study is a first of its kind, and uncovers a functional role of EphA2 expressed on microglia in supporting GBM growth and maintenance. Novel findings show that microglia express some Eph and ephrin family members highly and that modulation of EphA2 on microglia affects its phenotype and functional status. Although there is little consensus on microglia phenotypic states, EphA2 seems to in-part alter these states in a manner that causes microglia proliferation, migration, and phagocytic ability. Future studies will be needed to fully

Jiwrajka 2020 understand how EphA2 mediates these functions. It will also be important to establish an EphA2 constitutive KD that is not toxic to the cells to better elucidate function. Additionally, 3D co-culture studies were promising and suggest that this approach may be a more faithful representation of the true disease state. The field is effectively only now starting to appreciate the complexity and importance of the tumour micro-environment on GBM progression. This study aids in further understanding this important biology and informs future microglia research efforts. Lastly, this study may pave the way for future translational studies and clinical trials in the assessment of approaches directed at targeting EphA2 specifically on microglia and macrophages to provide greater benefit to GBM sufferers.

Jiwrajka 2020

6 REFERENCES

1. Frankel SA, German WJ. Glioblastoma multiforme; review of 219 cases with regard to natural history, pathology, diagnostic methods, and treatment. Journal of neurosurgery. 1958;15(5):489-503. 2. Paszat L, Laperriere N, Groome P, Schulze K, Mackillop W, Holowaty E. A population-based study of glioblastoma multiforme. International journal of radiation oncology, biology, physics. 2001;51(1):100-7. 3. Nicolaidis S. Biomarkers of glioblastoma multiforme. Metabolism: clinical and experimental. 2015;64(3 Suppl 1):S22-7. 4. Crespo I, Vital AL, Gonzalez-Tablas M, Patino Mdel C, Otero A, Lopes MC, et al. Molecular and Genomic Alterations in Glioblastoma Multiforme. The American journal of pathology. 2015;185(7):1820-33. 5. Coulthard MG, Morgan M, Woodruff TM, Arumugam TV, Taylor SM, Carpenter TC, et al. Eph/Ephrin Signaling in Injury and Inflammation. The American journal of pathology. 2012;181(5):1493-503. 6. Day BW, Stringer BW, Al-Ejeh F, Ting MJ, Wilson J, Ensbey KS, et al. EphA3 maintains tumorigenicity and is a therapeutic target in glioblastoma multiforme. Cancer cell. 2013;23(2):238-48. 7. Ferluga S, Debinski W. Ephs and Ephrins in malignant gliomas. Growth factors (Chur, Switzerland). 2014;32(6):190-201. 8. Pasquale EB. Eph receptors and ephrins in cancer: bidirectional signalling and beyond. Nature reviews Cancer. 2010;10(3):165-80. 9. Day BW, Stringer BW, Boyd AW. Eph receptors as therapeutic targets in glioblastoma. British journal of cancer. 2014;111(7):1255-61. 10. Markovic DS, Glass R, Synowitz M, Rooijen N, Kettenmann H. Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2. J Neuropathol Exp Neurol. 2005;64:754-62. 11. Bettinger I, Thanos S, Paulus W. Microglia promote glioma migration. Acta neuropathologica. 2002;103(4):351-5. 12. Hambardzumyan D, Gutmann DH, Kettenmann H. The role of microglia and macrophages in glioma maintenance and progression. Nat Neurosci. 2016;19(1):20-7.

Jiwrajka 2020

13. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger PC, Jouvet A, et al. The 2007 WHO Classification of Tumours of the Central Nervous System. Acta neuropathologica. 2007;114(2):97-109. 14. Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer cell. 2010;17(1):98-110. 15. Wang Q, Hu B, Hu X, Kim H, Squatrito M, Scarpace L, et al. Tumor Evolution of Glioma-Intrinsic Gene Expression Subtypes Associates with Immunological Changes in the Microenvironment. Cancer cell. 2017;32(1):42-56.e6. 16. Louis DN, Perry A, Reifenberger G, von Deimling A, Figarella-Branger D, Cavenee WK, et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta neuropathologica. 2016;131(6):803-20. 17. Kubben PL, ter Meulen KJ, Schijns OEMG, ter Laak-Poort MP, van Overbeeke JJ, Santbrink Hv. Intraoperative MRI-guided resection of glioblastoma multiforme: a systematic review. Lancet Oncology. 2011;12(11):1062-70. 18. Johnson DR, O’Neill BP. Glioblastoma survival in the United States before and during the temozolomide era. Journal of Neuro-Oncology. 2012;107(2):359-64. 19. Chang SM, Parney IF, Huang W, Anderson FA, Jr., Asher AL, Bernstein M, et al. Patterns of care for adults with newly diagnosed malignant glioma. Jama. 2005;293(5):557-64. 20. Hart MG, Garside R, Rogers G, Stein K, Grant R. Temozolomide for high grade glioma. The Cochrane database of systematic reviews. 2013;4:Cd007415. 21. Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer RC, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. The Lancet Oncology. 2009;10(5):459-66. 22. Hervey-Jumper SL, Berger MS. Role of Surgical Resection in Low- and High-Grade Gliomas. Current Treatment Options in Neurology. 2014;16(4):1-19. 23. Almeida JP, Chaichana KL, Rincon-Torroella J, Quinones-Hinojosa A. The Value of Extent of Resection of Glioblastomas: Clinical Evidence and Current Approach. Current Neurology and Neuroscience Reports. 2014;15(2):1-13. 24. Kita D, Ciernik IF, Vaccarella S, Franceschi S, Kleihues P, Lutolf UM, et al. Age as a predictive factor in glioblastomas: population-based study. Neuroepidemiology. 2009;33(1):17-22.

Jiwrajka 2020

25. Mazaris P, Hong X, Altshuler D, Schultz L, Poisson LM, Jain R, et al. Key determinants of short-term and long-term glioblastoma survival: A 14-year retrospective study of patients from the Hermelin Brain Tumor Center at Henry Ford Hospital. Clinical Neurology and Neurosurgery.120:103-12. 26. Field KM, Rosenthal MA, Yilmaz M, Tacey M, Drummond K. Comparison between poor and long-term survivors with glioblastoma: Review of an Australian dataset. Asia-Pacific Journal of Clinical Oncology. 2014;10(2):153-61. 27. Ostrom QT, Gittleman H, Fulop J, Liu M, Blanda R, Kromer C, et al. CBTRUS Statistical Report: Primary Brain and Central Nervous System Tumors Diagnosed in the United States in 2008-2012. Neuro-oncology. 2015;17 Suppl 4:iv1-iv62. 28. Masui K, Mischel PS, Reifenberger G. Molecular classification of gliomas. Handbook of clinical neurology. 2016;134:97-120. 29. Oberheim Bush NA, Hervey-Jumper SL, Berger MS. Management of Glioblastoma, Present and Future. World Neurosurgery. 2019;131:328-38. 30. Lacroix M, Abi-Said D, Fourney DR, Gokaslan ZL, Shi W, DeMonte F, et al. A multivariate analysis of 416 patients with glioblastoma multiforme: prognosis, extent of resection, and survival. Journal of neurosurgery. 2001;95(2):190-8. 31. Sanai N, Polley MY, McDermott MW, Parsa AT, Berger MS. An extent of resection threshold for newly diagnosed glioblastomas. Journal of neurosurgery. 2011;115(1):3-8. 32. Stummer W, Pichlmeier U, Meinel T, Wiestler OD, Zanella F, Reulen HJ. Fluorescence-guided surgery with 5-aminolevulinic acid for resection of malignant glioma: a randomised controlled multicentre phase III trial. The Lancet Oncology. 2006;7(5):392-401. 33. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med. 2005;352(10):987-96. 34. Joensuu H, Puputti M, Sihto H, Tynninen O, Nupponen NN. Amplification of genes encoding KIT, PDGFRα and VEGFR2 receptor tyrosine kinases is frequent in glioblastoma multiforme. The Journal of Pathology. 2005;207(2):224-31. 35. Puputti M, Tynninen O, Sihto H, Blom T, Mäenpää H, Isola J, et al. Amplification of KIT, PDGFRA, VEGFR2, and EGFR in Gliomas. Molecular Cancer Research. 2006;4(12):927-34. 36. Snuderl M, Fazlollahi L, Le LP, Nitta M, Zhelyazkova BH, Davidson CJ, et al. Mosaic amplification of multiple receptor tyrosine kinase genes in glioblastoma. Cancer cell. 2011;20(6):810-7.

Jiwrajka 2020

37. Huse JT, Holland EC. Targeting brain cancer: advances in the molecular pathology of malignant glioma and medulloblastoma. Nature reviews Cancer. 2010;10(5):319-31. 38. Cancer Genome Atlas Research N. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature. 2008;455(7216):1061-8. 39. Pearson JRD, Regad T. Targeting cellular pathways in glioblastoma multiforme. Signal Transduction and Targeted Therapy. 2017;2(1):17040. 40. Rao SK, Edwards J, Joshi AD, Siu IM, Riggins GJ. A survey of glioblastoma genomic amplifications and deletions. J Neurooncol. 2010;96(2):169-79. 41. Parsons DW, Jones S, Zhang X, Lin JC, Leary RJ, Angenendt P, et al. An integrated genomic analysis of human glioblastoma multiforme. Science. 2008;321(5897):1807-12. 42. Szerlip NJ, Pedraza A, Chakravarty D, Azim M, McGuire J, Fang Y, et al. Intratumoral heterogeneity of receptor tyrosine kinases EGFR and PDGFRA amplification in glioblastoma defines subpopulations with distinct growth factor response. Proc Natl Acad Sci U S A. 2012;109(8):3041-6. 43. Louveau A, Smirnov I, Keyes TJ, Eccles JD, Rouhani SJ, Peske JD, et al. Structural and functional features of central nervous system lymphatic vessels. Nature. 2015;523(7560):337-41. 44. Carson MJ, Doose JM, Melchior B, Schmid CD, Ploix CC. CNS immune privilege: hiding in plain sight. Immunol Rev. 2006;213:48-65. 45. Hussain SF, Yang D, Suki D, Aldape K, Grimm E, Heimberger AB. The role of human glioma-infiltrating microglia/macrophages in mediating antitumor immune responses. Neuro- oncology. 2006;8(3):261-79. 46. Bowles AP, Jr., Perkins E. Long-term remission of malignant brain tumors after intracranial infection: a report of four cases. Neurosurgery. 1999;44(3):636-42; discussion 42- 3. 47. Mahaley MS, Jr., Brooks WH, Roszman TL, Bigner DD, Dudka L, Richardson S. Immunobiology of primary intracranial tumors. Part 1: studies of the cellular and humoral general immune competence of brain-tumor patients. Journal of neurosurgery. 1977;46(4):467- 76. 48. Brooks WH, Netsky MG, Normansell DE, Horwitz DA. Depressed cell-mediated immunity in patients with primary intracranial tumors. Characterization of a humoral immunosuppressive factor. J Exp Med. 1972;136(6):1631-47.

Jiwrajka 2020

49. Hussain SF, Yang D, Suki D, Aldape K, Grimm E, Heimberger AB. The role of human glioma-infiltrating microglia/macrophages in mediating antitumor immune responses. Neuro- oncology. 2006;8(3):261-79. 50. Pardoll DM. The blockade of immune checkpoints in cancer immunotherapy. Nature Reviews Cancer. 2012;12(4):252-64. 51. Fabry Z, Schreiber HA, Harris MG, Sandor M. Sensing the microenvironment of the central nervous system: immune cells in the central nervous system and their pharmacological manipulation. Curr Opin Pharmacol. 2008;8(4):496-507. 52. Desai K, Hubben A, Ahluwalia M. The Role of Checkpoint Inhibitors in Glioblastoma. Targeted Oncology. 2019;14(4):375-94. 53. Fessas P, Lee H, Ikemizu S, Janowitz T. A molecular and preclinical comparison of the PD-1-targeted T-cell checkpoint inhibitors nivolumab and pembrolizumab. Semin Oncol. 2017;44(2):136-40. 54. Johnson DB, Frampton GM, Rioth MJ, Yusko E, Xu Y, Guo X, et al. Targeted Next Generation Sequencing Identifies Markers of Response to PD-1 Blockade. Cancer Immunol Res. 2016;4(11):959-67. 55. Song M, Chen X, Wang L, Zhang Y. Future of anti-PD-1/PD-L1 applications: Combinations with other therapeutic regimens. Chin J Cancer Res. 2018;30(2):157-72. 56. Cloughesy TF, Mochizuki AY, Orpilla JR, Hugo W, Lee AH, Davidson TB, et al. Neoadjuvant anti-PD-1 immunotherapy promotes a survival benefit with intratumoral and systemic immune responses in recurrent glioblastoma. Nat Med. 2019;25(3):477-86. 57. Bagley SJ, Desai AS, Linette GP, June CH, O'Rourke DM. CAR T-cell therapy for glioblastoma: recent clinical advances and future challenges. Neuro-oncology. 2018;20(11):1429-38. 58. Engelhardt B. Molecular mechanisms involved in T cell migration across the blood- brain barrier. J Neural Transm (Vienna). 2006;113(4):477-85. 59. O'Rourke DM, Nasrallah MP, Desai A, Melenhorst JJ, Mansfield K, Morrissette JJD, et al. A single dose of peripherally infused EGFRvIII-directed CAR T cells mediates antigen loss and induces adaptive resistance in patients with recurrent glioblastoma. Sci Transl Med. 2017;9(399):eaaa0984. 60. Brown CE, Starr R, Aguilar B, Shami AF, Martinez C, D'Apuzzo M, et al. Stem-like tumor-initiating cells isolated from IL13Rα2 expressing gliomas are targeted and killed by IL13-zetakine-redirected T Cells. Clin Cancer Res. 2012;18(8):2199-209.

Jiwrajka 2020

61. Akhavan D, Alizadeh D, Wang D, Weist MR, Shepphird JK, Brown CE. CAR T cells for brain tumors: Lessons learned and road ahead. Immunol Rev. 2019;290(1):60-84. 62. Newick K, O'Brien S, Sun J, Kapoor V, Maceyko S, Lo A, et al. Augmentation of CAR T-cell Trafficking and Antitumor Efficacy by Blocking Protein Kinase A Localization. Cancer Immunol Res. 2016;4(6):541-51. 63. Perry VH, Teeling J. Microglia and macrophages of the central nervous system: the contribution of microglia priming and systemic inflammation to chronic neurodegeneration. Seminars in Immunopathology. 2013;35(5):601-12. 64. Ginhoux F, Greter M, Leboeuf M, Nandi S, See P, Gokhan S, et al. Fate mapping analysis reveals that adult microglia derive from primitive macrophages. Science. 2010;330(6005):841-5. 65. Marin-Teva JL. Microglia promote the death of developing Purkinje cells. Neuron. 2004;41:535-47. 66. Perry VH, Hume DA, Gordon S. Immunohistochemical localization of macrophages and microglia in the adult and developing mouse brain. Neuroscience. 1985;15(2):313-26. 67. Gordon R, Hogan CE, Neal ML, Anantharam V, Kanthasamy AG, Kanthasamy A. A simple magnetic separation method for high-yield isolation of pure primary microglia. Journal of neuroscience methods. 2011;194(2):287-96. 68. Delpech J-C, Madore C, Nadjar A, Joffre C, Wohleb ES, Layé S. Microglia in neuronal plasticity: Influence of stress. Neuropharmacology. 2015;96, Part A:19-28. 69. Brown GC, Vilalta A. How microglia kill neurons. Brain Research. 2015;1628, Part B:288-97. 70. Sato K. Effects of Microglia on Neurogenesis. Glia. 2015;63(8):1394-405. 71. Ortega FJ, Vukovic J, Rodriguez MJ, Bartlett PF. Blockade of microglial KATP - channel abrogates suppression of inflammatory-mediated inhibition of neural precursor cells. Glia. 2014;62(2):247-58. 72. Fenn AM, Gensel JC, Huang Y, Popovich PG, Lifshitz J, Godbout JP. Immune activation promotes depression 1 month after diffuse brain injury: a role for primed microglia. Biological psychiatry. 2014;76(7):575. 73. Klegeris A, McGeer EG, McGeer PL. Therapeutic approaches to inflammation in neurodegenerative disease. Current opinion in neurology. 2007;20(3):351-7. 74. Lucas SM, Rothwell NJ, Gibson RM. The role of inflammation in CNS injury and disease. British Journal of Pharmacology. 2006;147(S1):S232-S40.

Jiwrajka 2020

75. Rački V, Petrić D, Kučić N, Gržeta N, Jurdana K, Rončević-Gržeta I. Cortical gray matter loss in schizophrenia: Could microglia be the culprit? Medical hypotheses. 2016;88:18- 21. 76. Takano T. Role of Microglia in Autism: Recent Advances. Developmental neuroscience. 2015;37(3):195. 77. Gomez-Nicola D, Perry VH. Microglial dynamics and role in the healthy and diseased brain: a paradigm of functional plasticity. Neuroscientist. 2015;21(2):169-84. 78. John Choi NM, Christopher Jackson , Zineb Belcaid , Michael Lim It takes two: potential therapies and insights involving microglia and macrophages in glioblastoma. Neuroimmunol Neuroinflammation 2018. 2018;5(42). 79. Sarkar S, Susobhan S, Axinia D, Franz JZ, Claudia S. Therapeutic activation of macrophages and microglia to suppress brain tumor-initiating cells. Nature neuroscience. 2014;17(1):46-55. 80. Taylor SE, Morganti-Kossmann C, Lifshitz J, Ziebell JM. Rod Microglia: A Morphological Definition. PLoS ONE. 2014;9(5):e97096. 81. Ransohoff RM, Perry VH. Microglial physiology: unique stimuli, specialized responses. Annual review of immunology. 2009;27:119-45. 82. Innocenti GM, Clarke S, Koppel H. Transitory macrophages in the white matter of the developing visual cortex. II. Development and relations with axonal pathways. Developmental Brain Research. 1983;11(1):55-66. 83. Dalmau I, Finsen B, Tønder N, Zimmer J, González B, Castellano B. Development of microglia in the prenatal rat hippocampus. The Journal of comparative neurology. 1997;377(1):70-84. 84. Polazzi E, Contestabile A. Reciprocal interactions between microglia and neurons: from survival to neuropathology. Reviews in the neurosciences. 2002;13(3):221-42. 85. Marı́n-Teva JL, Dusart I, Colin C, Gervais A, van Rooijen N, Mallat M. Microglia Promote the Death of Developing Purkinje Cells. Neuron. 2004;41(4):535-47. 86. Banati RB. Neuropathological imaging: in vivo detection of glial activation as a measure of disease and adaptive change in the brain. British medical bulletin. 2003;65(1):121- 31. 87. Saijo K, Glass CK. Microglial cell origin and phenotypes in health and disease. Nat Rev Immunol. 2011;11(11):775-87. 88. Nimmerjahn A, Kirchhoff F, Helmchen F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science. 2005;308(5726):1314-8.

Jiwrajka 2020

89. Chen Z, Trapp BD. Microglia and neuroprotection. Journal of Neurochemistry. 2016;136:10-7. 90. Wake H, Moorhouse AJ, Jinno S, Kohsaka S, Nabekura J. Resting microglia directly monitor the functional state of synapses in vivo and determine the fate of ischemic terminals. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2009;29(13):3974-80. 91. Hanisch U-K, Kettenmann H. Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat Neurosci. 2007;10(11):1387-94. 92. Fetler L, Amigorena S. Brain under Surveillance: The Microglia Patrol. Science. 2005;309(5733):392-3. 93. Stence N, Waite M, Dailey ME. Dynamics of microglial activation: A confocal time‐ lapse analysis in hippocampal slices. Glia. 2001;33(3):256-66. 94. Nayak D, Roth TL, McGavern DB. Microglia development and function. Annual review of immunology. 2014;32:367-402. 95. Eugenin EA, Eckardt D, Theis M, Willecke K, Bennett MV, Saez JC. Microglia at brain stab wounds express connexin 43 and in vitro form functional gap junctions after treatment with interferon-gamma and tumor necrosis factor-alpha. Proc Natl Acad Sci U S A. 2001;98(7):4190-5. 96. Dihne M, Block F, Korr H, Topper R. Time course of glial proliferation and glial apoptosis following excitotoxic CNS injury. Brain Res. 2001;902(2):178-89. 97. Benveniste EN, Nguyen VT, O'Keefe GM. Immunological aspects of microglia: relevance to Alzheimer's disease. Neurochemistry international. 2001;39(5-6):381-91. 98. Kingham PJ, Cuzner ML, Pocock JM. Apoptotic pathways mobilized in microglia and neurones as a consequence of chromogranin A-induced microglial activation. J Neurochem. 1999;73(2):538-47. 99. Streit WJ, Kreutzberg GW. Lectin binding by resting and reactive microglia. Journal of neurocytology. 1987;16(2):249-60. 100. Gordon S. Alternative activation of macrophages. Nat Rev Immunol. 2003;3(1):23-35. 101. Martinez FO, Helming L, Gordon S. Alternative activation of macrophages: an immunologic functional perspective. Annual review of immunology. 2009;27:451-83. 102. Kroner A, Greenhalgh AD, Zarruk JG, Passos Dos Santos R, Gaestel M, David S. TNF and increased intracellular iron alter macrophage polarization to a detrimental M1 phenotype in the injured spinal cord. Neuron. 2014;83(5):1098-116.

Jiwrajka 2020

103. Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ, Popovich PG. Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2009;29(43):13435-44. 104. Tarassishin L, Suh HS, Lee SC. Interferon regulatory factor 3 plays an anti- inflammatory role in microglia by activating the PI3K/Akt pathway. Journal of neuroinflammation. 2011;8:187. 105. Zhang Z, Zhang ZY, Schittenhelm J, Wu Y, Meyermann R, Schluesener HJ. Parenchymal accumulation of CD163+ macrophages/microglia in multiple sclerosis brains. Journal of neuroimmunology. 2011;237(1-2):73-9. 106. Miron VE, Boyd A, Zhao JW, Yuen TJ, Ruckh JM, Shadrach JL, et al. M2 microglia and macrophages drive oligodendrocyte differentiation during CNS remyelination. Nat Neurosci. 2013;16(9):1211-8. 107. Vaknin I, Kunis G, Miller O, Butovsky O, Bukshpan S, Beers DR, et al. Excess circulating alternatively activated myeloid (M2) cells accelerate ALS progression while inhibiting experimental autoimmune encephalomyelitis. PLoS One. 2011;6(11):e26921. 108. Cherry JD, Olschowka JA, O'Banion MK. Neuroinflammation and M2 microglia: the good, the bad, and the inflamed. Journal of neuroinflammation. 2014;11:98. 109. He L, Marneros AG. Doxycycline inhibits polarization of macrophages to the proangiogenic M2-type and subsequent neovascularization. The Journal of biological chemistry. 2014;289(12):8019-28. 110. Komohara Y, Ohnishi K, Kuratsu J, Takeya M. Possible involvement of the M2 anti- inflammatory macrophage phenotype in growth of human gliomas. J Pathol. 2008;216(1):15- 24. 111. Li W, Holsinger RM, Kruse CA, Flugel A, Graeber MB. The potential for genetically altered microglia to influence glioma treatment. CNS & neurological disorders drug targets. 2013;12(6):750-62. 112. Fenn AM, Hall JC, Gensel JC, Popovich PG, Godbout JP. IL-4 signaling drives a unique arginase+/IL-1beta+ microglia phenotype and recruits macrophages to the inflammatory CNS: consequences of age-related deficits in IL-4Ralpha after traumatic spinal cord injury. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2014;34(26):8904-17. 113. Perry VH, Holmes C. Microglial priming in neurodegenerative disease. Nature reviews Neurology. 2014;10(4):217-24.

Jiwrajka 2020

114. Raj DDA, Raj DDA, Jaarsma D, Holtman IR, Olah M. Priming of microglia in a DNA- repair deficient model of accelerated aging. Neurobiology of aging. 2014;35(9):2147-60. 115. Perry VH, Matyszak MK, Fearn S. Altered antigen expression of microglia in the aged rodent CNS. Glia. 1993;7(1):60-7. 116. Perry VH, Holmes C. Microglial priming in neurodegenerative disease. Nature reviews Neurology. 2014;10(4):217-24. 117. Combrinck MI, Perry VH, Cunningham C. Peripheral infection evokes exaggerated sickness behaviour in pre-clinical murine prion disease. Neuroscience. 2002;112(1):7-11. 118. Cunningham C, Wilcockson DC, Campion S, Lunnon K, Perry VH. Central and systemic endotoxin challenges exacerbate the local inflammatory response and increase neuronal death during chronic neurodegeneration. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2005;25(40):9275-84. 119. Cunningham C, Campion S, Lunnon K, Murray CL, Woods JF, Deacon RM, et al. Systemic inflammation induces acute behavioral and cognitive changes and accelerates neurodegenerative disease. Biol Psychiatry. 2009;65(4):304-12. 120. Koenigsknecht-Talboo J, Landreth GE. Microglial phagocytosis induced by fibrillar [beta]-amyloid and IgGs are differentially regulated by proinflammatory cytokines. J Neurosci. 2005;25:8240-9. 121. Nathan C. Protection from Alzheimer's-like disease in the mouse by genetic ablation of inducible nitric oxide synthase. J Exp Med. 2005;202:1163-9. 122. Mount MP. Involvement of interferon-gamma in microglial-mediated loss of dopaminergic neurons. J Neurosci. 2007;27:3328-37. 123. Qian L, Hong JS, Flood PM. Role of microglia in inflammation-mediated degeneration of dopaminergic neurons: neuroprotective effect of interleukin 10. J Neural Transm Suppl. 2006:367-71. 124. Lyons SA. Distinct physiologic properties of microglia and blood-borne cells in rat brain slices after permanent middle cerebral artery occlusion. J Cereb Blood Flow Metab. 2000;20:1537-49. 125. Lalancette-Hebert M, Gowing G, Simard A, Weng YC, Kriz J. Selective ablation of proliferating microglial cells exacerbates ischemic injury in the brain. J Neurosci. 2007;27:2596-605. 126. Jack C, Ruffini F, Bar-Or A, Antel JP. Microglia and multiple sclerosis. J Neurosci Res. 2005;81:363-73.

Jiwrajka 2020

127. Heppner FL. Experimental autoimmune encephalomyelitis repressed by microglial paralysis. Nat Med. 2005;11:146-52. 128. Huitinga I, van Rooijen N, de Groot CJ, Uitdehaag BM, Dijkstra CD. Suppression of experimental allergic encephalomyelitis in Lewis rats after elimination of macrophages. J Exp Med. 1990;172:1025-33. 129. Schetters STT, Gomez-Nicola D, Garcia-Vallejo JJ, Van Kooyk Y. Neuroinflammation: Microglia and T Cells Get Ready to Tango. Front Immunol. 2017;8:1905. 130. Ellwardt E, Walsh JT, Kipnis J, Zipp F. Understanding the Role of T Cells in CNS Homeostasis. Trends Immunol. 2016;37(2):154-65. 131. Penfield W. Microglia and the Process of Phagocytosis in Gliomas. The American journal of pathology. 1925;1(1):77-90.15. 132. Graeber MB, Scheithauer BW, Kreutzberg GW. Microglia in brain tumors. Glia. 2002;40(2):252-9. 133. Rossi ML, Hughes JT, Esiri MM, Coakham HB, Brownell DB. Immunohistological study of mononuclear cell infiltrate in malignant gliomas. Acta neuropathologica. 1987;74(3):269-77. 134. Yang I, Han SJ, Kaur G, Crane C, Parsa AT. The role of microglia in central nervous system immunity and glioma immunology. Journal of clinical neuroscience : official journal of the Neurosurgical Society of Australasia. 2010;17(1):6-10. 135. Roggendorf W, Strupp S, Paulus W. Distribution and characterization of microglia/macrophages in human brain tumors. Acta neuropathologica.92(3):288-93. 136. Jacobs VL, Landry RP, Liu Y, Romero-Sandoval EA, De Leo JA. Propentofylline decreases tumor growth in a rodent model of glioblastoma multiforme by a direct mechanism on microglia. Neuro-oncology. 2012;14(2):119-31. 137. Charles NA, Holland EC, Gilbertson R, Glass R, Kettenmann H. The brain tumor microenvironment. Glia. 2011;59(8):1169-80. 138. Sliwa M. The invasion promoting effect of microglia on glioblastoma cells is inhibited by cyclosporin A. Brain. 2007;130:476-89. 139. Markovic DS, Glass R, Synowitz M, Rooijen N, Kettenmann H. Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2. Journal of neuropathology and experimental neurology. 2005;64(9):754-62. 140. Badie B, Schartner J, Klaver J, Vorpahl J. In vitro modulation of microglia motility by glioma cells is mediated by hepatocyte growth factor/scatter factor. Neurosurgery. 1999;44(5):1077-82; discussion 82-3.

Jiwrajka 2020

141. Si Q, Nakamura Y, Ogata T, Kataoka K, Schubert P. Differential regulation of microglial activation by propentofylline via cAMP signaling. Brain Res. 1998;812(1-2):97- 104. 142. Si QS, Nakamura Y, Schubert P, Rudolphi K, Kataoka K. Adenosine and propentofylline inhibit the proliferation of cultured microglial cells. Experimental neurology. 1996;137(2):345-9. 143. Furnari FB, Fenton T, Bachoo RM, Mukasa A, Stommel JM, Stegh A, et al. Malignant astrocytic glioma: genetics, biology, and paths to treatment. Genes & development. 2007;21(21):2683-710. 144. Szulzewsky F, Pelz A, Feng X, Synowitz M, Markovic D, Langmann T, et al. Glioma- associated microglia/macrophages display an expression profile different from M1 and M2 polarization and highly express Gpnmb and Spp1. PLoS One. 2015;10(2):e0116644. 145. Goldshmit Y, McLenachan S, Turnley A. Roles of Eph receptors and ephrins in the normal and damaged adult CNS. Brain Research Reviews. 2006;52(2):327-45. 146. Nievergall E, Lackmann M, Janes PW. Eph-dependent cell-cell adhesion and segregation in development and cancer. Cellular and Molecular Life Sciences. 2012;69(11):1813-42. 147. Pasquale EB. Eph-Ephrin Bidirectional Signaling in Physiology and Disease. Cell. 2008;133(1):38-52. 148. Klein R. Eph/ephrin signaling in morphogenesis, neural development and plasticity. Current Opinion in Cell Biology. 2004;16(5):580-9. 149. Committee EN. Unified Nomenclature for Eph Family Receptors and Their Ligands, the Ephrins. Cell. 1997;90(3):403-4. 150. Klein R, Kullander K, Medicinska och farmaceutiska v, Institutionen för n, Medicinska f, Uppsala u. Mechanisms and functions of eph and ephrin signalling. Nature Reviews Molecular Cell Biology. 2002;3(7):475-86. 151. Goldshmit Y, Galea MP, Wise G, Bartlett PF, Turnley AM. Axonal regeneration and lack of astrocytic gliosis in EphA4-deficient mice. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2004;24(45):10064-73. 152. Dodelet VC, Pasquale EB. Eph receptors and ephrin ligands: embryogenesis to tumorigenesis. Oncogene. 2000;19(49):5614-9. 153. Li Y, Liu D-X, Li M-Y, Qin X-X, Fang W-G, Zhao W-D, et al. Ephrin-A3 and Ephrin- A4 Contribute to Microglia-Induced Angiogenesis in Brain Endothelial Cells. The Anatomical Record. 2014;297(10):1908-18.

Jiwrajka 2020

154. Brantley-Sieders D, Schmidt S, Parker M, Chen J. Eph receptor tyrosine kinases in tumor and tumor microenvironment. Current pharmaceutical design. 2004;10(27):3431-42. 155. Nakamoto M, Bergemann AD. Diverse roles for the Eph family of receptor tyrosine kinases in carcinogenesis. Microscopy research and technique. 2002;59(1):58-67. 156. Adams RH. Vascular patterning by Eph receptor tyrosine kinases and ephrins. Seminars in Cell & Developmental Biology. 2002;13(1):55-60. 157. Berclaz G, Flutsch B, Altermatt HJ, Rohrbach V, Djonov V, Ziemiecki A, et al. Loss of EphB4 receptor tyrosine kinase protein expression during carcinogenesis of the human breast. Oncology reports. 2002;9(5):985-9. 158. Herath NI, Doecke J, Spanevello MD, Leggett BA, Boyd AW. Epigenetic silencing of EphA1 expression in colorectal cancer is correlated with poor survival. British journal of cancer. 2009;100(7):1095-102. 159. Stephenson SA, Slomka S, Douglas EL, Hewett PJ, Hardingham JE. Receptor protein tyrosine kinase EphB4 is up-regulated in colon cancer. BMC molecular biology. 2001;2:15. 160. Kataoka H, Tanaka M, Kanamori M, Yoshii S, Ihara M, Wang YJ, et al. Expression profile of EFNB1, EFNB2, two ligands of EPHB2 in human gastric cancer. Journal of cancer research and clinical oncology. 2002;128(7):343-8. 161. Perez White BE, Getsios S. Eph receptor and ephrin function in breast, gut, and skin epithelia. Cell adhesion & migration. 2014;8(4):327-38. 162. Batlle E, Bacani J, Begthel H, Jonkheer S, Gregorieff A, van de Born M, et al. EphB receptor activity suppresses colorectal cancer progression. Nature. 2005;435(7045):1126-30. 163. Batlle E, Henderson JT, Beghtel H, van den Born MM, Sancho E, Huls G, et al. Beta- catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB. Cell. 2002;111(2):251-63. 164. Kaidi A, Moorghen M, Williams AC, Paraskeva C. Is the downregulation of EphB2 receptor expression during colorectal tumorigenesis due to hypoxia? Gut. 2007;56(11):1637- 8. 165. Liu W, Jung YD, Ahmad SA, McCarty MF, Stoeltzing O, Reinmuth N, et al. Effects of overexpression of ephrin-B2 on tumour growth in human colorectal cancer. British journal of cancer. 2004;90(8):1620-6. 166. Rutkowski R, Mertens-Walker I, Lisle JE, Herington AC, Stephenson S-A. Evidence for a dual function of EphB4 as tumor promoter and suppressor regulated by the absence or presence of the ephrin-B2 ligand. International Journal of Cancer. 2012;131(5):E614-E24.

Jiwrajka 2020

167. Noren NK, Foos G, Hauser CA, Pasquale EB. The EphB4 receptor suppresses breast cancer cell tumorigenicity through an Abl-Crk pathway. Nat Cell Biol. 2006;8(8):815-25. 168. Dun MD, Chalkley RJ, Faulkner S, Keene S, Avery-Kiejda KA, Scott RJ, et al. Proteotranscriptomic Profiling of 231-BR Breast Cancer Cells: Identification of Potential Biomarkers and Therapeutic Targets for Brain Metastasis. Mol Cell Proteomics. 2015;14(9):2316-30. 169. Ferluga S, Gibo D, Debinski W. BI-09EphA3 RECEPTOR IS A MOLECULAR TARGET EXPRESSED IN MULTIPLE COMPARTMENTS OF GBM. Neuro-oncology. 2014;16(Suppl 5):v25-v. 170. Li JJ, Liu DP, Liu GT, Xie D. EphrinA5 acts as a tumor suppressor in glioma by negative regulation of epidermal growth factor receptor. Oncogene. 2009;28(15):1759-68. 171. Chen T, Liu X, Yi S, Zhang J, Ge J, Liu Z. EphB4 is overexpressed in gliomas and promotes the growth of glioma cells. Tumor Biology. 2013;34(1):379-85. 172. Nakada M, Nambu E, Furuyama N, Yoshida Y, Takino T, Hayashi Y, et al. Integrin [alpha]3 is overexpressed in glioma stem-like cells and promotes invasion. The British Journal of Cancer. 2013;108(12):2516. 173. Liu D-P, Wang Y, Koeffler HP, Xie D. Ephrin-A1 is a negative regulator in glioma through down-regulation of EphA2 and FAK. International journal of oncology. 2007;30(4):865. 174. Wykosky J, Debinski W. The EphA2 Receptor and EphrinA1 Ligand in Solid Tumors: Function and Therapeutic Targeting. Molecular Cancer Research. 2008;6(12):1795-806. 175. Wykosky J, Gibo DM, Stanton C, Debinski W. EphA2 as a Novel Molecular Marker and Target in Glioblastoma Multiforme. Molecular Cancer Research. 2005;3(10):541-51. 176. Binda E, Visioli A, Giani F, Lamorte G, Copetti M, Pitter KL, et al. The EphA2 receptor drives self-renewal and tumorigenicity in stem-like tumor-propagating cells from human glioblastomas. Cancer cell. 2012;22(6):765-80. 177. Offenhäuser C, Al-Ejeh F, Puttick S, Ensbey KS, Bruce ZC, Jamieson PR, et al. EphA3 Pay-Loaded Antibody Therapeutics for the Treatment of Glioblastoma. Cancers (Basel). 2018;10(12):519. 178. Jellinghaus S, Poitz DM, Ende G, Augstein A, Weinert S, Stütz B, et al. Ephrin- A1/EphA4-mediated adhesion of monocytes to endothelial cells. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research. 2013;1833(10):2201-11. 179. Zelinski DP, Zantek ND, Stewart JC, Irizarry AR, Kinch MS. EphA2 Overexpression Causes Tumorigenesis of Mammary Epithelial Cells. Cancer Research. 2001;61(5):2301-6.

Jiwrajka 2020

180. Miao H, Li D-Q, Mukherjee A, Guo H, Petty A, Cutter J, et al. EphA2 Mediates Ligand- Dependent Inhibition and Ligand-Independent Promotion of Cell Migration and Invasion via a Reciprocal Regulatory Loop with Akt. Cancer cell. 2009;16(1):9-20. 181. Ogawa K, Pasqualini R, Lindberg RA, Kain R, Freeman AL, Pasquale EB. The ephrin- A1 ligand and its receptor, EphA2, are expressed during tumor neovascularization. Oncogene. 2000;19(52):6043-52. 182. Wang LF, Fokas E, Bieker M, Rose F, Rexin P, Zhu Y, et al. Increased expression of EphA2 correlates with adverse outcome in primary and recurrent glioblastoma multiforme patients. Oncology reports. 2008;19(1):151-6. 183. Liu F, Park PJ, Lai W, Maher E, Chakravarti A, Durso L, et al. A genome-wide screen reveals functional gene clusters in the cancer genome and identifies EphA2 as a mitogen in glioblastoma. Cancer Res. 2006;66(22):10815-23. 184. Debinski W, Wykosky J. Molecular Targeting of IL-13Rα2 and EphA2 Receptor in GBM. In: Meir EG, editor. CNS Cancer: Models, Markers, Prognostic Factors, Targets, and Therapeutic Approaches. Totowa, NJ: Humana Press; 2009. p. 847-63. 185. Chow KKH, Naik S, Kakarla S, Brawley VS, Shaffer DR, Yi Z, et al. T Cells Redirected to EphA2 for the Immunotherapy of Glioblastoma. Molecular Therapy. 2013;21(3):629-37. 186. Ferluga S, Tomé CML, Herpai DM, D’Agostino R, Debinski W. Simultaneous targeting of Eph receptors in glioblastoma. Oncotarget. 2016;7(37). 187. Darling TK, Lamb TJ. Emerging Roles for Eph Receptors and Ephrin Ligands in Immunity. Front Immunol. 2019;10(1473). 188. Bonaparte MI, Dimitrov AS, Bossart KN, Crameri G, Mungall BA, Bishop KA, et al. Ephrin-B2 ligand is a functional receptor for Hendra virus and Nipah virus. Proc Natl Acad Sci U S A. 2005;102(30):10652-7. 189. Hahn AS, Kaufmann JK, Wies E, Naschberger E, Panteleev-Ivlev J, Schmidt K, et al. The ephrin receptor tyrosine kinase A2 is a cellular receptor for Kaposi's sarcoma-associated herpesvirus. Nat Med. 2012;18(6):961-6. 190. Pfaff D, Heroult M, Riedel M, Reiss Y, Kirmse R, Ludwig T, et al. Involvement of endothelial ephrin-B2 in adhesion and transmigration of EphB-receptor-expressing monocytes. J Cell Sci. 2008;121(Pt 22):3842-50. 191. Funk SD, Orr AW. Ephs and ephrins resurface in inflammation, immunity, and atherosclerosis. Pharmacol Res. 2013;67(1):42-52.

Jiwrajka 2020

192. Jellinghaus S, Poitz DM, Ende G, Augstein A, Weinert S, Stutz B, et al. Ephrin- A1/EphA4-mediated adhesion of monocytes to endothelial cells. Biochim Biophys Acta. 2013;1833(10):2201-11. 193. Ende G, Poitz DM, Wiedemann E, Augstein A, Friedrichs J, Giebe S, et al. TNF-alpha- mediated adhesion of monocytes to endothelial cells-The role of ephrinA1. J Mol Cell Cardiol. 2014;77:125-35. 194. Liu H, Devraj K, Moller K, Liebner S, Hecker M, Korff T. EphrinB-mediated reverse signalling controls junctional integrity and pro-inflammatory differentiation of endothelial cells. Thromb Haemost. 2014;112(1):151-63. 195. Poitz DM, Ende G, Stutz B, Augstein A, Friedrichs J, Brunssen C, et al. EphrinB2/EphA4-mediated activation of endothelial cells increases monocyte adhesion. Mol Immunol. 2015;68(2 Pt C):648-56. 196. Saeki N, Nishino S, Shimizu T, Ogawa K. EphA2 promotes cell adhesion and spreading of monocyte and monocyte/macrophage cell lines on integrin ligand-coated surfaces. Cell adhesion & migration. 2015;9(6):469-82. 197. Morimoto K, Nakajima K. Role of the Immune System in the Development of the Central Nervous System. Front Neurosci. 2019;13:916. 198. Li X, Wang L, Gu JW, Li B, Liu WP, Wang YG, et al. Up-regulation of EphA2 and down-regulation of EphrinA1 are associated with the aggressive phenotype and poor prognosis of malignant glioma. Tumour Biol. 2010;31(5):477-88. 199. Li X, Wang Y, Wang Y, Zhen H, Yang H, Fei Z, et al. Expression of EphA2 in human astrocytic tumors: correlation with pathologic grade, proliferation and apoptosis. Tumour Biol. 2007;28(3):165-72. 200. Hatano M, Eguchi J, Tatsumi T, Kuwashima N, Dusak JE, Kinch MS, et al. EphA2 as a glioma-associated antigen: a novel target for glioma vaccines. Neoplasia. 2005;7(8):717-22. 201. Dello Russo C, Cappoli N, Coletta I, Mezzogori D, Paciello F, Pozzoli G, et al. The human microglial HMC3 cell line: where do we stand? A systematic literature review. Journal of neuroinflammation. 2018;15(1):259. 202. Blasi E, Mathieson BJ, Varesio L, Cleveland JL, Borchert PA, Rapp UR. Selective immortalization of murine macrophages from fresh bone marrow by a raf/myc recombinant murine retrovirus. Nature. 1985;318(6047):667-70. 203. Blasi E, Barluzzi R, Bocchini V, Mazzolla R, Bistoni F. Immortalization of murine microglial cells by a v-raf / v-myc carrying retrovirus. Journal of neuroimmunology. 1990;27(2):229-37.

Jiwrajka 2020

204. Davenport CM, Sevastou IG, Hooper C, Pocock JM. Inhibiting p53 pathways in microglia attenuates microglial-evoked neurotoxicity following exposure to Alzheimer peptides. J Neurochem. 2010;112(2):552-63. 205. Rolph MS, Mahalingam S, Cowden WB. Nonspecific antiviral immunity by formalin- fixed Coxiella burnetii is enhanced in the absence of nitric oxide. Virology. 2004;326(1):1-5. 206. Kyme C. The EphA2 receptor in glioblastoma multiforme. Nature Clinical Practice Neurology. 2006;2(2):62-. 207. Ahmed Z, Shaw G, Sharma VP, Yang C, McGowan E, Dickson DW. Actin-binding proteins coronin-1a and IBA-1 are effective microglial markers for immunohistochemistry. J Histochem Cytochem. 2007;55(7):687-700. 208. Imai Y, Ibata I, Ito D, Ohsawa K, Kohsaka S. A novel gene iba1 in the major histocompatibility complex class III region encoding an EF hand protein expressed in a monocytic lineage. Biochem Biophys Res Commun. 1996;224(3):855-62. 209. Mitchell K, Shah JP, Tsytsikova LV, Campbell AM, Affram K, Symes AJ. LPS antagonism of TGF-β signaling results in prolonged survival and activation of rat primary microglia. Journal of Neurochemistry. 2014;129(1):155-68. 210. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem. 1982;126(1):131-8. 211. Bryan NS, Grisham MB. Methods to detect nitric oxide and its metabolites in biological samples. Free Radic Biol Med. 2007;43(5):645-57. 212. Kania A, Klein R. Mechanisms of ephrin-Eph signalling in development, physiology and disease. Nature reviews Molecular cell biology. 2016;17(4):240-56. 213. Askew K, Li K, Olmos-Alonso A, Garcia-Moreno F, Liang Y, Richardson P, et al. Coupled Proliferation and Apoptosis Maintain the Rapid Turnover of Microglia in the Adult Brain. Cell Rep. 2017;18(2):391-405. 214. Poitz DM, Biedermann JM, Kraeter M, Ende G, Kube L, Augstein A, et al. 3853Ephrin A1 modulates M2a polarization of macrophages and their migration potential. European Heart Journal. 2017;38(suppl_1). 215. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, et al. A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019;9(1):4902.

Jiwrajka 2020

216. D'Souza RCJ, Offenhäuser C, Straube J, Baumgartner U, Kordowski A, Li Y, et al. Q- Cell Glioblastoma Resource: Proteomics Analysis Reveals Unique Cell-States are Maintained in 3D Culture. Cells. 2020;9(2). 217. Day BW, Stringer BW, Wilson J, Jeffree RL, Jamieson PR, Ensbey KS, et al. Glioma surgical aspirate: a viable source of tumor tissue for experimental research. Cancers (Basel). 2013;5(2):357-71. 218. Pollard SM, Yoshikawa K, Clarke ID, Danovi D, Stricker S, Russell R, et al. Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic screens. Cell Stem Cell. 2009;4(6):568-80. 219. Himanen JP, Yermekbayeva L, Janes PW, Walker JR, Xu K, Atapattu L, et al. Architecture of Eph receptor clusters. Proceedings of the National Academy of Sciences. 2010;107(24):10860-5. 220. Vearing C, Lee FT, Wimmer-Kleikamp S, Spirkoska V, To C, Stylianou C, et al. Concurrent binding of anti-EphA3 antibody and ephrin-A5 amplifies EphA3 signaling and downstream responses: potential as EphA3-specific tumor-targeting reagents. Cancer Res. 2005;65(15):6745-54. 221. Zimmermann WH, Melnychenko I, Wasmeier G, Didie M, Naito H, Nixdorff U, et al. Engineered heart tissue grafts improve systolic and diastolic function in infarcted rat hearts. Nat Med. 2006;12(4):452-8. 222. Mills RJ, Titmarsh DM, Koenig X, Parker BL, Ryall JG, Quaife-Ryan GA, et al. Functional screening in human cardiac organoids reveals a metabolic mechanism for cardiomyocyte cell cycle arrest. Proc Natl Acad Sci U S A. 2017;114(40):E8372-e81. 223. Lively S, Schlichter LC. The microglial activation state regulates migration and roles of matrix-dissolving enzymes for invasion. Journal of neuroinflammation. 2013;10:75-. 224. Jeon H, Kim J-H, Kim J-H, Lee W-H, Lee M-S, Suk K. Plasminogen activator inhibitor type 1 regulates microglial motility and phagocytic activity. Journal of neuroinflammation. 2012;9:149-. 225. Zhai H, Heppner FL, Tsirka SE. Microglia/macrophages promote glioma progression. Glia. 2011;59(3):472-85. 226. Mills RJ, Parker BL, Quaife-Ryan GA, Voges HK, Needham EJ, Bornot A, et al. Drug Screening in Human PSC-Cardiac Organoids Identifies Pro-proliferative Compounds Acting via the Mevalonate Pathway. Cell Stem Cell. 2019;24(6):895-907.e6. 227. Li W, Graeber MB. The molecular profile of microglia under the influence of glioma. Neuro-oncology. 2012;14(8):958-78.

Jiwrajka 2020

228. Barros MHM, Hauck F, Dreyer JH, Kempkes B, Niedobitek G. Macrophage Polarisation: an Immunohistochemical Approach for Identifying M1 and M2 Macrophages. PLOS ONE. 2013;8(11):e80908. 229. Heusinkveld M, van der Burg SH. Identification and manipulation of tumor associated macrophages in human cancers. J Transl Med. 2011;9:216. 230. Liu S, Zhang C, Maimela NR, Yang L, Zhang Z, Ping Y, et al. Molecular and clinical characterization of CD163 expression via large-scale analysis in glioma. OncoImmunology. 2019;8(7):e1601478. 231. Roesch S, Rapp C, Dettling S, Herold-Mende C. When Immune Cells Turn Bad- Tumor-Associated Microglia/Macrophages in Glioma. Int J Mol Sci. 2018;19(2). 232. Mahmood DF, Abderrazak A, Couchie D, Lunov O, Diderot V, Syrovets T, et al. Truncated thioredoxin (Trx-80) promotes pro-inflammatory macrophages of the M1 phenotype and enhances atherosclerosis. J Cell Physiol. 2013;228(7):1577-83. 233. Chinetti-Gbaguidi G, Baron M, Bouhlel MA, Vanhoutte J, Copin C, Sebti Y, et al. Human atherosclerotic plaque alternative macrophages display low cholesterol handling but high phagocytosis because of distinct activities of the PPARgamma and LXRalpha pathways. Circ Res. 2011;108(8):985-95. 234. Li W, Graeber MB. The molecular profile of microglia under the influence of glioma. Neuro-oncology. 2012;14(8):958-78. 235. Sliwa M, Markovic D, Gabrusiewicz K, Synowitz M, Glass R, Zawadzka M, et al. The invasion promoting effect of microglia on glioblastoma cells is inhibited by cyclosporin A. Brain. 2007;130(Pt 2):476-89. 236. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6(269):pl1. 237. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data. Cancer Discovery. 2012;2(5):401-4. 238. Brennan CW, Verhaak RG, McKenna A, Campos B, Noushmehr H, Salama SR, et al. The somatic genomic landscape of glioblastoma. Cell. 2013;155(2):462-77. 239. Sanchez-Vega F, Mina M, Armenia J, Chatila WK, Luna A, La KC, et al. Oncogenic Signaling Pathways in The Cancer Genome Atlas. Cell. 2018;173(2):321-37.e10.

Jiwrajka 2020

240. Hoadley KA, Yau C, Hinoue T, Wolf DM, Lazar AJ, Drill E, et al. Cell-of-Origin Patterns Dominate the Molecular Classification of 10,000 Tumors from 33 Types of Cancer. Cell. 2018;173(2):291-304.e6. 241. Khan I, Waqas M, Shamim MS. Prognostic significance of IDH 1 mutation in patients with glioblastoma multiforme. J Pak Med Assoc. 2017;67(5):816-7. 242. Chhor V, Le Charpentier T, Lebon S, Oré M-V, Celador IL, Josserand J, et al. Characterization of phenotype markers and neuronotoxic potential of polarised primary microglia in vitro. Brain Behav Immun. 2013;32:70-85. 243. Heindl S, Gesierich B, Benakis C, Llovera G, Duering M, Liesz A. Automated Morphological Analysis of Microglia After Stroke. Frontiers in Cellular Neuroscience. 2018;12(106). 244. Dai D, Huang Q, Nussinov R, Ma B. Promiscuous and specific recognition among ephrins and Eph receptors. Biochimica et biophysica acta. 2014;1844(10):1729-40. 245. Singh DR, Kanvinde P, King C, Pasquale EB, Hristova K. The EphA2 receptor is activated through induction of distinct, ligand-dependent oligomeric structures. Commun Biol. 2018;1:15-.

Jiwrajka 2020

APPENDIX

6.1 SUPPLEMENTARY DATA

U373: Eph and ephrin screen

400 B

T 350

C 300 A

r 250

e 200 p

o i

s 40

s e

r 30

x E

A N

R 10 m 0 1 2 3 4 5 6 7 8 1 2 3 4 6 1 2 3 4 5 1 2 3 A A A A A A A A B B B B B A A A A A B B B h h h h h h h h h h h h h n n n n n n n n p p p p p p p p p p p p p ri ri ri ri ri ri ri ri E E E E E E E E E E E E E h h h h h h h h p p p p p p p p e e e e e e e e

Supplementary Figure 1: mRNA expression in U373 cells (positive control for EphA2).

Results demonstrate high expression of EphA2 and the corresponding high-affinity ligand ephrinA1. (Results are presented as mean ±SEM (n=2)).

Phagocytosis of Microglia with LPS stimulation

)

e e

r 0.6

a /

d 0.4

e esiRNA EphA2 KD Control

a ( esiRNA EphA2 KD + LPS

s 0.2

c o

g 0.0 a

h 1 7 3 9 5 1 7 3 9 5 1 7 3 9 5 1

1 1 2 3 3 4 4 5 6 6 7 7 8 9 P Hours

Supplementary Figure 2: Phagocytosis of HMC3 microglia post EphA2 KD and LPS stimulation.

Jiwrajka 2020

Phagocytosis is marginally attenuated by the addition of LPS in EphA2 knockdown microglia cells compared to the control cells.

Supplementary Table 1: Quantified representation of normalised ratio of phosphorylated EphA2 as compared to total EphA2 using ImageJ software.

Normalized to Isotype 5min 15min 30min 60min EphA2 loading control (Pos Control*) pEPHA2 1.0 1.3 1.5 0.8 0.1 3.7

EPHA2 1.0 1.2 1.8 1.3 0.8 1.2

IBA1 1.0 1.2 1.8 1.3 0.8 1.2 pEPHA2/total 1.0 1.0 1.0 0.6 0.1 4.2 EPHA2

*U373 cells as positive EphA2 control in combination with microglia that have been treated with EphrinA1Fc as demonstrated in Figure 9A.

Jiwrajka 2020

6.2 ETHICS APPROVAL

Jiwrajka 2020