Phosphorylation of Plcg1 by Epha2 Receptor Tyrosine Kinase Promotes Tumor Growth in Lung Cancer Wenqiang Song1,2, Laura C

Published OnlineFirst August 4, 2020; DOI: 10.1158/1541-7786.MCR-20-0075

MOLECULAR CANCER RESEARCH | SIGNAL TRANSDUCTION AND FUNCTIONAL IMAGING

Phosphorylation of PLCg1 by EphA2 Receptor Tyrosine Kinase Promotes Tumor Growth in Lung Cancer Wenqiang Song1,2, Laura C. Kim3, Wei Han4, Yuan Hou5, Deanna N. Edwards1, Shan Wang1, Timothy S. Blackwell2,4,6, Feixiong Cheng5,7,8, Dana M. Brantley-Sieders1,9, and Jin Chen1,2,3,6,9

ABSTRACT ◥ EphA2 receptor tyrosine kinase (RTK) is often expressed at EphA2 decreased phosphorylation of PLCg1andlossofPLCg1 high levels in cancer and has been shown to regulate tumor inhibited tumor cell growth in vitro.KnockoutofPLCg1by growth and metastasis across multiple tumor types, including CRISPR-mediated genome editing also impaired tumor growth non–small cell lung cancer. A number of signaling pathways in a KrasG12D-p53-Lkb1 murine lung tumor model. Collectively, downstream of EphA2 RTK have been identiﬁed; however, these data show that the EphA2-PLCg1 signaling axis promotes mechanisms of EphA2 proximal downstream signals are less tumor growth of lung cancer and provides rationale for disrup- well characterized. In this study, we used a yeast-two-hybrid tion of this signaling axis as a potential therapeutic option. screen to identify phospholipase C gamma 1 (PLCg1) as a novel EphA2 interactor. EphA2 interacts with PLCg1andthekinase Implications: The EphA2-PLCG1 signaling axis promotes tumor activity of EphA2 was required for phosphorylation of PLCg1. In growth of non–small cell lung cancer and can potentially be targeted human lung cancer cells, genetic or pharmacologic inhibition of as a therapeutic option.

Introduction inhibitor–resistant tumor cells (5). Loss of EphA2 reduced viability of erlotinib-resistant tumor cells harboring EGFRT790M muta- Receptor tyrosine kinases (RTK) regulate signal transduction path- tions in vitro and inhibited tumor growth in an inducible ways that control cell proliferation, survival, and motility. Dysregula- þ EGFRL858R T790M-mutant lung cancer model in vivo (5). Several tion of RTKs by mutations, amplifications, or overexpression can lead EphA2 inhibitors including an antibody, a peptide, and a small- to oncogenic transformation and malignant progression (1). A num- molecule inhibitor have been developed (6). An EphA2-targeting ber of RTKs have been identified as potential drivers of non–small cell DOPC-encapsulated siRNA is currently in phase I clinical trials for lung cancer (NSCLC), one of which is EphA2 (2). The EphA2 RTK advanced or recurrent solid tumors (NCT01591356). However, belongs to the EPH family, the largest family of RTKs, and is despite the interest in EphA2 as a therapeutic target, molecular commonly overexpressed in NSCLC and associated with poor clinical mechanisms mediating EphA2 function, particularly its proximal outcomes (3). Targeted disruption of EphA2 impairs tumor growth in downstream signals, are not well characterized. KRAS-mutant mouse models and in human NSCLC xenografts (4). Phospholipase C gamma (PLCg) is a lipase activated by receptors in Furthermore, EphA2 is overexpressed in EGFR tyrosine kinase the cellular membrane, including RTKs and adhesion receptors. Once activated, PLCg hydrolyzes phosphatidylinositol 4,5-bisphosphate to form diacylglycerol and inositol 1,4,5-trisphosphate, the latter pro- þ 1Division of Rheumatology and Immunology, Department of Medicine, moting the transient release of intracellular Ca2 , another important 2 Vanderbilt University Medical Center, Nashville, Tennessee. Veterans Affairs signaling molecule. PLCg is ubiquitously expressed and exists in two Medical Center, Tennessee Valley Healthcare System, Nashville, Tennessee. isoforms, PLCG1 and PLCG2, each with distinct functions in a variety 3Program in Cancer Biology, Vanderbilt University, Nashville, Tennessee. 4Division of Allergy, Pulmonary and Critical Care Medicine, Department of of cell types and disease states (7, 8). PLCG1 plays a role in vascu- Medicine, Vanderbilt University Medical Center, Nashville, Tennessee. 5Genomic logenesis and erythrogenesis as well as T-cell development and Medicine Institute, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio. activity (9). Importantly, loss of PLCG1 is embryonic lethal in 6Department of Cell and Developmental Biology, Vanderbilt University, mice (10). PLCG2, meanwhile, is critical for B-cell development and 7 Nashville, Tennessee. Department of Molecular Medicine, Cleveland Clinic maturation (8, 11). Both PLCg isoforms are enriched and mutated in Lerner College of Medicine, Case Western Reserve University, Cleveland, Ohio. many cancers (8). Elevated PLCg1 has been shown to drive metastasis 8Case Comprehensive Cancer Center, Case Western Reserve University School of Medicine, Cleveland, Ohio. 9Vanderbilt-Ingram Cancer Center, Vanderbilt and progression of breast cancer (12, 13), and its phosphorylation University Medical Center, Nashville, Tennessee. status is prognostic for metastatic risk (14). PLCg has also been implicated in resistance to cancer treatment. In glioblastoma, Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/). PLCg/HIF1a mediated FGFR1-induced radioresistance (15) while in head and neck and esophageal squamous cell carcinoma, the W. Song and L.C. Kim contributed equally to this article. AXL-EGFR-PLCg1 axis mediated resistance to PI3K inhibition (16). Corresponding Authors: Jin Chen, Vanderbilt University Medical Center, An acquired PLCG2 mutation also caused resistance to ibrutinib in T-3207E, Medical Center North, Vanderbilt University School of Medicine, 1161 chronic lymphocytic leukemia (17). While important roles for PLCg 21st Avenue South, Nashville, TN 37232. Phone: 615-343-3819; Fax: 615-343- fi g 8648; E-mail: [email protected]; and Dana M. Brantley-Sieders, have been identi ed in several cancer types, PLC role in lung cancer [email protected] has yet to be elucidated. In this report, we show that PLCg is a novel target of the EphA2 RTK Mol Cancer Res 2020;XX:XX–XX in lung cancer. We show that EphA2 interacts with and directly doi: 10.1158/1541-7786.MCR-20-0075 phosphorylates PLCg for activation. In addition, knockdown of 2020 American Association for Cancer Research. PLCG1 significantly reduces the growth of KRAS-mutant lung cancer

AACRJournals.org | OF1

Song et al.

cells in vitro and inhibits lung tumor growth in an orthotopic Kras- interactome are given in our recent studies (18–20). We then mapped p53-Lkb1–mutant mouse model in vivo. Collectively, these studies the EPHA2, PLCG1, and PLCG2 into the PPIs network to construct identify the EphA2-PLCg1 axis as a potential therapeutic target for EPHA2-PLCG1/PLCG2 subnetwork. Next, we performed Kyoto KRAS-mutant lung cancer. Encyclopedia of Genes and Genomes (KEGG) enrichment analysis to identify the functional pathway related with PLCG1 and PLCG2.

Materials and Methods Cell growth assays Cell lines, plasmids, and reagents MTT assay was used to evaluate the short-term proliferation of cells. 293FT, COS-7, and mouse Kras, p53, and Lkb1 (KPL) lines were A total of 2 103 cells were plated into 96-well plates with six replicates cultured in DMEM supplemented with penicillin/streptomycin in growth media. MTT reagent was added and the plates were read and10% FBS. Human lung cancer cell lines (A549, H23, H358, using plate reader (Synergy HT, BioTek) on days 1 to 6. Cell viability H2030, H2009, and HCC44) and BEAS2B cells were cultured in was normalized to day 1. Colony formation assays were used to RPMI1640 supplemented with penicillin/streptomycin and 10% FBS. evaluate the long-term proliferation of cells. A total of 400 cells were All cell lines were purchased from ATCC, except the murine KPL line plated into 12-well plates with 3 to 4 replicates in growth media. For which was generated in our lab as shown in Fig. 5. Cell lines were used drug treatment experiments, drugs were added the day after cell between passages 1 and 50 after thaw and authenticated using attachment with an initial plating of 2 104 cells. Cell colonies were short tandem repeat profiling at ATCC, most recently in June 2019. visualized by crystal violet staining after 2 weeks for human cells or Mycoplasma was routinely tested approximately every 6 months to 1 week for mouse KPL cells. exclude possible contamination, most recently in November 2019, using the PlasmoTest Kit from InvivoGen. Y2H screen For transient knockdown, siRNAs were purchased from Dharma- Y2H screening was carried out by Hybrigenics Services (hybrigenics- con (smart pool siEphA2: catalog no. L-003116-00-0005; nontargeting services.com). The cytoplasmic EphA2 tail (AA 559-976) was cloned as pool: catalog no. D-001810-10-05; individual siPLCG1 #1–3: catalog a N-LexA-EPHA2-C fusion to be the bait against a lung cancer cDNA no. J-003559-05, 07, 08). For stable short hairpin (shRNA) knock- library (mix of A549, H1703, and H460) and 79 positive clones were down, lentiviral vector pLKO.1 was used (EphA2 shRNA #1 CGGA- selected on DO-3–selective medium plates. A confidence score CAGACATATGGGATATT; EphA2 shRNA#2 GCGTATCTT- (predicted biological score, PBS) was assigned to each interaction, then CATTGAGCTCAA; PLCG1 shRNA #1 ATGACAAAGCAATGT- scores were stratified into categories based on the degree of confidence. GACTGG; PLCG1 shRNA #2 ATGTAAACTTTGTTTCCCTGG; PLCG1 shRNA #3 AATTTCACGAATGTCAATGGC; PLCG1 Proximity ligation assay shRNA #4 ATACCATTCGTGGTTCACAGG; GFP shRNA control Cancer cells in culture medium were plated onto coverslips coated GCAAGCTGACCCTGAAGTTCAT). For CRISPR/Cas9-mediated with 0.5% gelatin in DPBS. Cells were washed with PBS and fixed with gene knockout, lentiviral vector LentiCRISPR v2 was used human 4% paraformaldehyde after 24 hours growth. 5% goat serum plus 0.3% PLCG1 gRNA #1 ATAGCGATCAAAGTCCCGTG; human triton X-100 in DPBS was used to permeabilize cells. Anti-PLCG1 PLCG1 gRNA #2 GTTCACTTCATCCTCAGATG; LacZ gRNA rabbit polyclonal antibody (Santa Cruz Biotechnology, catalog no. TGCGAATACGCCCACGCGAT; mouse PLCG1 gRNA #1 SC-81, 1:200) and anti-EphA2 mouse mAb (EMD Millipore, catalog GCTAATGGAGGATACACTGC; mouse PLCG1 gRNA #2 no. 05-480, 1:400) diluted in blocking buffer were applied to cells and CCGCGGCGCGGACAAAATCG). The PLCG1 full-length cDNA incubated for overnight at 4C. The DuoLink Proximity Ligation Kit plasmid was purchased from Sino Biological Inc (catalog no. (Sigma-Aldrich, catalog no. DUO92102) was used according to man- MG50804-G) and PLCG1 was subcloned into pCDH-puro vector ufacturer's instructions. with Flag-tag at its C-terminus. The EphA2 full-length cDNA plasmid (pCDH-puro EphA2-Myc) and its corresponding mutants (S897A, Immunoblots, immunoprecipitation, and IHC Y588F, Y594F, Y735F, Y930F, K646M, and D739N) were all from lab For Western blotting, 10 to 30 mg of total protein from cell lysates stocks. For adeno-associated virus (AAV) system, AAV9 and pDF6 were separated by SDS-PAGE, transferred to a nitrocellulose mem- plasmids were purchased form Penn Vector Core at the University of brane and probed with indicated antibodies. Primary antibodies used Pennsylvania (Philadelphia, PA), and AAV-KPL plasmid was pur- in this study were as follows: rabbit anti-EphA2 (Santa Cruz Biotech- chased from Addgene (catalog no. 60224). ALW-II-41-27 was pur- nology, catalog no. SC-924, 1:1,000), mouse anti-EphA2 (EMD Milli- chased from MedChem Express. pore, catalog no. 05-480, 1:1,000), mouse anti-PLCG1 (Santa Cruz Biotechnology, catalog no. SC-7290, 1:500), rabbit anti-PLCG2 (Santa Building a human protein–protein interactome Cruz Biotechnology, catalog no. SC-407, 1:500), rabbit anti-EphA2 To construct a comprehensive and high-quality human protein– Y588 (Cell Signaling Technology, catalog no. 12677, 1:500), rabbit protein interaction (PPI) network, we assembled 15 commonly anti-PLCG1 Y783 (Cell Signaling Technology, catalog no.14008, used data sources with five types of experimental evidence: (i) binary 1:500), mouse anti-b-actin (Santa Cruz Biotechnology, catalog no. PPIs tested by high-throughput yeast-two-hybrid (Y2H) systems; (ii) SC-47778, 1:1,000). Secondary antibodies used were as follows: binary, physical PPIs from protein three-dimensional structures; (iii) anti-rabbit IgG HRP (Promega, catalog no. W4011, 1:5,000), kinase-substrate interactions from literature-derived low-throughput anti-mouse IgG HRP (Promega, catalog no. W4021, 1:5,000), and high-throughput experiments; (iv) signaling networks derived anti-rabbit IgG IRDye 800CW (LI-COR, catalog no. 926-32211), from low-throughput experiments; (v) literature-derived identified by and anti-mouse IgG IRDye 680LT (LI-COR, catalog no. 926- affinity purification followed by mass spectrometry and low- 68020). Antibodies were diluted in PBST/5% nonfat milk. Signal throughput experiments. In total, the updated human interactome was detected using enhanced chemiluminescence substrate (West consisted of 351,444 PPIs (edges or links) linked to 17,706 unique Femto or West Pico, Thermo Fisher Scientific) or by LI-COR proteins (nodes). The detailed descriptions of building the human Odyssey Infrared Imaging System.

OF2 Mol Cancer Res; 2020 MOLECULAR CANCER RESEARCH

EphA2 Interacts with PLCg1 in Lung Cancer

For immunoprecipitation (IP), cells were lysed in IP buffer Vector Laboratories), both for 1 hour at room temperature, with (10 mmol/L Tris-HCl pH ¼ 7.5, 150 mmol/L NaCl, 2 mmol/L thorough washing before and after each step. Staining was performed EDTA, 0.5-1% Triton X-100). A total of 1 mgoftotalproteinwas using liquid diaminobenzidine (catalog no. SK-4103, Vector Labora- incubated with anti-Myc tag or anti-Flag agarose beads or indicated tories) and hematoxylin (catalog no. H-3401, Vector Laboratories). antibody then Protein G Dynabeads (Invitrogen) overnight at 4C. Following dehydration, stained tissues were mounted using Cytoseal Beads were washed with lysis buffer and boiled with 20 mLSDS XYL. Slides were imaged on a Leica SCN400 Slide Scanner at 40 loading buffer. The soluble fraction was loaded for immunoblot magnification at a resolution of 0.25 mm/pixel. The diaminobenzidine analysis. stained area and total tissue area were determined from deconvoluted Lung tumor sections were stained with hematoxylin and eosin by high-resolution images of each tissue core in the Leica Digital Image Vanderbilt University Translational Pathology Shared Resource. Pro- Hub. The percentage of tissue area positive for diaminobenzidine liferating cell nuclear antigen (PCNA) staining (Cell Signaling Tech- staining is shown. nology, rabbit anti PCNA, catalog no. 13110) for proliferation or terminal deoxynucleotidyl transferase–mediated dUTP nick end label- T7E1 mismatch detection assay ing (TUNEL) assay (Millipore, ApopTag Red In Situ Apoptosis Genomic DNA was extracted using QuickExtract DNA Extraction Detection Kit, catalog no. S7165) for apoptosis was performed as Solution (Lucigen) according to the manufacturer's protocol. Target described previously (21, 22). Tumor area of 20 images was analyzed regions were amplified with indicated primers (Supplementary Fig. S2) by ImageJ or CellSens software. using the Q5 polymerase (NEB) and T7E1 mismatch detection assay Formalin-fixed, paraffin-embedded human lung adenocarcinoma was performed and analyzed according to previously published tissue arrays (catalog no. LC641) were purchased from Biomax. protocols (23). Following rehydration, antigen retrieval was accomplished using Retrievagen A (BD Biosciences) as per manufacturer's instructions. Animal studies fi Following blockade of endogenous peroxidases using 3% H2O2, tissues AAV was produced in 293FT cells, chemically puri ed and con- were first permeabilized for 5 minutes with 0.3% Triton X-100 in PBS centrated according to published methods (24). AAV titer was deter- and then washed in PBS. Tissues were blocked with 2.5% goat serum mined using AAVpro Titration Kita (Takara Bio Inc., catalog no. and then probed with antibodies against EphA2 (10 mg/mL; catalog no. 6233). A titer of 2 1011 viral genome copies in 75 mL DPBS was 34-7400, Zymed Laboratories) or phospho-PLCg1 (Tyr783; 1:50; intratracheally injected into 7- to 8-week-old Rosa26-LSL-Cas9-EGFP catalog no. 14008S, Cell Signaling Technology) overnight at 4C. mice (stock no.: 024858, The Jackson Laboratory). Tumor develop- Samples were incubated with biotinylated anti-rabbit IgG (1:250; ment was monitored weekly by MRI and by GFP imaging after catalog no. 550338, BD Biosciences) and subsequently incubated with sacrifice. For orthotopic lung tumor growth, KPL lines were trans- horseradish peroxidase (HRP) streptavidin (catalog no. SA-5704, fected with luciferase expression plasmid and intravenously injected

Figure 1. EphA2 interacts with PLCg. A, A Y2H screen identified potential EphA2 interactors based on a lung cancer cDNA library. Orange, very high confidence; blue, high confidence; green, moderate confidence. B and C, Combinations of EphA2 and either PLCG1 or PLCG2 were expressed in COS-7 cells. B, Flag-PLCg or Myc-EphA2 were immunoprecipitated and coim- munoprecipitating EphA2 or PLCg was probed by Western blotting. C, Phosphorylation levels of EphA2 and PLCg were measured by Western blotting. D, Map of the human EphA2-PLCg1/PLCg2 subnetwork analysis. Proteins in the Ras pathway are delineated by a blue line. E, KEGG pathway enrichment analysis of the PLCg interactome. FDR, false discovery rate.

AACRJournals.org Mol Cancer Res; 2020 OF3

Song et al.

via tail vein. Lung tumor growth was measured once a week by EphA2, validating the efficacy and accuracy of the Y2H bioluminescence imaging. screen (25, 26). We chose to explore PLCG1 and PLCG2 further All animal experiments were preapproved by the Vanderbilt Insti- because both are PLCg family members and novel interactors with tutional Animal Care and Use Committee and followed all state and EphA2 identified in this screen with very high confidence and high federal rules and regulations. confidence, respectively. To verify the interaction between EphA2 and PLCg (PLCg1 and Statistical analysis PLCg2) identified in the Y2H screen, EphA2 and PLCG1 or PLCG2 Data were presented as mean SD or SEM and statistically were expressed in COS-7 cells. Both PLCg isoforms were immuno- analyzed by two-tailed Student t test or two-way ANOVA with Tukey precipitated with EphA2; however, in the reverse direction, only IP of post hoc correction. All experiments were performed at least two PLCg1 was able to coimmunoprecipitate EphA2 (Fig. 1B), suggesting independent times and P < 0.05 was treated as statistically significant. a weaker interaction between EphA2 and PLCg2 compared with GraphPad Prism 8 was used for statistical analysis. PLCg1. PLCg1 and PLCg2 are important mediators of intracellular signal transduction and are activated by phosphorylation by upstream Results kinases (27). To determine whether EphA2 is required for PLCg EphA2 interacts with PLCg activation, we assessed phosphorylation by immunoblotting. Expres- To identify EphA2-interacting partners in human lung cancer sion of EphA2 increased the overall phosphorylation levels of both cells, the intracellular domain (AA 559-976) of EphA2 was used as PLCg1 and PLCg2 including two different tyrosine sites on each bait for a Y2H screen against the cDNA library of lung cancer protein (Y783 and Y1253 for PLCg1; Y759 and Y1217 for cells (www.hybrigenics-services.com). A total of 79 positive clones PLCg2; Fig. 1C). We also observed enhanced phosphorylation of were screened, resulting in 15 total candidates. The candidates Y783 on endogenous PLCg1 in EphA2-overexpressing samples. Con- were stratified into three categories based on confidence of inter- versely, overexpression of PLCg had no effect on the phosphorylation action: very high confidence (3 proteins, orange), high confidence of EphA2 (Fig. 1C), suggesting signaling proceeds from EphA2 to (4 proteins, blue), and moderate confidence (8 proteins, PLCg. green; Fig. 1A). One to 2 candidates were identified in each Additional analysis of the PLCg protein–protein interactome category that have been previously reported to interact with identified 57 interacting proteins for PLCg1, far more than the

Figure 2. EphA2 kinase activity is required for phosphorylation of PLCg. Wild-type (wt) or mutant EphA2 was expressed in COS-7 or BEAS2B cells to assess their ability to phosphorylate PLCg1. A, Diagram showing the domains of EphA2 and the mutants used in the following experiments. B, Whole cell lysates of COS-7 cells 48 hours posttransfection were analyzed by Western blotting for phosphorylation of EphA2 and PLCg1. C, Quantiﬁcation of the ratio of phospho-PLCg to total PLCg in EphA2 and PLCg coexpressing cells from two independent experiments. p/t, phospho/total. D, PLCG1 and EphA2 were cotransfected into COS-7 cells at a ratio of 1:0.1, 1:0.2, 1:0.4, and 1:1 and whole cell lysates were collected 48 hours posttransfection. Lysates were analyzed by Western blotting and quantiﬁed in the bottom panel. E, BEAS2B cells overexpressing EphA2 were cultured for 48 hours in growth medium or serum-starved and FBS-stimulated for 10 minutes before collection of lysates. Whole cell lysates were analyzed by Western blotting using the indicated antibodies.

OF4 Mol Cancer Res; 2020 MOLECULAR CANCER RESEARCH

EphA2 Interacts with PLCg1 in Lung Cancer

Figure 3. PLCg1 is activated by EphA2 in human lung cancer cell lines. PLCg1 activity was evaluated by its Y783 phosphorylation in human KRAS-mutant lines. A2: EphA2; P1: PLCg1. A, Wild-type or kinase dead (KD) EphA2 was expressed in H23 cells. Cells were serum-starved and FBS-stimulated for 10 minutes and whole cell lysates were analyzed by Western blotting with the indicated antibodies. B and C, EphA2 was knocked down by pooled siRNA in the indicated cell lines and whole cell lysates were analyzed by Western blotting. B, H23 cells were serum-starved and stimulated with FBS for 10 or 30 minutes. C, Cell lines were cultured in complete growth media for 24 hours posttransfection. D, EphA2 was knocked down by two different shRNA sequences (#1 and #2) in H23 and H2009 cell lines which were serum-starved and stimulated with FBS for 10 minutes. Whole cell lysates were analyzed by Western blotting with the indicated antibodies. E, H23 and H2009 cell lines were stimulated with IgG-Fc or Ephrin-A1-Fc for 10 or 20 minutes. Whole cell lysates were analyzed by Western blotting with the indicated antibodies. F, H23 shGFP control or shEphA2 (sequence #1) knockdown cells were stimulated with IgG-Fc or Ephrin-A1-Fc for 10 minutes. Whole cell lysates were analyzed by Western blotting with the indicated antibodies. G, H23 or H2009 cells were treated with increasing concentrations of ALW for 24 hours. Whole cell lysates were analyzed by Western blotting with the indicated antibodies. H and I, Endogenous interactions between EphA2 and PLCg1 in H23 and H2009 cells were analyzed by Duolink PLA in shGFP control cells compared with either shEphA2 or shPLCG1 knockdown cells. PLA signals (dots) were quantiﬁed from three to six 40 ﬁelds. Data are presented as mean SD. , P < 0.05, Student t test. J, IgG or PLCg1 immunoprecipitates and whole cell lysates from H23 shGFP control or shEphA2 cells were assessed by Western blotting with the indicated antibodies.

14 interacting proteins of PLCg2(Fig. 1D). Interestingly, KEGG EphA2 kinase activity is required for PLCg1 phosphorylation enrichment analysis of the PLCg1 interactome identified 22 pro- PLCg is a well-known downstream effector of several RTKs, teins that were significantly enriched in the Ras signaling pathway including EGFR, platlet-derived growth factor receptor, VEGFR, P ¼ ( adjusted 2.1e-22; Fig. 1E), a pathway known to be important in and TrkB (9). Phospho-tyrosine sites on the RTKs interact with the driving a significant portion of NSCLC. SH2 domain of PLCg for activation (9). Consistent with other Because PLCg1 had a stronger interaction with EphA2 (Fig. 1B) and RTKs, our results from the Y2H screen indicated that the SH2 PPI analysis of PLCG1 showed a broader functional network than domain of PLCg1 was involved in the interaction with the EphA2 PLCg2, we focused on PLCg10s interaction with EphA2 in KRAS- intracellular domain. To characterize the interaction between mutant lung cancer for the remainder of the study. EphA2 and PLCg1, a series of EphA2 mutants were made,

AACRJournals.org Mol Cancer Res; 2020 OF5

Song et al.

Figure 4. PLCg1 loss inhibits human KRAS-mutant lung cancer cell growth. A, Western blot analysis of PLCg1 levels in H23 cells upon siPLCG1 targeting. B, Cell viability of H23 and H2009 cells upon knockdown of PLCG1 by siRNA was measured by MTT assay. Representative data are presented as mean SD. , P < 0.01; , P < 0.001, Student t test. C, Western blot analysis of PLCg1 levels in H23 and H2009 cells upon knockdown of PLCG1 by shRNA. D, MTT assays measuring the relative cell viability of H23 and H2009 upon targeting of PLCG1 by shRNA. Representative data are presented as mean SD. , P < 0.001, two-way ANOVA with Tukey post hoc correction for multiple comparisons. E, Colony growth of shGFP or shPLCG1 H23 and H2009 cells. Quantiﬁcation of colony area below. Representative data are presented as mean SD. , P < 0.001, Student t test. F, Western blot analysis of H23 cells upon targeting of PLCG1 by CRISPR-Cas9–mediated genome editing. G, Colony growth of sgLacZ or sgPLCG1 H23 cells. Quantiﬁcation of colony area below. Representative data are presented as mean SD. , P < 0.01; , P < 0.001, Student t test.

including two kinase dead mutants (K646M, D739N), four tyrosine EphA2 activates PLCg1 in human lung cancer cells phosphorylation site mutants (Y588F, Y594F, Y735F, Y930F), and EphA2 is highly expressed in many KRAS-mutant lung cancer cells one serine phosphorylation site mutant (S897A; Fig. 2A). These and has been shown to regulate tumor malignancy (4), prompting us to phosphorylation sites were chosen on the basis of the literature and investigate if PLCg1 is regulated by EphA2 in these cells. Expression of analysis of EphA2 in the PhosphoSitePlus PTM Resource (https:// wild-type EphA2 in H23 cells led to phosphorylation of PLCg1, while www.phosphosite.org/homeAction.action) as putative sites most kinase-dead EphA2 had no effect on p-PLCg1 levels (Fig. 3A). likely to be involved in EphA2 kinase activity or its cellular Corresponding experiments knocking down EphA2 by siRNA in a function. panel of KRAS-mutant lung cancer cell lines (H23, H2009, A549, In EphA2 and PLCG1 coexpressing COS-7 cells (Fig. 2B and C), HCC44, H2030, H358) led to a decrease of p-PLCg1(Fig. 3B and C). wild-type EphA2 increased the level of phospho-PLCg1, whereas Furthermore, loss of EphA2 by shRNA or siRNA in either H23 or the ability to phosphorylate PLCg1 was impaired in cells expressing H2009 cells diminished p-PLCg1 in serum-starved, stimulated, or kinase dead or the two tyrosine mutants (Y588F and Y594F) that are normal growth conditions (Fig. 3B and D). Stimulation with ephrin- situated within the juxtamembrane domain of EphA2 and are A1-Fc, a surrogate for EphA2 canonical ligand ephrin-A1, also known to be required for proper kinase activity (28). Mutation of increased p-PLCg 1 in H23 and H2009 cells (Fig. 3E). This signal was theothertwotyrosinesitesinthekinasedomainandSAMdomain depleted when EphA2 was knocked down by shRNA (Fig. 3F). aswellastheserinesitehadlittleeffectonPLCg1 phosphorylation. Pharmacologic inhibition of EphA2 kinase activity using the small- Furthermore, the level of phospho-PLCg1 was dependent on the molecule inhibitor ALW-II-41-27(4; ALW) also inhibited phosphor- level of EphA2 expression in the cells (Fig. 2D). Consistent ylation of PLCg1, with increasing doses of ALW inhibiting both with Fig. 2C, expression of the EphA2 kinase dead mutant p-EphA2 and p-PLCg1 in H23 and H2009 cells (Fig. 3G; Supplemen- (K646M) had no effect on phosphorylation of PLCg1evenatvery tary Fig. S1A). IHC analysis of EphA2 and p-PLCG1 in a human lung high doses. The Y588F mutant, which exhibited reduced kinase adenocarcinoma tumor microarray showed a positive correlation activity, only weakly affected phosphorylation of PLCg1athigh between EphA2 and p-PLCg1 staining (Supplementary Fig. S1B and expression levels. S1C), supporting the relevance of the EphA2-PLCG1 axis in human We also expressed EphA2 in BEAS2B cells, a immortalized lung cancer. bronchial epithelial cell line with low endogenous EphA2 expres- To verify that EphA2 phosphorylates PLCg1 via a direct interaction sion and analyzed the phosphorylation levels of endogenous PLCg1 between the two proteins in lung cancer cells, we performed DuoLink (Fig. 2E). The result here showed that only wild-type EphA2, but proximity ligation assay (PLA). We showed that loss of either EphA2 not K646M or Y588F mutants, could phosphorylate PLCg1, dem- or PLCg1 by shRNA reduced the number of EphA2-PLCg1 interac- onstrating that PLCg1 phosphorylation is dependent on the kinase tions compared with control shGFP (Fig. 3H and I). In addition, activity of EphA2. EphA2 coimmunoprecipitated with PLCg1 in H23 shGFP control

OF6 Mol Cancer Res; 2020 MOLECULAR CANCER RESEARCH

EphA2 Interacts with PLCg1 in Lung Cancer

cells, but not in shEphA2 cells, providing evidence of an endogenous formation assays (Fig. 4C–E; Supplementary Fig. S2). shPLCG1 cells EphA2-PLCg1 interaction (Fig. 3J). Together, these data show that showed a much slower growth rate and rarely formed colonies even EphA2 interacts with and phosphorylates PLCg1 in human KRAS- after 2 weeks in culture compared with shGFP control. Similarly, mutant lung cancer cell lines. PLCg1 loss significantly hindered colony formation in sgPLCG1 cells compared with sgLacZ control, with the reduction in colony formation Loss of PLCg1 blocks human lung cancer cell growth correlating with the efficiency of knockout (Fig. 4F and G). Thus, we Despite PLCg10s well-known roles in regulating T-cell development demonstrate that PLCG1 promotes the growth of human lung cancer and homeostasis (29) and breast cancer cell migration and inva- cells in vitro. sion (30), a role for PLCg1 in lung cancer remains unclear. We used three independent siRNAs to knockdown PLCG1 in H23 and H2009 PLCg1deficiency decreases tumor growth in a mouse KPL lung cells (Fig. 4A). In both cell lines, transient loss of PLCg1 significantly tumor model reduced cell viability compared with control (Fig. 4B). Long-term To evaluate the in vivo role of PLCg1 in tumor growth within a effects of PLCg1 loss on cell proliferation were assessed by stable competent immune environment, a mouse KPL lung tumor model was knockdown or knockout of PLCG1 by four independent shRNAs or established (Fig. 5A–C) based on the report from Platt and collea- CRISPR-Cas9–mediated genome editing followed by MTT and colony gues (24). An adeno-associated virus (AAV) carrying three adjacent

Figure 5. PLCg1deficiency hinders mouse KPL lung tumor growth. A, Schematic of AAV vector used for expression of sgKras, sgp53, sgLkb1, Cre, and KrasG12D template. B, MRI of tumor formation in KPL mice up to 3 months after viral instillation. C, Representative image of GFP expression in KPL lung tumors. Cells were isolated from tumors to create KPL tumor cell lines. D, Single cell clones from KPL tumors were grown to create KPL tumor cell lines (e.g., KPL-C1, clone 1). Whole cell lysates were analyzed by Western blotting using the indicated antibodies. E, KPL-C2 cells were treated with increasing doses of ALW. Cell lysates were analyzed by Western blotting using the indicated antibodies. F, Colony assay of KPL-C2 cells with increasing doses of ALW. Quantification in the bottom panel. Data are presented as mean SEM. , P < 0.01; , P < 0.001, Student t test. G, Western blot analysis showing loss of PLCg1 upon targeting of KPL-C2 cells with CRISPR-Cas9 sgPLCG1. H, Colony assay of KPL-C2 cells targeted with sgPLCG1. Quantification in bottom panels. Representative data are presented as mean SD. , P < 0.05; , P < 0.01, Student t test. I–M, sgPLCG1 KPL-C2 cells were injected via tail vein injection back into Rosa26-LSL-Cas9-GFP mice. I, Tumor formation was visible by GFP expression. J, Quantification of GFP density of sgLacZ or sgPLCG1 KPL-C2 tumors. Data are presented as mean SEM. , P < 0.01; , P < 0.001, Student t test. K, Proliferation of sgLacZ or sgPLCG1 KPL-C2 tumors was measured by PCNA IHC staining. L, Quantification of PCNA staining. Data are presented as mean SEM. , P < 0.05, Student t test. M, Apoptosis was measured by TUNEL IHC staining. Quantified data are presented as mean SEM, Student t test.

AACRJournals.org Mol Cancer Res; 2020 OF7

Song et al.

sgRNAs targeting Kras, p53, and Lkb1 genes (KPL), together with a Cre tumorigenesis (38–42), additional studies are required to determine expression cassette and a mutant KrasG12D genomic template, was whether these interactors participate in EphA2 signaling during purified and delivered into the lungs of Rosa26-LSL-Cas9-EGFP lung tumor progression. knock-in recipient mice via intratracheal instillation (Fig. 5A). The role of PLCg1 in tumor cell proliferation is controversial. While Cre-mediated recombination allows for EGFP and Cas9 expression PLCg1 has been implicated in directing cell-cycle progression (43, 44), in target cells, which leads to mutation of the three target genes via other reports suggest that PLCg1 may negatively regulate cell prolif- nonhomologous end joining (p53 or Lkb1) or homology-directed eration (45). These conflicting reports suggest that PLCg1 regulation of repair (Kras G12D). The mice developed abundant lung nodules cell proliferation may be context dependent, perhaps varying based on approximately 2–3 months after viral instillation, as monitored by the tumor type or activating growth factor. In this study, we show that MRI (Fig. 5B). Tumor nodules were also visible by EGFP after lung loss of PLCG1 reduces cell viability of KRAS-mutant lung cancer cell dissection (Fig. 5C). EGFP-positive tumor cell populations were then lines in vitro and reduced PCNA staining of KPL lung tumors in vivo. isolated from the tumor mass and single cell clones were established Thus, our data suggest in the context of KRAS-mutant lung cancer, (Fig. 5C). Western blots were used to confirm KPL mutations in the PLCg1 facilitates tumor cell proliferation. Furthermore, PLCg has clones (Fig. 5D), and clone KPL-C2 was selected for use in the been implicated in AXL-mediated resistance to PI3K inhibition in following experiments. neck and esophageal squamous cell carcinomas (16). Because EphA2 In addition to the targeted KPL mutations, KPL-C2 cells had high also plays critical roles in tumor resistance to EGFR kinase inhibitors in EphA2 and p-EphA2 expression. Pharmacologic inhibition of EphA2 lung cancer (5) and B-Raf inhibitors in melanoma (46), it will be by ALW effectively blocked both p-EphA2 and p-PLCg1(Fig. 5E, interesting to investigate whether PLCg mediates the EphA2 signaling arrow) and colony growth of KPL cells in a dose-dependent manner pathway in drug-resistant cells. (Fig. 5F), indicating EphA2 might modulate PLCg1 activity to regulate In summary, our data reveal that PLCg1 is a novel interactor of the KPL tumor cell growth. CRISPR-Cas9–mediated genome editing was EphA2 RTK in lung cancer cells, and our data support the idea that used to generate PLCg1 knockout KPL cells (Fig. 5G). PLCg1-deficient targeting this EphA2- PLCg1 signaling axis could be a promising KPL cells showed a significant decrease in colony growth in vitro therapeutic option for treating lung cancer. (Fig. 5H). sgLacZ control and sgPLCG1 knockout cells were subsequently injected into the tail veins of immune competent mice Disclosure of Potential Conflicts of Interest (Rosa26-LSL-Cas9-EGFP). sgLacZ cells developed a significant num- L.C. Kim reports grants from NCI during the conduct of the study. ber of tumors in the lungs at week 3, while PLCG1-deficient cells D.M. Brantley-Sieders reports grants from NIH/NCI during the conduct of formed a very limited number of tumors compared with the control the study. J. Chen reports grants from NCI and VA during the conduct of the study. No potential conflicts of interest were disclosed by the other authors. cells (Fig. 5I and J). In some mice, loss of PLCg1 completely inhibited tumor formation. PCNA and cleaved caspase-3 IHC staining of the Authors’ Contributions tumors showed that PLCg1deficiency in these KPL cells inhibited – W. Song: Conceptualization, data curation, formal analysis, investigation, tumor cell proliferation but had little effect on apoptosis (Fig. 5K M), visualization, methodology, writing-original draft, writing-review and editing. respectively, in agreement with our previous findings that EphA2 L.C. Kim: Data curation, formal analysis, investigation, writing-original draft, knockdown affected tumor cell proliferation but not apoptosis (31, 32). writing-review and editing. W. Han: Data curation, formal analysis. Y. Hou: Data Collectively, these data show that PLCg1 promotes KPL lung tumor curation, formal analysis. D.N. Edwards: Data curation, formal analysis. S. Wang: growth. Data curation. T.S. Blackwell: Resources. F. Cheng: Data curation, formal analysis, supervision. D.M. Brantley-Sieders: Resources, data curation, supervision. J. Chen: Conceptualization, resources, formal analysis, supervision, project administration, Discussion writing-review and editing. EphA2 has emerged as a promising target in several tumor types Acknowledgments including lung, pancreatic, breast, and glioblastoma (4, 31–35), yet We would like to acknowledge the Vanderbilt Small Animal Image Core for understanding of its proximal downstream signals is not compre- assistance with live animal imaging and the Vanderbilt Translational Pathology hensive. In this report, we identify PLCg as a novel downstream Shared Resource for their help with immunohistochemistry staining of tumor effector of EphA2 capable of promoting tumor progression in the sections. This work was supported by a VA Merit Award 5101BX000134 and a VA Research Career Scientist Award (to J. Chen), NIH grants R01 CA177681 (to J. Chen context of KRAS-mutant lung cancer. In addition to PLCg1, several and D.M. Brantley-Sieders), R01 CA95004 (to J. Chen), T32 CA009592 (to L.C. Kim), other well-known signaling molecules, including S6K1-pBAD, JNK- and F31 CA2220804-01 (to L.C. Kim). c-JUN, mTOR, and ERK, are also known to function downstream of EphA2 in lung cancer (4, 31, 36, 37). How cells precisely regulate The costs of publication of this article were defrayed in part by the payment of page timing and localization of these interactions downstream of EphA2 charges. This article must therefore be hereby marked advertisement in accordance remains unanswered. Along with PLCg, our Y2H screen also with 18 U.S.C. Section 1734 solely to indicate this fact. identified other EphA2 interactors including Src family proteins, the PTPN3 phosphatase, and PIK3R1, a regulatory subunit of PI3K Received January 20, 2020; revised July 7, 2020; accepted July 20, 2020; (Fig. 1A). While many of these hits have been implicated in lung published first August 4, 2020.

References 1. Mayekar MK, Bivona TG. Current landscape of targeted therapy in lung cancer. 3. Pasquale EB. Eph receptors and ephrins in cancer: bidirectional signalling and Clin Pharmacol Ther 2017;102:757–64. beyond. Nat Rev Cancer 2010;10:165–80. 2. Rikova K, Guo A, Zeng Q, Possemato A, Yu J, Haack H, et al. Global survey of 4. Amato KR, Wang S, Hastings AK, Youngblood VM, Santapuram PR, Chen H, phosphotyrosine signaling identiﬁes oncogenic kinases in lung cancer. Cell 2007; et al. Genetic and pharmacologic inhibition of EPHA2 promotes apoptosis in 131:1190–203. NSCLC. J Clin Invest 2014;124:2037–49.

OF8 Mol Cancer Res; 2020 MOLECULAR CANCER RESEARCH

EphA2 Interacts with PLCg1 in Lung Cancer

5. Amato KR, Wang S, Tan L, Hastings AK, Song W, Lovly CM, et al. EPHA2 27. Carpenter G, Ji Q. phospholipase C-g as a signal-transducing element. Exp Cell blockade overcomes acquired resistance to EGFR kinase inhibitors in lung Res 1999;253:15–24. cancer. Cancer Res 2016;76:305–18. 28. Bin Fang W, DM Brantley-Sieders, Hwang Y, Ham AJL, Chen J. Identification 6. Barquilla A, Pasquale EB. Eph receptors and ephrins: therapeutic opportunities. and functional analysis of phosphorylated tyrosine residues within EphA2 Annu Rev Pharmacol Toxicol 2015;55:465–87. receptor tyrosine kinase. J Biol Chem 2008;283:16017–26. 7. Suh PG, Park JI, Manzoli L, Cocco L, Peak JC, Katan M, et al. Multiple roles of 29. Koss H, Bunney TD, Behjati S, Katan M. Dysfunction of phospholipase Cg in phosphoinositide-specific phospholipase C isozymes. BMB Rep 2008;41:415–34. immune disorders and cancer. Trends Biochem Sci 2014;39:603–11. 8. Jang HJ, Suh PG, Lee YJ, Shin KJ, Chae YC. PLCg1: potential arbitrator of cancer 30. Emmanouilidi A, Lattanzio R, Sala G, Piantelli M, Falasca M. The role of progression. Adv Biol Regul 2018;67:179–89. phospholipase Cg1 in breast cancer and its clinical significance. Futur Oncol 9. Yang YR, Follo MY, Cocco L, Suh PG. The physiological roles of primary 2017;13:1991–7. phospholipase C. Adv Biol Regul 2013;53:232–41. 31. Song W, Ma Y, Wang J, Brantley-Sieders D, Chen J. JNK signaling mediates 10. JiQS,WinnierGE,NiswenderKD,HorstmanD,WisdomR,MagnusonMA, EPHA2-dependent tumor cell proliferation, motility, and cancer stem cell-like et al. Essential role of the tyrosine kinase substrate phospholipase C-gamma1 properties in non-small cell lung cancer. Cancer Res 2014;74:2444–54. in mammalian growth and development. Proc Natl Acad Sci U S A 1997;94: 32. Song W, Hwang Y, Youngblood VM, Cook RS, Balko JM, Chen J, et al. Targeting 2999–3003. EphA2 impairs cell cycle progression and growth of basal-like/triple-negative 11. Faccio R, Cremasco V. PLCg2: where bone and immune cells find their common breast cancers. Oncogene 2017;36:5620–30. ground. Ann N Y Acad Sci 2010;1192:124–30. 33. Brantley-Sieders DM, Zhuang G, Hicks D, Bin Fang W, Hwang Y, Cates JMM, 12. Sala G, Dituri F, Raimondi C, Previdi S, Maffucci T, Mazzoletti M, et al. et al. The receptor tyrosine kinase EphA2 promotes mammary adenocarcinoma Phospholipase Cg1 is required for metastasis development and progression. tumorigenesis and metastatic progression in mice by amplifying ErbB2 signaling. Cancer Res 2008;68:10187–96. J Clin Invest 2008;118:64–78. 13. Arteaga CL, Johnson MD, Todderud G, Coffey RJ, Carpenter G, Page DL. 34. Paraiso KHT, Das Thakur M, Fang B, Koomen JM, Fedorenko I V, John JK, et al. Elevated content of the tyrosine kinase substrate phospholipase C-gamma 1 in Ligand-independent EPHA2 signaling drives the adoption of a targeted therapy- primary human breast carcinomas. Proc Natl Acad Sci U S A 1991;88:10435–9. mediated metastatic melanoma phenotype. Cancer Discov 2015;5:264–73. 14. Lattanzio R, Iezzi M, Sala G, Tinari N, Falasca M, Alberti S, et al. PLC-gamma-1 35. Qazi MA, Vora P, Venugopal C, Adams J, Singh M, Hu A, et al. Cotargeting phosphorylation status is prognostic of metastatic risk in patients with early- ephrin receptor tyrosine kinases A2 and A3 in cancer stem cells reduces growth stage Luminal-A and -B breast cancer subtypes. BMC Cancer 2019;19:747. of recurrent glioblastoma. Cancer Res 2018;78:5023–37. 15. Gouaze-Andersson V, Delmas C, Taurand M, Martinez-Gala J, Evrard S, 36. Faoro L, Singleton PA, Cervantes GM, Lennon FE, Choong NW, Kanteti R, et al. Mazoyer S, et al. FGFR1 induces glioblastoma radioresistance through the EphA2 mutation in lung squamous cell carcinoma promotes increased cell PLCg/Hif1 pathway. Cancer Res 2016;76:3036–44. survival, cell invasion, focal adhesions, and mammalian target of rapamycin 16. Elkabets M, Pazarentzos E, Juric D, Sheng Q, Pelossof RA, Brook S, et al. AXL activation. J Biol Chem 2010;285:18575–85. mediates resistance to PI3Ka inhibition by activating the EGFR/PKC/mTOR 37. Brannan JM, Sen B, Saigal B, Prudkin L, Behrens C, Solis L, et al. EphA2 in the axis in head and neck and esophageal squamous cell carcinomas. Cancer Cell early pathogenesis and progression of non-small cell lung cancer. Cancer Prev 2015;27:533–46. Res 2009;2:1039–49. 17. Liu TM, Woyach JA, Zhong Y, Lozanski A, Lozanski G, Dong S, et al. 38. Giaccone G, Zucali PA. Src as a potential therapeutic target in non-small-cell Hypermorphic mutation of phospholipase C, g2 acquired in ibrutinib- lung cancer. Ann Oncol 2008;19:1219–23. resistant CLL confers BTK independency upon B-cell receptor activation. 39. Taniguchi CM, Winnay J, Kondo T, Bronson RT, Guimaraes AR, Aleman JO, Blood 2015;126:61–8. et al. The phosphoinositide 3-kinase regulatory subunit p85a can exert tumor 18. Cheng F, Desai RJ, Handy DE, Wang R, Schneeweiss S, Barabasi AL, et al. suppressor properties through negative regulation of growth factor signaling. Network-based approach to prediction and population-based validation of in Cancer Res 2010;70:5305–15. silico drug repurposing. Nat Commun 2018;9:2691. 40. Peng Y, Dai Y, Hitchcock C, Yang X, Kassis ES, Liu L, et al. Insulin growth factor 19. Cheng F, Kovaacs IA, Barabaasi AL. Network-based prediction of drug combi- signaling is regulated by microRNA-486, an underexpressed microRNA in lung nations. Nat Commun 2019;10:1197. cancer. Proc Natl Acad Sci U S A 2013;110:15043–8. 20. Cheng F, Lu W, Liu C, Fang J, Hou Y, Handy DE, et al. A genome-wide 41. Li MY, Lai PL, Chou YT, Chi AP, Mi YZ, Khoo KH, et al. Protein tyrosine positioning systems network algorithm for in silico drug repurposing. phosphatase PTPN3 inhibits lung cancer cell proliferation and migration by Nat Commun 2019;10:3476. promoting EGFR endocytic degradation. Oncogene 2015;34:3791–803. 21. Youngblood VM, Kim LC, Edwards DN, Hwang Y, Santapuram PR, Stirdivant 42. Li MY, Peng WH, Wu CH, Chang YM, Lin YL, Chang GD, et al. PTPN3 SM, et al. The ephrin-A1/EPHA2 signaling axis regulates glutamine metabolism suppresses lung cancer cell invasiveness by counteracting Src-mediated DAAM1 in HER2-positive breast cancer. Cancer Res 2016;76:1825–36. activation and actin polymerization. Oncogene 2019;38:7002–16. 22. Brantley-Sieders DM, Zhuang G, Vaught D, Freeman T, Hwang Y, Hicks D, 43. Wang Z, Gluck€ S, Zhang L, Moran MF. Requirement for phospholipase C-g1 et al. Host deficiency in Vav2/3 guanine nucleotide exchange factors impairs enzymatic activity in growth factor-induced mitogenesis. Mol Cell Biol 1998;18: tumor growth, survival, and angiogenesis in vivo. Mol Cancer Res 2009;7: 590–7. 615–23. 44. Browaeys-Poly E, Perdereau D, Lescuyer A, Burnol A-F, Cailliau K. Akt 23. Sentmanat MF, Peters ST, Florian CP, Connelly JP, Pruett-Miller SM. A survey of interaction with PLC(gamma) regulates the G(2)/M transition triggered by validation strategies for CRISPR-Cas9 editing. Sci Rep 2018;8:88. FGF receptors from MDA-MB-231 breast cancer cells. Anticancer Res 2009; 24. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, et al. CRISPR-Cas9 29:4965–9. knockin mice for genome editing and cancer modeling. Cell 2014;159:440–55. 45. Choi JH, Kim HS, Kim S-H, Yang YR, Bae YS, Chang JS, et al. Phospholipase 25. Hunter SG, Zhuang G, Brantley-Sieders D, Swat W, Cowan CW, Chen J. Cgamma1 negatively regulates growth hormone signalling by forming a ternary Essential role of Vav family guanine nucleotide exchange factors in EphA complex with Jak2 and protein tyrosine phosphatase-1B. Nat Cell Biol 2006;8: receptor-mediated angiogenesis. Mol Cell Biol 2006;26:4830–42. 1389–97. 26. Zhuang G, Hunter S, Hwang Y, Chen J. Regulation of EphA2 receptor endo- 46. Miao B, Ji Z, Tan L, Taylor M, Zhang J, Choi HG, et al. EPHA2 is a mediator of cytosis by SHIP2 lipid phosphatase via phosphatidylinositol 3-kinase-dependent vemurafenib resistance and a novel therapeutic target in melanoma. Rac1 activation. J Biol Chem 2007;282:2683–94. Cancer Discov 2015;5:274–87.

AACRJournals.org Mol Cancer Res; 2020 OF9

Phosphorylation of PLCγ1 by EphA2 Receptor Tyrosine Kinase Promotes Tumor Growth in Lung Cancer

Wenqiang Song, Laura C. Kim, Wei Han, et al.

Mol Cancer Res Published OnlineFirst August 4, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-20-0075

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2020/08/04/1541-7786.MCR-20-0075.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2020/08/18/1541-7786.MCR-20-0075. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.