DOCSLIB.ORG

On Human Chromosome 7

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

PREFERENTIAL ALLELIC EXPRESSION OF GENETIC INFORMATION ON HUMAN CHROMOSOME 7 LAYLA KATIRAEE A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Layla Katiraee 2008 PREFERENTIAL ALLELIC EXPRESSION OF GENETIC INFORMATION ON HUMAN CHROMOSOME 7 LAYLA KATIRAEE Doctor of Philosophy Department of Molecular Genetics University of Toronto 2008 ABSTRACT Genes are typically expressed in equal amounts from both parentally inherited chromosomes. However, recent studies have demonstrated that genes can be preferentially transcribed from a locus. Non-random preferential expression of alleles can occur in a parent-of-origin pattern, known as imprinting, where epigenetic factors regulate their transcription. Alternatively, it can occur in a haplotype-specific pattern, where cis-acting polymorphisms in regulatory regions are thought to underlie the phenomenon. Both forms of unequal allelic expression have been associated with human disease. Consequently, it is important to identify genes subject to unequal allelic expression and characterize mechanisms that regulate differential transcription. This thesis presents the results of a screen for unequal allelic expression where approximately 50 murine transcripts homologous to genes on human chromosome 7 were analyzed. Human chromosome 7 was selected due to its association with several human disorders that show parent-of-origin effects. The screen identified non-imprinted ii preferential allelic expression in numerous transcripts and demonstrated that such patterns can occur in tissue specific patterns. Paraoxonase-1 (Pon1), a gene implicated in arthrosclerosis, was identified as having a dynamic pattern of allelic expression which varies throughout embryonic development. This finding represents the first report of a developmentally regulated pattern of allelic variance. Carboxypeptidase-A4 (Cpa4) was identified as having a tissue-specific imprinted pattern of expression, where the maternal allele was preferentially expressed in all embryonic tissues, with the exception of the brain. The Krüppel-like factor 14 gene (Klf14), a novel imprinted transcript, was found to have ubiquitous maternal expression in all human and murine tissues analyzed. A differentially methylated region, generally associated with imprinted transcripts, was not found in the gene’s CpG island, nor was a differential pattern of histone modifications identified. However, it was determined that maternal methylation regulates the transcript. The data in this thesis contribute to our understanding of the numerous patterns of allelic expression that exist in nature and the diverse mechanisms that regulate them. Ultimately, quantitative analyses of allelic expression patterns and the identification of their underlying genomic DNA sequences will become standard protocol in all biomedical studies. iii ACKNOWLEDGMENTS I would like to thank my supervisor Dr. Stephen Scherer for his confidence in me and for his support, as well as my committee members Dr. Timothy Hughes and Dr. Christopher Pearson for their guidance and encouragement. I would like to thank Dr. Kazuhiko Nakabayashi for introducing me to the field of epigenetics, for the overwhelming amount of guidance that he offered throughout the course of my doctoral degree, for exemplifying scientific creativity and discipline, for answering all my frantic emails, and for his friendship. To Dr. Takahiro Yamada, I thank him for his assistance and collaboration in countless experiments, for his patience in my training, for his wit and humour. To all the post-docs, technicians, and students who assisted me, particularly Dr. Kohji Okamura, Dr. Makiko Meguro-Horike, Dr. Shin-ichi Horike, Dr. Yan Ren, Michelle Lee, Maryam Mashreghi- Mohammadi, Katherine Sansom, and Xiaochu Zhao, I owe a debt of gratitude. I’d like to thank our collaborators who made the findings in this thesis possible. I’d like to thank Dr. Johanna Rommens for her guidance and wisdom. I’d particularly like to thank Dr. Helen Petropoulos for her encouragement, friendship, movie and television critiques, for teaching me all the basics, and for her help troubleshooting several experiments. I thank Adam Smith for his experimental assistance and the critical reading of this thesis. I’d like to thank all past and present members of TCAG and the Scherer lab, particularly the members of the Sequencing and Tissue Culture facilities, as well as the bioinformaticians. I’d like to thank Dr. Ilona Skerjanc and Dr. Robert Hegele for helping me get where I am today. I’d like to thank all the members of the Scherer, Minassian, and Pearson labs for their friendship and help, especially Julie Turnbull, Dr. Iulia Oprea, Julie Tomlinson, Sanjeev Pullenayegum, Dr. Elayne Chan, and Dr. Christian Marshall. To Dr. Lars Feuk and particularly Andrew Carson, with whom I’ve solved over 2000 crossword puzzles, hundreds of wordraces, cricklers, and iSketches, and have spent countless hours discussing the merits of TV shows, I iv owe an endless debt of gratitude for their friendship, support, and assistance. Moving my desk into the lab may have been one of the most difficult, yet responsible decisions I made throughout my PhD, but the ‘conversations’ we had at Sick Kids will always make me smile. To Jennifer Skaug, who epitomizes dedication, discipline, and patience, I can never thank enough. I doubt that I will ever find a co-worker and friend as kind and understanding wherever I may go. I’d like to thank the members of the Association for Baha’i Studies at the University of Toronto, the Baha’i Community of Toronto, Varqa Children’s Magazine, and all the members of my Ruhi study circles for enriching my life. To my friends in Toronto who brightened these past five years: Ted & Lindsay Slavin, Sherine & Nabil Kharooba, Lynn & Jason Arsenault, the Sahba Family, Poopak & Hilda Raad, Robyn & Zayne Raue, and Carol Forster. I thank the countless artists whose music kept me company and entertained me on evenings and weekends ☺ I would like to thank my extended family for their support and prayers along this long trek, particularly my grandparents, my aunt Guity and uncle Faramarz, my cousins Ala, Sina, and Lisa, as well as my in-laws Sam and Barbara, who I consider one of my guardian angels. I would like to thank my siblings Ema, Babak, and Galen and would like to point out that I’m the only real doctor in the family. This thesis would have never been completed without the love, support and encouragement of my parents, Hamid and Mahboobeh, who took care of me when I needed it the most, always believed in me, and let me achieve my goals. Finally, I’d like to dedicate this thesis to my husband and my best friend, David Parker. You’ve brightened every hour of these past five years, including my darkest days. You gave me the strength that I needed to finish and held my hand every step of the way, reminding me why I’m the lucky one. You’ve stood by me and believed in me like nobody ever has. This would have been impossible without you and I look forward to getting where I’m going with you. v TABLE OF CONTENTS THESIS ABSTRACT...................................................................................................................ii ACKNOWLEDGEMENTS............................................................................................................iv TABLE OF CONTENTS..............................................................................................................vi LIST OF TABLES......................................................................................................................ix LIST OF FIGURES......................................................................................................................x LIST OF APPENDICES..............................................................................................................xii CHAPTER I: INTRODUCTION TO UNEQUAL ALLELIC EXPRESSION I.A UNEQUAL ALLELIC EXPRESSION..................................................................................2 I.B UNEQUAL ALLELIC EXPRESSION IN NON-PARENT-OF-ORIGIN PATTERNS....................4 I.B.1 Physiological importance of unequal allelic expression in non-parent of origin patterns............................................................................................................. 4 I.C UNEQUAL ALLELIC EXPRESSION IN PARENT-OF-ORIGIN PATTERNS............................ 5 I.C.1 Imprinting disorders...........................................................................................6 I.C.2 Regulation of imprinting.................................................................................... 9 I.C.2.i DNA methylation................................................................................... 9 I.C.2.ii Histone modifications............................................................................11 I.C.2.iii Insulation............................................................................................12 I.C.2.iv Non-coding RNA................................................................................. 13 I.C.3 Imprinted clusters in human and murine genomes.............................................. 17 I.C.3.i The H19/Igf2 locus............................................................................... 17 I.C.3.ii Imprinted loci on human chromosome 7....................................................18 I.C.3.ii.a GRB10..................................................................................
Recommended publications
  • Analysis of Trans Esnps Infers Regulatory Network Architecture

    Analysis of Trans Esnps Infers Regulatory Network Architecture

    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
  • Analysis of Gene Expression Data for Gene Ontology

    Analysis of Gene Expression Data for Gene Ontology

    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
  • Variation in Protein Coding Genes Identifies Information

    Variation in Protein Coding Genes Identifies Information

    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
  • Comparative Analysis of Human Chromosome 7Q21 and Mouse

    Comparative Analysis of Human Chromosome 7Q21 and Mouse

    Downloaded from genome.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Comparative analysis of human chromosome 7q21 and mouse proximal chromosome 6 reveals a placental-specific imprinted gene, TFPI2/Tfpi2, which requires EHMT2 and EED for allelic-silencing David Monk,1,6 Alexandre Wagschal,2 Philippe Arnaud,2 Pari-Sima Mu¨ller,3 Layla Parker-Katiraee,4 Déborah Bourc’his,5 Stephen W. Scherer,4 Robert Feil,2 Philip Stanier,1 and Gudrun E. Moore1 1Institute of Child Health, London WC1N 1EH, United Kingdom; 2Institute of Molecular Genetics, CNRS UMR-5535 and University of Montpellier-II, 34293 Montpellier, France; 3Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom; 4Center for Applied Genomics, The Hospital for Sick Children, Toronto M5G 1L7, Canada; 5Inserm U741, F-75251 Paris Cedex 05, France Genomic imprinting is a developmentally important mechanism that involves both differential DNA methylation and allelic histone modifications. Through detailed comparative characterization, a large imprinted domain mapping to chromosome 7q21 in humans and proximal chromosome 6 in mice was redefined. This domain is organized around a maternally methylated CpG island comprising the promoters of the adjacent PEG10 and SGCE imprinted genes. Examination of Dnmt3l−/+ conceptuses shows that imprinted expression for all genes of the cluster depends upon the germline methylation at this putative “imprinting control region” (ICR). Similarly as for other ICRs, we find its DNA-methylated allele to be associated with trimethylation of lysine 9 on histone H3 (H3K9me3) and trimethylation of lysine 20 on histone H4 (H4K20me3), whereas the transcriptionally active paternal allele is enriched in H3K4me2 and H3K9 acetylation.
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway

    Analysis of the Indacaterol-Regulated Transcriptome in Human Airway

    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
  • The Arf1p Gtpase-Activating Protein Glo3p Executes Its Regulatory Function Through a Conserved Repeat Motif at Its C-Terminus

    The Arf1p Gtpase-Activating Protein Glo3p Executes Its Regulatory Function Through a Conserved Repeat Motif at Its C-Terminus

    2604 Research Article The Arf1p GTPase-activating protein Glo3p executes its regulatory function through a conserved repeat motif at its C-terminus Natsuko Yahara1,*, Ken Sato1,2 and Akihiko Nakano1,3,‡ 1Molecular Membrane Biology Laboratory, RIKEN Discovery Research Institute and 2PRESTO, Japan Science and Technology Agency, Hirosawa, Wako, Saitama 351-0198, Japan 3Department of Biological Sciences, Graduate School of Science, University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033, Japan *Present address: Department of Biochemistry, University of Geneva, Sciences II, Geneva, Switzerland ‡Author for correspondence (e-mail: [email protected]) Accepted 21 March 2006 Journal of Cell Science 119, 2604-2612 Published by The Company of Biologists 2006 doi:10.1242/jcs.02997 Summary ADP-ribosylation factors (Arfs), key regulators of ArfGAP, Gcs1p, we have shown that the non-catalytic C- intracellular membrane traffic, are known to exert multiple terminal region of Glo3p is required for the suppression of roles in vesicular transport. We previously isolated eight the growth defect in the arf1 ts mutants. Interestingly, temperature-sensitive (ts) mutants of the yeast ARF1 gene, Glo3p and its homologues from other eukaryotes harbor a which showed allele-specific defects in protein transport, well-conserved repeated ISSxxxFG sequence near the C- and classified them into three groups of intragenic terminus, which is not found in Gcs1p and its homologues. complementation. In this study, we show that the We name this region the Glo3 motif and present evidence overexpression of Glo3p, one of the GTPase-activating that the motif is required for the function of Glo3p in vivo. proteins of Arf1p (ArfGAP), suppresses the ts growth of a particular group of the arf1 mutants (arf1-16 and arf1-17).
  • A Chromosome Level Genome of Astyanax Mexicanus Surface Fish for Comparing Population

    A Chromosome Level Genome of Astyanax Mexicanus Surface Fish for Comparing Population

    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title 2 A chromosome level genome of Astyanax mexicanus surface fish for comparing population- 3 specific genetic differences contributing to trait evolution. 4 5 Authors 6 Wesley C. Warren1, Tyler E. Boggs2, Richard Borowsky3, Brian M. Carlson4, Estephany 7 Ferrufino5, Joshua B. Gross2, LaDeana Hillier6, Zhilian Hu7, Alex C. Keene8, Alexander Kenzior9, 8 Johanna E. Kowalko5, Chad Tomlinson10, Milinn Kremitzki10, Madeleine E. Lemieux11, Tina 9 Graves-Lindsay10, Suzanne E. McGaugh12, Jeff T. Miller12, Mathilda Mommersteeg7, Rachel L. 10 Moran12, Robert Peuß9, Edward Rice1, Misty R. Riddle13, Itzel Sifuentes-Romero5, Bethany A. 11 Stanhope5,8, Clifford J. Tabin13, Sunishka Thakur5, Yamamoto Yoshiyuki14, Nicolas Rohner9,15 12 13 Authors for correspondence: Wesley C. Warren ([email protected]), Nicolas Rohner 14 ([email protected]) 15 16 Affiliation 17 1Department of Animal Sciences, Department of Surgery, Institute for Data Science and 18 Informatics, University of Missouri, Bond Life Sciences Center, Columbia, MO 19 2 Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 20 3 Department of Biology, New York University, New York, NY 21 4 Department of Biology, The College of Wooster, Wooster, OH 22 5 Harriet L. Wilkes Honors College, Florida Atlantic University, Jupiter FL 23 6 Department of Genome Sciences, University of Washington, Seattle, WA 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020.
  • A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection

    A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection

    CLINICAL RESEARCH www.jasn.org A Peripheral Blood Gene Expression Signature to Diagnose Subclinical Acute Rejection Weijia Zhang,1 Zhengzi Yi,1 Karen L. Keung,2 Huimin Shang,3 Chengguo Wei,1 Paolo Cravedi,1 Zeguo Sun,1 Caixia Xi,1 Christopher Woytovich,1 Samira Farouk,1 Weiqing Huang,1 Khadija Banu,1 Lorenzo Gallon,4 Ciara N. Magee,5 Nader Najafian,5 Milagros Samaniego,6 Arjang Djamali ,7 Stephen I. Alexander,2 Ivy A. Rosales,8 Rex Neal Smith,8 Jenny Xiang,3 Evelyne Lerut,9 Dirk Kuypers,10,11 Maarten Naesens ,10,11 Philip J. O’Connell,2 Robert Colvin,8 Madhav C. Menon,1 and Barbara Murphy1 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background In kidney transplant recipients, surveillance biopsies can reveal, despite stable graft function, histologic features of acute rejection and borderline changes that are associated with undesirable graft outcomes. Noninvasive biomarkers of subclinical acute rejection are needed to avoid the risks and costs associated with repeated biopsies. Methods We examined subclinical histologic and functional changes in kidney transplant recipients from the prospective Genomics of Chronic Allograft Rejection (GoCAR) study who underwent surveillance biopsies over 2 years, identifying those with subclinical or borderline acute cellular rejection (ACR) at 3 months (ACR-3) post-transplant. We performed RNA sequencing on whole blood collected from 88 indi- viduals at the time of 3-month surveillance biopsy to identify transcripts associated with ACR-3, developed a novel sequencing-based targeted expression assay, and validated this gene signature in an independent cohort.
  • Views [10-12] in Favour of Information Theory- Methods

    Views [10-12] in Favour of Information Theory- Methods

    BMC Bioinformatics BioMed Central Research article Open Access Evaluation of GO-based functional similarity measures using S. cerevisiae protein interaction and expression profile data Tao Xu1,2, LinFang Du*2 and Yan Zhou*3,1 Address: 1Shanghai-MOST Key Laboratory of Health and Disease Genomics, Chinese National Human Genome Center at Shanghai, Shanghai 201203, PR China, 2College of Life Sciences, Sichuan University, Chengdu 610064, PR China and 3Department of Microbiology, School of Life Sciences, Fudan University, Shanghai 200433, PR China Email: [email protected]; LinFangDu*[email protected]; Yan Zhou* - [email protected] * Corresponding authors Published: 6 November 2008 Received: 18 March 2008 Accepted: 6 November 2008 BMC Bioinformatics 2008, 9:472 doi:10.1186/1471-2105-9-472 This article is available from: http://www.biomedcentral.com/1471-2105/9/472 © 2008 Xu et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Researchers interested in analysing the expression patterns of functionally related genes usually hope to improve the accuracy of their results beyond the boundaries of currently available experimental data. Gene ontology (GO) data provides a novel way to measure the functional relationship between gene products. Many approaches have been reported for calculating the similarities between two GO terms, known as semantic similarities. However, biologists are more interested in the relationship between gene products than in the scores linking the GO terms.
  • Supplementary Tables S1-S3

    Supplementary Tables S1-S3

    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
  • Specific, Gene Expression Signatures in HIV-1 Infection1

    Specific, Gene Expression Signatures in HIV-1 Infection1

    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Qingsheng Li Publications Papers in the Biological Sciences 2009 Microarray Analysis of Lymphatic Tissue Reveals Stage- Specific, Gene Expression Signatures in HIV-1 Infection1 Qingsheng Li University of Minnesota, [email protected] Anthony J. Smith University of Minnesota Timothy W. Schacker University of Minnesota John V. Carlis University of Minnesota Lijie Duan University of Minnesota See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/biosciqingshengli Li, Qingsheng; Smith, Anthony J.; Schacker, Timothy W.; Carlis, John V.; Duan, Lijie; Reilly, Cavan S.; and Haase, Ashley T., "Microarray Analysis of Lymphatic Tissue Reveals Stage- Specific, Gene Expression Signatures in HIV-1 Infection1" (2009). Qingsheng Li Publications. 8. https://digitalcommons.unl.edu/biosciqingshengli/8 This Article is brought to you for free and open access by the Papers in the Biological Sciences at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Qingsheng Li Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Qingsheng Li, Anthony J. Smith, Timothy W. Schacker, John V. Carlis, Lijie Duan, Cavan S. Reilly, and Ashley T. Haase This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ biosciqingshengli/8 NIH Public Access Author Manuscript J Immunol. Author manuscript; available in PMC 2013 January 23. Published in final edited form as: J Immunol. 2009 August 1; 183(3): 1975–1982. doi:10.4049/jimmunol.0803222. Microarray Analysis of Lymphatic Tissue Reveals Stage- Specific, Gene Expression Signatures in HIV-1 Infection1 $watermark-text $watermark-text $watermark-text Qingsheng Li2,*, Anthony J.
  • Mouse Bet1 Knockout Project (CRISPR/Cas9)

    Mouse Bet1 Knockout Project (CRISPR/Cas9)

    https://www.alphaknockout.com Mouse Bet1 Knockout Project (CRISPR/Cas9) Objective: To create a Bet1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Bet1 gene (NCBI Reference Sequence: NM_009748 ; Ensembl: ENSMUSG00000032757 ) is located on Mouse chromosome 6. 4 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 4 (Transcript: ENSMUST00000049166). Exon 1~4 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 1 starts from about 0.28% of the coding region. Exon 1~4 covers 100.0% of the coding region. The size of effective KO region: ~8910 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 Legends Exon of mouse Bet1 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats.