Comparative Genomics and Novel Bioinformatics Methodology
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Open Dogan Phdthesis Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name DiGeorge syndrome critical region gene 14 Gene Symbol Dgcr14 Organism Mouse Gene Summary The human ortholog of this gene is located within the minimal DGS critical region (MDGCR) thought to contain the gene(s) responsible for a group of developmental disorders. These disorders include DiGeorge syndrome velocardiofacial syndrome conotruncal anomaly face syndrome and some familial or sporadic conotruncal cardiac defects which have been associated with microdeletion of human chromosome band 22q11.2. The encoded protein localizes to the nucleus and the orthologous protein in humans co-purifies with C complex spliceosomes. Multiple transcript variants encoding different isoforms have been found for this gene. Gene Aliases AI462402, D16H22S1269E, Dgcr1, Dgsi, ES2, Es2el RefSeq Accession No. NC_000082.6, NT_039624.8, NT_187007.1 UniGene ID Mm.256480 Ensembl Gene ID ENSMUSG00000003527 Entrez Gene ID 27886 Assay Information Unique Assay ID qMmuCID0011048 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000003621 Amplicon Context Sequence GCCTGTAGCTTCTCCACATCAGGGAAGAAGTCTCTCTGGATAACTGTCTGAAGTC CCTCGATGTACTCTTCTTCATCCAGGACCCGCTGCCTGCTTCTCGCAACTCCGG CCT Amplicon Length (bp) 82 Chromosome Location 16:17910201-17911217 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 95 R2 0.9994 cDNA Cq 21.87 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 79.5 gDNA Cq 23.94 Specificity (%) 100 Information to assist with data interpretation is provided -
CRNKL1 Is a Highly Selective Regulator of Intron-Retaining HIV-1 and Cellular Mrnas
bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 CRNKL1 is a highly selective regulator of intron-retaining HIV-1 and cellular mRNAs 2 3 4 Han Xiao1, Emanuel Wyler2#, Miha Milek2#, Bastian Grewe3, Philipp Kirchner4, Arif Ekici4, Ana Beatriz 5 Oliveira Villela Silva1, Doris Jungnickl1, Markus Landthaler2,5, Armin Ensser1, and Klaus Überla1* 6 7 1 Institute of Clinical and Molecular Virology, University Hospital Erlangen, Friedrich-Alexander 8 Universität Erlangen-Nürnberg, Erlangen, Germany 9 2 Berlin Institute for Medical Systems Biology, Max-Delbrück-Center for Molecular Medicine in the 10 Helmholtz Association, Robert-Rössle-Strasse 10, 13125, Berlin, Germany 11 3 Department of Molecular and Medical Virology, Ruhr-University, Bochum, Germany 12 4 Institute of Human Genetics, University Hospital Erlangen, Friedrich-Alexander Universität Erlangen- 13 Nürnberg, Erlangen, Germany 14 5 IRI Life Sciences, Institute für Biologie, Humboldt Universität zu Berlin, Philippstraße 13, 10115, Berlin, 15 Germany 16 # these two authors contributed equally 17 18 19 *Corresponding author: 20 Prof. Dr. Klaus Überla 21 Institute of Clinical and Molecular Virology, University Hospital Erlangen 22 Friedrich-Alexander Universität Erlangen-Nürnberg 23 Schlossgarten 4, 91054 Erlangen 24 Germany 25 Tel: (+49) 9131-8523563 26 e-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.04.934927; this version posted February 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. -
Ingenuity Pathway Analysis of Differentially Expressed Genes Involved in Signaling Pathways and Molecular Networks in Rhoe Gene‑Edited Cardiomyocytes
INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 1225-1238, 2020 Ingenuity pathway analysis of differentially expressed genes involved in signaling pathways and molecular networks in RhoE gene‑edited cardiomyocytes ZHONGMING SHAO1*, KEKE WANG1*, SHUYA ZHANG2, JIANLING YUAN1, XIAOMING LIAO1, CAIXIA WU1, YUAN ZOU1, YANPING HA1, ZHIHUA SHEN1, JUNLI GUO2 and WEI JIE1,2 1Department of Pathology, School of Basic Medicine Sciences, Guangdong Medical University, Zhanjiang, Guangdong 524023; 2Hainan Provincial Key Laboratory for Tropical Cardiovascular Diseases Research and Key Laboratory of Emergency and Trauma of Ministry of Education, Institute of Cardiovascular Research of The First Affiliated Hospital, Hainan Medical University, Haikou, Hainan 571199, P.R. China Received January 7, 2020; Accepted May 20, 2020 DOI: 10.3892/ijmm.2020.4661 Abstract. RhoE/Rnd3 is an atypical member of the Rho super- injury and abnormalities, cell‑to‑cell signaling and interaction, family of proteins, However, the global biological function and molecular transport. In addition, 885 upstream regulators profile of this protein remains unsolved. In the present study, a were enriched, including 59 molecules that were predicated RhoE‑knockout H9C2 cardiomyocyte cell line was established to be strongly activated (Z‑score >2) and 60 molecules that using CRISPR/Cas9 technology, following which differentially were predicated to be significantly inhibited (Z‑scores <‑2). In expressed genes (DEGs) between the knockout and wild‑type particular, 33 regulatory effects and 25 networks were revealed cell lines were screened using whole genome expression gene to be associated with the DEGs. Among them, the most signifi- chips. A total of 829 DEGs, including 417 upregulated and cant regulatory effects were ‘adhesion of endothelial cells’ and 412 downregulated, were identified using the threshold of ‘recruitment of myeloid cells’ and the top network was ‘neuro- fold changes ≥1.2 and P<0.05. -
Proteomic Analysis Uncovers Measles Virus Protein C Interaction with P65
bioRxiv preprint doi: https://doi.org/10.1101/2020.05.08.084418; this version posted May 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Proteomic Analysis Uncovers Measles Virus Protein C Interaction with p65/iASPP/p53 Protein Complex Alice Meignié1,2*, Chantal Combredet1*, Marc Santolini 3,4, István A. Kovács4,5,6, Thibaut Douché7, Quentin Giai Gianetto 7,8, Hyeju Eun9, Mariette Matondo7, Yves Jacob10, Regis Grailhe9, Frédéric Tangy1**, and Anastassia V. Komarova1, 10** 1 Viral Genomics and Vaccination Unit, Department of Virology, Institut Pasteur, CNRS UMR-3569, 75015 Paris, France 2 Université Paris Diderot, Sorbonne Paris Cité, Paris, France 3 Center for Research and Interdisciplinarity (CRI), Université de Paris, INSERM U1284 4 Network Science Institute and Department of Physics, Northeastern University, Boston, MA 02115, USA 5 Department of Physics and Astronomy, Northwestern University, Evanston, IL 60208-3109, USA 6 Department of Network and Data Science, Central European University, Budapest, H-1051, Hungary 7 Proteomics platform, Mass Spectrometry for Biology Unit (MSBio), Institut Pasteur, CNRS USR 2000, Paris, France. 8 Bioinformatics and Biostatistics Hub, Computational Biology Department, Institut Pasteur, CNRS USR3756, Paris, France 9 Technology Development Platform, Institut Pasteur Korea, Seongnam-si, Republic of Korea 10 Laboratory of Molecular Genetics of RNA Viruses, Institut Pasteur, CNRS UMR-3569, -
Análise Integrativa De Perfis Transcricionais De Pacientes Com
UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. -
Novel Rheumatoid Arthritis Susceptibility Locus at 22Q12 Identified in an Extended UK Genome-Wide Association Study
View metadata, citation and similar papers at core.ac.uk brought to you by CORE ARTHRITIS & RHEUMATOLOGY provided by Aberdeen University Research Archive Vol. 66, No. 1, January 2014, pp 24–30 DOI 10.1002/art.38196 © 2014 The Authors. Arthritis & Rheumatology is published by Wiley Periodicals, Inc. on behalf of the American College of Rheumatology. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made. Novel Rheumatoid Arthritis Susceptibility Locus at 22q12 Identified in an Extended UK Genome-Wide Association Study Gisela Orozco,1 Sebastien Viatte,1 John Bowes,1 Paul Martin,1 Anthony G. Wilson,2 Ann W. Morgan,3 Sophia Steer,4 Paul Wordsworth,5 Lynne J. Hocking,6 UK Rheumatoid Arthritis Genetics Consortium, Wellcome Trust Case Control Consortium, Biologics in Rheumatoid Arthritis Genetics and Genomics Study Syndicate Consortium, Anne Barton,1 Jane Worthington,1 and Stephen Eyre1 Objective. The number of confirmed rheumatoid extend our previous RA GWAS in a UK cohort, adding arthritis (RA) loci currently stands at 32, but many lines more independent RA cases and healthy controls, with of evidence indicate that expansion of existing genome- the aim of detecting novel association signals for sus- wide association studies (GWAS) enhances the power to ceptibility to RA in a homogeneous UK cohort. detect additional loci. This study was undertaken to Methods. A total of 3,223 UK RA cases and 5,272 UK controls were available for association analyses, Funding to generate the genome-wide association study data with the extension adding 1,361 cases and 2,334 controls was provided by Arthritis Research UK (grant 17552), Sanofi-Aventis, to the original GWAS data set. -
The Viral Oncoproteins Tax and HBZ Reprogram the Cellular Mrna Splicing Landscape
bioRxiv preprint doi: https://doi.org/10.1101/2021.01.18.427104; this version posted January 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The viral oncoproteins Tax and HBZ reprogram the cellular mRNA splicing landscape Charlotte Vandermeulen1,2,3, Tina O’Grady3, Bartimee Galvan3, Majid Cherkaoui1, Alice Desbuleux1,2,4,5, Georges Coppin1,2,4,5, Julien Olivet1,2,4,5, Lamya Ben Ameur6, Keisuke Kataoka7, Seishi Ogawa7, Marc Thiry8, Franck Mortreux6, Michael A. Calderwood2,4,5, David E. Hill2,4,5, Johan Van Weyenbergh9, Benoit Charloteaux2,4,5,10, Marc Vidal2,4*, Franck Dequiedt3*, and Jean-Claude Twizere1,2,11* 1Laboratory of Viral Interactomes, GIGA Institute, University of Liege, Liege, Belgium.2Center for Cancer Systems Biology (CCSB), Dana-Farber Cancer Institute, Boston, MA, USA.3Laboratory of Gene Expression and Cancer, GIGA Institute, University of Liege, Liege, Belgium.4Department of Genetics, Blavatnik Institute, Harvard Medical School, Boston, MA, USA. 5Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA, USA.6Laboratory of Biology and Modeling of the Cell, CNRS UMR 5239, INSERM U1210, University of Lyon, Lyon, France.7Department of Pathology and Tumor Biology, Kyoto University, Japan.8Unit of Cell and Tissue Biology, GIGA Institute, University of Liege, Liege, Belgium.9Laboratory of Clinical and Epidemiological Virology, Rega Institute for Medical Research, Department of Microbiology, Immunology and Transplantation, Catholic University of Leuven, Leuven, Belgium.10Department of Human Genetics, CHU of Liege, University of Liege, Liege, Belgium.11Lead Contact. *Correspondence: [email protected]; [email protected]; [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.01.18.427104; this version posted January 18, 2021. -
The Genetics of Bipolar Disorder
Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF. -
A Discovery Resource of Rare Copy Number Variations in Individuals with Autism Spectrum Disorder
INVESTIGATION A Discovery Resource of Rare Copy Number Variations in Individuals with Autism Spectrum Disorder Aparna Prasad,* Daniele Merico,* Bhooma Thiruvahindrapuram,* John Wei,* Anath C. Lionel,*,† Daisuke Sato,* Jessica Rickaby,* Chao Lu,* Peter Szatmari,‡ Wendy Roberts,§ Bridget A. Fernandez,** Christian R. Marshall,*,†† Eli Hatchwell,‡‡ Peggy S. Eis,‡‡ and Stephen W. Scherer*,†,††,1 *The Centre for Applied Genomics, Program in Genetics and Genome Biology, The Hospital for Sick Children, Toronto M5G 1L7, Canada, †Department of Molecular Genetics, University of Toronto, Toronto M5G 1L7, Canada, ‡Offord Centre for Child Studies, Department of Psychiatry and Behavioural Neurosciences, McMaster University, Hamilton L8P 3B6, § Canada, Autism Research Unit, The Hospital for Sick Children, Toronto M5G 1X8, Canada, **Disciplines of Genetics and Medicine, Memorial University of Newfoundland, St. John’s, Newfoundland A1B 3V6, Canada, ††McLaughlin Centre, University of Toronto, Toronto M5G 1L7, Canada, and ‡‡Population Diagnostics, Inc., Melville, New York 11747 ABSTRACT The identification of rare inherited and de novo copy number variations (CNVs) in human KEYWORDS subjects has proven a productive approach to highlight risk genes for autism spectrum disorder (ASD). A rare variants variety of microarrays are available to detect CNVs, including single-nucleotide polymorphism (SNP) arrays gene copy and comparative genomic hybridization (CGH) arrays. Here, we examine a cohort of 696 unrelated ASD number cases using a high-resolution one-million feature CGH microarray, the majority of which were previously chromosomal genotyped with SNP arrays. Our objective was to discover new CNVs in ASD cases that were not detected abnormalities by SNP microarray analysis and to delineate novel ASD risk loci via combined analysis of CGH and SNP array cytogenetics data sets on the ASD cohort and CGH data on an additional 1000 control samples. -
Familial Amyotrophic Lateral Sclerosis Is Associated with a Mutation in D-Amino Acid Oxidase
Familial amyotrophic lateral sclerosis is associated with a mutation in D-amino acid oxidase John Mitchella,1, Praveen Paula,1, Han-Jou Chena, Alex Morrisa, Miles Paylinga, Mario Falchib, James Habgooda, Stefania Panoutsouc, Sabine Winklerc, Veronica Tisatoc, Amin Hajitouc, Bradley Smithd, Caroline Vanced, Christopher Shawd, Nicholas D. Mazarakisc, and Jacqueline de Bellerochea,2 aNeurogenetics Group, Department of Cellular and Molecular Neuroscience, Division of Neuroscience and Mental Health, and bSection of Genomic Medicine, Faculty of Medicine, Imperial College London, Hammersmith Hospital Campus, London W12 0NN, United Kingdom; cDepartment of Gene Therapy, Division of Medicine, Faculty of Medicine, Imperial College London, St. Mary’s Campus, London W2 1PG, United Kingdom; and dDepartment of Clinical Neuroscience, King’s College London and Institute of Psychiatry, London SE5 8AF, United Kingdom Edited by Don W. Cleveland, University of California, La Jolla, CA, and approved March 8, 2010 (received for review December 11, 2009) We report a unique mutation in the D-amino acid oxidase gene D-amino acid oxidase (DAO) gene, located within this locus, which (R199W DAO) associated with classical adult onset familial amyotro- causes classical adult onset familial ALS (FALS). We also provide phic lateral sclerosis (FALS) in a three generational FALS kindred, after evidence for the pathogenic effects of this mutation on cell viability, candidate gene screening in a 14.52 cM region on chromosome 12q22- which are associated with the formation of ubiquitinated aggregates. 23 linked to disease. Neuronal cell lines expressing R199W DAO DAO controls the level of D-serine, which accumulates in the spinal showed decreased viability and increased ubiquitinated aggregates cord in sporadic ALS and a mouse model of ALS, indicating that compared with cells expressing the wild-type protein. -
WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.