Notch2 Signaling Regulates Id4 and Cell Cycle Genes to Maintain Neural Stem Cell Quiescence in the Adult Hippocampus
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Prelude to the Proximity Interaction Mapping of CXXC5
www.nature.com/scientificreports OPEN A prelude to the proximity interaction mapping of CXXC5 Gamze Ayaz1,4,6*, Gizem Turan1,6, Çağla Ece Olgun1,6, Gizem Kars1, Burcu Karakaya1, Kerim Yavuz1, Öykü Deniz Demiralay1, Tolga Can2, Mesut Muyan1,3* & Pelin Yaşar1,5,6 CXXC5 is a member of the zinc-fnger CXXC family proteins that interact with unmodifed CpG dinucleotides through a conserved ZF-CXXC domain. CXXC5 is involved in the modulation of gene expressions that lead to alterations in diverse cellular events. However, the underlying mechanism of CXXC5-modulated gene expressions remains unclear. Proteins perform their functions in a network of proteins whose identities and amounts change spatiotemporally in response to various stimuli in a lineage-specifc manner. Since CXXC5 lacks an intrinsic transcription regulatory function or enzymatic activity but is a DNA binder, CXXC5 by interacting with proteins could act as a scafold to establish a chromatin state restrictive or permissive for transcription. To initially address this, we utilized the proximity-dependent biotinylation approach. Proximity interaction partners of CXXC5 include DNA and chromatin modifers, transcription factors/co-regulators, and RNA processors. Of these, CXXC5 through its CXXC domain interacted with EMD, MAZ, and MeCP2. Furthermore, an interplay between CXXC5 and MeCP2 was critical for a subset of CXXC5 target gene expressions. It appears that CXXC5 may act as a nucleation factor in modulating gene expressions. Providing a prelude for CXXC5 actions, our results could also contribute to a better understanding of CXXC5-mediated cellular processes in physiology and pathophysiology. Te methylation of mammalian genomic DNA, which predominantly arises post-replicatively at the 5’ posi- tion of the cytosine base in the context of CpG dinucleotides, varies across cell types, developmental stages, physiological and pathophysiological conditions 1. -
Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
© 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice. -
Open Dogan Phdthesis Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia
ARTICLE DOI: 10.1038/s41467-018-05379-y OPEN Evaluation of chromatin accessibility in prefrontal cortex of individuals with schizophrenia Julien Bryois 1, Melanie E. Garrett2, Lingyun Song3, Alexias Safi3, Paola Giusti-Rodriguez 4, Graham D. Johnson 3, Annie W. Shieh13, Alfonso Buil5, John F. Fullard6, Panos Roussos 6,7,8, Pamela Sklar6, Schahram Akbarian 6, Vahram Haroutunian 6,9, Craig A. Stockmeier 10, Gregory A. Wray3,11, Kevin P. White12, Chunyu Liu13, Timothy E. Reddy 3,14, Allison Ashley-Koch2,15, Patrick F. Sullivan 1,4,16 & Gregory E. Crawford 3,17 1234567890():,; Schizophrenia genome-wide association studies have identified >150 regions of the genome associated with disease risk, yet there is little evidence that coding mutations contribute to this disorder. To explore the mechanism of non-coding regulatory elements in schizophrenia, we performed ATAC-seq on adult prefrontal cortex brain samples from 135 individuals with schizophrenia and 137 controls, and identified 118,152 ATAC-seq peaks. These accessible chromatin regions in the brain are highly enriched for schizophrenia SNP heritability. Accessible chromatin regions that overlap evolutionarily conserved regions exhibit an even higher heritability enrichment, indicating that sequence conservation can further refine functional risk variants. We identify few differences in chromatin accessibility between cases and controls, in contrast to thousands of age-related differential accessible chromatin regions. Altogether, we characterize chromatin accessibility in the human prefrontal cortex, the effect of schizophrenia and age on chromatin accessibility, and provide evidence that our dataset will allow for fine mapping of risk variants. 1 Department of Medical Epidemiology and Biostatistics, Karolinska Institutet, SE-17177 Stockholm, Sweden. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
The Function of NFIX During Developmental and Adult Neurogenesis
The function of NFIX during developmental and adult neurogenesis Lachlan Ian Harris Bachelor of Science (Biomedical), Honours Class I A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2017 Faculty of Medicine 1 Abstract Understanding the transcription factor proteins that control the biology of neural stem cells during embryogenesis provides insight into brain development as well as neurodevelopmental disorders. Likewise, studying the function of transcription factors in adult neural stem cells allows us to appreciate the dynamics of these cells and their contribution to normal cognitive function. It also provides a knowledge base so as to one day harness the activity of adult neural stem cells to treat degenerative conditions of the nervous system. One family of transcription factors key to brain development are the Nuclear Factor Ones (NFIs). Comprised of four members in mammals (NFIA, NFIB, NFIC and NFIX) these proteins promote both neuronal and glial differentiation during mouse forebrain development, and in general, appear to have a highly similar function. This thesis addressed two outstanding questions regarding the function of one these proteins, NFIX, in mouse neural stem cell biology. The first question concerned refining our understanding of NFIX function during forebrain development by determining, which stage of neuron differentiation, from a stem cell to a mature neuron, is controlled by NFIX? I answered this question by studying early changes in progenitor populations in loss-of-function mice, revealing that NFIX promotes the production of intermediate neuronal progenitors by directing stem cells to divide in an asymmetric manner. Mechanistically, this was because NFIX, and NFIA/B activated the expression of the spindle regulator Inscuteable, which changes cleavage plane orientations to direct an intermediate neuronal progenitor cell fate. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling
FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Cand.scient. Rasmus Klinck Department of Beta Cell Regeneration, Hagedorn Research Institute, and The PhD School of Science, Faculty of Science, University of Copenhagen, Denmark. The role of Hes1 in pancreas development Expression, Interdependancy and Notch signalling. Academic Advisors Dr. Olaf Nielsen, Department of Biology, Faculty of Science, University of Copenhagen – Denmark Dr. Mette C. Jørgensen, Department of Beta Cell Regeneration, Hagedorn Research Institute Denmark Submitted: 31/05/11 Cover picture: e10.5 mouse embryo expressing EGFP under the control of the Hes1 promoter manually stitched together from 15 complete image stacks. 2 Preface This Ph.D. thesis is based on experimental work performed in the Department of β Cell Regeneration at the Hagedorn Research Institute, Gentofte, Denmark from January 2008 to December 2010. The faculty supervisor on the project was Professor Olaf Nielsen, Department of Genetics, Faculty of Science, University of Copenhagen, and the project supervisor was Mette Christine Jørgensen, Ph.D., Chemist, Department of Beta Cell Regeneration at the Hagedorn Research Institute. This thesis is submitted in order to meet the requirements for obtaining a Ph.D. degree at the Faculty of Science, University of Copenhagen. The thesis is built around three scientific Manuscripts: Manuscript I: “A BAC transgenic Hes1-EGFP reporter reveals novel expression domains in mouse embryos” Submitted to Gene Expression Patterns Rasmus Klinck1, Ernst-Martin Füchtbauer2, Jonas Ahnfelt-Rønne1, Palle Serup1,Jan Nygaard Jensen1, Ole Dragsbæk Madsen1, Mette Christine Jørgensen1 1Department of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark .2Department of Molecular Biology, Aarhus University, C. -
Spatial and Temporal Specification of Neural Fates by Transcription Factor Codes François Guillemot
REVIEW 3771 Development 134, 3771-3780 (2007) doi:10.1242/dev.006379 Spatial and temporal specification of neural fates by transcription factor codes François Guillemot The vertebrate central nervous system contains a great diversity Box 1. Neurons and glial cells of neurons and glial cells, which are generated in the embryonic neural tube at specific times and positions. Several classes of transcription factors have been shown to control various steps in the differentiation of progenitor cells in the neural tube and to determine the identity of the cells produced. Recent evidence indicates that combinations of transcription factors of the homeodomain and basic helix-loop-helix families establish molecular codes that determine both where and when the different kinds of neurons and glial cells are generated. Introduction Neuron Oligodendrocyte Astrocyte A multitude of neurons of different types, as well as oligodendrocytes and astrocytes (see Box 1), are generated as the vertebrate central The vertebrate central nervous system comprises three primary cell nervous system develops. These different neural cells are generated types, including neurons and two types of glial cells. Neurons are at defined times and positions by multipotent progenitors located in electrically excitable cells that process and transmit information via the walls of the embryonic neural tube. Progenitors located in the the release of neurotransmitters at synapses. Different subtypes of ventral neural tube at spinal cord level first produce motor neurons, neurons can be distinguished by the morphology of their cell body which innervate skeletal muscles and later produce oligodendrocytes and dendritic tree, the type of cells they connect with via their axon, the type of neurotransmitter used, etc. -
Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651 -
Detection of Differentially Methylated Regions Using Bayes Factor For
G C A T T A C G G C A T genes Article Detection of Differentially Methylated Regions Using Bayes Factor for Ordinal Group Responses Fengjiao Dunbar 1, Hongyan Xu 2, Duchwan Ryu 3, Santu Ghosh 2, Huidong Shi 4 and Varghese George 2,* 1 Genomics Research Center, AbbVie, North Chicago, IL 60064, USA; [email protected] 2 Department of Population Health Sciences, Augusta University, Augusta, GA 30912, USA; [email protected] (H.X.); [email protected] (S.G.) 3 Department of Statistics and Actuarial Science, Northern Illinois University, DeKalb, IL 60178, USA; [email protected] 4 Georgia Cancer Center, Augusta University, Augusta, GA 30912, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-706-721-0801 Received: 19 July 2019; Accepted: 15 September 2019; Published: 17 September 2019 Abstract: Researchers in genomics are increasingly interested in epigenetic factors such as DNA methylation, because they play an important role in regulating gene expression without changes in the DNA sequence. There have been significant advances in developing statistical methods to detect differentially methylated regions (DMRs) associated with binary disease status. Most of these methods are being developed for detecting differential methylation rates between cases and controls. We consider multiple severity levels of disease, and develop a Bayesian statistical method to detect the region with increasing (or decreasing) methylation rates as the disease severity increases. Patients are classified into more than two groups, based on the disease severity (e.g., stages of cancer), and DMRs are detected by using moving windows along the genome. Within each window, the Bayes factor is calculated to test the hypothesis of monotonic increase in methylation rates corresponding to severity of the disease versus no difference.