NMDAR-Mediated Transcriptional Control of Gene Expression During the Development of Medial Ganglionic Eminence-Derived Interneurons

Total Page:16

File Type:pdf, Size:1020Kb

Load more

bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144295; this version posted January 29, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. NMDAR-mediated transcriptional control of gene expression during the development of medial ganglionic eminence-derived interneurons a b c a a Vivek Mahadevan , Apratim Mitra , Yajun Zhang , Xiaoqing Yuan , Areg Peltekian , Ramesh a b d c a Chittajallu , Caroline Esnault , Dragan Maric , Christopher Rhodes , Kenneth A. Pelkey , Ryan b c a,∗ Dale , Timothy J. Petros , Chris J. McBain aSection on Cellular and Synaptic Physiology, Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD), Bethesda, 20892, MD, USA bBioinformatics and Scientific Programming Core, NICHD, Bethesda, 20892, MD, USA cUnit on Cellular and Molecular Neurodevelopment, NICHD, Bethesda, 20892, MD, USA dFlow and Imaging Cytometry Core Facility, National Institute of Neurological Disorders and Stroke (NINDS), Bethesda, 20852, MD, USA ABSTRACT Medial ganglionic eminence (MGE)-derived parvalbumin (PV)+, somatostatin (SST)+ and Neurogli- aform (NGFC)-type cortical and hippocampal interneurons, have distinct molecular, anatomical and physiological properties. However, the molecular mechanisms regulating their diversity remain poorly understood. Here, via single-cell transcriptomics, we show that the obligate NMDA-type glutamate receptor (NMDAR) subunit gene Grin1 mediates subtype-specific transcriptional regulation of gene ex- pression in MGE-derived interneurons, leading to altered subtype abundances. Notably, MGE-specific conditional Grin1 loss results in a systemic downregulation of diverse transcriptional, synaptogenic and membrane excitability regulatory programs. These widespread gene expression abnormalities mirror aberrations that are typically associated with neurodevelopmental disorders, particularly schizophre- nia. Our study hence provides a road map for the systematic examination of NMDAR signaling in interneuron subtypes, revealing potential MGE-specific genetic targets that could instruct future therapies of psychiatric disorders. Keywords: Interneurons, Medial ganglionic eminence, PV, SST, Neurogliaform, NMDA receptor, Transcriptional regulation, Neurodevelopmental disorders, Schizophrenia, NMDA-hypofunction, Hippocampus, Frontal Cortex, Mouse model, scRNAseq 1 1. INTRODUCTION entire forebrain accounting for approximately 6 60% of all cortical interneurons [1, 2]. In ad- 7 2 Medial ganglionic eminence (MGE)-derived dition, approximately half of all hippocampal 8 3 forebrain GABAergic interneurons comprise the neurogliaform-type cells (NGFCs), the so called 9 4 parvalbumin-containing (PV) and somatostatin- Ivy cells, originate from the MGE [3, 4]. In- 10 5 containing (SST) subpopulations throughout the terestingly, though only rarely found in rodent 11 neocortex such MGE-derived NGFCs are sig- 12 ∗Corresponding author. nificantly more populous in primate neocortex, 13 Email addresses: [email protected] (Vivek Mahadevan), [email protected] (Ryan Dale), including humans [5]. While PV neurons exert ro- 14 [email protected] (Timothy J. Petros), bust somatic, and proximal dendritic inhibition, 15 [email protected] (Chris J. McBain) Mahadevan et al., 2021 1/49 NMDAR-mediated control of gene expression in MGE-derived interneurons bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144295; this version posted January 29, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 16 the SST and NGFCs mediate domain-specific resembles global Grin1 -mutants [32] in their con- 63 17 dendritic inhibition on their downstream pyrami- stellation of schizophrenia-like behavioral aber- 64 18 dal neuron targets [6]. Collectively these classes rations. This indicates that Grin1 dysfunction 65 19 of interneurons shape diverse aspects of corti- across multiple interneuron-subtypes precipitates 66 20 cal and hippocampal circuit maturation during schizophrenia-like abnormalities [33]. In addition, 67 21 development, and critically regulate information this interneuron-specific NMDAR-hypofunction 68 22 processing in mature circuits by maintaining ap- model is sensitive to developmental age, since 69 23 propriate excitation-inhibition (E-I) balance [7]. adult-onset Grin1 loss does not result in the same 70 24 Recent evidence indicates a critical role for activ- phenotypes [29]. Despite the importance of devel- 71 25 ity, particularly through ionotropic glutamate opmental NMDAR function in interneurons, and 72 26 receptors (iGluRs), in driving the morpho- its relevance to human neurodevelopmental disor- 73 27 physiological maturation of MGE-derived in- ders, a comprehensive interrogation of the impact 74 28 terneurons [8–12]. Unlike mature interneurons of developmental NMDAR ablation in interneu- 75 29 where iGluRs differentially contribute towards rons, particularly across MGE-derived interneu- 76 30 synaptic transmission, immature and migrating rons, is lacking. 77 31 interneurons express different glutamate receptor It is clear that during the developmental win- 78 32 subunits including the NMDA-type iGluR (NM- dow between embryonic day (ED) 13.5 and post- 79 33 DAR) and AMPA/Kainate-type iGluR (AM- natal day (PD) ~10 [34], a combination of innate 80 34 PAR/KAR) [13–15] prior to the expression of genetic programs, external environment, and neu- 81 35 any functional synapses. This becomes particu- ronal activity shapes interneuron subtype spec- 82 36 larly important as the developing brain contains ification leading to remarkable diversity [2, 21, 83 37 higher ambient glutamate levels than the adult 35, 36] The NMDAR signaling complex comprises 84 38 brain [16]. Collectively, higher ambient gluta- an essential node for regulating gene expression 85 39 mate, developmental expression of iGluRs and via excitation-transcription (E-T) coupling in ma- 86 40 recruitment of glutamatergic signaling is con- ture circuits [37–39]. Moreover, different NMDAR 87 41 sidered to be trophic [8, 17, 18] and thought to subunits are widely expressed in the developing 88 42 engage mechanisms to regulate various aspects of brain [40] where they provide a critical source of 89 2+ 43 interneuron development including morphological Ca -entry via trophic glutamate signaling prior 90 44 and electrical maturation to promote appropriate to synaptogenesis [15, 19, 41]. However, it is not 91 2+ 45 circuit integration [9, 11, 14, 16, 19–22]. clear whether the NMDAR-mediated Ca cas- 92 46 Interneuron-specific impairments are increas- cades in nascent and developing MGE-derived in- 93 47 ingly considered central to the etiology of multi- terneurons engage transcriptional programs nec- 94 48 ple neurodevelopmental and circuit disorders [23]. essary for MGE-derived interneuron diversity. To 95 49 The importance of interneuron-expressed iGluRs investigate this, we conditionally deleted Grin1 96 50 is most notable in psychiatric disorders exhibiting in MGE progenitors that give rise to cortical and 97 51 impaired NMDAR-associated systems [24, 25]. In hippocampal PV, SST, and NGFC subsets, us- 98 52 the adult brain, acute pharmacological NMDAR ing the Nkx2-1-Cre mouse line [3, 4, 42]. In 99 53 blockade results in circuit disinhibition and psy- this model, Nkx2-1 -driven Cre expression is re- 100 54 chotic symptoms [26], mediated in-part, by the ported in cycling/proliferating MGE cells, well 101 55 enhanced sensitivity of interneuronal NMDARs to before the cells become postmitotic, allowing for 102 56 their antagonists [27]. Indeed, direct blockade of assessment of the developmental impact of em- 103 57 interneuron activity also precipitates distinct be- bryonic loss of Grin1 activity across all subsets of 104 58 havioral deficits relevant to schizophrenia [28]. In MGE-derived interneurons. Applying a combina- 105 59 particular, ablation of the obligate NMDAR sub- tion of high-throughput single-cell RNA sequenc- 106 60 unit gene Grin1 in interneuron-specific early post- ing (scRNAseq), MGE-interneuron-specific ribo- 107 61 natal mouse [29], but not PV-specific [30], or glu- somal tagging, and quantitative immunostaining 108 62 tamatergic neuron-specific Grin1 ablation [31], and in situ RNAscope analyses we establish that 109 Mahadevan et al., 2021 2/49 NMDAR-mediated control of gene expression in MGE-derived interneurons bioRxiv preprint doi: https://doi.org/10.1101/2020.06.10.144295; this version posted January 29, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. 110 NMDAR-mediated transcriptional cascades reg- markers Pvalb, Sst, and Lamp5, marking PV and 155 111 ulate MGE subtype abundances, by regulating SST, NGFC subsets respectively (Figure1B, 156 112 the expression of diverse transcriptional, synap- Figure1-Supplement3A). While we did not 157 113 togenic and membrane excitability genetic pro- recover cells expressing the CGE-markers Prox1, 158 114 grams. Notably, we identify numerous disease- Htr3a or Vip, we recovered a minor fraction of 159 115
Recommended publications
  • Methylation of the Homeobox Gene, HOPX, Is Frequently Detected in Poorly Differentiated Colorectal Cancer

    Methylation of the Homeobox Gene, HOPX, Is Frequently Detected in Poorly Differentiated Colorectal Cancer

    ANTICANCER RESEARCH 31: 2889-2892 (2011) Methylation of the Homeobox Gene, HOPX, Is Frequently Detected in Poorly Differentiated Colorectal Cancer YOSHIKUNI HARADA, KAZUHIRO KIJIMA, KAZUKI SHINMURA, MAKIKO SAKATA, KAZUMA SAKURABA, KAZUAKI YOKOMIZO, YOUHEI KITAMURA, ATSUSHI SHIRAHATA, TETSUHIRO GOTO, HIROKI MIZUKAMI, MITSUO SAITO, GAKU KIGAWA, HIROSHI NEMOTO and KENJI HIBI Gastroenterological Surgery, Showa University Fujigaoka Hospital, 1-30 Fujigaoka, Aoba-ku, Yokohama 227-8501, Japan Abstract. Background: Homeodomein only protein x pathogenesis of colorectal cancer (4-8). It is also known that (HOPX) gene methylation has frequently been detected in gene promoter hypermethylation is involved in the cancer tissues. The methylation status of the HOPX gene in development and progression of cancer (9). An investigation colorectal cancer was examined and compared to the of genetic changes is important in order to clarify the clinocopathological findings. Materials and Methods: tumorigenic pathway of colorectal cancer (10). Eighty-nine tumor samples and corresponding normal tissues The homeodomain only protein x (HOPX) gene, also were obtained from colorectal cancer patients who known as NECC1 (not expressed in choriocarcinoma clone underwent surgery at our hospital. The methylation status of 1), LAGY (lung cancer-associated gene Y), and OB1 (odd the HOPX gene in these samples was examined by homeobox 1 protein), was initially identified as an essential quantitative methylation-specific PCR (qMSP). Subsequently, gene for the modulation of cardiac growth and development the clinicopathological findings were correlated with the (11). Three spliced transcript variants, HOPX-α, HOPX-β methylation status of the HOPX gene. Results: HOPX gene and HOPX-γ, encode the same protein, which contains a methylation was found in 46 (52%) out of the 89 colorectal putative homeodomain motif that acts as an adapter protein carcinomas, suggesting that it was frequently observed in to mediate transcriptional repression (12).
  • A Prelude to the Proximity Interaction Mapping of CXXC5

    A Prelude to the Proximity Interaction Mapping of CXXC5

    www.nature.com/scientificreports OPEN A prelude to the proximity interaction mapping of CXXC5 Gamze Ayaz1,4,6*, Gizem Turan1,6, Çağla Ece Olgun1,6, Gizem Kars1, Burcu Karakaya1, Kerim Yavuz1, Öykü Deniz Demiralay1, Tolga Can2, Mesut Muyan1,3* & Pelin Yaşar1,5,6 CXXC5 is a member of the zinc-fnger CXXC family proteins that interact with unmodifed CpG dinucleotides through a conserved ZF-CXXC domain. CXXC5 is involved in the modulation of gene expressions that lead to alterations in diverse cellular events. However, the underlying mechanism of CXXC5-modulated gene expressions remains unclear. Proteins perform their functions in a network of proteins whose identities and amounts change spatiotemporally in response to various stimuli in a lineage-specifc manner. Since CXXC5 lacks an intrinsic transcription regulatory function or enzymatic activity but is a DNA binder, CXXC5 by interacting with proteins could act as a scafold to establish a chromatin state restrictive or permissive for transcription. To initially address this, we utilized the proximity-dependent biotinylation approach. Proximity interaction partners of CXXC5 include DNA and chromatin modifers, transcription factors/co-regulators, and RNA processors. Of these, CXXC5 through its CXXC domain interacted with EMD, MAZ, and MeCP2. Furthermore, an interplay between CXXC5 and MeCP2 was critical for a subset of CXXC5 target gene expressions. It appears that CXXC5 may act as a nucleation factor in modulating gene expressions. Providing a prelude for CXXC5 actions, our results could also contribute to a better understanding of CXXC5-mediated cellular processes in physiology and pathophysiology. Te methylation of mammalian genomic DNA, which predominantly arises post-replicatively at the 5’ posi- tion of the cytosine base in the context of CpG dinucleotides, varies across cell types, developmental stages, physiological and pathophysiological conditions 1.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Open Dogan Phdthesis Final.Pdf

    Open Dogan Phdthesis Final.Pdf

    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia

    Evaluation of Chromatin Accessibility in Prefrontal Cortex of Individuals with Schizophrenia

    ARTICLE DOI: 10.1038/s41467-018-05379-y OPEN Evaluation of chromatin accessibility in prefrontal cortex of individuals with schizophrenia Julien Bryois 1, Melanie E. Garrett2, Lingyun Song3, Alexias Safi3, Paola Giusti-Rodriguez 4, Graham D. Johnson 3, Annie W. Shieh13, Alfonso Buil5, John F. Fullard6, Panos Roussos 6,7,8, Pamela Sklar6, Schahram Akbarian 6, Vahram Haroutunian 6,9, Craig A. Stockmeier 10, Gregory A. Wray3,11, Kevin P. White12, Chunyu Liu13, Timothy E. Reddy 3,14, Allison Ashley-Koch2,15, Patrick F. Sullivan 1,4,16 & Gregory E. Crawford 3,17 1234567890():,; Schizophrenia genome-wide association studies have identified >150 regions of the genome associated with disease risk, yet there is little evidence that coding mutations contribute to this disorder. To explore the mechanism of non-coding regulatory elements in schizophrenia, we performed ATAC-seq on adult prefrontal cortex brain samples from 135 individuals with schizophrenia and 137 controls, and identified 118,152 ATAC-seq peaks. These accessible chromatin regions in the brain are highly enriched for schizophrenia SNP heritability. Accessible chromatin regions that overlap evolutionarily conserved regions exhibit an even higher heritability enrichment, indicating that sequence conservation can further refine functional risk variants. We identify few differences in chromatin accessibility between cases and controls, in contrast to thousands of age-related differential accessible chromatin regions. Altogether, we characterize chromatin accessibility in the human prefrontal cortex, the effect of schizophrenia and age on chromatin accessibility, and provide evidence that our dataset will allow for fine mapping of risk variants. 1 Department of Medical Epidemiology and Biostatistics, Karolinska Institutet, SE-17177 Stockholm, Sweden.
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis

    Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis

    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
  • 2016 Joint Meeting Program

    2016 Joint Meeting Program

    April 15 – 17, 2016 Fairmont Chicago Millennium Park • Chicago, Illinois The AAP/ASCI/APSA conference is jointly provided by Boston University School of Medicine and AAP/ASCI/APSA. Meeting Program and Abstracts www.jointmeeting.org www.jointmeeting.org Special Events at the 2016 AAP/ASCI/APSA Joint Meeting Friday, April 15 Saturday, April 16 ASCI President’s Reception ASCI Food and Science Evening 6:15 – 7:15 p.m. 6:30 – 9:00 p.m. Gold Room The Mid-America Club, Aon Center ASCI Dinner & New Member AAP Member Banquet Induction Ceremony (Ticketed guests only) (Ticketed guests only) 7:00 – 10:00 p.m. 7:30 – 9:45 p.m. Imperial Ballroom, Level B2 Rouge, Lobby Level How to Solve a Scientific Puzzle: Speaker: Clara D. Bloomfield, MD Clues from Stockholm and Broadway The Ohio State University Comprehensive Cancer Center Speaker: Joe Goldstein, MD APSA Welcome Reception & University of Texas Southwestern Medical Center at Dallas Presidential Address APSA Dinner (Ticketed guests only) 9:00 p.m. – Midnight Signature Room, 360 Chicago, 7:30 – 9:00 p.m. John Hancock Center (off-site) Rouge, Lobby Level Speaker: Daniel DelloStritto, APSA President Finding One’s Scientific Niche: Musings from a Clinical Neuroscientist Speaker: Helen Mayberg, MD, Emory University Dessert Reception (open to all attendees) 10:00 p.m. – Midnight Imperial Foyer, Level B2 Sunday, April 17 APSA Future of Medicine and www.jointmeeting.org Residency Luncheon Noon – 2:00 p.m. Rouge, Lobby Level 2 www.jointmeeting.org Program Contents General Program Information 4 Continuing Medical Education Information 5 Faculty and Speaker Disclosures 7 Scientific Program Schedule 9 Speaker Biographies 16 Call for Nominations: 2017 Harrington Prize for Innovation in Medicine 26 AAP/ASCI/APSA Joint Meeting Faculty 27 Award Recipients 29 Call for Nominations: 2017 Harrington Scholar-Innovator Award 31 Call for Nominations: George M.
  • The Function of NFIX During Developmental and Adult Neurogenesis

    The Function of NFIX During Developmental and Adult Neurogenesis

    The function of NFIX during developmental and adult neurogenesis Lachlan Ian Harris Bachelor of Science (Biomedical), Honours Class I A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2017 Faculty of Medicine 1 Abstract Understanding the transcription factor proteins that control the biology of neural stem cells during embryogenesis provides insight into brain development as well as neurodevelopmental disorders. Likewise, studying the function of transcription factors in adult neural stem cells allows us to appreciate the dynamics of these cells and their contribution to normal cognitive function. It also provides a knowledge base so as to one day harness the activity of adult neural stem cells to treat degenerative conditions of the nervous system. One family of transcription factors key to brain development are the Nuclear Factor Ones (NFIs). Comprised of four members in mammals (NFIA, NFIB, NFIC and NFIX) these proteins promote both neuronal and glial differentiation during mouse forebrain development, and in general, appear to have a highly similar function. This thesis addressed two outstanding questions regarding the function of one these proteins, NFIX, in mouse neural stem cell biology. The first question concerned refining our understanding of NFIX function during forebrain development by determining, which stage of neuron differentiation, from a stem cell to a mature neuron, is controlled by NFIX? I answered this question by studying early changes in progenitor populations in loss-of-function mice, revealing that NFIX promotes the production of intermediate neuronal progenitors by directing stem cells to divide in an asymmetric manner. Mechanistically, this was because NFIX, and NFIA/B activated the expression of the spindle regulator Inscuteable, which changes cleavage plane orientations to direct an intermediate neuronal progenitor cell fate.
  • Co-Occupancy by Multiple Cardiac Transcription Factors Identifies

    Co-Occupancy by Multiple Cardiac Transcription Factors Identifies

    Co-occupancy by multiple cardiac transcription factors identifies transcriptional enhancers active in heart Aibin Hea,b,1, Sek Won Konga,b,c,1, Qing Maa,b, and William T. Pua,b,2 aDepartment of Cardiology and cChildren’s Hospital Informatics Program, Children’s Hospital Boston, Boston, MA 02115; and bHarvard Stem Cell Institute, Harvard University, Cambridge, MA 02138 Edited by Eric N. Olson, University of Texas Southwestern, Dallas, TX, and approved February 23, 2011 (received for review November 12, 2010) Identification of genomic regions that control tissue-specific gene study of a handful of model genes (e.g., refs. 7–10), it has not been expression is currently problematic. ChIP and high-throughput se- evaluated using unbiased, genome-wide approaches. quencing (ChIP-seq) of enhancer-associated proteins such as p300 In this study, we used a modified ChIP-seq approach to define identifies some but not all enhancers active in a tissue. Here we genome wide the binding sites of these cardiac TFs (1). We show that co-occupancy of a chromatin region by multiple tran- provide unbiased support for collaborative TF interactions in scription factors (TFs) identifies a distinct set of enhancers. GATA- driving cardiac gene expression and use this principle to show that chromatin co-occupancy by multiple TFs identifies enhancers binding protein 4 (GATA4), NK2 transcription factor-related, lo- with cardiac activity in vivo. The majority of these multiple TF- cus 5 (NKX2-5), T-box 5 (TBX5), serum response factor (SRF), and “ binding loci (MTL) enhancers were distinct from p300-bound myocyte-enhancer factor 2A (MEF2A), here referred to as cardiac enhancers in location and functional properties.
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT

    WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line