Identification of Ataxia-Associated Mtdna Mutations (M.4052T>C And

tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

ABSTRACT: The potential pathogenicity of two homoplasmic mtDNA point mutations, 9035TϾC and 4452TϾC, found in a family afﬂicted with maternally transmitted cognitive developmental delay, learning disability, and progressive ataxia was evaluated using transmitochondrial cybrids. We conﬁrmed that the 4452TϾC transition in tRNAMet represented a polymorphism; however, 9035TϾC conversion

in the ATP6 gene was responsible for a defective F0-ATPase. Accordingly, mutant cybrids had a reduced oligomycin-sensitive ATP hydrolyzing activity. They had less than half of the steady-state content of ATP and nearly an 8-fold higher basal level of reactive oxygen species (ROS). Mutant cybrids were unable to cope with additional insults, i.e., glucose deprivation or tertiary-butyl hydroperoxide, and they succumbed to either apoptotic or necrotic cell death. Both of these outcomes were

prevented by the antioxidants CoQ10 and vitamin E, suggesting that the abnormally high levels of ROS were the triggers of cell death. In conclusion, the principal metabolic defects, i.e., energy deﬁciency and ROS burden, resulted from the 9035TϾC mutation and could be responsible for the development of clinical symptoms in this family. Furthermore, antioxidant therapy might prove helpful in the management of this disease. Muscle Nerve 39: 000–000, 2009

IDENTIFICATION OF ATAXIA-ASSOCIATED mtDNA MUTATIONS (m.4052T>C and m.9035T>C) AND EVALUATION OF THEIR PATHOGENICITY IN TRANSMITOCHONDRIAL CYBRIDS

MARIANNA SIKORSKA, PhD,1 JAGDEEP K. SANDHU, PhD,1 DAVID K. SIMON, MD, PhD,2 VIMUKTHI PATHIRAJA, MD,2 CAROLINE SODJA, MSc,1 YAN LI, MD,1 MARIA RIBECCO-LUTKIEWICZ, PhD,1 PATRICIA LANTHIER, BSc,1 HENRYK BOROWY-BOROWSKI, PhD,1 ADRIAN UPTON, MD, PhD,3 SANDEEP RAHA, PhD,4 STEFAN M. PULST, MD, PhD,5 and MARK A. TARNOPOLSKY, MD, PhD3,4 1 Neurogenesis and Brain Repair Group M54, Institute for Biological Sciences, National Research Council Canada, 1200 Montreal Road, Ottawa, Ontario, K1A 0R6, Canada 2 Department of Neurology, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA 3 Department of Medicine (Neurology), McMaster University, Hamilton, Ontario, Canada 4 Department of Pediatrics (Neuromuscular and Neurometabolic Disorders), 1200 Main Street West, Room 2U26, McMaster University, Hamilton, Ontario, L8N 3Z5, Canada 5 Cedars-Sinai Medical Center, Los Angeles, California, USA

Accepted 17 February 2009

Maternally inherited mitochondrial diseases are tion/deletions. To date, more than 130 pathogenic linked directly to mutations in the mitochondrial mtDNA mutations have been described. Many of genome, namely, base substitutions and/or inser- them are located in the polypeptide encoding regions and impair the functions of respiratory chain complexes, the ﬁnal common pathway of aerobic Abbreviations: ATP, adenosine triphosphate; CFDA, 5-carboxyﬂuorescein metabolism. A variety of clinical features have been diacetate; CoQ10, coenzyme Q10; CuZnSOD, copper-zinc superoxide dis- associated with mitochondrial cytopathies, including mutase; ␥GCS, ␥-glutamyl cysteine ligase; GCLC, ␥-glutamyl cysteine ligase catalytic subunit; GCLM, ␥-glutamyl cysteine ligase modulatory subunit; GD, ptosis, ataxia, external ophthalmoplegia, optic atrophy, glucose deprivation; GSH, reduced glutathione; MnSOD, manganese super- pigmentary retinopathy, sensorineural deafness, neu- oxide dismutase; mtDNA, mitochondrial DNA; OXPHOS, oxidative phosphor- ylation; PTS, polyoxyethanyl-alpha-tocopheryl sebacate; ROS, reactive oxy- ropathy, cardiomyopathy, proximal myopathy, and ex- gen species; tBHP, tertiary butyl hydroperoxide ercise intolerance.10,11,28,34,49 Mitochondrial cytopa- Key words: antioxidant; homoplasmic mutations; mitochondrial; oxidative stress; therapy thies often share small clusters of clinical features that Correspondence to: M. Sikorska; e-mail: [email protected] or allow them to be grouped into clinical syndromes, i.e., M.A. Tarnopolsky; e-mail: [email protected] the Kearns–Sayre syndrome (KSS), chronic progressive © 2009 Wiley Periodicals, Inc. 25 Published online in Wiley InterScience (www.interscience. external ophthalmoplegia (CPEO), mitochondrial wiley.com). DOI 10.1002/mus.21355 encephalomyopathy with lactic acidosis and stroke-like

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 1 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

episodes (MELAS),7 myoclonic epilepsy with ragged- utilizes the proton motive force generated by the red fibers (MERRF),15 Leigh syndrome (LS),8 or neu- respiratory chain complexes I–IV.30 rogenic weakness with ataxia and retinitis pigmentosa In this study we generated transmitochondrial (NARP).18 cybrids to discern the metabolic defects attributable The majority of pathogenic mtDNA mutations to the homoplasmic base substitutions, 4452TϾC are heteroplasmic, and the manifestation of clinical and 9035TϾC, which was identified in the affected symptoms occurs only after a critical proportion of family. The results revealed a significant decrease in mutant mtDNA in a tissue exceeds the threshold for oligomycin-sensitive ATP hydrolysis, reduction of genotype expression.45 This threshold varies for dif- ATP, and high reactive oxygen species (ROS) levels ferent types of mtDNA mutations. For example, for in the mutant cybrids. All these changes are consis- the 8344AϾG mutation, which causes MERRF syn- tent with alterations in F0-ATPase, which most likely Ͼ drome, the threshold level is about 85% of mutant resulted from the presence of the 9035T C transi- mtDNA,6 whereas for the 8993TϾG mutation, re- tion converting Leu-170 to proline in the A6 subunit. sponsible for the NARP phenotype, the threshold is The data also confirmed the polymorphic nature of Ͼ between 70% and 90%.9,47 Homoplasmic mutations, the 4452T C transition. on the other hand, are mostly regarded as polymorphisms, and their pathogenic significance is often MATERIALS AND METHODS difficult to demonstrate. However, several homoplas- Subjects/Case Report. The subjects were members mic point mutations have been linked to clinical of a four-generation pedigree, in which 16 out of 17 Ͼ disorders such as deafness, i.e., the 1555A G tran- members were clinically affected by developmental sition in SNHL (nonsyndromic and aminoglycoside- delay, learning disability, and progressive ataxia induced sensorineural hearing loss) or blindness, starting in early to late childhood. The family history i.e., 11778GϾA, 3460AϾG, or 14484TϾC, which are was suggestive of a maternally transmitted mitochon- commonly found in LHON (Leber’s hereditary op- drial cytopathy (Fig. 1). Blood samples for DNA F1 tic neuropathy) patients.4 We and others22,42 have analysis were taken from eight members of the ped- also described a variety of clinical features associated with homoplasmic mutations. Recently, we identified a family in which several members, maternally linked across four generations, were afflicted with developmental delays, learning disabilities, and ataxia. Genetic testing for spinocer- ebellar ataxias 1, 2, 3, 6, 7, 8, 17, Friedreich’s ataxia (FRDA), and the 8993TϾG/C NARP/MILS mutations were all negative. Sequencing of the mtDNA revealed that all affected individuals carried two homoplasmic basepair (bp) substitutions, 4452TϾCin tRNAMet and 9035TϾC in the ATP6 gene (A6 subunit), which might have been an underlying cause of the clinical symptoms. The mitochondrial tRNAMet is one of 22 tRNAs encoded by mtDNA and is utilized in translation of 13 essential subunits of respiratory FIGURE 1. A pedigree diagram. Sixteen of 17 family members, chain complexes (i.e., I, III, IV, and V). This is a maternally linked across four generations (marked in black), have critical gene for mitochondrial protein synthesis, es- been clinically affected with cognitive developmental delay, learn- pecially in the mammalian system, which utilizes a ing disability, and progressive ataxia starting in childhood. The Met single tRNA species not only for two alternative M only person not affected was a 5-year-old boy (III6), born to a codons (AUG and AUA), but also for both initiation male, who showed no evidence of ataxia or developmental issues. Arrows point to probands II and III , mother and daughter, 12 1 1 and elongation of translation. The A6 is one of the respectively, who donated blood for the generation of transmito- two mitochondrially encoded subunits of the F0 por- chondrial cybrids. Two cybrid clones from each of these two tion of ATP synthase (complex V). Structurally, ATP mtDNA donors were selected for further studies: CF2B1 and CF2D2 generated from proband II1 and JE1B2 and JE2G1 gen- synthase is comprised of a rotary catalytic F1 portion, erated from proband III1. *Patient a neurological examination a transmembrane F0 portion, and two stalks that link completed by one of the authors (M.T.). Patients IV2 and IV3 were 3,19 F1 and F0. The F1F0-ATP synthase complex is examined by a pediatric neurologist in their home town and were located in the inner mitochondrial membrane and confirmed to have developmental delay and ataxia.

2 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

igree across four generations, and muscle biopsies some experiments, cells were pretreated 3ϫ a week and nerve conduction tests were obtained in two for 1 week with a water-soluble formulation of Coen-

individuals (II1, III1). zyme Q10 (CoQ10) formulated with polyoxyethanyl ␮ alpha-tocopheryl sebacate (PTS; 10 g CoQ10 and 30 DNA Extraction and PCR Ampliﬁcation. Total cellular ␮g PTS/ml) or with PTS alone (30 ␮g/ml) added

DNA was extracted from the blood of proband III1. directly to the media and prepared as described U87MG glioblastoma cells, control cybrids harbor- below. The 5-carboxyﬂuorescein diacetate (CFDA) ing wildtype (wt) mtDNA, and cybrids harboring assay was used to quantify cell viability.31

mutated mtDNA from proband II1 and proband III1 were amplified using polymerase chain reaction Preparation of Water-Soluble Formulation of CoQ10 and 38 (PCR), as described previously. PCR amplification PTS. PTS was synthesized by conjugating polyethyl- Met of the tRNA region was performed with the fol- ene glycol 600 to alpha-tocopherol via bi-functional Ј lowing primers: forward 5 CTC CAT ACC CAT TAC sebacic acid (Sigma-Aldrich, St. Louis, Missouri) as Ј AAT CTC3 (nt 4221–4238; GenBank Access. No. previously described.2,37 A water-soluble formulation Ј D38112.1) and reverse 5 CGG GTT GGG CCA GGG was prepared by combining PTS and CoQ (Kyowa Ј 10 GAT TAA TTA GTA CGG GAA GGG CAT3 (nt Hakko, New York, New York) in a molar ratio of 2:1 4491–4453). The mutation was detected after restric- mol/mol (3:1 w/w) and heating them to a temper- tion digestion of the PCR products with Nla III. PCR ature higher than their respective melting points to amplification of the ATP6 region was performed form a clear melt that was water-soluble and could be with the following primers: forward 5ЈGCG GGC diluted with aqueous solutions (e.g., water, saline, ACA GTG ATT ATA GG3Ј (nt 8845–8871) and re- phosphate buffer) to a desired concentration. Typi- verse 5ЈGTT GAT ATT GCT AGG GTG GCG CTT cally, stock solutions of 50 mg/ml in phosphate- CCA ATT AGG TTC ATG 3Ј (nt 9075–9038). Restric- buffered saline (PBS) were prepared. tion digestion to detect the mutation was done with

BspHI. PCR was run at 94°C for 1 min, 55°C for 45 s, Analysis of CoQ10, PTS, and Vitamin E Contents. Mea- 72°C for 30 s for 30 cycles. surements were performed on a high-performance liquid chromatography (HPLC) apparatus (Beck- Generation of Cybrids. Cybrids were generated on a man Gold System, Palo Alto, California) consisting background of U87MG human glioblastoma (Amer- of a 126 Solvent Module equipped with a Rheodyne ican Tissue Culture Collection [ATCC], Rockville, 7725i loop injector and a UV 168 Detector as previ- Maryland, No. HTB-14) by platelet transformation as ously described.14,37 Brieﬂy, harvested cells (1–2 ϫ o previously described.42 Brieﬂy, U87MG␳ cells were 107) were pelleted, lysed in 100 ␮l of water, and fused in the presence of PEG1500 with mitochon- subsequently frozen at Ϫ70°C. Prior to further ex- dria-containing platelets isolated from fresh blood of traction with 1-propanol and n-hexane, samples were subjects II1 and III1 (mother and daughter, Fig. 1) subjected to repeated freeze/thaw cycles. The sol- and from a 45-year-old healthy volunteer. The plate- vents were evaporated, and the dry residues were

let isolation and subsequent cell transformation dissolved in ethanol. For CoQ10 measurements, sam- 42 were performed exactly as previously described. ples were treated with H2O2 and analyzed by a re- The transformed cells were allowed to recover for 1 verse-phase chromatography on a Supelcosil LC- week in ␳° medium, and the cybrids were selected 18-DB column (5 ␮m particle size, 30 cm ϫ 4.0 mm and maintained in MEM with 10% fetal bovine se- I.D., Supelco, Bellefonte, Pennsylvania) with a mo- rum (FBS), 100 ␮g/ml pyruvate, 2 mM glutamine, bile phase of dichloromethane:methanol (40:60 v/v) and 1ϫ antibiotic-antimycotic solution (complete pumped isocratically at a ﬂow rate of 1 ml/min. medium) at 37°C in 5% CO2. Cybrid clones were Absorbance at 275 and 290 nm was monitored, and expanded and analyzed for the presence of mtDNA the detector output was recorded using Beckman mutations by PCR ampliﬁcation and restriction di- System Gold software. The retention time was 8.2

gestion with Nla III and BspHI. min for CoQ10, 4.7 min for PTS and 4.1 min for vitamin E. Their concentrations were calculated Experimental Treatments and Cell Viability Assay. Cy- from the appropriate peak areas using standard brids (70% conﬂuent) were placed in glucose-free curves.2,37 (GD) medium for up to 48 h, or in complete medium with 1.5 mM tertiary butyl hydroperoxide RNA Extraction and Real-Time PCR Analysis. Total (tBHP) and 2% FBS for 45 min, followed by recovery RNA from control and mutant cybrids was extracted in complete medium without tBHP for up to 16 h. In using a TriReagent method according to the manu-

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 3 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

facturer’s instructions (Molecular Research Center, centration was determined by the bicinchoninic acid Cincinnati, Ohio). RNA was reverse-transcribed assay. (RT) using Superscript II reverse transcriptase (In- vitrogen, Burlington, Ontario) and AncT primers Caspase-3 Activity Assay. Cells were lysed on ice for (5ЈT20VN3Ј). Following cDNA synthesis, RNA tem- 30 min in 25 mM HEPES, 5 mM MgCl2, 2 mM DTT, plates in the RT reaction were degraded. cDNA was 1.3 mM EDTA, 1 mM EGTA, 0.1% Triton X-100, and purified using QIAquick PCR purification columns protease inhibitor cocktail. Caspase-3 (CPP32) activ- (Qiagen, Mississauga, Ontario), and it was quantified ity was measured using the ApoAlert caspase assay as using a Quant-iT OliGreen ssDNA quantitation kit previously described.31 (Molecular Probes, Invitrogen). Five nanograms of cDNA per sample, in tripli- Measurement of ROS. ROS levels were assessed by flow cytometry of cells stained with CMH2DFDA (5- cate, were used for real-time PCR, performed using Ј Ј primer sets specific for the genes of interest and 6-chloromethyl-2 ,7-dichlorodihydrofluorescein) as previously described.31 SYBR Green PCR Master Mix (Applied Biosystems, Foster City, California) in the ABI PRISM 7000 Se- quence Detection System (Applied Biosystems) (Ta- Measurement of Mitochondrial Membrane Potential. ble 1). Changes in gene expression were measured Cybrids grown in T-75 flasks (70% confluent) were ⌬⌬ using a comparative Ct (2- Ct) method that calcu- incubated in Earle’s Balanced Salt Solution contain- lates relative fold differences between the cybrids ing 500 nM MitoTracker Red CM-H2XRos (Molecu- containing the wt mtDNA and the mutant mtDNA. lar Probes) for 30 min at 37°C. Cells were collected by centrifugation and resuspended in PBS contain- Cytochemistry of Cytochrome c Oxidase Activity. Cy- ing 1% BSA. Samples were kept on ice in the dark, brids grown in 12-well plates were incubated with 0.5 and a minimum of 20000 events were analyzed using 20 mg/mlof3Ј3-diaminobenzidine and 1 mg/ml of a Coulter ELITE ESP flow cytometer. oxidized cytochrome c at 37°C for 30 min as previ- Measurement of Glutathione (GSH) Content. ously described.31 Images were captured on a Carl Cells Zeiss Axiovert 200M microscope. were harvested, washed twice with ice-cold PBS, and pelleted. Cell pellets (1 ϫ 106 cells/sample) were resuspended in 500 ␮l of cold deoxygenated PBS Measurement of ATP Content. Cybrids grown in T-25 and briefly sonicated. Proteins were precipitated flasks were harvested in Tris-acetate buffer (pH with 5% perchloric acid (final concentration), and 7.75), and ATP content was analyzed using lucif- samples were centrifuged at 14,000g at 4°C for 10 erase-luciferin solution (Thermo Labsystems Oy, min. Protein concentration was determined using Helsinki, Finland) as described.31 BioRad (Hercules, California) reagent. Supernatants were injected directly into the HPLC (Beckman Sys- Mitochondrial ATPase Activity Assay. Cybrids grown tem Gold) equipped with a Synergi 4 ␮l Hydro-RP, in 6-well plates (70% confluent) were incubated in 150 ϫ 4.6 mm column (Phenomenex, Torrance, Earle’s Balanced Salt Solution with or without 15 ␮M California). The mobile phase was 20 mM potassium oligomycin (O4876, Sigma) for 20 min at 37°C. The phosphate, pH 2.7/acetonitrile (99:1) at room tem- 13 activity of ATPase was measured as described. perature; flow rate 1.0 ml/min, and UV detection at Briefly, cells were pelleted, washed with 25 mM 210 nm. GSH (Sigma) was used as a standard (0.2 ␮g HEPES, 110 mM NaCl, 2.6 mM KH2PO4, 1.2 mM was injected onto the column and eluted as above MgSO4, and 1 mM CaCl2, pH 7.4, and resuspended with retention times of 3.217 min for GSH). Data ␮ in 800 l of 20 mM HEPES, 1 mM MgCl2,and2mM analysis was performed using 32 Karat software EGTA, pH 7.0. The samples were kept on ice and (Beckman Coulter). sonicated for5sat60␮m amplitude. To each sam- ␮ ple 200 l of buffer containing 60 mM sucrose, 50 Western Blotting. Cybrids were lysed in RIPA buffer mM triethanolamine, 50 mM KCl, 4 M MgCl2,2mM (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA, EGTA, 1 mM KCN, 200 ␮M NADH, 2 mM ATP, and 0.1% SDS, 1% deoxycholate, 1% Triton X-100), and 1.5 mM phosphoenolpyruvate, pH 8.0 (with KOH) proteins were separated by 10% sodium dodecyl sul- was added. The conversion of NADH to NADϩ was fate-polyacrylamide gel electrophoresis (SDS-PAGE). followed for 2 min at 340 nm after the addition of 5 Samples were transferred to nitrocellulose and probed U pyruvate kinase (P1506, Sigma) and 5 U lactate with rabbit polyclonal anti-GCS light chain antibody dehydrogenase (L3888, Sigma). Total protein con- (generated in-house), anti-GCS heavy chain antibody

4 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

at 3 ␮g/ml (Neomarkers), anti-MnSOD (Santa Cruz Electrophysiological testing revealed normal motor Biotechnology, Santa Cruz, California) or mouse and sensory nerve conduction velocities in the arms monoclonal anti-␤ actin (Sigma) followed by horserad- with decreased compound muscle actual potential am- ish peroxidase (HRP)-conjugated antirabbit secondary plitudes and absent sensory nerve action potentials in antibody. ECL plus (Amersham, Arlington Heights, the legs. Electromyography of the right tibialis anterior Illinois) was used for detection. and medial gastrocnemius muscles showed normal in- sertional activity and 1ϩ long duration and polyphasic Microscopy. Cells grown on glass coverslips were motor unit potentials. A computed tomography (CT) treated with either GD or tBHP, fixed with 3% para- scan of the head showed mild cerebellar atrophy. Fur- formaldehyde, and stained with Hoechst 33258. Im- ther laboratory testing showed normal profiles of very ages were captured by fluorescence and phase contrast long chain fatty acids, urinary amino acids and organic optics on a Carl Zeiss Axiovert 200M microscope. acids, serum lactate, ammonia, pyruvate, urinary sul- fite, and vitamin E. Genetic testing for SCA 1, 2, 3, 6, 7, Ethics Approval. All patients gave informed written 8, 17, and FRDA were also normal. A muscle biopsy consent for all aspects of the clinical testing. All of of the right vastus lateralis was normal at the light the testing was completed as part of the clinical and electron microscopic level. Mutational analysis work-up of the pedigree with an unknown ataxia. for mitochondrial DNA deletions (Southern blot) and 3243AϾG, 3260AϾG, 3303CϾT, 8344AϾG, Blood for the generation of the cybrids was obtained Ͼ Ͼ at the time of blood drawing from three of the 8993T G/C, 3271T C point mutations by PCR- RFLP were all negative. subjects during their participation in a randomized The family history, however, was suggestive of a double-blind clinical trial that was part of a larger maternally transmitted mitochondrial cytopathy, study approved by the McMaster University Ethics since 16 of 17 family members in a four-generation Board. pedigree were clinically affected with cognitive developmental delay/learning disability and progres- Statistical Analysis. Data are expressed as mean Ϯ sive ataxia starting in childhood (Fig. 1). Twelve of SEM, unless otherwise stated. Comparisons between the family members were evaluated by one of the groups were performed using analysis of variance authors (M.T.) and were confirmed to have varying (ANOVA) followed by a post-hoc Dunnett’s, Bonfer- levels of ataxia, developmental delay, and sensory Ͻ roni’s, or Tukey’s multiple comparisons test. P neuropathy. Three of the men have had anger man- 0.05 was taken as statistically significant. Statistical agement issues resulting in legal charges and incar- analysis was carried out using GraphPad Prism 4.0 ceration. The only person apparently not affected software (San Diego, California). was a 5-year-old born to a man whose parents and teachers reported no clinical evidence of ataxia or RESULTS developmental issues at school (III6). Blood samples for DNA analysis were taken from 11 members of the Report of Pedigree. Proband II had a spinocerebel- 1 pedigree across four generations, and muscle biop- lar degeneration phenotype, elevated lactate with sies and nerve conduction tests were obtained from 1H-MRS, and a family history suggesting mitochon- two individuals (II , III ). drial inheritance (Fig. 1). Proband II was first re- 1 1 1 Muscle biopsies were normal at the light micro- ferred in 1999 as a 38-year-old left-handed woman scopic level. Early paracrystalline inclusions were with a 30-year history of dysarthria and ataxia. She seen in patient III1 using electron microscopy. Nerve had difficulty keeping up with the other children in conduction tests demonstrated reductions in com- school and could not finish a grade nine curriculum. pound muscle action potential amplitudes of the Her symptoms were slowly progressive. Physical ex- peroneal and tibial nerves. Electron transport chain amination revealed mild cognitive impairment, enzyme activity of skeletal muscle in patient III1 slurred and scanning speech, mild distal intrinsic showed borderline complex I ϩ III activity (0.52, foot atrophy, ankle dorsiflexion and eversion weak- range ϭ 0.5–1.9) with a low ratio relative to citrate ness, brisk upper extremity and knee reflexes with synthase (9.7%, normal Ͼ10%), with normal com- absent ankle reflexes, extensor plantar responses, plex II ϩ III and IV activities. MRI scanning with 1 decreased vibration sensation at the metatarsopha- H-MR spectroscopy in patients III1 and II2 showed langeal joint, a positive Trendelenburg test, upper mild cerebellar atrophy in the superior and poste- and lower extremity dysmetria, and a broad-based, rior vermal regions with an elevated lactate signal in profoundly ataxic gait. the brainstem, basal ganglia, and temporal/occipital

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 5 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

white matter regions. All members of the pedigree had normal resting plasma lactate concentrations (Ͻ2.2 mmol/L).

Patients II1 and III1 participated in a randomized double blind crossover study of creatine monohy- drate 5 g daily, alpha lipoic acid 150 mg twice daily,

Coenzyme Q10 100 mg twice daily, and vitamin E 100 IU twice daily. They reported subjective improve- ment in energy and balance during the treatment trial. We sequenced the entire coding region of the

mtDNA isolated from muscle of patient II1, and also screened DNA from blood of patients II2,II5, III1, III2, III4, III5, III7, III8, and IV1. All patients tested positive for homoplasmic variants, 4452TϾCin tRNAMet and 9035TϾC transition in the ATP6 gene. Neither of these two variants was found in 140 unrelated ataxia patients. This posed a question whether these transitions represented polymorphisms or were pathogenic and responsible for the above-described clinical manifestations. To address this question, mitochondria from two females in two

generations (i.e., probands II1 and III1, mother and daughter, respectively) and from a healthy volunteer were used to generate transmitochondrial cybrids and used for further biochemical studies.

Generation and Characterization of Cybrids. Multiple FIGURE 2. Characterization of transmitochondrial cybrids. (A) cybrid clones were selected for each of the three Restriction digestion patterns of mtDNA. DNA was isolated, PCR- mtDNA donors based on the restriction digestion amplified and digested with Nla III (lanes 1–6) or BspH I (lanes patterns of PCR-amplified DNA fragments with Nla 7–12). Lanes 1 and 7: restriction pattern of mtDNA from parent U87MG cells; lanes 2 and 8: mutant mtDNA from platelets of F2 III and BspHI (Fig. 2A). The 4452TϾC transition proband III1; lanes 3 and 9: wt mtDNA from MK1 cybrid; lanes 4 introduced a restriction site for Nla III (i.e., Nla III and 10: wt mtDNA from MK4 cybrid; lanes 5 and 11: mutant Met cuts at CATG) in the region of tRNA gene. There- mtDNA from CF2D2 cybrid (proband II1 mtDNA donor); lanes 6 and 12: mutant mtDNA from JE2G1 cybrid (proband III mtDNA fore, the restriction enzyme cuts the 271 bp PCR 1 donor). (B) Cytochrome c oxidase activity. a: U87MG rho0 cells; fragment from mutant mtDNA into 235 bp and 36 b: control wt MK1 cybrid; c,d: mutants CF2D2 and JE2G1 clones, bp (Fig. 2A). Indeed, the cutting was observed in the respectively. Magnification: 200ϫ. (C) Cellular ATP content. ATP mutant mtDNA donor (lane 2) and all cybrids trans- levels in control (MK1 and MK4) and mutant (CF2B1, CF2D2, formed by platelets of both donors carrying the mu- JE1B2, JE2G1) cybrids. Data are the mean Ϯ SEM from eight tant mtDNA (lanes 5, 6). The restriction digestion separate experiments performed in duplicate. **Significant (P Ͻ 0.01) differences between wt and mutant cybrids. was always complete, indicating the homoplasmic nature of this mutation. Since there was no native restriction site for Nla III in the wt mtDNA, the PCR fragments of the wt mtDNA donor (lane 1) or con- Two cybrid clones from each mtDNA donor were trol wt cybrids (lanes 3, 4) remained intact. On the selected for further studies. These were control cy- other hand, the 9035TϾC mutation in the ATP6 brids, MK1 and MK4 with wt mtDNA, mutant cy-

gene eliminated the restriction site for BspHI (i.e., brids, CF2B1 and CF2D2 from proband II1, and BspHI cuts at TCATGA). Whereas the 222 bp PCR JE1B2 and JE2G1 from proband III1. Subsequently, fragment of wt mtDNA was cleaved into two frag- growth kinetics of the selected cybrids was exam- ments (184 bp and 38 bp) by BspHI (Fig. 2A, lanes ined. Cybrids carrying mutant mtDNA grew much 7 and 9, 10), the 9035TϾC transition eliminated this slower, with doubling times from 48–94 h (i.e., site, and the mutant PCR products were not cleaved JE2G1 and CF2B1); this contrasted with control cy- (lanes 6 and 11, 12). Again, the digestion pattern was brids, which doubled every 30–36 h (MK1 and consistent with the homoplasmic mutation. MK4). The mutant cybrids were stable and main-

6 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

Table 1. Gene-specific primer sets for qPCR. Consistent with this possibility, there was a clear difference in the steady-state levels of intracellular Product ATP between wt and mutant cybrids (Fig. 2C). Sig- size Gene Primer sequence (bp) nificantly, the basal ATP content in all mutant cybrids was 40%–50% lower than in wt controls. The F: 5Ј GCTTGTCCAAATCAGGATCCA 3Ј Ϯ Ј Ј values measured in control cybrids were 6.2 0.4 MnSOD R: 5 GCGTGCTCCCACACATCA 3 77 Ϯ ␮ F: 5Ј TGGTCCATGAAAAAGCAGATGA 3Ј and 5.2 0.6 pmoles/ g protein in MK1 and MK4 CuZnSOD R: 5Ј CACAAGCCAAACGACTTCCA 3Ј 87 and between 3.1 Ϯ 0.4 to 3.5 Ϯ 0.4 in mutant CF2B1 F: 5Ј GCCCTCCACCCCTCATG 3Ј and JE2G1 (P Ͻ 0.01 for all mutants as compared to Ј Ј GSR R: 5 CTGAAAAAATCCATCGCTGGTT 3 70 wt controls, Dunnett’s multiple comparisons test). F: 5Ј AGAGAAGGGGGAAAGGACAA 3Ј R: 5Ј GTGAACCCAGGACAGCCTAA 3Ј The measured ATP values, however, only re- F: 5Ј TCAGTCCTTGGAGTTGCACA 3Ј flected the cybrids’ net balance between energy con- R: 5Ј ACACAGCAGGAGGCAAGATT 3Ј sumption and production. They were not direct in- GCLC F: 5ЈCTG TTG AAG ATG CGG CGA GAC 3Ј 231 dicators of the mitochondrial ATP synthase activity, GCLM R: 5ЈGGC CAA ACC TTG GTG AGA TCG 3Ј 241 Ј Ј which would be expected to be altered if the CAT F: 5 TGC TCG GTT TCC CGT GCA A 3 175 Ͼ GSHPX R: 5Ј ACC GTT CAC CTC GCA CTT CT 3Ј 139 9035T C transition in the ATP6 gene contributed to the lowering of cellular energy balance. To ad- Primer sets for human Mn superoxide dismutase (MnSOD or SOD2, dress this, we evaluated the catalytic activity of mito- mitochondrial), CuZn superoxide dismutase (CuZnSOD or SOD1, soluble), and glutathione reductase (GSR) were designed using the software Primer chondrial F1F0-ATP synthase using oligomycin-sensi- Express (ABI). Primer sets for glutamyl-cysteine ligase catalytic (GCLC) and tive ATP hydrolysis coupled to the oxidation of modifier (GCLM) subunits were designed using Primer3 software, whereas primer for catalase (CAT) and glutathione peroxidase (GSHPX) were from NADH. The mitochondrial ATP synthase also cata- published sequences.1 lyzes a reversible reaction of ATP hydrolysis (ATPase activity) that is coupled to proton pumping across the mitochondrial inner membrane.30 As shown in tained homoplasmy for 2–3 months in culture. The Table 2, nearly 50% of cellular ATP hydrolyzing T1-T2 transferred mitochondria were functional, and the activity in wt cybrids was oligomycin-sensitive, hence cybrids possessed comparable levels of mitochon- it was contributed by the mitochondrial F1F0-AT- drial cytochrome c oxidase activity as visualized by Pase. In the mutants this activity dropped to 15%– histochemistry (Fig. 2B), although some variations 17% of the total, indicating clearly the defective between cybrid clones were observed (Fig. 2B panels catalytic properties of ATP synthase. Furthermore, b, c, for example). Since the COX complex was the total cellular ATPase activity was also much lower unaffected, the 4452TϾC transition did not seem to in the mutant cybrids, pointing again to their meta- have a prominent impact on overall mitochondrial bolic impairments. protein synthesis. This confirmed that the 4452TϾC The mitochondrial membrane potential was transition represented a polymorphism (reported in measured by flow cytometry after staining the cells the MITOMAP database, www.mitomap.org), rather with MitoTracker Red. The mean fluorescence in- than a pathogenic mutation. It is thus possible that tensity was very similar in the wt and mutant cybrids, the homoplasmic 9035TϾC transition, which con- i.e., 8.1 Ϯ 1.1, 7.5 Ϯ 0.5, and 8.6 Ϯ 1.4 for MK1, verts Leu-170 to proline in the transmembrane do- CF2D2, and JE2G1, respectively (PϾ0.05, Newman– main of A6, might be responsible for the above- Keuls multiple comparisons test), indicating no sig- described clinical features. nificant differences in the membrane potential.

Table 2. ATPase activity of mitochondrial ATP synthase (complex V). Total ATPase activity Oligomycin-sensitive ATPase activity nmol NADH /min/mg Percentage nmol NADH/ min/mg Percentage Percentage Cybrids protein ϮSEM of control protein ϮSEM of control of total MK1 796 Ϯ 54 100 390 Ϯ 41 100 49 CF2D2 301 Ϯ 32 38 47 Ϯ 10 12 15 JE1B2 437 Ϯ 41 55 75 Ϯ 16 19 17

ATPase activity was measured as described in Materials and Methods. The amount of NADH converted to NADϩ was calculated by comparing the absorbance at 340 nm resulting from the initial NADH concentration in the samples (200 ␮M) to the absorbance at 340 nm 2 min after the addition of pyruvate kinase and lactate dehydrogenase. Data are the mean Ϯ SEM from three separate experiments performed in duplicate.

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 7 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

FIGURE 3. ROS and ROS-scavenging genes. (A) Basal ROS levels. ROS levels were measured using a Coulter ELITE ESP flow cytometer, and a minimum of 20,000 events were analyzed per sample. Bars are mean Ϯ SEM from four separate experi- FIGURE 4. Glutathione system. (A,B) qPCR analysis. qPCR was ments performed in duplicate. ***Significant (P Ͻ 0.001) differ- performed using primers (Table 1) specific for (A) GCLC (B) Ϯ ences between wt cybrid and mutant cybrids. (B,C) qPCR anal- GCLM. Bars represent the mean SD from three replicates. (C) ysis. qPCR was performed using primers (Table 1) specific for Western blot analysis. Cybrids were lysed, and protein samples CuZnSOD (B) or MnSOD (C). Bars represent the mean Ϯ SD were separated and immunoblotted with anti-GCLC and anti- ␤ from 3 replicates. (D) Western blot analysis. Cybrids were lysed GCLM antibodies. Anti- -actin shows equal protein loading. and protein samples were separated and immunoblotted with anti-MnSOD. Anti-␤-actin shows equal protein loading. and its inactivation depends on the capacity of the cellular GSH system. Therefore, we also examined Oxidative Stress and Antioxidant Defenses. The de- GSH biosynthesis (Fig. 4) as well as the cellular fective properties of ATP synthase in the mutant content of GSH (Table 3). ␥-Glutamyl cysteine ligase cybrids (Table 2) suggested a possibility of the in- (␥GCS), a heterodimer of a catalytic heavy chain creased ROS production. Basal ROS values in the (GCLC) and a regulatory light chain (GCLM), is a mutant cybrids were 5–7 times higher than in wt rate-limiting enzyme in GSH synthesis. Both of these controls, clearly suggesting that this newly identified subunits were expressed in the cybrids (Fig. 4). Ͼ 9035T C mutation could be responsible for putting There was no difference in the expression of GCLC the mutant cybrids under a constant burden of ex- between the mutants and wt controls, either at the Ͻ F3 cessive oxidative stress (Fig. 3A, P 0.001 for both mRNA (Fig. 4A) or at the protein (Fig. 4C) level. mutants as compared to wt controls, Bonferroni’s However, the mutant cybrids had significantly up- multiple comparisons test). No statistically signifi- regulated expression of GCLM. Both the GCLM cant difference in ROS levels was seen between the message (Fig. 4B, Ϸ7- and 9-fold over control in Ͼ mutant cybrids (P 0.05). Although cells, in gen- CF2D2 and JE2G1, respectively, and the protein lev- eral, are equipped with strong antioxidant defense els (Fig. 4C) were increased in the mutants. There systems to offset the toxic nature of ROS, the ques- was no difference in the mRNA level of glutathione tion was, how did these cybrids adapt to such a heavy reductase between control and mutant cybrids (data burden of these species? Here we examined the not shown). The GSH content was also significantly expression levels of ROS scavenging enzymes, i.e., higher (Ϸ2–4-fold) in the mutants than in controls Mn and CuZn superoxide dismutases (SOD), cata- (Table 3), suggesting that the survival of the mutant lase, glutathione reductase, and the glutathione cybrids might have required a significant upregula- (GSH) system in both wt control and mutant cybrids tion of the GSH antioxidant system. F4-T3 (Figs. 3, 4, and Tables 1 and 3). Although the expression level of cytosolic CuZnSOD was similar in Cybrid Viability Under Stress. Thus far, we have es- all cybrids (Fig. 3B), the transcripts of mitochondrial tablished that cybrids that carried mutant mtDNA, MnSOD were significantly upregulated in the mutants, i.e., Ϸ3–7 fold higher in JE2G1 and CF2D2 than in the wt MK1 control (Fig. 3C). The upregu- Table 3. Cellular content of GSH. lation of MnSOD was also evident at the protein level ␮ (Fig. 3D). This implied that the mutant cybrids pro- GSH pmol/ g protein Cybrids ϮSEM Fold increase duced high levels of superoxide anions that had to be detoxified. We did not find any differences be- MK1 14.70 Ϯ 1.42 — JE1B2 24.74 Ϯ 5.87 1.68 tween wt and mutant cybrids in the expression levels CF2D2 43.41 Ϯ 10.79 2.95 of glutathione reductase or catalase (data not shown). Cell pellets (1 x 106 cells/sample) were treated with 5% perchloric acid, precipitated proteins were separated and GSH content was measured in Typically, the detoxification of superoxide an- the supernatants by HPLC, as described in Materials and Methods. Data ions leads to a production of hydrogen peroxide, are the mean Ϯ SEM from two separate experiments in duplicate.

8 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

after 16 h (Fig. 6A). The mutant cybrids, on the other hand, were very vulnerable, with a survival rate of 30%–60% (i.e., 33.1 Ϯ 6.9% for cybrid JE1B2 and 63.2 Ϯ 3.7% for CF2B1, P Ͻ 0. 01 for all tBHP- treated mutants as compared to tBHP-treated controls, Dunnett’s multiple comparisons test). This high rate of cell death was also reflected in the significant drop of basal ATP content. In all mutants, ATP content decreased by more than 50% (Fig. 6B, P Ͻ 0. 05, Tukey’s multiple comparisons test); no change was seen in wt controls. FIGURE 5. The effects of glucose deprivation (GD). (A) Cell viability. Cell viability was measured by CFDA assay after 48 h of Morphological examination of cybrids exposed GD and is expressed as percent of control. Bars represent the to 48 h of GD revealed the presence of shrunken mean Ϯ SEM from three separate experiments performed in cells, small brightly stained nuclei with collapsed Ͻ triplicate. Significant differences are shown as **P 0.01. (B) chromatin, and occasional apoptotic bodies (Fig. 7A, F7 Cellular ATP levels. ATP was measured after 24 h of GD. Bars panels b, e, h, k, n, q). These features were present represent the mean Ϯ SEM from three separate experiments performed in duplicate. No statistically significant differences be- in both wt (panels b, e) and mutants (panels h, k, n, tween treated and untreated samples were observed. q) and were indicative of apoptotic cell death. In- deed, activation of apoptotic caspase 3 was observed in all cybrids, and statistically significant increases in its activity were measured after4hofGD(Fig. 7B, regardless of whether it was derived from subject II1 P Ͻ 0. 05, Tukey’s multiple comparisons test). On or III1, had low basal levels of ATP, defective catalytic property of ATP synthase, and excessive production the other hand, in tBHP-treated cells the apoptotic of ROS. In spite of the high ROS productions, the features (Fig. 7A, panels c, f) and caspase 3 activation cells showed evidence of adaptation, as evidenced by (Fig. 7C, P Ͻ 0. 05, Tukey’s multiple comparisons upregulation of the MnSOD and GSH system, and test) were detected only in wt controls. The tBHP- were able to survive. An important question was treated mutants, on the other hand, died by necro- whether the cells could also cope with any additional sis, as many large, swollen cells with disintegrating exogenous stresses? nuclei were seen frequently (Fig. 7A, panels i, l, o, r). The cybrids were first subjected to glucose deprivation (GD), which inhibits the glycolytic pathway Cytoprotective Effects of Antioxidants. Finally, we and forces cells to rely primarily on OXPHOS for addressed the issue of whether antioxidants could energy production. This phenomenon has been de- offset these effects of mitochondrial dysfunction and scribed for human HepG2 hepatoma cells grown in could be appropriate for therapeutic intervention in the absence of glucose for up to 96 h.46 Thus, the cybrids were placed in glucose-free media for 48 h, and their viability was measured by CFDA assay (Fig. F5 5A). Both control cybrids survived well under these conditions (nearly 100% survival rate, i.e., 94.1 Ϯ 2.0% for MK1). The mutant cybrids were more sensitive, and between 25%–35% of cells lost viability after 48 h (i.e., 72.4 Ϯ 4.9% of viable CF2D2 and 62.5 Ϯ 4.0% of JE1B2 after 48 h of GD, P Ͻ 0. 01 for all mutants as compared to wt controls, Dunnett’s multiple comparisons test). GD did not significantly alter the basal levels of ATP. Despite a diminishing supply of ATP from the glycolytic pathway, all cybrids FIGURE 6. The effects of tertiary butyl hydroperoxide (tBHP). (A) maintained ATP at the pretreatment levels (Fig. 5B). Cell viability. Cell viability was measured by CFDA assay 16 h In separate sets of experiments, cybrids were after tBHP treatment and is expressed as percent of control. Bars briefly exposed to tertiary-butyl hydroperoxide, represent the mean Ϯ SEM from three separate experiments Ͻ tBHP (1.5 mM for 45 min), which transiently puts performed in triplicate. Significant differences are shown as **P 0.01. (B) Cellular ATP levels. ATP was measured 4 h after the F6 the cells under excessive oxidative stress (Fig. 6). treatment. Bars represent the mean Ϯ SEM from three separate Here again, the majority of control cybrids were able experiments performed in duplicate. *Significant (P Ͻ 0.05) dif- to survive the treatment; Ϸ10% of cells lost viability ferences between control and mutant cybrids.

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 9 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

It can modify respiratory chain function and reduce the level of cytotoxic metabolites, including ROS. However, although numerous beneﬁcial outcomes, both experimental and clinical, have been reported

in response to CoQ10 supplementation, its full therapeutic potential is greatly limited by the lack of solubility in aqueous media. We have produced a

water-soluble formulation of CoQ10 and PTS (alpha- tocopherol derivatized to polyoxyethanyl-alpha-tocopheryl sebacate).2,37 Here we tested the effects of this combination of two active antioxidants on the cybrid behavior under stress (Fig. 8, Table 4). F8-T4

The cybrids readily internalized both CoQ10 and PTS. After a week of growth in medium containing

PTS/CoQ10, all cybrids contained PTS and metabo- lized it to vitamin E, and all cybrids internalized

CoQ10, increasing its level 2–5-fold (Table 4). This treatment led to a statistically significant elevation of ATP in wt cybrids (P Ͻ 0.05, Bonferroni’s multiple comparisons test), but not in mutants (Fig. 8A). Furthermore, there was a significant reduction of ROS in the treated mutant cybrids (Fig. 8B). This effect also was observed in cybrids treated with PTS alone (P Ͻ 0.05, Bonferroni’s multiple comparisons test). However, the most significant effects of the PTS/

CoQ10 treatment on cybrid viability were observed in the mutant cybrids subsequently exposed to tBHP (Fig. 8C, P Ͻ 0. 05, Tukey’s multiple comparisons test). Here we observed nearly a complete protection from the cytotoxic effects of this compound. The basal ATP content did not drop (Fig. 8D), and there was no further increase in ROS (not shown) in response to the tBHP treatment. These protective outcomes could be measured by the CFDA viability assay FIGURE 7. Morphological and biochemical features of cell death. (Fig. 8C), and there was clear evidence of morpho- (A) Fluorescent micrographs. Cybrids were treated with either logically intact cells under microscopy (Fig. 8E). GD or tBHP and stained with Hoechst 33258. Nuclear morphol- ogy of wt MK1 (a–c) and MK4 (d–f) cybrids and mutant CF2B1 (g–i), CF2D2 (j–l), JE1B2 (m–o), and JE2G1 (p–r) cybrids is DISCUSSION shown before (control panel) and after the treatments (GD and We have identified two homoplasmic basepair variants tBHP panels). Arrows point to apoptotic cells and arrowheads Ͼ indicate necrotic cells. Magnification: 200ϫ. (B,C) Caspase-3 in the mitochondrial genome, 4452T C and activity. Caspase-3 activation was measured 24 h after GD (B) 9035TϾC, in a family affected by developmental delay, and 4 h after tBHP treatment (C). Data are the mean Ϯ SEM from sensory neuropathy, learning disability, and progres- Ͻ three experiments performed in duplicate. *Significant (P 0.05) sive ataxia. These nucleotide transitions were not differences between treated and untreated. present in unrelated ataxia patients, based on further screening of 140 subjects including those with SCA and NARP phenotypes. Although 4452TϾC has Ͼ the afflicted family. For many years now CoQ10,a been reported, 9035T C has not been listed in the highly mobile carrier of electrons and protons be- existingdatabases(http://www.mitomap.org;http:// tween the flavoproteins and the cytochrome system, www.genpat.uu.se/mtDB). The 4452TϾC base sub- has been investigated as a potential therapeutic stitution locates to the tRNAMet gene, and 9035TϾC agent to treat cardiovascular diseases, neurodegen- converts an amino acid Leu-170 to a proline in the erative diseases, and mitochondrial disorders.24,36,48 mitochondrially encoded ATP6 gene. Although

10 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

these basepair variants could be clearly linked to the ing of mtDNA, but most often they represent maternally transmitted disease symptoms, their ho- polymorphisms and have no pathogenic signifi- moplasmic nature puts their pathogenicity in ques- cance. We performed extensive biochemical analyses tion. In the majority of mitochondrial cytopathies, of transmitochondrial cybrids carrying mutant the pathogenic mutations are heteroplasmic, with a mtDNA from female subjects from two generations quantitative correlation between phenotype and het- and identified metabolic defects likely attributable to eroplasmy.26,32,49 Furthermore, homoplasmic muta- these base transitions. The results revealed that the tions are frequently found during systematic screen- mutant cybrids had the defective F0 portion of ATP synthase and, consequently, the reduced output of ATP and abnormally high levels of ROS. The mutant cybrids were also much more vulnerable to additional injuries (i.e., metabolic or oxidative stress), most likely due to insufficient energy buffers required to detoxify ROS. Although both of these point mutations were homoplasmic, it seemed more likely that the observed defects were due to the 9035TϾC transition in the ATP6 gene rather than the 4452TϾC substitution in tRNA.Met This assertion is based on the fact that no obvious defects in mitochondrial protein synthesis were observed, which would be expected if the function of this tRNA was affected. Mammalian mitochondria utilize a single tRNA,Met and its function is critical for mitochondrial translation.12 How- ever, in our case the activities of complex I ϩ III, ϩ complex II III and IV measured in patient III1,as well as the activity of complex IV (cytochrome c oxidase) measured in the mutant cybrids (Fig. 2), were within the normal range. Thus, the 4452TϾC transition, which occurred at a nonconserved nucleotide 51, did not seem to alter the function of the 4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™ FIGURE 8. The effects of antioxidants. (A) ATP levels. ATP

content of CoQ10/PTS treated and untreated wt MK1 and mutant CF2D2 and JE2G1 cybrids. Bars represent the mean Ϯ SEM from two separate experiments performed in duplicate. *Signiﬁ- Ͻ cant (P 0.05) difference between MK1 treated with CoQ10/PTS and untreated. (B) ROS levels. ROS levels were measured by ﬂow cytometry in mutant cybrids cultured in the presence of

CoQ10/PTS or PTS alone. Data is expressed as percentages of untreated samples. Bars represent the mean Ϯ SEM from two experiments performed in duplicate. *Significant (P Ͻ 0.05) differences between the antioxidant treated and untreated. (C) Cell viability. Cell viability was measured by CFDA assay in wt and mutant cybrids 16 h after tBHP treatment. Bars represent the mean Ϯ SEM from three experiments performed in duplicate. *Significant (P Ͻ 0.05) differences between antioxidant treated and untreated. (D) ATP levels. ATP content was measured 4 h after tBHP exposure in wt and mutants, treated and untreated for Ϯ 1 week with CoQ10/PTS. Data are the mean SEM from three separate experiments performed in duplicate. No significant differences were found in antioxidant treated and untreated samples. (E) Phase contrast micrographs. Control (a–c) and mutant (d–e) cybrids were examined 16 h after tBHP exposure (b,e) or following pretreatment with PTS (c,f); untreated cultures are shown in a and d. Arrows indicate swollen dead cells. Magnifi- cation: 200ϫ.

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 11 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

Table 4. Antioxidant content. PTS ␮g/g

CoQ10 ng/g protein protein Vitamin E ng/g protein Cybrids Endogenous Loaded Loaded Endogenous Loaded Controls (MK1, MK4) 100.7 Ϯ 5.2 198.8 Ϯ 9.0 2.38 Ϯ 0.67 Trace 12.15 Mutants (CF2B1, JE1B2, JE2G1) 42.0 Ϯ 16.0 210.4 Ϯ 32.9 6.02 Ϯ 1.78 Trace 7.61

7 ␮ Cell pellets (1 x 10 cells/sample) were lysed by osmotic shock in 100 l of water. CoQ10, PTS, and vitamin E were extracted from the lysates with 1-propanol and n-hexane solvents and were analyzed by HPLC.

Met 17 tRNA gene (http://mamit-trna.u-strasbg.fr/). hydrolyzing activity, consistent with the defective F0 According to the http://www.mitomap.org/ data- portion of the synthase and, consequently, a signifi- base, three different point mutations in tRNAMet cant reduction in the steady-state level of ATP. Fur- gene have been linked to mitochondrial diseases. thermore, it would appear that this impairment of Ͼ These include: a homoplasmic 4435A G transition the F0 function was responsible for creating high at nucleotide 37 of the anticodon domain that mod- protonic potential within the matrix space leading to ulates phenotypic expression of the 11778GϾAmu- abnormal ROS production, especially superoxide tation associated with LHON29 and two heteroplas- anions. Thus, the ROS levels in the mutant cybrids Ͼ mic mutations, 4409T C at nucleotide 8 of the were nearly 8-fold higher than normal, and their Ͼ acceptor stem and 4450G A at the nucleotide 50 of survival clearly required the upregulation of MnSOD T-stem, both linked to mitochondrial myop- (Fig. 3) and GSH (Fig. 4, Table 3) antioxidant sys- 17,40,41,44 Ͼ athy. We have confirmed that 4452T Cisa tems to neutralize them. Superoxide anions can be polymorphism, due to the lack of obvious defects in produced by both complex I and complex III, which mitochondrial protein synthesis. Still, the possibility even under normal conditions can convert oxygen to Ͼ that 4452T C contributes to the phenotype through superoxides.39 Mitochondrial ROS production Ͼ an interaction with the 9035T C mutation cannot would increase when respiratory flux is depressed be entirely excluded from our data. and protonic potential in the matrix is high, such as The 9035TϾC mutation, on the other hand, might be the case here.16 It seems more likely, how- caused a conversion of a highly conserved leucine to ever, that superoxides were generated by complex I a helix that destabilizes proline at codon 170 of the and were released mainly into the mitochondrial A6 subunit. Its secondary structure predicts that this matrix, as indicated by the upregulation of mito- amino acid is located within the third transmem- chondrial antioxidant systems, such as MnSOD and brane ␣-helix of A6, more specifically, at the critical GSH. Complex III, on the other hand, can release interface of the A6 and c subunit contacts. The ROS on both sides of the mitochondrial membrane. F1F0-ATP synthase is a molecular motor, in which proton translocation from intermembrane space to It would also require engagement of cytoplasmic antioxidants,27 but we did not observe any change in the matrix through the F0 portion drives the rotation of oligomeric c subunits (c ring). This, in turn, the levels of either CuZnSOD or catalase (Fig. 3). It is interesting to note that the observed increase induces rotation of the central part of F1 relative to its catalytic site where the synthesis of ATP from ADP in the GSH content was due to its de novo synthesis 30,34,35 involving a ␥GCS heterodimeric enzyme complex and Pi takes place. Thus, the correct secondary structure of the A6 subunit is critical for subunit consisting of GCLC and GCLM subunits.23 Our data coupling; hence, the formation of the proton chan- indicated that of these two subunits, the rate-limiting nel and turning of the rotor for ATP synthesis. Ac- component in the GSH synthesis was the modifier GCLM whose expression was significantly induced in cording to the current understanding of F0 subunit coupling, the rotation of the c ring relies on seven the mutant cybrids (Fig. 4). Although by itself GCLM direct interhelix contacts between A6 and c subunits has no enzymatic activity, its function is to alter the (Leu-170 on A6 is in contact with C-64 on subunit Ki of GCLC for GSH and, thus, to increase the c).30,34,35 Therefore, the replacement of neutral formation of enzymatically active holoenzyme com- amino acid leucine for a classical helix breaker pro- plex.21 Others have shown that overexpression of line would be expected to impair the properties of GCLM in HeLa cells increases ␥GCS activity by 2–3- the ATP synthase. Indeed, the results revealed a fold.43 Since the GCLM gene contains the ARE (an- significantly diminished oligomycin-sensitive ATP tioxidant response element) sequence, its expres-

12 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

sion could be upregulated through the ARE-Nrf2 T8993C mtDNA mutation. Am J Med Genet A 2007;143: 5 2046–2051. pathway. 10. DiMauro S, Moraes CT. Mitochondrial encephalomyopathies. In summary, of the two identified homoplasmic Arch Neurol 1993;50:1197–1208. basepair variants, we confirmed that the 4452TϾC 11. Finsterer J. Mitochondriopathies. Eur J Neurol 2004;11:163– transition in tRNAMet represented a polymorphism. 186. 12. Florentz C, Sohm B, Tryoen-Toth P, Putz J, Sissler M. Human However, the 9035TϾC transition in the ATP6 gene mitochondrial tRNAs in health and disease. Cell Mol Life Sci (A6 subunit) led to metabolic deficiencies and likely 2003;60:1356–1375. is pathogenic in this family. Several point mutations 13. Florholmen G, Aas V, Rustan AC, Lunde PK, Straumann N, Eid H, et al. Leukemia inhibitory factor reduces contractile within the ATP6 gene, mainly heteroplasmic, have function and induces alterations in energy metabolism in been reported thus far (http://www.mitomap.org). isolated cardiomyocytes. J Mol Cell Cardiol 2004;37:1183– Of these, the best-characterized are the transitions in 1193. 14. Graves S, Sikorska M, Borowy-Borowski H, Ho RJ, Bui T, codon 156 and 217, 8993TϾG/C, and 9176TϾG/C, Woodhouse C. Analysis of coenzyme Q10 content in human which convert leucine to either arginine or proline, plasma and other biological samples. Methods Mol Biol 1998; respectively, and are responsible for a subgroup of 108:353–365. 15. Hammans SR, Sweeney MG, Brockington M, Lennox GG, maternally inherited striatal necrosis syndromes Lawton NF, Kennedy CR, et al. The mitochondrial DNA (i.e., NARP and MILS).32,33 In all these cases the transfer RNA(Lys)A–ϾG(8344) mutation and the syndrome substitution of proline for leucine gives less severe of myoclonic epilepsy with ragged red fibres (MERRF). Rela- tionship of clinical phenotype to proportion of mutant mito- disease symptoms than arginine for leucine. This chondrial DNA. Brain 1993;116:617–632. suggests that the interference with the ATP synthesis 16. Han D, Williams E, Cadenas E. Mitochondrial respiratory mechanism is far greater from the charged amino chain-dependent generation of superoxide anion and its release into the intermembrane space. Biochem J 2001;353: acid arginine than from the helix destabilizing pro- 411–416. line. An elegant discussion regarding the effects of 17. Helm M, Brule H, Friede D, Giege R, Putz D, Florentz C. these transitions on the catalytic properties of ATP Search for characteristic structural features of mammalian mitochondrial tRNAs. RNA 2000;6:1356–1379. synthase are presented by Schon et al.34 To these, we 18. Holt IJ, Harding AE, Petty RK, Morgan-Hughes JA. A new can now add the homoplasmic T9035G mutation mitochondrial disease associated with mitochondrial DNA that converts leucine to proline at codon 170, which heteroplasmy. Am J Hum Genet 1990;46:428–433. 19. Issartel JP, Dupuis A, Garin J, Lunardi J, Michel L, Vignais PV. most likely is responsible for the described mater- The ATP synthase (F0–F1) complex in oxidative phosphory- nally transmitted mitochondrial cytopathy with clin- lation. Experientia 1992;48:351–362. ical features of cognitive developmental delay/learn- 20. Jayaraman S. Flow cytometric determination of mitochondrial membrane potential changes during apoptosis of T lympho- ing disability and progressive ataxia. cytic and pancreatic beta cell lines: comparison of tetrameth- ylrhodamineethylester (TMRE), chloromethyl-X-rosamine (H2-CMX-Ros) and MitoTracker Red 580 (MTR580). J Im- munol Methods 2005;306:68–79. REFERENCES 21. Lee JI, Kang J, Stipanuk MH. Differential regulation of glu- 1. Aksenov MY, Tucker HM, Nair P, Aksenova MV, Butterfield tamate-cysteine ligase subunit expression and increased ho- DA, Estus S, et al. The expression of key oxidative stress- loenzyme formation in response to cysteine deprivation. Bio- handling genes in different brain regions in Alzheimer’s dis- chem J 2006;393:181–190. ease. J Mol Neurosci 1998;11:151–164. 22. McFarland R, Chinnery PF, Blakely EL, Schaefer AM, Morris 2. Borowy-Borowski H, Sodja C, Docherty J, Walker PR, Sikorska AA, Foster SM, et al. Homoplasmy, heteroplasmy, and mito- M. Unique technology for solubilization and delivery of chondrial dystonia. Neurology 2007;69:911–916. highly lipophilic bioactive molecules. J Drug Target 2004;12: 23. Meister A. Glutathione metabolism and its selective modifica- 415–424. tion. J Biol Chem 1988;263:17205–17208. 3. Boyer PD. A research journey with ATP synthase. J Biol Chem 24. Miquel J. Can antioxidant diet supplementation protect 2002;277:39045–39061. against age-related mitochondrial damage? Ann N Y Acad Sci 4. Carelli V, Giordano C, d’Amati G. Pathogenic expression of 2002;959:508–516. homoplasmic mtDNA mutations needs a complex nuclear- 25. Moraes CT, DiMauro S, Zeviani M, Lombes A, Shanske S, mitochondrial interaction. Trends Genet 2003;19:257–262. Miranda AF, et al. Mitochondrial DNA deletions in progres- 5. Chen XL, Kunsch C. Induction of cytoprotective genes sive external ophthalmoplegia and Kearns-Sayre syndrome. through Nrf2/antioxidant response element pathway: a new N Engl J Med 1989;320:1293–1299. therapeutic approach for the treatment of inflammatory dis- 26. Morgan-Hughes JA, Hanna MG. Mitochondrial encephalo- eases. Curr Pharm Des 2004;10:879–891. myopathies: the enigma of genotype versus phenotype. Bio- 6. Chomyn A. The myoclonic epilepsy and ragged-red fiber chim Biophys Acta 1999;1410:125–145. mutation provides new insights into human mitochondrial 27. Muller FL, Liu Y, Van RH. Complex III releases superoxide to function and genetics. Am J Hum Genet 1998;62:745–751. both sides of the inner mitochondrial membrane. J Biol 7. Ciafaloni E, Ricci E, Shanske S, Moraes CT, Silvestri G, Hirano Chem 2004;279:49064–49073. M, et al. MELAS: clinical features, biochemistry, and molec- 28. Pavlakis SG, Phillips PC, DiMauro S, De Vivo DC, Rowland LP. ular genetics. Ann Neurol 1992;31:391–398. Mitochondrial myopathy, encephalopathy, lactic acidosis, and 8. Ciafaloni E, Santorelli FM, Shanske S, Deonna T, Roulet E, strokelike episodes: a distinctive clinical syndrome. Ann Neu- Janzer C, et al. Maternally inherited Leigh syndrome. J Pedi- rol 1984;16:481–488. atr 1993;122:419–422. 29. Qu J, Li R, Zhou X, Tong Y, Lu F, Qian Y, et al. The novel 9. Debray FG, Lambert M, Lortie A, Vanasse M, Mitchell GA. A4435G mutation in the mitochondrial tRNAMet may mod- Long-term outcome of Leigh syndrome caused by the NARP- ulate the phenotypic expression of the LHON-associated ND4

Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009 13 tapraid5/za3-mus/za3-mus/za300909/za32342d09g knepper1 Sϭ7 7/20/09 11:41 Art: 08-0574

G11778A mutation. Invest Ophthalmol Vis Sci 2006;47:475– quence variations in patients with mitochondrial disorders. 483. Brain 2001;124:984–994. 30. Rastogi VK, Girvin ME. Structural changes linked to proton 41. Sternberg D, Danan C, Lombes A, Laforet P, Girodon E, translocation by subunit c of the ATP synthase. Nature 1999; Goossens M, et al. Exhaustive scanning approach to screen all 402:263–268. the mitochondrial tRNA genes for mutations and its applica- 31. Sandhu JK, Sodja C, McRae K, Li Y, Rippstein P, Wei YH, et al. tion to the investigation of 35 independent patients with Effects of nitric oxide donors on cybrids harboring the mito- mitochondrial disorders. Hum Mol Genet 1998;7:33–42. chondrial myopathy, encephalopathy, lactic acidosis and 42. Tarnopolsky MA, Simon DK, Roy BD, Chorneyko K, Lowther stroke-like episodes (MELAS) A3243G mitochondrial DNA SA, Johns DR, et al. Attenuation of free radical production mutation. Biochem J 2005;391:191–202. and paracrystalline inclusions by creatine supplementation in 32. Schon EA. Mitochondrial genetics and disease. Trends Bio- a patient with a novel cytochrome b mutation. Muscle Nerve chem Sci 2000;25:555–560. 2004;29:537–547. 33. Schon EA, Bonilla E, DiMauro S. Mitochondrial DNA mutations and pathogenesis. J Bioenerg Biomembr 1997;29:131– 43. Tipnis SR, Blake DG, Shepherd AG, McLellan LI. Overexpres- 149. sion of the regulatory subunit of gamma-glutamylcysteine 34. Schon EA, Santra S, Pallotti F, Girvin ME. Pathogenesis of synthetase in HeLa cells increases gamma-glutamylcysteine primary defects in mitochondrial ATP synthesis. Semin Cell synthetase activity and confers drug resistance. Biochem J Dev Biol 2001;12:441–448. 1999;337:559–566. 35. Sgarbi G, Baracca A, Lenaz G, Valentino LM, Carelli V, So- 44. Vissing J, Salamon MB, Rlien-Soborg P, Norby S, Manta P, laini G. Inefﬁcient coupling between proton transport and DiMauro S, et al. A new mitochondrial tRNA(Met) gene ATP synthesis may be the pathogenic mechanism for NARP mutation in a patient with dystrophic muscle and exercise and Leigh syndrome resulting from the T8993G mutation in intolerance. Neurology 1998;50:1875–1878. mtDNA. Biochem J 2006;395:493–500. 45. Wallace DC. Mitochondrial defects in neurodegenerative dis- 36. Shults CW, Oakes D, Kieburtz K, Beal MF, Haas R, Plumb S, ease. Ment Retard Dev Disabil Res Rev 2001;7:158–166. et al. Effects of coenzyme Q10 in early Parkinson disease: 46. Weber K, Ridderskamp D, Alfert M, Hoyer S, Wiesner RJ. evidence of slowing of the functional decline. Arch Neurol Cultivation in glucose-deprived medium stimulates mitochon- 2002;59:1541–1550. drial biogenesis and oxidative metabolism in HepG2 hepa- 37. Sikorska M, Borowy-Borowski H, Zurakowski B, Walker PR. toma cells. Biol Chem 2002;383:283–290. Derivatised alpha-tocopherol as a CoQ10 carrier in a novel water-soluble formulation. Biofactors 2003;18:173–183. 47. White SL, Collins VR, Wolfe R, Cleary MA, Shanske S, Di- 38. Simon DK, Johns DR. Mitochondrial disorders: clinical and Mauro S, et al. Genetic counseling and prenatal diagnosis for genetic features. Annu Rev Med 1999;50:111–127. the mitochondrial DNA mutations at nucleotide 8993. Am J 39. St-Pierre J, Buckingham JA, Roebuck SJ, Brand MD. Topology Hum Genet 1999;65:474–482. of superoxide production from different sites in the mito- 48. Young AJ, Johnson S, Steffens DC, Doraiswamy PM. Coen- chondrial electron transport chain. J Biol Chem 2002;277: zyme Q10: a review of its promise as a neuroprotectant. CNS 44784–44790. Spectr 2007;12:62–68. 40. Sternberg D, Chatzoglou E, Laforet P, Fayet G, Jardel C, 49. Zeviani M, Di DS. Mitochondrial disorders. Brain 2004;127: Blondy P, et al. Mitochondrial DNA transfer RNA gene se- 2153–2172.

14 Ataxia-Associated mtDNA Mutations MUSCLE & NERVE Month 2009

Identification of Ataxia-Associated Mtdna Mutations (M.4052T&gt;C And

Identification of Ataxia-Associated Mtdna Mutations (M.4052T>C And