Assessment of the Genetic Diversity of Philippine Arabica Coffee (Coffea Arabica L.) Using SSR Markers

Home , Lists of cultivars, List of coffee varieties

Philippine Journal of Science 149 (3-a): 993-1003, October 2020 ISSN 0031 - 7683 Date Received: 18 May 2020

Assessment of the Genetic Diversity of Philippine Arabica Coffee (Coffea arabica L.) Using SSR Markers

Miriam D. Baltazar1,2* and Jermaine Marie Ann O. Fabella2

1Department of Biological Sciences 2National Coffee Research, Development and Extension Center Cavite State University, Indang, Cavite 4122 Philippines

Arabica coffee (Coffea arabica L.) plays a significant contribution to the Philippine coffee industry. Many important genes are continuously lost due to an increase in population, urbanization, and the promotion of registered and popular varieties in the country. This study was conducted to assess the genetic diversity of 27 Philippine C. arabica accessions currently maintained at the Cavite State University – National Coffee Research, Development and Extension Center (CvSU-NCRDEC) field genebank using 19 simple sequence repeat (SSR) markers. Around 80% of the markers used showed polymorphism. A total of 56 alleles were detected, 47 of which were polymorphic. The average number of alleles per locus (3.7) and the polymorphism information content (PIC) (~ 0.40) found in this study were higher than those reported in the literature. Duplicate accessions were identified despite their striking morphological differences, and differentiation of synonymous accessions was also noted. The average genetic similarity was 0.83 and ranged from 0.64–1.0. Overall, the genetic diversity of Philippine C. arabica collection was low. Nonetheless, the higher number of alleles and PIC obtained provide more information in the selection of materials that can be used as parents in hybridization works. Cluster analysis showed three major clusters: Cluster I consisted of most of the accessions from Benguet State University (BSU), while Cluster II consisted of all accessions from the Bureau of Plant Industry (BPI) except Yellow Bourbon. MCA and Yellow Bourbon banded in Cluster III. The cluster analysis offers valuable information in the selection of parents for the development of vigorous F1 hybrids. Further, the results obtained in this study can be utilized in developing strategies to widen the low genetic variability of C. arabica through proper management of the country’s coffee genetic resources, development of effective breeding and selection programs, and varietal registration and identification.

Keywords: Arabica coffee, coffee, Coffea arabica, genetic diversity, molecular markers, SSR markers

INTRODUCTION Woehl et al. 2020). The worldwide demand for coffee is continuously increasing. The Philippines consumes 3.0 Coffee is a highly traded commodity that provides M bags of coffee every year, and there has been a steady livelihood for around 12.5 million households per annum increase in per capita coffee consumption from 0.7 kg per around the world (Browning 2018). The coffee industry person in 2008 to 1.5 kg and 1.7 kg in 2014 and 2017, is estimated to generate some USD 74 bn (Pruvot- respectively. Net imports are 2.8 M bags of coffee or 93% *Corresponding Author: [email protected] of total consumption (ICO 2017). Commercial production

993 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee is mainly attributed to Coffea arabica L. (Arabica coffee) Assessment of the genetic diversity of coffee is important. and C. canephora (known as Conillon when produced in This can be done by using morphological characters; Brazil and Robusta in other parts of the world). However, however, this could lead to inconsistent data as they other less popular ones are also cultivated: C. liberica var. are highly affected by the environment. Morphological liberica (Liberica coffee) and C. liberica var. dewevrei, characterization is time-consuming and requires also known as Excelsa (IPNI 2020). expertise. Many of these morphological keys may also be effective only for a particular life stage; for example, The center of origin of C. arabica is the South Western many distinct characteristics can be observed only when forests of Ethiopia and the Boma Plateau of South Sudan. the coffee trees are already bearing flowers and fruits. th From Ethiopia, seeds were introduced in Yemen in the 15 This necessitates a more effective and reliable tool in century. From Yemen, coffee was introduced to i) Bourbon germplasm characterization and identification. Island (today French Reunion Island), giving the Bourbon- based varieties; and ii) to India and from India to Indonesia, The use of molecular markers is one efficient way to giving the Typica-based varieties in the late 17th and early genetically assess the collection. This method is more precise 18th centuries (Pruvot-Woehl et al. 2020). Instrumental to and reliable. Many DNA-based markers were widely used the introduction of the first coffee tree to the Philippines such as restriction fragment length polymorphism, random was a Spanish Franciscan monk in 1740 in Lipa, Batangas, amplified polymorphic DNA, amplified fragment length from which it eventually spread to the whole province and polymorphism, SSR or microsatellites, etc. Molecular nearby areas and the whole country (Juan and Francisco markers are very useful especially in identification as they 2007). This school of thought that is believed by many must directly represent the genotype and are not affected by the be treated with caution due to the paucity of research and environment. They are also diverse and highly distributed lack of refereed scholarly works (Castro 2003). in the genome. Numerous studies on coffee demonstrated the success of the use of molecular markers for species Coffee belongs to the genus Coffea of Rubiaceae family. and varietal identification as well as analysis of genetic It consists of 124 species (Davis 2011) with chromosome diversity of collections in various countries (Anthony et number 2n = 22 except for C. arabica (2n = 4x = 44). al. 2002; Aga et al. 2003; Ruas et al. 2003; Cubry et al. C. arabica is the only self-fertile among the other 2008; Teressa et al. 2010; Mishra et al. 2011; Geleta et al. commercially cultivated species (Lashermes et al. 1999). C. 2012; Razafinarivo et al. 2013). SSR markers are the most arabica is prized over C. canephora and C. liberica due to desired molecular markers for genetic diversity analysis its superior quality. In 2018, it accounted for ~ 23% of the because of their high-information content, co-dominant Philippines’ total production (www.psa.gov.ph). Despite its nature, sensitivity, and ease to analyze with minimal high cup quality, production is limited in high elevations. quantities of test samples. It is also increasingly being used They are mostly planted in the highlands of Sultan Kudarat, for linkage analysis and molecular breeding (Baruah et al. Davao del Sur, Sulu, South Cotabato, Iloilo, Benguet, and 2003). Despite its widespread use in coffee, there is little Mountain Province (www.psa.gov.ph). information on its use in evaluating the genetic diversity As the wild coffee population is generally under threat due of coffee varieties in the Philippines. Hence, the study was to its natural habitat disturbance mainly by deforestation conducted to assess the genetic diversity of C. arabica and land-use change (Poncet et al. 2004; Teressa et al. of the country. This is vital in coffee improvement and 2010), the effect is also evident in the Philippines. There selection, screening of important traits such as reaction was a continuous decline in the area of production of to pests and diseases, tolerance/resistance to biotic and C. arabica since 2001 with an average reduction of ~ abiotic stresses, high cup quality, and other traits. The 270 ha/yr (www.psa.gov.ph). This situation, along with information generated in this study could lead to numerous continuous urbanization, could lead to the genetic erosion possibilities in coffee breeding and selection, in ensuring of C. arabica in the country. Because of its high market the authenticity of coffee varieties, DNA fingerprinting, potential, the use of the National Seed Industry Council and many more. (NSIC)-registered C. arabica varieties is promoted. This – together with encroachment by agricultural activities, population pressures, and economic hardships – also contribute to this threat. The CvSU identified this gap of MATERIALS AND METHODS the coffee industry, limiting coffee genetic diversity that will greatly impact the sustainability of coffee production. Plant Materials Thus, a formal exploration and collection of coffee genetic A total of 68 accessions of coffee representing all resources throughout the country were initiated in 2013. commercially cultivated species that were collected from The collection is conserved in a field gene bank inside all over the Philippines were established in a field with the main campus. a land area of 1.3 ha located inside CvSU (14˚12.407’N,

994 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

120˚52.803E; approximately 266 masl). Of these, the 27 stain (Biotin GelRedTM Nucleic Acid; 10,000x in water), 1x accessions of C. arabica were used as samples (Table Tris-acetate-EDTA (TAE) buffer. Only samples with intact 1). Additionally, one representative accession of the DNA and had sufficient quantities were used. Thirty-seven other Coffea was included in this study for reference and (37) SSR primers were screened based on their reported comparison of SSR profiles. polymorphism across Coffea spp. Of these, 29 gave clear, distinct, consistent, and scorable bands. Nineteen (19) primers were found polymorphic across Coffea spp., 15 of DNA Extraction and Primer Selection which were polymorphic in C. arabica (Table 2). Fresh young leaves of a representative tree of each accession were ground with liquid nitrogen in a small mortar and pestle. Two DNA extraction protocols were Polymerase Chain Reaction (PCR) Amplification used and followed in the experiment: modified cetyl The primers were tested on the genomic DNA of the trimethylammonium bromide method [modified from coffee accessions. PCR was carried out in 10 µL volume Doyle and Doyle (1987)] was used in Granica, RDRF, containing 1x PCR reaction buffer (10 mM Tris-HCl, pH MVA, and FRT11; and Qiagen™ DNeasy Plant Mini Kit 9.1; 0.01% TritonTM X-100; and 50 mM KCl), 1.5 mM for the rest of the accessions. The quality and quantity of MgCl2, 0.2 mM dNTPs, 0.2 mM forward and reverse DNA samples were estimated using Lambda DNA (0.5 µg primers, 1 U Taq DNA polymerase µL–1 (Vivantis), and 1 µL–1, Vivantis) in 1% agarose gel (50 ml) with a 0.4 µL gel µL of 20–50 ng extracted DNA. PCR amplifications were

Table 1. List of Philippine coffee accessions/varieties of Coffea arabica used in the study. Accession no. Popular name Source Genetic group CvS01 Typica Ampasit, La Trinidad, Benguet Typica CvS02 Mokka BSU, Ampasit, La Trinidad, Benguet Bourbon CvS03 Mundo Novo (Bektey) BSU, Bektey, La Trinidad, Benguet Typica + Bourbon CvS04 Granica (Fine) BSU, Ampasit, La Trinidad, Benguet CvS05 Granica (Broad) BSU, Ampasit, La Trinidad, Benguet CvS06 MSAC BSU, Ampasit, La Trinidad, Benguet CvS07 Kenya BSU, Ampasit, La Trinidad, Benguet CvS08 Granica (Standard) BSU, Ampasit, La Trinidad, Benguet CvS09 Yellow Catturra BSU, Ampasit, La Trinidad, Benguet Bourbon CvS10 Improved San Ramon BSU, Ampasit, La Trinidad, Benguet Typica CvS11 San Ramon BSU, Ampasit, La Trinidad, Benguet Typica CvS12 Mundo Novo (Ampasit) BSU, Ampasit, La Trinidad, Benguet Typica + Bourbon CvS13 Mundo Novo 01 BSU, Ampasit, La Trinidad, Benguet Typica + Bourbon CvS14 Red Bourbon Atok, Benguet Bourbon CvS33 Mysore Mt. Matutum, Polomolok, South Cotabato Typica CvS34 Yellow Bourbon BPI, Baguio City Bourbon CvS36 MCA unknown CvS45 Catimor Calamansig, Sultan Kudarat Introgressed CvS55 Mysore T'boli Sitio Motokling, Monkayo, T'boli, South Cotabato Typica CvS57 Granica Tublay, Benguet CvS58 Mundo Novo Sagada Banga-an, Sagada, Mt. Province Typica + Bourbon CvS59 MVA Unknown CvS62 RDRF Los Banos, Laguna CvS65 Red Cattura BPI, Baguio City Bourbon CvS66 BRRT BPI, Baguio City CvS67 BRRB BPI, Baguio City CvS68 IRRT BPI, Baguio City *Genetic group described by WCR (2018) and Pruvot-Woehl et al. (2020)

995 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Table 2. SSR markers used with the locus name; forward and reverse primer sequences; and annealing temperature, Ta (°C), and duration (min). Code Locus name Primer sequence Reference Ta (°C), duration (min) A M306 5’CTCGTTTGTGCTCTTTTTG3’ Poncet et al. (2007) 57, 0.5 5’TTTGTTAGTTTCTCTCCACCA3’ B M310 5’CACAGGTTGAGTTGCTTGA3’ Poncet et al. (2007) 57, 0.5 5’CCTCTCTGATTGGATTTGG3’ C M324 5’GCCCTTCCTTTCTTCATTTC3’ Poncet et al. (2007) 57, 0.5 5’TGGGTGTTCCTCTTTCTCTG3’ D M326 5’GCTTTCTTGCCTTTCTTTTCC3’ Poncet et al. (2007) 57, 0.5 5’CATCCACTTACCTCTCCCAAA3’ E M329 5’ACTCAGACAAACCCTTCAAC3’ Poncet et al. (2007) 55, 0.5 5’GATGTTTTGCATCTATTTGG3’ I 471 5’TTACCTCCCGGCCAGAC3’ Cubry et al. (2008) 57, 0.5 5’CAGGAGACCAAGACCTTAGCA3’ J CaM03 5’CGCGCTTGCTCCCTCTGTCTCT3’ Hendre et al. (2008) 65, 1 5’TGGGGGAGGGGCGGTGTT3’ K CaM16 5’AAGGCAGCTGAAGCGGGACAAA3’ Hendre et al. (2008) 65, 1 5’TGGGGAGAGCTGCAGTTGGAGG3’ M CM5 5’GTAACCACCACCTCCTCTGC3’ Baruah et al. (2003) 54, 1 5’TGGAGGTAACGGAAGCTCTG3’ S DCM06 5’GTAGTCGGTGGGCTTGTGTT3’ Aggarwal et al. (2007) 57, 1 5’AACGCGGACTAATTGAGGAA3’ T R105 5’CACCAATTCCACTGACAATG3’ Teressa et al. (2010) 50, 1 5’TCCCTGCCAACACACTTC3’ U R126 5’GCACAATCACTCCCAAAG3’ Teressa et al. (2010) 50, 1 5’TGACGGCCTACTACTTACAG3’ X R268 5’GTATCCCACAATGAAATCAC3’ Teressa et al. (2010) 50, 0.5 5’AGTAGAATTTTCAACATATAAG3’ Y R278 5’TGTAGATTTGAAACCCAATC3’ Teressa et al. (2010) 50, 0.5 5’AAGTCTCGACAAGTTTTGAC3’ Z R325 5’CCTTGTTGTTGGGGAATGTC3’ Teressa et al. (2010) 47, 0.5 5’GGCTGTTCTGGGCTTTGTG3’ A1 R338 5’CGAAGGCTGTCAACAACTGG3’ Teressa et al. (2010) 50, 1 5’GGGATAAACAAGTTAAAGGA3’ B1 R339 5’ATTATGCTCGCTGGGCTGTT3’ Teressa et al. (2010) 50, 1 5’TGGGATCACTCCTGTGTCGC3’ D1 124161 5’TGCGAAACCATTGAGAACAG3’ Teressa et al. (2010) 50, 0.5 5’CCGGAGGATGAGATTGAAAA3’ F1 123909 5’AGGCTTGCTGGAACTCTTGA3’ Teressa et al. (2010) 47, 0.5 5’GAAAGACTTGTCCTTTGCCG3’ carried out as follows: initial denaturation at 94 °C for 5 °C for 2 min. min followed by 35 cycles of 94 °C for 2 min (optimized annealing temperature and duration for each marker) The amplification was confirmed by running 4 µL of the (Table 2), 72 °C for 1 min, and a final denaturation at 72 PCR products on 1% agarose gels stained with 0.4 µL

996 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Biotin GelRedTM nucleic acid; 10,000x in water) using TM Labnet ENDURO Gel XL Electrophoresis at 100 V for (2) 45 min in 0.5x TAE buffer, then viewed in Bio-Print ST4 Vilber Lourmat Gel Documentation System. where pij is the frequency of the jth allele of the total Data Scoring and Analysis number of alleles at SSR locus and n is the total number The PCR products were further resolved in 6% of alleles for locus. polyacrylamide gel electrophoresis at 80 V for 1 hr and 30 min in 1x TAE buffer. After electrophoresis, the gels were stained in SYBR® Safe DNA gel stain for 15–30 min. The size (bp) of amplified PCR products was RESULTS AND DISCUSSION estimated using 0.5 µg µL–1 VC 100 bp plus DNA ladder (Vivantis). Fragments amplified by primer pairs were SSR Marker Diversity scored manually in terms of the position of the bands SSR markers were employed to assess the genetic diversity relative to the ladder: “1” for the presence and “0” for the of C. arabica accessions collected from various areas in absence of the band. the Philippines. The collection is currently conserved ex An allele matrix (1/0) was formed to generate a genetic situ in a field genebank. Out of the 19 SSR markers used, similarity matrix using Numerical Taxonomy and 15 (78.95%) were found to be polymorphic (Figure 1). Multivariate Analysis System (NTSYSpc) v. 2.0. The Non-informative markers that did not show polymorphism similarity index was computed using the formula of the across the 27 accessions were M306, M310, CaM03, and Dice coefficient of association to measure the similarity R338. Out of the 56 alleles, 47 were polymorphic (rP = between genotypes. 83.9%). The number of alleles of the polymorphic markers ranged from 2–6 with an average of 3.73 alleles per SSR locus. CM05 generated the most number of alleles (Table (1) 3). The number of alleles per locus we obtained was higher than that reported by Moncada and McCouch (2004) where a corresponds to the number of bands present on using 34 SSR markers, Maluf et al. (2005), Cubry et al. both genotypes, and b and c to the number of bands unique (2008), and Geleta et al. (2012). Marker CM5 obtained to each genotype. six alleles while R268 and 471 loci both obtained five alleles. Of the 15 SSR markers used, only three of these The relationships among accessions were analyzed using amplified two alleles (Table 3). These results are indicative the unweighted pair group method with arithmetic mean of the presence of non-recombining alleles of some loci (UPGMA) employing SAHN (sequential, agglomerative, in C. arabica. These loci represent the homoeologous hierarchical, and nested clustering) algorithm. regions from its two progenitors, C. canephora and C. Bootstrapping was applied to evaluate the degree of eugenoides. This corroborates the previous reports on association between the genetic similarity matrix and the amphidiploid (allotetraploid) nature of C. arabica dendrogram using the PAleontological STatistics software (Lashermes et al. 1999). version 4.03. The PIC that measures the variability at a locus was calculated based on allele frequencies of all The degree of informativeness of the loci detected by their coffee samples analyzed. PIC was calculated as follows:

Figure 1. Representative gel showing polymorphism in C. arabica accessions using primer CaM16. PCR product was run in 6% polyacrylamide gel post-stained with SYBR® Safe DNA gel stain and viewed in Bio-Print ST4 Vilber Lourmat Gel Documentation System.

997 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Table 3. Number of alleles and PIC of 15 SSR markers in Coffea and Geleta et al. (2012). Such a narrow genetic base is arabica in the Philippines. expected for an introduced crop such as coffee as rigorous No. Marker Total Number of PIC selection has taken place. Further, this is accounted for the number of polymorphic values autogamous nature of C. arabica limiting the introduction alleles alleles of new alleles through hybridization. 1 M324 4 2 0.532 It is already established that C. canephora (Robusta) 2 M326 4 2 0.140 is the progenitor of C. arabica; thus, it is expected that 3 M329 4 4 0.568 C. canephora is closer to C. arabica than C. liberica. 4 471 5 5 0.408 A 100% bootstrap support was observed for C. arabica and C. canephora, and C. liberica and moderately strong 5 CaM16 4 2 0.532 bootstrap support (68%) for C. canephora and C. arabica. 6 CM5 6 6 0.441 Further, Liberica (C. liberica var. liberica) and Excelsa 7 DCM06 3 2 0.609 (C. liberica var. dewevrei) belong to the same species 8 R105 2 2 0.203 (Lashermes et al. 1999) but are distinct from each other. 9 R126 4 4 0.396 The separation of the two in the dendrogram is reliable as supported by high bootstrap value (75%). These findings 10 R268 5 4 0.424 are upheld in the dendrogram generated (Figure 2). 11 R278 3 3 0.591 12 R325 4 4 0.203 Generally, three major clusters were formed by the C. arabica accessions using both the Dice (coefficient = 13 R339 2 1 0.203 0.783) and Jaccard (coefficient = 0.757) indices: Cluster 14 124161 4 4 0.331 I comprised of 15 accessions where most of the BSU 15 123909 2 2 0.252 accessions belong (nine out of 12); Cluster II was a smaller Total 56 47 group that consisted of 10 accessions (all accessions from Average 3.716 3.209 0.389 BPI, Baguio City except Yellow Bourbon, the rest of the BSU collection, Mundo Novo Sagada, and Mysore Rate of polymorphism, 83.9 rP (%) T’boli); and Cluster III consisted of Yellow Bourbon and MCA only that markedly separated from the two large groups (Figure 2). The clustering of the accessions was largely based on the origin of germplasm. The separation PIC values ranged from 0.140 (M326) to 0.609 (DCM06). of Cluster III from the other two clusters had 99% Most markers used were moderately to highly informative bootstrap value, thereby indicating the reliability of the (PIC > 0.5), indicating their effectiveness in assessing the separation of Yellow Bourbon and MCA from the rest genetic diversity of the collection (Table 3). of the C. arabica accessions. The separation of the two accessions had moderately high bootstrap support (77%). Genetic Diversity and Cluster Analysis Cluster I and Cluster II had low bootstrap supports but The Dice similarity coefficient was used to generate the values do not necessarily indicate the unreliability the matrix of genetic similarities and construct a of the dendrogram generated. Although the separation dendrogram (Table 4 and Figure 2, respectively) of Cluster I and Cluster II is generally based on the showing the relationships among the 27 Philippine C. origin of germplasm, it should be noted that the two arabica accessions. In order to ascertain the dendrogram institution sources (BPI, Baguio City, Benguet; BSU, La generated, the similarity coefficient was also computed Trinidad, Benguet) are located in adjacent municipalities using the Jaccard coefficient. of Benguet. As such, the exchange of germplasm and planting materials between the two institutions and The genetic similarity of the accessions ranged from 0.64 coffee farmers in Benguet occurred and resulted in gene (MCA and Mundo Novo from Bektey, Kenya, Mundo Novo flow between populations that cause chimeric loci. Thus, (Ampasit), Mundo Novo 01, and Red Bourbon; and MVA clustering based on the geographic source of germplasm and MCA) to 1.0 (San Ramon and Improved San Ramon; in C. arabica accessions is not supported. Mundo Novo (Ampasit) and Mundo Novo 01; Mysore T’boli and BRRB, and BRRT; and Red Cattura and IRRT). Duplicate accessions were found despite their striking The average genetic similarity of the collection was 0.83; morphological differences, for instance, San Ramon overall, the genetic diversity of the Philippine C. arabica and Improved San Ramon; Mundo Novo (Ampasit) and is considered low (Table 4). This result is in agreement Mundo Novo 1, and Granica (Fine) and Granica (Broad) with the findings of Anthony et al. (2002), Baruah et al. (Table 4; Figure 2). The bootstrap values’ levels of (2003), Moncada and McCouch (2004), Cubry et al. (2008), support were high (81–88%). Improved San Ramon had

998 Vol. 149No.3-a,October2020 Philippine JournalofScience

Table 4. Genetic similarity matrix based on the Dice coefficient from 15 SSR markers obtained for Philippine Coffea arabica.

Accession/variety Typica Mokka Mundo Granica Granica MSAC Kenya Granica Yellow Improved San Mundo Mundo Red Mysore Yellow MCA Granica MVA RDRF Catimor Mysore Mundo Red BRRT BRRB IRRT Novo (Fine) (Broad) (Standard) Catturra San Ramon Ramon Novo Novo 01 Bourbon Bourbon T'boli Novo Cattura (Bektey) (Ampasit) Sagada

Typica 1.00

Mokka 0.92 1.00

Mundo Novo (Bektey) 0.90 0.97 1.00

Granica (Fine) 0.83 0.87 0.88 1.00

Granica (Broad) 0.84 0.86 0.89 0.99 1.00

MSAC 0.78 0.81 0.85 0.90 0.91 1.00

Kenya 0.80 0.82 0.86 0.93 0.94 0.89 1.00

Granica (Standard) 0.69 0.70 0.71 0.76 0.77 0.86 0.79 1.00

Yellow Catturra 0.67 0.72 0.75 0.80 0.80 0.89 0.81 0.93 1.00

Improved San Ramon 0.84 0.86 0.89 0.96 0.98 0.91 0.94 0.79 0.82 1.00

San Ramon 0.84 0.86 0.89 0.96 0.98 0.91 0.94 0.78 0.82 1.00 1.00

Mundo Novo (Ampasit) 0.81 0.88 0.92 0.94 0.95 0.88 0.92 0.75 0.79 0.98 0.98 1.00

Mundo Novo 01 0.81 0.88 0.92 0.94 0.95 0.88 0.92 0.75 0.79 0.98 0.98 1.00 1.00

Red Bourbon 0.86 0.83 0.87 0.89 0.90 0.88 0.86 0.77 0.78 0.93 0.93 0.90 0.90 1.00

Mysore 0.92 0.89 0.87 0.90 0.91 0.86 0.84 0.73 0.71 0.91 0.91 0.88 0.88 0.91 1.00

Yellow Bourbon 0.70 0.68 0.66 0.69 0.70 0.76 0.68 0.87 0.84 0.70 0.70 0.67 0.67 0.67 0.77 1.00

MCA 0.72 0.68 0.64 0.70 0.70 0.73 0.64 0.86 0.77 0.65 0.68 0.64 0.64 0.64 0.78 0.90 1.00

Granica 0.88 0.82 0.79 0.90 0.89 0.84 0.83 0.73 0.72 0.85 0.87 0.84 0.84 0.84 0.89 0.74 0.74 1.00

MVA 0.87 0.91 0.87 0.92 0.91 0.81 0.87 0.67 0.72 0.88 0.91 0.93 0.93 0.88 0.91 0.68 0.64 0.89 1.00

RDRF 0.91 0.88 0.84 0.94 0.93 0.83 0.89 0.71 0.76 0.89 0.93 0.90 0.90 0.88 0.91 0.71 0.68 0.93 0.95 1.00 Baltazar andFabella:GeneticDiversityof

Catimor 0.73 0.78 0.81 0.79 0.79 0.88 0.81 0.88 0.89 0.81 0.81 0.85 0.85 0.81 0.74 0.78 0.70 0.79 0.81 0.78 1.00

Mysore T'boli 0.75 0.73 0.77 0.88 0.88 0.97 0.82 0.91 0.89 0.87 0.86 0.82 0.82 0.86 0.82 0.83 0.71 0.84 0.72 0.77 0.92 1.00

Mundo Novo Sagada 0.71 0.67 0.71 0.77 0.77 0.85 0.76 0.83 0.86 0.80 0.80 0.76 0.76 0.79 0.70 0.74 0.69 0.76 0.71 0.76 0.89 0.91 1.00

Red Cattura 0.76 0.73 0.76 0.81 0.81 0.92 0.83 0.92 0.93 0.84 0.84 0.80 0.80 0.83 0.76 0.81 0.75 0.81 0.76 0.80 0.96 0.97 0.95 1.00 Philippine Arabica Coffee Philippine Arabica

BRRT 0.76 0.72 0.76 0.86 0.86 0.93 0.80 0.91 0.90 0.84 0.84 0.80 0.80 0.83 0.80 0.82 0.77 0.85 0.76 0.80 0.93 1.00 0.92 0.98 1.00

BRRB 0.68 0.68 0.74 0.81 0.81 0.91 0.74 0.87 0.86 0.79 0.79 0.79 0.79 0.78 0.79 0.81 0.74 0.80 0.74 0.74 0.97 1.00 0.96 0.97 1.00 1.00

IRRT 0.72 0.67 0.72 0.79 0.79 0.94 0.86 0.93 0.90 0.82 0.82 0.77 0.77 0.86 0.71 0.71 0.67 0.78 0.72 0.77 0.94 0.96 0.92 1.00 0.97 0.94 1.00 999 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Figure 2. Consensus dendrogram based on the Dice coefficient (SAHN clustering using UPGMA) illustrating the genetic relationship between Coffea arabica accessions from the NCRDEC field genebank. Bootstrap supports (in percentage) of 1000 replicates are shown. a pyramidal appearance whereas San Ramon was bushy. Some varieties that have the same names were collected On the other hand, Mundo Novo (Ampasit) had greenish from different locations. For instance, there were four young leaves whereas Mundo Novo 1 had reddish-brown Mundo Novo accessions collected: three in the area of young leaves, while Granica (Fine) had narrow leaves and BSU, La Trinidad, Benguet; and one in Sagada, Mountain Granica (Broad) had broad leaves (data not shown). These Province. Two Mysore samples were collected in T’boli and observations demonstrated that the use of SSR markers Polomolok, South Cotabato. Four Granica samples were is powerful in identifying similar or unique individuals. acquired: three in BSU, La Trinidad, Benguet; and one in Tublay, Benguet. Synonymous accessions were expected Although high genetic similarity was observed between to have a high genetic similarity or at least share the same Mysore T’boli, BRRB, and BRRT; and Red Cattura and cluster. In our study – except for the two Mundo Novo IRRT (Table 4; Figure 2), the bootstrap values were below from BSU, Ampasit, Benguet – the otherwise has been 50%. Additional loci could be explored to determine the observed. The similarity indices were less than 0.90 in most genetic relationships of the mentioned accessions. BRRB, accessions, and they did not band together in one cluster BRRT, Red Cattura, and IRRT –all from BPI – were (Table 4; Figure 2). Given the autogamous nature of the identified by the institution as different accessions/strains. crop, it could be possible that these accessions were at first Nonetheless, these results are crucial for BPI in managing the same or came from the same mother trees; however, it is their coffee germplasm, selection, and improvement of unexpected for such differentiation of varieties to happen. coffee through identification and selection of breeding The most plausible explanation for such differentiation is stocks, and in the registration of varieties at NSIC. due to the presence of some degree of outcrossing in C. Interestingly, RDRF, a productive C. arabica in lowland arabica, which may happen at a rate of 10–15% (Anthony conditions (collected from Laguna province; 22 masl) et al. 2001) and even as high as 50%, as that reported by was included in Cluster I (Figure 2) and had low genetic Berecha et al. (2014) in Ethiopian forests. Coffee pollens similarity (0.31) with the C. canephora / Robusta can be transported as far as 6.5 km through insect pollinators representative sample (FRT 11). These results nullified our such as bees (Schmitt 2006). Thus, it is very likely that initial hypothesis that RDRF is a variety of C. canephora genetic drift happened for an originally pure variety or just one variety of a lesser cup quality C. arabica because C. arabica nursery owners and propagators in the that thrives in the lowland such as Catimor. RDRF then Philippines do not practice procedures such as isolation can open the possibility of producing Arabica coffee in of mother trees, bagging of flowers, etc. to prevent cross- lowland areas of the Philippines. pollination. Genetic drift can be heightened by hybrid vigor

1000 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

(Leroy et al. 1993; Bertrand et al. 2011). For instance, Red CONCLUSION Bourbon trees can be pollinated by another variety planted nearby. Some of the seeds are, therefore, F hybrids of Red The genetic diversity of Philippine C. arabica coffee 1 collections was assessed using 19 SSR markers. To the Bourbon and that variety. When these F1 hybrid seeds are planted, they will perform better than Red Bourbon and the best of our knowledge, this is the first report on the genetic other parent. This will prompt the grower/farmer to select characterization of coffee in the Philippines that involves a relatively large number of genotypes using molecular fruits from these F1 hybrids trees. In the F2 generation, the traits will segregate and the true genetic identity of Red markers. Bourbon has been lost. The SSR markers used were informative that resulted The information from the cluster analysis further offers in determining the genetic diversity of the collection, knowledge in choosing appropriate parents in developing identification of duplicates, and unique accessions. F hybrids that are produced through the hybridization Overall, the genetic diversity of the collection was low, 1 a similar observation in other C. arabica collections of of two genetically distant parents. The F1 progenies are utilized as they have a higher level of adaptability and other countries. Low genetic variation compromises a performance than either parent due to “hybrid vigor” population to extinction. Genetic variation is the raw materials for evolution, and low variability prevents or heterosis. Thus, Arabica F1 hybrids are termed as new generation Arabica coffee varieties (Pruvot-Woehl the species to evolve in response to the adverse effects of changing the environment. Thus, the information et al. 2020). Several Arabica coffee F1 hybrids were recently developed by the World Coffee Research such generated in this study are indispensable in increasing as Centroamericano, Mundo Maya, Starmaya, Ruiru 11, the genetic variability of Philippine C. arabica through etc. and were noted of the exceptional cup quality and proper management of the genetic resources; identification resistance to pests and diseases (Pruvot-Woehl et al. 2020). of core collection; varietal registration and approval; and development of breeding and selection strategies Distinct genetic groups were described in C. arabica: for resistance to coffee leaf rust, coffee berry borer, the Typica, Bourbon, Typica and Bourbon, Introgressed nematodes, tolerance to high temperature, high cup (Catimor or Villa Sarchi groups), and the F1 hybrid groups quality, and other economically important traits. (WCR 2018; Pruvot-Woehl et al. 2020). The cluster analysis revealed that the clustering of the varieties/ accessions was not in line with their varietal classification based on their genetic groups. For instance, the Bourbon ACKNOWLEDGMENTS Group (Yellow Caturra, Yellow Bourbon, Red Caturra, This study was funded by CvSU and the Department and Red Bourbon) did not assemble in the same cluster. of Science and Technology – Philippine Council for These results may be attributed to the complicated Agriculture, Aquatic and Natural Resources Research naming of C. arabica in the Philippines. This may also and Development. The authors are grateful to BSU, BPI be due to mislabelling and mixing up of plant materials Baguio City, and all donors of Arabica coffee. The efforts in the germplasm collection or by the farmers and plant of the PCP Project 2 and the National Coffee Research, propagators. Some varieties/accessions have synonymous Development and Extension Center staff in maintaining labels where the same genotype carries different names the collection are highly recognized. (for example, IRRT and Red Caturra); a homonymous label where different genotypes carry the same name (such as Granica, Mundo Novo, and Mysore); and new name based on an erroneous belief about the name of the variety REFERENCES (as in the case of Mysore and Catimor). Mysore is not a variety but a place in India where Typica was initially AGA E, BRYNGELSSON T, BEKELE E, SOLOMON B. introduced in the 17th century. Correspondingly, Catimor 2003. Genetic diversity of forest Arabica coffee (Coffea is not a variety but a group of distinct varieties of C. arabica L.) in Ethiopia as revealed by random ampli- arabica (WCR 2018). A similar observation was reported fied polymorphic DNA (RAPD) analysis. Hereditas by Geleta et al. (2012) in their study on Nicaraguan C. 138(1): 36–46. arabica. Pruvot-Woehl et al. (2020) also reported that AGGARWAL RK, HENDRE PS, VARSHNEY RK, this is a widespread situation in almost all parts of the BHAT PR, KRISHNAKUMAR V, SINGH L. 2007. coffee-producing areas of the world. Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor Appl Genet 114: 359–372.

1001 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

ANTHONY F, BERTRAND B, QUIROS O, WILCHES DOYLE JJ, DOYLE JL. 1987. A rapid DNA isolation A, LASHERMES AP, BERTHAUD J, CHARRIER A. procedure for small quantities of fresh leaf tissue. 2001. Genetic diversity of wild coffee (Coffea arabica Phytochemical Bulletin 19: 11–15. L.) using molecular markers. Euphytica 118: 53–65. GELETA M, HERRERA I, MONZÓN A, BRYNGELS- ANTHONY F, COMBES M, ASTORGA C, BERTRAND SON T. 2012. Genetic Diversity of Arabica Coffee B, GRAZIOSI G, LASHERMES P. 2002. The origin (Coffea arabica L.) in Nicaragua as Estimated by of cultivated Coffea arabica L. varieties revealed Simple Sequence Repeat Markers. The Scientific by AFLP and SSR markers. Theor and Appl Genet World Journal 2012: 1–11. 104: 894–900. HENDRE PS, PHANINDRANATH R, ANNAPURNA BARUAH A, NAIK V, HENDRE PS, RAJKUMAR R, C, LALREMRUATA A, AGGARWAL RK. 2008. RAJENDRAKUMAR P, AGGARWAL RK. 2003. Development of new genomic microsatellite markers Isolation and characterization of nine microsatellite from robusta coffee (Coffea canephora Pierre ex A. markers from Coffea arabica L., showing wide cross- Froehner) showing broad cross-species transferability species ampliﬁcations. Molecular Ecology Notes 3: and utility in genetic studies. BMC Plant Biology 8: 51. 647–650. [ICO] International Coffee Organization. 2017. Historical BERECHA GA, AERTS R, VANDEPITTE K, VAN GLA- Data on the Global Coffee Trade. Retrieved on 27 Mar BEKE S, MUYS B, ROLDÁN-RUIZ I, HONNAY 2020 from http://www.ico.org O. 2014. Effects of Forest Management on Mating [IPNI] The International Plant Names Index. 2020. The Patterns, Pollen Flow and Intergenerational Transfer Royal Botanic Gardens, Kew, Harvard University Her- of Genetic Diversity in Wild Arabica Coffee (Coffea baria, The Australian National Herbarium. Retrieved arabica L.) from Afromontane Rainforests. Biological on 18 Aug 2018 from http://www.ipni.org Journal of the Linnean Society 112(1): 76–88. JUAN P, FRANCISCO M. 2007. An introduction to Cof- BERTRAND B, ALPIZAR E, LLARA L, SANTACREO fee. Manila: Anvil Publishing 216p. R, HIDALGO M, QUIJANO JM, CHARMETANT P, MONTAGNON C, GEORGET F, ETIENNE H. LASHERMES P, COMES MC, ROBERT J, TROUSLOT 2011. Performance of Coffea arabica F1 hybrids in P, D’HONT A, ANTHONY F, CHARRIER A. 1999. agroforestry and full-sun cropping systems in com- Molecular characterization and origin of the Coffea parison with American pure line varieties. Euphytica arabica L. genome. Molecular and General Genetics 181(2): 147–158. 261: 259–266. BROWNING D. 2018. How many coffee farms are there LEROY T, MONTAGNON C, CHARRIER A, ESKES in the world? ASIC Conference Portland, 16–20 Sep- AB. 1993. Reciprocal recurrent selection applied tember 2018. Retrieved on 20 Mar 2020 from https:// to Coffea canephora Pierre. I. Characterization and www.youtube.com/watch?v¼vKaeDkpqPSg evaluation of breeding populations and value of inter- group hybrids. Euphytica 67: 113–125. CASTRO BS. 2003. Demythologising the history of coffee in Lipa, Batangas in the 19th cen- MALUF MP, SILVESTRINI M, RUGGIERO LMDC, tury [MS thesis]. University of Adelaide, Ad- FILHO OG, COLOMBO CA. 2005. Genetic diversity elaide, South Australia. 55p. Retrieved from https:// of cultivated Coffea arabica inbred lines assessed by digital.library.adelaide.edu.au/dspace/handle/ RAPD, AFLP and SSR marker system. Science Agri- 2440/56622 culture 62(4): 366–373. CUBRY O, MUSOLI P, LEGNATE H, POT D, DE MISHRA MK, NISHANI S, JAYARAMA. 2011. Mo- BELLIS F, PONCET V, ANTHONY F, DUGOUR M, lecular Identification and genetic relationship among LEROY T. 2008. Diversity in coffee assessed with SSR coffee species (Coffea L.) inferred from ISSR and markers: structure of the genus Coffea and perspective SRAP marker analyses. Archives of Biologial Sciences in breeding. Genome 51: 50–63. 63(3): 667–679. DAVIS AP, TOSH J, RUCH N, FAY MF. 2011. Growing MONCADA P, MCCOUCH S. 2004. Simple sequence coffee: Psilanthus (Rubiaceae) subsumed on the basis repeats diversity in diploid and tetraploid Coffea spe- of molecular and morphological data; implications for cies. Genome 47: 501–509. the size, morphology, distribution and evolutionary [PSA] Philippine Statistics Authority. n/d. Other Crops: history of Coffea. Botanical Journal of the Linnean Volume of Production, by Region and by Province, Society 167: 357–377. 1990–2018; Other Crops: Area Planted/Harvested, by

1002 Philippine Journal of Science Baltazar and Fabella: Genetic Diversity of Vol. 149 No. 3-a, October 2020 Philippine Arabica Coffee

Region and by Province, 1990–2018. Retrieved on 28 RUAS PM, RUAS CF, RAMPIM L, CARVALHO VP, Mar 2020 from http://openstat.psa.gov.ph/ RUAS EA, SERA T. 2003. Genetic relationship in Coffea species and parentage determination of inter- PONCET V, HAMON P, MINIER J, CARASCO C, HAM- specific hybrids using ISSR (Inter-Simple Sequence ON S, NOIROT M. 2004. SSR cross-amplification and Repeats) markers. Genetics and Molecular Biology variation within coffee trees (Coffea spp.). Genome 26(3): 319–327. 47: 1071–1081. SCHMITT CB. 2006. Montane rainforest with wild Cof- PONCET V, DUFOUR M, HAMON P, HAMON S, DE fea arabica in the Bonga Region (SW Ethiopia): plant KOCHKO A, LEROY T. 2007. Development of ge- diversity, wild coffee management and implications nomic microsatellite markers in Coffea canephora and for conservation [Ph.D. Thesis]. Ecology and Devel- their transferability to other coffee species. Genome opment Series No. 48. Cuvillier Verlag: Göttingen, 50(12): 1156–1161. Germany. 172p. PRUVOT-WOEHL S, KRISHNAN S, SOLANO W, TERESSA A, CROUZILAT D, PETIARD V, BROUHAN SCHILLING T, TONIUTTI L, BERTRAND B, P. 2010. Genetic Diversity of Arabica coffee (Coffea MONTAGNON C. 2020. Authentication of Coffea arabica L.) collections. Ethiopian Journal of Applied arabica varieties through DNA fingerprinting and its Sciences and Technology 1(1): 63–79. significance for the coffee sector. Journal of AOAC International 103(2): 325–334. [WCR] World Coffee Research. 2018. Arabica Coffee Varieties. Portland, Oregon. 54p. Retrieved on 17 RAZAFINARIVO NJ, GUYOT R, DAVIS AP, COU- Aug 2018 from https://varieties.worldcoffeeresearch. TURON E, HAMON S, CROUZILLAT D, RIGORE- org/varieties AU M, DUBREUIL-TRANCHANT C, PONCET V, DE KOCHKO A, RAKOTOMALALA JJ, HAMON P. 2013. Genetic structure and diversity of coffee (Coffea) across Africa and the Indian Ocean islands revealed using microsatellites. Annals of Botany 111: 229–248.

1003